DOCSLIB.ORG

Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Ibrahim Halil Polat ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través del Dipòsit Digital de la UB (diposit.ub.edu) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB (diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR o al Repositorio Digital de la UB. No se autoriza la presentación de su contenido en una ventana o marco ajeno a TDR o al Repositorio Digital de la UB (framing). Esta reserva de derechos afecta tanto al resumen de presentación de la tesis como a sus contenidos. En la utilización o cita de partes de la tesis es obligado indicar el nombre de la persona autora. WARNING. On having consulted this thesis you’re accepting the following use conditions: Spreading this thesis by the TDX (www.tdx.cat) service and by the UB Digital Repository (diposit.ub.edu) has been authorized by the titular of the intellectual property rights only for private uses placed in investigation and teaching activities. Reproduction with lucrative aims is not authorized nor its spreading and availability from a site foreign to the TDX service or to the UB Digital Repository. Introducing its content in a window or frame foreign to the TDX service or to the UB Digital Repository is not authorized (framing). Those rights affect to the presentation summary of the thesis as well as to its contents. In the using or citation of parts of the thesis it’s obliged to indicate the name of the author. Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Metabolism Ibrahim Halil Polat Doctoral Thesis 2016 The image used in the cover was obtained from the website http://www.mariasklodowska.com/. Marie Sklodowska Curie (1867‐1934) is the woman who opened the nuclear age and she is famous for her discoveries on radioactivity. She was not only the first woman who was awarded a Nobel Prize but also the only woman who had it in two different fields. Also, she was the first woman to become a professor at the University of Paris. She was born in 1867 and named as Maria Salomea Skłodowska in Warsaw, Poland. She had her early education and practical scientific training in Warsaw and in 1891, she moved to Paris to get her higher degrees to conduct her subsequent scientific work. In 1895, she married Pierre Curie, a fellow scientist and together with Pierre, they did extensive research on the recently discovered phenomenon of radioactivity. Inspired by the discovery of radioactivity by Henri Becquerel in 1896, they conducted extensive researches and analyses which led to the isolation of two elements, Polonium and Radium. For the work they carried out on radioactivity that led to the discovery of these two elements, Marie and Pierre Curie shared the 1903 Nobel Prize for Physics, jointly with Henri Becquerel and she was the first woman ever to win a Nobel. In 1906, when Pierre Curie died in an accident Marie Curie was offered to take over the professorship at Sorbonne and to lecture in Pierre’s place, which made her the first woman to become a Professor at the Sorbonne. She accepted it hoping to create a world‐class laboratory dedicated to Pierre. Despite that Marie Curie had been devastated by Pierre’s death, she continued her work on radioactivity stoutly. In 1910 she gained insights into the nature of the atom and finally she isolated Radium physically. Moreover, she defined an international standard for radioactive emissions that was eventually named after her and Pierre: the Curie. In that way, she obtained her second Nobel Prize in 1911, in Chemistry, for her work on Radium. Even today, she is the only woman in the list of multiple Nobel winners. In 1914, she founded the Radium Institute in Paris (today’s Curie Institute), which is a radioactivity laboratory created for her by the Pasteur Institute and the University of Paris. During World War I, Marie Curie developed mobile radiography units because of the need for field radiological centers in the battlefield to help surgeons. On the other hand, in 1915 Curie produced hollow needles containing 'radium emanation', in order to be used for sterilizing infected tissue. After the War, Marie continued with her scientific work, and also with establishing the Radium Institute. She was honoured by many countries and participated various International scientific committees. Her health got deteriorated because of being exposed to radiation for long‐term during her work and she died in 1934 due to Blood Cancer. Her daughter Irene Joliot‐Curie followed her in scientific works and also won a Nobel Prize for Chemistry (1935). Marie Curie is regarded as one of the most influential scientists of all times. Doctoral Program in Biotechnology Department of Biochemistry and Molecular Biomedicine Faculty of Biology Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Metabolism Doctoral Thesis submitted by Ibrahim Halil Polat to obtain Ph.D degree from the Universitat de Barcelona and Université Grenoble Alpes in the frame of dual degree agreement Dr. Marta Cascante Serratosa Dr. Philippe Sabatier Co‐supervisor and tutor Co‐supervisor Ibrahim Halil Polat Doctoral Student To Christian, my family and all the people who have shared my life experience during the last years. My sincere thanks to Dr. Marta Cascante, Dr. Philippe Sabatier, Dr. Roldan Cortes and Dr. Silvia Marin for their support to make this Ph.D Thesis possible. Also, special thanks to Dr. Miriam Tarrado, Dr. Anusha Jayaraman, Joseph Tarrago, Erika Zodda (que me sueña), and Dr. Esther Aguilar (canari@s) for always being there for me. “Un científico es una persona a la que el sistema educativo no ha logrado destruir su curiosidad de niño y sigue preguntándose cosas como por qué el cielo es azul” León Lederman (Premio Nobel de Física 1988) TABLE OF CONTENTS 1. ABBREVIATIONS ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 13 2. INTRODUCTION ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 19 2.1. CANCER ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 21 2.1.1. Breast Cancer ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 21 2.1.2. Colorectal Cancer ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 22 2.2. HALLMARKS OF CANCER ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 23 2.3. UNDERSTANDING CANCER METABOLISM ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 28 2.3.1. An Emerging Hallmark: Tumor Metabolic Reprogramming ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 29 2.3.2. Glycolysis and Learnings from Warburg ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 32 2.3.3. Pentose Phosphate Pathway ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 34 2.3.4. Mitochondrial Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 38 2.3.4.1. Glutamine Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 39 2.3.5. Amino Acid Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 41 2.3.6. Lipid Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 42 2.3.7. Cell Metabolism Plays a Key Role in the Regulation of Redox Status, Cell Cycle and Apoptosis ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 43 2.3.8. Crosstalk between Signaling Events and Cancer Metabolism ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 47 2.3.9. Current Approaches in Cancer Therapy Targeting Metabolic Reprogramming ‐‐‐‐‐‐ 50 2.4. TOOLS USED TO STUDY CANCER METABOLISM ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54 2.4.1. Metabolomics ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 54 Adapted from Frontiers, an Open Access Publisher. Vernocchi, P., et al., Integration of datasets from different analytical techniques to assess the impact of nutrition on human metabolome. Front Cell Infect Microbiol, 2012. 2: p. 156. Copyright © 2012 ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ 56 2.4.2. Fluxomics ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐
Load more

Recommended publications
  • Gene-Expression Signature Regulated by the KEAP1-NRF2-CUL3 Axis Is Associated with a Poor Prognosis in Head and Neck Squamous Cell Cancer Akhileshwar Namani1†, Md
    Namani et al. BMC Cancer (2018) 18:46 DOI 10.1186/s12885-017-3907-z RESEARCH ARTICLE Open Access Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer Akhileshwar Namani1†, Md. Matiur Rahaman2†, Ming Chen2* and Xiuwen Tang1* Abstract Background: NRF2 is the key regulator of oxidative stress in normal cells and aberrant expression of the NRF2 pathway due to genetic alterations in the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (nuclear factor erythroid 2 like 2)-CUL3 (cullin 3) axis leads to tumorigenesis and drug resistance in many cancers including head and neck squamous cell cancer (HNSCC). The main goal of this study was to identify specific genes regulated by the KEAP1-NRF2-CUL3 axis in HNSCC patients, to assess the prognostic value of this gene signature in different cohorts, and to reveal potential biomarkers. Methods: RNA-Seq V2 level 3 data from 279 tumor samples along with 37 adjacent normal samples from patients enrolled in the The Cancer Genome Atlas (TCGA)-HNSCC study were used to identify upregulated genes using two methods (altered KEAP1-NRF2-CUL3 versus normal, and altered KEAP1-NRF2-CUL3 versus wild-type). We then used a new approach to identify the combined gene signature by integrating both datasets and subsequently tested this signature in 4 independent HNSCC datasets to assess its prognostic value. In addition, functional annotation using the DAVID v6.8 database and protein-protein interaction (PPI) analysis using the STRING v10 databasewereperformedonthesignature. Results: A signature composed of a subset of 17 genes regulated by the KEAP1-NRF2-CUL3 axis was identified by overlapping both the upregulated genes of altered versus normal (251 genes) and altered versus wild-type (25 genes) datasets.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Development of Potent and Selective Inhibitors of Aldo−Keto Reductase
    Article pubs.acs.org/jmc Development of Potent and Selective Inhibitors of Aldo−Keto Reductase 1C3 (Type 5 17β-Hydroxysteroid Dehydrogenase) Based on N-Phenyl-Aminobenzoates and Their Structure−Activity Relationships † § ‡ § † † † ‡ Adegoke O. Adeniji, , Barry M. Twenter, , Michael C. Byrns, Yi Jin, Mo Chen, Jeffrey D. Winkler,*, † and Trevor M. Penning*, † Department of Pharmacology and Center of Excellence in Environmental Toxicology, Perelman School of Medicine, University of Pennsylvania, 130C John Morgan Building, 3620 Hamilton Walk, Philadelphia, Pennsylvania 19104-6084, United States ‡ Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104, United States *S Supporting Information ABSTRACT: Aldo−keto reductase 1C3 (AKR1C3; type 5 17β-hydroxy- steroid dehydrogenase) is overexpressed in castration resistant prostate cancer (CRPC) and is implicated in the intratumoral biosynthesis of testosterone and 5α-dihydrotestosterone. Selective AKR1C3 inhibitors are required because compounds should not inhibit the highly related AKR1C1 and AKR1C2 isoforms which are involved in the inactivation of 5α-dihydrotestosterone. NSAIDs, N-phenylanthranilates in particular, are potent but nonselective AKR1C3 inhibitors. Using flufenamic acid, 2-{[3-(trifluoromethyl)phenyl]amino}- benzoic acid, as lead compound, five classes of structural analogues were synthesized and evaluated for AKR1C3 inhibitory potency and selectivity. Structure−activity relationship (SAR) studies revealed that a meta-carboxylic acid group relative to the amine conferred pronounced AKR1C3 selectivity without loss of potency, while electron withdrawing groups on the phenylamino B-ring were optimal for AKR1C3 inhibition. Lead compounds did not inhibit COX-1 or COX-2 but blocked the AKR1C3 mediated production of testosterone in LNCaP-AKR1C3 cells. These compounds offer promising leads toward new therapeutics for CRPC.
    [Show full text]
  • Bioinformatic and Modelling Approaches for a System-Level Understanding of Oxidative Stress Toxicity Elias Zgheib
    Bioinformatic and modelling approaches for a system-level understanding of oxidative stress toxicity Elias Zgheib To cite this version: Elias Zgheib. Bioinformatic and modelling approaches for a system-level understanding of oxidative stress toxicity. Quantitative Methods [q-bio.QM]. Université de Technologie de Compiègne, 2018. English. NNT : 2018COMP2464. tel-02088169 HAL Id: tel-02088169 https://tel.archives-ouvertes.fr/tel-02088169 Submitted on 2 Apr 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Par Elias ZGHEIB Bioinformatic and modelling approaches for a system- level understanding of oxidative stress toxicity Thèse présentée pour l’obtention du grade de Docteur de l’UTC Soutenue le 18 décembre 2018 Spécialité : Bio-ingénierie et Mathématiques Appliquées : Unité de Recherche Biomécanique et Bio-ingénierie (UMR-7338) D2464 BIOINFORMATIC AND MODELLING APPROACHES FOR A SYSTEM-LEVEL UNDERSTANDING OF OXIDATIVE STRESS TOXICITY A THESIS SUBMITTED TO THE UNIVERSITE DE TECHNOLOGIE DE COMPIEGNE SORBONNE UNIVERSITES LABORATOIRE DE BIO-MECANIQUE ET BIOINGENIERIE UMR CNRS 7338 – BMBI 18TH OF DECEMBER 2018 For the degree of Doctor Spécialité : Bio-ingénierie et Mathématiques Appliquées Elias ZGHEIB SUPERVISED BY Prof. Frédéric Y. BOIS JURY MEMBERS Mme. Karine AUDOUZE Rapporteur Mr.
    [Show full text]
  • Data Supplement
    JPET#173179 1 SUPPLEMENTAL DATA Manuscript title: Naturally occurring variants of human aldo-keto reductases with reduced in vitro metabolism of daunorubicin and doxorubicin Authors: Onkar S. Bains, Thomas A. Grigliatti, Ronald E. Reid, and K. Wayne Riggs Journal name: Journal of Pharmacology and Experimental Therapeutics TABLES Supplemental Table 1—Primers for creating non-synonymous single nucleotide polymorphic variants of human AKRs and CBR4 using site-directed mutagenesis. The base pair mutation is given beneath each variant [in square brackets]. Also, the mutated base pair is underlined in the forward and reverse primer sequences. ENZYME VARIANT FORWARD PRIMER (5'3') REVERSE PRIMER (5'3') I15F CAAGATGCCCTTCCTGGGGTT CCAACCCCAGGAAGGGCATC AKR1B1 [AT] GG TTG H42L CGGGTACCGCCTCATCGACTG GGGCACAGTCGATGAGGCGG [AT] TGCCC TACCCG L73V GCGTGAGGAGGTCTTCATCGT GCTGACGATGAAGACCTCCTC [CG] CAGC ACGC K90E GGGCCTGGTGGAAGGAGCCTG GGCAGGCTCCTTCCACCAGGC [AG] CC CC G204S GCCAGTCCAAAAGCATCGTGG GTCACCACGATGCTTTTGGAC [GA] TGAC TGGC T288I CCAGGATATGACCATCTTACTC GTAGCTGAGTAAGATGGTCAT [CT] AGCTAC ATCCTGG P87S CACTTTCTTTGAGAGATCCCTT CTTTCCTCACAAGGGATCTCT AKR1B10 [CT] GTGAGGAAAG CAAAGAAAGTG M286T GTGATGAGGAGACGGCAACCA GAGTATGGTTGCCGTCTCCTC [TC] TACTC ATCAC N313D GACTATCCCTTCGATGCAGAA CAATATTCTGCATCGAAGGGA [AG] TATTG TAGTC R170H CCAACTTCAACCACAGGCAGC CTCCAGCTGCCTGTGGTTGAA AKR1C1 [GA] TGGAG GTTGG Q172L CTTCAACCGCAGGCTGCTGGA GGATCATCTCCAGCAGCCTGC [AT] GATGATCC GGTTGAAG F46Y CAATAGAAGCCGGGTACCACC GAATCAATATGGTGGTACCCG AKR1C2 [TA] ATATTTGATTC GCTTCTATTG JPET#173179
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Functional Role of Pentose Phosphate Pathway and Glutamine in Cancer Cell Metabolism Ibrahim Halil Polat
    Functional role of pentose phosphate pathway and glutamine in cancer cell metabolism Ibrahim Halil Polat To cite this version: Ibrahim Halil Polat. Functional role of pentose phosphate pathway and glutamine in cancer cell metabolism. Human health and pathology. Universitat de Barcelona, 2016. English. NNT : 2016GREAS031. tel-01722703 HAL Id: tel-01722703 https://tel.archives-ouvertes.fr/tel-01722703 Submitted on 5 Mar 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE LA COMMUNAUTÉ UNIVERSITÉ GRENOBLE ALPES préparée dans le cadre d’une cotutelle entre la Communauté Université Grenoble Alpes et Université de Barcelona Spécialité : BIS-Biotechnologie, instrumentation, signal et imagerie pour la biologie, la médecine et l’environnement Arrêté ministériel : 25 mai 2016 Présentée par « Ibrahim Halil Polat » Thèse dirigée par « Philippe Sabatier » codirigée par « Marta Cascante » préparée au sein des Laboratoires « TIMC-IMAG » et « BQI » dans les Écoles Doctorales « EDISCE » et « Ecole Doctorale de l’Université de Barcelone » Rôle fonctionnel des pentoses phosphates et glutamine dans le métabolisme des cellules cancéreuses Thèse soutenue publiquement le « 4 novembre 2016 », devant le jury composé de : M. Santiago Imperial Rodenas Professeur à l’Université de Barcelone (Président) Mme Loranne Agius Professeur à l’Université de Newcastle Upon Tyne (Rapporteur) M.
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • Download Tool
    by Submitted in partial satisfaction of the requirements for degree of in in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________ Chair ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Adolfo Cuesta ii Acknowledgements For me, completing a doctoral dissertation was a huge undertaking that was only possible with the support of many people along the way. First, I would like to thank my PhD advisor, Jack Taunton. He always gave me the space to pursue my own ideas and interests, while providing thoughtful guidance. Nearly every aspect of this project required a technique that was completely new to me. He trusted that I was up to the challenge, supported me throughout, helped me find outside resources when necessary. I remain impressed with his voracious appetite for the literature, and ability to recall some of the most subtle, yet most important details in a paper. Most of all, I am thankful that Jack has always been so generous with his time, both in person, and remotely. I’ve enjoyed our many conversations and hope that they will continue. I’d also like to thank my thesis committee, Kevan Shokat and David Agard for their valuable support, insight, and encouragement throughout this project. My lab mates in the Taunton lab made this such a pleasant experience, even on the days when things weren’t working well. I worked very closely with Tangpo Yang on the mass spectrometry aspects of this project. Xiaobo Wan taught me almost everything I know about protein crystallography. Thank you as well to Geoff Smith, Jordan Carelli, Pat Sharp, Yazmin Carassco, Keely Oltion, Nicole Wenzell, Haoyuan Wang, Steve Sethofer, and Shyam Krishnan, Shawn Ouyang and Qian Zhao.
    [Show full text]
  • Important Roles of the AKR1C2 and SRD5A1 Enzymes in Progesterone
    Chemico-Biological Interactions xxx (2014) xxx–xxx Contents lists available at ScienceDirect Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint Important roles of the AKR1C2 and SRD5A1 enzymes in progesterone metabolism in endometrial cancer model cell lines ⇑ Maša Sinreih a, Maja Anko a, Sven Zukunft b, Jerzy Adamski b,c,d, Tea Lanišnik Rizˇner a, a Institute of Biochemistry, Faculty of Medicine, University of Ljubljana, Ljubljana, Slovenia b Institute of Experimental Genetics, Genome Analysis Centre, Helmholtz Zentrum München, München, Germany c Lehrstuhl für Experimentelle Genetik, Technische Universität München, 85356 Freising-Weihenstephan, Germany d German Centre for Diabetes Research, 85764 Neuherberg, Germany article info abstract Article history: Endometrial cancer is the most frequently diagnosed gynecological malignancy. It is associated with Available online xxxx prolonged exposure to estrogens that is unopposed by progesterone, whereby enhanced metabolism of progesterone may decrease its protective effects, as it can deprive progesterone receptors of their active Keywords: ligand. Furthermore, the 5a-pregnane metabolites formed can stimulate proliferation and may thus 3-Keto/20-keto-reductases contribute to carcinogenesis. The aims of our study were to: (1) identify and quantify progesterone 5a-Reductases metabolites formed in the HEC-1A and Ishikawa model cell lines of endometrial cancer; and (2) pinpoint Pre-receptor metabolism the enzymes involved in progesterone metabolism, and delineate their roles. Progesterone metabolism 5a-Pregnanes studies combined with liquid chromatography–tandem mass spectrometry enabled identification and 4-Pregnenes quantification of the metabolites formed in these cells. Further quantitative PCR analysis and small-inter- fering-RNA-mediated gene silencing identified individual progesterone metabolizing enzymes and their relevant roles.
    [Show full text]
  • AKR1C1 Controls Cisplatin-Resistance in Head and Neck Squamous Cell
    Chang et al. Journal of Experimental & Clinical Cancer Research (2019) 38:245 https://doi.org/10.1186/s13046-019-1256-2 RESEARCH Open Access AKR1C1 controls cisplatin-resistance in head and neck squamous cell carcinoma through cross-talk with the STAT1/3 signaling pathway Wei-Min Chang1, Yu-Chan Chang1, Yi-Chieh Yang1, Sze-Kwan Lin2, Peter Mu-Hsin Chang3,4*† and Michael Hsiao1,5*† Abstract Background: Cisplatin is the first-line chemotherapy used against most upper aerodigestive tract carcinomas. In head and neck cancer, sensitivity to cisplatin remains the key issue in treatment response and outcome. Genetic heterogeneity and aberrant gene expression may be the intrinsic factors that cause primary cisplatin-resistance. Methods: Combination of the HNSCC gene expression data and the cisplatin sensitivity results from public database. We found that aldo-keto reductase family 1 member C1 (AKR1C1) may be associated with cisplatin sensitivity in HNSCC treatment of naïve cells. We examined the AKR1C1 expression and its correlation with cisplatin IC50 and prognosis in patients. The in vitro and in vivo AKR1C1 functions in cisplatin-resistance through overexpression or knockdown assays, respectively. cDNA microarrays were used to identify the upstream regulators that modulate AKR1C1-induced signaling in HNSCC. Finally, we used the cigarette metabolites to promote AKR1C1 expression and ruxolitinib to overcome AKR1C1-induced cisplatin-resistance. Results: AKR1C1 positively correlates to cisplatin-resistance in HNSCC cells. AKR1C1 is a poor prognostic factor for recurrence and death of HNSCC patients. Silencing of AKR1C1 not only reduced in vitro IC50 but also increased in vivo cisplatin responses and vise versa in overexpression cells.
    [Show full text]
  • Aldo-Keto Reductase 1C1 (AKR1C1) As the First Mutated Gene in a Family with Nonsyndromic Primary Lipedema
    International Journal of Molecular Sciences Article Aldo-Keto Reductase 1C1 (AKR1C1) as the First Mutated Gene in a Family with Nonsyndromic Primary Lipedema Sandro Michelini 1 , Pietro Chiurazzi 2,3, Valerio Marino 4 , Daniele Dell’Orco 4 , Elena Manara 5 , Mirko Baglivo 5, Alessandro Fiorentino 1, Paolo Enrico Maltese 6 , Michele Pinelli 7,8 , Karen Louise Herbst 9, Astrit Dautaj 10 and Matteo Bertelli 5,10,* 1 Dipartimento di Riabilitazione, Ospedale San Giovanni Battista, A.C.I.S.M.O.M., 00148 Rome, Italy; [email protected] (S.M.); a.fi[email protected] (A.F.) 2 Istituto di Medicina Genomica, Università Cattolica del Sacro Cuore, 00168 Rome, Italy; [email protected] 3 Fondazione Policlinico Universitario “A.Gemelli” IRCCS, UOC Genetica Medica, 00168 Rome, Italy 4 Dipartimento di Neuroscienze, Biomedicina e Movimento, Sezione di Chimica Biologica, Università di Verona, 37134 Verona, Italy; [email protected] (V.M.); [email protected] (D.D.) 5 MAGI Euregio, 39100 Bolzano, Italy; [email protected] (E.M.); [email protected] (M.B.) 6 MAGI’s LAB, 38068 Rovereto, Italy; [email protected] 7 Dipartimento di Scienze Mediche Traslazionali, Sezione di Pediatria, Università di Napoli Federico II, 80131 Naples, Italy; [email protected] 8 Telethon Institute of Genetics and Medicine (TIGEM), 80078 Pozzuoli, Italy 9 Departments of Medicine, Pharmacy, Medical Imaging, Division of Endocrinology, University of Arizona, Tucson, AZ 85721, USA; [email protected] 10 EBTNA-Lab, 38068 Rovereto, Italy; [email protected] * Correspondence: [email protected] Received: 20 July 2020; Accepted: 27 August 2020; Published: 29 August 2020 Abstract: Lipedema is an often underdiagnosed chronic disorder that affects subcutaneous adipose tissue almost exclusively in women, which leads to disproportionate fat accumulation in the lower and upper body extremities.
    [Show full text]