DOCSLIB.ORG

Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Metabolism Ibrahim Halil Polat

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Metabolism Ibrahim Halil Polat Functional role of pentose phosphate pathway and glutamine in cancer cell metabolism Ibrahim Halil Polat To cite this version: Ibrahim Halil Polat. Functional role of pentose phosphate pathway and glutamine in cancer cell metabolism. Human health and pathology. Universitat de Barcelona, 2016. English. NNT : 2016GREAS031. tel-01722703 HAL Id: tel-01722703 https://tel.archives-ouvertes.fr/tel-01722703 Submitted on 5 Mar 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE LA COMMUNAUTÉ UNIVERSITÉ GRENOBLE ALPES préparée dans le cadre d’une cotutelle entre la Communauté Université Grenoble Alpes et Université de Barcelona Spécialité : BIS-Biotechnologie, instrumentation, signal et imagerie pour la biologie, la médecine et l’environnement Arrêté ministériel : 25 mai 2016 Présentée par « Ibrahim Halil Polat » Thèse dirigée par « Philippe Sabatier » codirigée par « Marta Cascante » préparée au sein des Laboratoires « TIMC-IMAG » et « BQI » dans les Écoles Doctorales « EDISCE » et « Ecole Doctorale de l’Université de Barcelone » Rôle fonctionnel des pentoses phosphates et glutamine dans le métabolisme des cellules cancéreuses Thèse soutenue publiquement le « 4 novembre 2016 », devant le jury composé de : M. Santiago Imperial Rodenas Professeur à l’Université de Barcelone (Président) Mme Loranne Agius Professeur à l’Université de Newcastle Upon Tyne (Rapporteur) M. Jose Antonio Lupiañez Professeur à l’Université de Grenade (Rapporteur) M. Philippe Sabatier Professeur à l’Université Grenoble Alpes (Membre) Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Metabolism Ibrahim Halil Polat Doctoral Thesis 2016 To Christian, my family and all the people who have shared my life experience during the last years. My sincere thanks to Dr. Marta Cascante, Dr. Philippe Sabatier, Dr. Roldan Cortes and Dr. Silvia Marin for their support to make this Ph.D Thesis possible. Also, special thanks to Dr. Miriam Tarrado, Dr. Anusha Jayaraman, Joseph Tarrago, Erika Zodda (que me sueña), and Dr. Esther Aguilar (canari@s) for always being there for me. “Un científico es una persona a la que el sistema educativo no ha logrado destruir su curiosidad de niño y sigue preguntándose cosas como por qué el cielo es azul” León Lederman (Premio Nobel de Física 1988) TABLE OF CONTENTS 1. ABBREVIATIONS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 13 2. INTRODUCTION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 19 2.1. CANCER ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 21 2.1.1. Breast Cancer ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 21 2.1.2. Colorectal Cancer ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 22 2.2. HALLMARKS OF CANCER ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 23 2.3. UNDERSTANDING CANCER METABOLISM ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 28 2.3.1. An Emerging Hallmark: Tumor Metabolic Reprogramming ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 29 2.3.2. Glycolysis and Learnings from Warburg ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 32 2.3.3. Pentose Phosphate Pathway ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 34 2.3.4. Mitochondrial Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 38 2.3.4.1. Glutamine Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 39 2.3.5. Amino Acid Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 41 2.3.6. Lipid Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 42 2.3.7. Cell Metabolism Plays a Key Role in the Regulation of Redox Status, Cell Cycle and Apoptosis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 43 2.3.8. Crosstalk between Signaling Events and Cancer Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 47 2.3.9. Current Approaches in Cancer Therapy Targeting Metabolic Reprogramming ‐‐‐‐‐‐ 50 2.4. TOOLS USED TO STUDY CANCER METABOLISM ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54 2.4.1. Metabolomics ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54 Adapted from Frontiers, an Open Access Publisher. Vernocchi, P., et al., Integration of datasets from different analytical techniques to assess the impact of nutrition on human metabolome. Front Cell Infect Microbiol, 2012. 2: p. 156. Copyright © 2012 ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 56 2.4.2. Fluxomics ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 57 2.4.2.1. Parallel Labeling Approach in 13C Assisted Metabolomics Experiments ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 59 2.4.2.2. Mass Isotopomer Distribution Analysis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 62 2.4.2.3. Computational Modeling Based Flux Estimation ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 63 3. OBJECTIVES ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 65 4. MATERIALS AND METHODS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 69 4.1. Cell Culture ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 71 4.2. siRNA Transfection ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 71 4.3. RNA isolation and gene expression analysis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 72 4.4. Cell proliferation and Viability Assays ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 73 4.5. Cell Cycle distribution analysis. ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 74 4.6. Apoptosis measurement. ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 74 4.7. Enzyme Activity Assays ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 75 4.7.1. 6‐Phosphogluconate Dehydrogenase (6PGD), Glucose‐6‐Phosphate Dehydrogenase (G6PD) Malic Enzyme (ME) and Isocitrate Dehydrogenase (IDH) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 75 4.7.2. Lactate dehydrogenase ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 76 4.8. Mammosphere formation assay (3D cell culture) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 76 4.9. Total Protein Extraction from Cell Culture ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 76 4.10. Western Blot ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 77 4.11. ROS level Measurement ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 77 4.12. Biochemical Assays ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 78 4.13. Transcriptomic analysis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 79 4.14. 13C Mediated Metabolomics ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 80 4.14.1. Glucose ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 81 4.14.2. Lactate ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 82 4.14.3. Glutamate ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 82 4.14.4. Alanine, Glycine, Aspartate/Aspargine, Glutamate/Glutamine, Serine, Proline, Methionine ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 83 4.14.5. Ribose ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 84 4.14.6. Palmitate and Stereate ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 84 4.14.7. TCA Cycle Intermediates ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 85 4.15. GC‐MS Data Reduction ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 86 4.16. Data Analysis and modeling by using Isodyn ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 86 4.17. Mass isotopomer distribution analysis (MIDA) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 87 4.17.1. Calculation of pathway specific production of lactate ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 88 4.17.2. Calculation of glucose contribution to Mitochondria (via PC or PDH) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 90 4.17.3. Calculation of glucose and glutamine contribution to fatty acid synthesis ‐‐‐‐‐‐‐‐‐‐‐ 91 4.17.4. Calculation of Approximate Flux ratio of Glutamate Dehydrogenase (GDH) to Isocitrate Dehdrogenase (IDH) ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 92 4.18.
Load more

Recommended publications
  • Gene-Expression Signature Regulated by the KEAP1-NRF2-CUL3 Axis Is Associated with a Poor Prognosis in Head and Neck Squamous Cell Cancer Akhileshwar Namani1†, Md
    Namani et al. BMC Cancer (2018) 18:46 DOI 10.1186/s12885-017-3907-z RESEARCH ARTICLE Open Access Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer Akhileshwar Namani1†, Md. Matiur Rahaman2†, Ming Chen2* and Xiuwen Tang1* Abstract Background: NRF2 is the key regulator of oxidative stress in normal cells and aberrant expression of the NRF2 pathway due to genetic alterations in the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (nuclear factor erythroid 2 like 2)-CUL3 (cullin 3) axis leads to tumorigenesis and drug resistance in many cancers including head and neck squamous cell cancer (HNSCC). The main goal of this study was to identify specific genes regulated by the KEAP1-NRF2-CUL3 axis in HNSCC patients, to assess the prognostic value of this gene signature in different cohorts, and to reveal potential biomarkers. Methods: RNA-Seq V2 level 3 data from 279 tumor samples along with 37 adjacent normal samples from patients enrolled in the The Cancer Genome Atlas (TCGA)-HNSCC study were used to identify upregulated genes using two methods (altered KEAP1-NRF2-CUL3 versus normal, and altered KEAP1-NRF2-CUL3 versus wild-type). We then used a new approach to identify the combined gene signature by integrating both datasets and subsequently tested this signature in 4 independent HNSCC datasets to assess its prognostic value. In addition, functional annotation using the DAVID v6.8 database and protein-protein interaction (PPI) analysis using the STRING v10 databasewereperformedonthesignature. Results: A signature composed of a subset of 17 genes regulated by the KEAP1-NRF2-CUL3 axis was identified by overlapping both the upregulated genes of altered versus normal (251 genes) and altered versus wild-type (25 genes) datasets.
    [Show full text]
  • Integration of Metabolism
    Integration of Metabolism Our bodies are an integrated system of organs, each with its own requirements for nourishment and energy utilization. In spite of this, our tissues share a common circulation system. Strict limits on the blood levels of ions, lipids and sugars must be upheld if a healthy situation is to be maintained. These restrictions are valid at rest, while we work and after meals. How do we organize our bodies and survive under differing situations? The question is extremely difficult to answer. Physical activity and meals greatly alter influx to and uptake from the circulation. And yet, feedback and feed-forward control mechanisms on the enzymatic level, central nuclear control of protein synthesis and hormonal messaging and signaling all play a part in the integration of metabolism which those of us who are healthy manage so well. Here comes my effort to clarify this jungle. Have patience and please remember my "closing remarks" (click here if you have forgotten them). Integration of metabolism is essential on both short-term and long-term bases. Perhaps the most crucial short-term element is maintenance of a stable blood glucose level. The table below has been presented earlier but I will use it here to emphasize the fact that exercise can quickly reduce blood sugar levels. Maintenance of blood glucose levels over 2.5-3 mmol/s is essential for brain function. One might expect, therefore, that nature had equipped us with a sizable glucose reserve. Surprisingly, the total amount of glucose in the blood and liver is so small that can be exhausted in minutes.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Diagnostic Value of Serum Enzymes-A Review on Laboratory Investigations
    Review Article ISSN 2250-0480 VOL 5/ ISSUE 4/OCT 2015 DIAGNOSTIC VALUE OF SERUM ENZYMES-A REVIEW ON LABORATORY INVESTIGATIONS. 1VIDYA SAGAR, M.SC., 2DR. VANDANA BERRY, MD AND DR.ROHIT J. CHAUDHARY, MD 1Vice Principal, Institute of Allied Health Sciences, Christian Medical College, Ludhiana 2Professor & Ex-Head of Microbiology Christian Medical College, Ludhiana 3Assistant Professor Department of Biochemistry Christian Medical College, Ludhiana ABSTRACT Enzymes are produced intracellularly, and released into the plasma and body fluids, where their activities can be measured by their abilities to accelerate the particular chemical reactions they catalyze. But different serum enzymes are raised when different tissues are damaged. So serum enzyme determination can be used both to detect cellular damage and to suggest its location in situ. Some of the biochemical markers such as alanine aminotransferase, aspartate aminotransferase, alkaline phasphatase, gamma glutamyl transferase, nucleotidase, ceruloplasmin, alpha fetoprotein, amylase, lipase, creatine phosphokinase and lactate dehydrogenase are mentioned to evaluate diseases of liver, pancreas, skeletal muscle, bone, etc. Such enzyme test may assist the physician in diagnosis and treatment. KEYWORDS: Liver Function tests, Serum Amylase, Lipase, CPK and LDH. INTRODUCTION mitochondrial AST is seen in extensive tissue necrosis during myocardial infarction and also in chronic Liver diseases like liver tissue degeneration DIAGNOSTIC SERUM ENZYME and necrosis². But lesser amounts are found in Enzymes are very helpful in the diagnosis of brain, pancreas and lung. Although GPT is plentiful cardiac, hepatic, pancreatic, muscular, skeltal and in the liver and occurs only in the small amount in malignant disorders. Serum for all enzyme tests the other tissues.
    [Show full text]
  • Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell
    Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Ibrahim Halil Polat ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través del Dipòsit Digital de la UB (diposit.ub.edu) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB (diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR o al Repositorio Digital de la UB.
    [Show full text]
  • GC-MS Metabolic Profile and -Glucosidase-, -Amylase-, Lipase-, and Acetylcholinesterase-Inhibitory Activities of Eight Peach
    molecules Article GC-MS Metabolic Profile and α-Glucosidase-, α-Amylase-, Lipase-, and Acetylcholinesterase-Inhibitory Activities of Eight Peach Varieties Dasha Mihaylova 1,* , Ivelina Desseva 2,* , Aneta Popova 3 , Ivayla Dincheva 4 , Radka Vrancheva 2 , Anna Lante 5 and Albert Krastanov 1 1 Department of Biotechnology, Technological Faculty, University of Food Technologies, 4002 Plovdiv, Bulgaria; [email protected] 2 Department of Analytical Chemistry and Physical Chemistry, Technological Faculty, University of Food Technologies, 4002 Plovdiv, Bulgaria; [email protected] 3 Department of Catering and Tourism, Economics Faculty, University of Food Technologies, 4002 Plovdiv, Bulgaria; [email protected] 4 AgroBioInstitute, Agricultural Academy, 8 Dr. Tsankov Blvd., 1164 Sofia, Bulgaria; [email protected] 5 Department of Agronomy, Food, Natural Resources, Animals, and Environment—DAFNAE, Agripolis, University of Padova, 35020 Legnaro, Italy; [email protected] * Correspondence: [email protected] (D.M.); [email protected] (I.D.) Abstract: The inhibition of certain digestive enzymes by target food matrices represents a new approach in the treatment of socially significant diseases. Proving the ability of fruits to inhibit such enzymes can support the inclusion of specific varieties in the daily diets of patients with diabetes, obesity, Alzheimer’s disease, etc., providing them with much more than just valuable Citation: Mihaylova, D.; Desseva, I.; micro- and macromolecules. The current study aimed atidentifying and comparing the GC-MS Popova, A.; Dincheva, I.; Vrancheva, metabolic profiles of eight peach varieties (“Filina”, “Ufo 4, “Gergana”, “Laskava”, “July Lady”, R.; Lante, A.; Krastanov, A. GC-MS “Flat Queen”, “Evmolpiya”, and “Morsiani 90”) grown in Bulgaria (local and introduced) and to Metabolic Profile and α-Glucosidase-, evaluate the inhibitory potential of their extracts towards α-glucosidase, α-amylase, lipase, and α-Amylase-, Lipase-, and acetylcholinesterase.
    [Show full text]
  • The Role of Phospholipase D (Pld) and Grb2 in Chemotaxis
    THE ROLE OF PHOSPHOLIPASE D (PLD) AND GRB2 IN CHEMOTAXIS A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By KATIE J. KNAPEK B.S., Indiana University of Pennyslvania, 2006 2008 Wright State University WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES December 19, 2008 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISON BY Katie J. Knapek ENTITLED The Role of Phospholipase D (PLD) and Grb2 in Chemotaxis BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science. _____________________________ Julian Gomez-Cambronero, Ph. D. Thesis Director _____________________________ Barbara Hull, Ph. D. Program Director Committee on Final Examination _______________________ Julian Gomez-Cambronero, Ph. D. _______________________ Nancy Bigley, Ph. D. _______________________ Mill Miller, Ph. D. ________________________ Joseph F. Thomas Jr., Ph. D. Dean, School of Graduate Studies ABSTRACT Knapek, Katie J. M.S., Department of Biological Sciences, Microbiology and Immunology Program, Wright State University, 2008. The Role of Phospholipase D (PLD) and Grb2 in Chemotaxis. Phospholipase D (PLD) is an enzyme that hydrolyzes phosphatidylcholine yielding choline and phosphatidic acid. PLD is activated by mitogens (lead to cell division) and motogens (leading to cell migration). PLD is known to contribute to cellular proliferation and deregulated expression of PLD has been implicated in several human cancers. PLD has been found to play a role in leukocyte chemotaxis and adhesion as studied through the formation of chemokine gradients. We have established a model of cell migration comprising three cell lines: macrophages RAW 264.7 and LR-5 (for innate defense), and fibroblast COS-7 cells (for wound healing).
    [Show full text]
  • Multiple Roles of Phosphoinositide-Specific Phospholipase C Isozymes
    BMB reports Mini Review Multiple roles of phosphoinositide-specific phospholipase C isozymes Pann-Ghill Suh1,*, Jae-Il Park1, Lucia Manzoli2, Lucio Cocco2, Joanna C. Peak3, Matilda Katan3, Kiyoko Fukami4, Tohru Kataoka5, Sanguk Yun1 & Sung Ho Ryu1 1Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang, Korea, 2Cellular Signaling Laboratory, Department of Anatomical Sciences, University of Bologna, Via Irnerio, 48 I-40126, Bologna, Italy, 3Cancer Research UK Centre for Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, Fulham Road, London SW3 6JB, UK, 4Laboratory of Genome and Biosignal, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, 192-0392 Tokyo, Japan, 5Division of Molecular Biology, Department of Biochemistry and Molecular Biology, Kobe University Graduate School of Medicine, Chuo-ku, Kobe, Japan Phosphoinositide-specific phospholipase C is an effector mole- cellular calcium release (1-3; Fig. 1a). cule in the signal transduction process. It generates two sec- The first evidence of PLC activity was suggested by Hokin et ond messengers, inositol-1,4,5-trisphosphate and diacylglycer- al. in 1953 who reported specific hydrolysis of phospholipids ol from phosphatidylinositol 4,5-bisphosphate. Currently, thir- in pigeon’s pancreas slices after cholinergic stimulation (4). teen mammal PLC isozymes have been identified, and they are The authors showed that the enhanced turnover of phosphor- divided into six groups: PLC-β, -γ, -δ, -ε, -ζ and -η. Sequence ylinositol groups of phosphatidylinositol occurred in cells as a analysis studies demonstrated that each isozyme has more response to a variety of stimuli. In 1983, Streb et al.
    [Show full text]
  • Development of Potent and Selective Inhibitors of Aldo−Keto Reductase
    Article pubs.acs.org/jmc Development of Potent and Selective Inhibitors of Aldo−Keto Reductase 1C3 (Type 5 17β-Hydroxysteroid Dehydrogenase) Based on N-Phenyl-Aminobenzoates and Their Structure−Activity Relationships † § ‡ § † † † ‡ Adegoke O. Adeniji, , Barry M. Twenter, , Michael C. Byrns, Yi Jin, Mo Chen, Jeffrey D. Winkler,*, † and Trevor M. Penning*, † Department of Pharmacology and Center of Excellence in Environmental Toxicology, Perelman School of Medicine, University of Pennsylvania, 130C John Morgan Building, 3620 Hamilton Walk, Philadelphia, Pennsylvania 19104-6084, United States ‡ Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104, United States *S Supporting Information ABSTRACT: Aldo−keto reductase 1C3 (AKR1C3; type 5 17β-hydroxy- steroid dehydrogenase) is overexpressed in castration resistant prostate cancer (CRPC) and is implicated in the intratumoral biosynthesis of testosterone and 5α-dihydrotestosterone. Selective AKR1C3 inhibitors are required because compounds should not inhibit the highly related AKR1C1 and AKR1C2 isoforms which are involved in the inactivation of 5α-dihydrotestosterone. NSAIDs, N-phenylanthranilates in particular, are potent but nonselective AKR1C3 inhibitors. Using flufenamic acid, 2-{[3-(trifluoromethyl)phenyl]amino}- benzoic acid, as lead compound, five classes of structural analogues were synthesized and evaluated for AKR1C3 inhibitory potency and selectivity. Structure−activity relationship (SAR) studies revealed that a meta-carboxylic acid group relative to the amine conferred pronounced AKR1C3 selectivity without loss of potency, while electron withdrawing groups on the phenylamino B-ring were optimal for AKR1C3 inhibition. Lead compounds did not inhibit COX-1 or COX-2 but blocked the AKR1C3 mediated production of testosterone in LNCaP-AKR1C3 cells. These compounds offer promising leads toward new therapeutics for CRPC.
    [Show full text]
  • Bioinformatic and Modelling Approaches for a System-Level Understanding of Oxidative Stress Toxicity Elias Zgheib
    Bioinformatic and modelling approaches for a system-level understanding of oxidative stress toxicity Elias Zgheib To cite this version: Elias Zgheib. Bioinformatic and modelling approaches for a system-level understanding of oxidative stress toxicity. Quantitative Methods [q-bio.QM]. Université de Technologie de Compiègne, 2018. English. NNT : 2018COMP2464. tel-02088169 HAL Id: tel-02088169 https://tel.archives-ouvertes.fr/tel-02088169 Submitted on 2 Apr 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Par Elias ZGHEIB Bioinformatic and modelling approaches for a system- level understanding of oxidative stress toxicity Thèse présentée pour l’obtention du grade de Docteur de l’UTC Soutenue le 18 décembre 2018 Spécialité : Bio-ingénierie et Mathématiques Appliquées : Unité de Recherche Biomécanique et Bio-ingénierie (UMR-7338) D2464 BIOINFORMATIC AND MODELLING APPROACHES FOR A SYSTEM-LEVEL UNDERSTANDING OF OXIDATIVE STRESS TOXICITY A THESIS SUBMITTED TO THE UNIVERSITE DE TECHNOLOGIE DE COMPIEGNE SORBONNE UNIVERSITES LABORATOIRE DE BIO-MECANIQUE ET BIOINGENIERIE UMR CNRS 7338 – BMBI 18TH OF DECEMBER 2018 For the degree of Doctor Spécialité : Bio-ingénierie et Mathématiques Appliquées Elias ZGHEIB SUPERVISED BY Prof. Frédéric Y. BOIS JURY MEMBERS Mme. Karine AUDOUZE Rapporteur Mr.
    [Show full text]
  • Pancreatic Amylase and Lipase Plasma Concentrations Are
    Diabetes Care Volume 38, May 2015 e71 Pancreatic Amylase and Lipase Plasma David P. Sonne,1 Tina Vilsbøll,1 and Filip K. Knop1,2 Concentrations Are Unaffected by Increments in Endogenous GLP-1 Levels Following Liquid Meal Tests Diabetes Care 2015;38:e71–e72 | DOI: 10.2337/dc14-2751 Recent findings have suggested that amylase and lipase in plasma following patients with type 2 diabetes (P , incretin-based therapies promote pan- the ingestion of oral glucose and three 0.05), whereas lipase concentrations creatic inflammation and possibly cell isocaloric and isovolemic liquid mealsd were similar. Neither of the enzymes proliferation within the endocrine and all of which exerted normal endogenous increased following nutrient ingestion, exocrine pancreas (1). However, these GLP-1 secretion (4)din patients with suggesting that postprandial elevations studies have been met with substan- type 2 diabetes and matched control of endogenous GLP-1 (two- to three- tive criticism based on technical and subjects. fold) cannot trigger enzyme release methodical issues (2). Nevertheless, Detailed description of the experimen- from the human pancreas, at least not incretin-based therapies seem to result tal procedures and subjects was provided acutely. in small increases (within normal range) previously (4). In short, pancreas-specific These results suggest that the obser- in plasma concentrations of amylase amylase and lipase concentrations were vation of elevated plasma amylase and andlipaseinpatientsreceivingthese measured in plasma from 15 patients lipase
    [Show full text]
  • Data Supplement
    JPET#173179 1 SUPPLEMENTAL DATA Manuscript title: Naturally occurring variants of human aldo-keto reductases with reduced in vitro metabolism of daunorubicin and doxorubicin Authors: Onkar S. Bains, Thomas A. Grigliatti, Ronald E. Reid, and K. Wayne Riggs Journal name: Journal of Pharmacology and Experimental Therapeutics TABLES Supplemental Table 1—Primers for creating non-synonymous single nucleotide polymorphic variants of human AKRs and CBR4 using site-directed mutagenesis. The base pair mutation is given beneath each variant [in square brackets]. Also, the mutated base pair is underlined in the forward and reverse primer sequences. ENZYME VARIANT FORWARD PRIMER (5'3') REVERSE PRIMER (5'3') I15F CAAGATGCCCTTCCTGGGGTT CCAACCCCAGGAAGGGCATC AKR1B1 [AT] GG TTG H42L CGGGTACCGCCTCATCGACTG GGGCACAGTCGATGAGGCGG [AT] TGCCC TACCCG L73V GCGTGAGGAGGTCTTCATCGT GCTGACGATGAAGACCTCCTC [CG] CAGC ACGC K90E GGGCCTGGTGGAAGGAGCCTG GGCAGGCTCCTTCCACCAGGC [AG] CC CC G204S GCCAGTCCAAAAGCATCGTGG GTCACCACGATGCTTTTGGAC [GA] TGAC TGGC T288I CCAGGATATGACCATCTTACTC GTAGCTGAGTAAGATGGTCAT [CT] AGCTAC ATCCTGG P87S CACTTTCTTTGAGAGATCCCTT CTTTCCTCACAAGGGATCTCT AKR1B10 [CT] GTGAGGAAAG CAAAGAAAGTG M286T GTGATGAGGAGACGGCAACCA GAGTATGGTTGCCGTCTCCTC [TC] TACTC ATCAC N313D GACTATCCCTTCGATGCAGAA CAATATTCTGCATCGAAGGGA [AG] TATTG TAGTC R170H CCAACTTCAACCACAGGCAGC CTCCAGCTGCCTGTGGTTGAA AKR1C1 [GA] TGGAG GTTGG Q172L CTTCAACCGCAGGCTGCTGGA GGATCATCTCCAGCAGCCTGC [AT] GATGATCC GGTTGAAG F46Y CAATAGAAGCCGGGTACCACC GAATCAATATGGTGGTACCCG AKR1C2 [TA] ATATTTGATTC GCTTCTATTG JPET#173179
    [Show full text]