DOCSLIB.ORG

4766.Full.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
4766.Full.Pdf Identification of Novel Th2-Associated Genes in T Memory Responses to Allergens Anthony Bosco, Kathy L. McKenna, Catherine J. Devitt, Martin J. Firth, Peter D. Sly and Patrick G. Holt This information is current as of October 1, 2021. J Immunol 2006; 176:4766-4777; ; doi: 10.4049/jimmunol.176.8.4766 http://www.jimmunol.org/content/176/8/4766 Downloaded from References This article cites 119 articles, 43 of which you can access for free at: http://www.jimmunol.org/content/176/8/4766.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 1, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Identification of Novel Th2-Associated Genes in T Memory Responses to Allergens1 Anthony Bosco, Kathy L. McKenna, Catherine J. Devitt, Martin J. Firth, Peter D. Sly, and Patrick G. Holt2 Atopic diseases are associated with hyperexpression of Th2 cytokines by allergen-specific T memory cells. However, clinical trials with recently developed Th2 inhibitors in atopics have proven disappointing, suggesting underlying complexities in atopy patho- genesis which are not satisfactorily explained via the classical Th1/Th2 paradigm. One likely possibility is that additional Th2- associated genes which are central to disease pathogenesis remain unidentified. The aim of the present study was to identify such novel Th2-associated genes in recall responses to the inhalant allergen house dust mite. In contrast to earlier human microarray studies in atopy which focused on mitogen-activated T cell lines and clones, we concentrated on PBMC-derived primary T cells stimulated under more physiological conditions of low dose allergen exposure. We screened initially for allergen-induced gene Downloaded from activation by microarray, and validated novel genes in independent panels of subjects by quantitative RT-PCR. Kinetic analysis of allergen responses in PBMC revealed an early wave of novel atopy-associated genes involved in signaling which were coex- pressed with IL-4 and IL-4R, followed by a later wave of genes encoding the classical Th2 effector cytokines. We further dem- onstrate that these novel activation-associated Th2 genes up-regulate in response to another atopy-associated physiological stim- ulus bacterial superantigen, but remain quiescent in nonphysiological responses in primary T cells or cell lines driven by potent mitogens, which may account for their failure to be detected in earlier microarray studies. The Journal of Immunology, 2006, 176: http://www.jimmunol.org/ 4766–4777. t is well-established from studies in humans and animal mod- number of differentially expressed genes identified, however, the els that Th2 lymphocytes secreting signature cytokines such lack of consistency in the gene lists reported by each study is I as IL-4, IL-5, IL-9, and IL-13 are central to the development striking. of atopy (1, 2). Accordingly, these cytokines and their downstream In the current study, a different approach was undertaken. We products have become major foci for drug development for control reasoned that while the pattern of T cell gene expression induced of diseases such as atopic asthma. However, the level of clinical in vivo at sites such as the airway mucosa is ultimately controlled efficacy achieved in recent trials with newly developed Th2 an- by local tissue microenvironmental factors, significant elements of by guest on October 1, 2021 tagonists including anti-IgE (3), rIL-12 (4), anti-IL-4 (5), and anti- the potential gene response “program” of allergen-specific T mem- IL-5 (6) have been disappointing, suggesting that additional (as yet ory cells (exemplified by the IL-4/IL-5-dominant cytokine profile unrecognized) components of the Th2 cascade which escape reg- of T cell clones from atopics) can be accurately revealed by low- ulation via these approaches play key roles in atopy pathogenesis. intensity in vitro stimulation of recirculating memory cells har- The likelihood that additional atopy-associated genes remain to vested from peripheral blood. In adopting this approach, we have be identified can be inferred from recent experiences reported in minimized in vitro manipulations and avoided the use of strong the immunological literature following the introduction of mi- activation stimuli, which have the potential to distort patterns of croarray technology. Collectively, these studies indicate that indi- gene expression in T cells (22, 23), and report for the first time the vidual immune responses typically involve up-regulation of mul- results of microarray analysis of PBMC-derived T cell responses tiple hundreds of genes (7–9). This technology has also been to the house dust mite (HDM)3 allergen in short-term primary applied in the allergy field to study Th2 responses and related culture. The fidelity of the experimental system was evident by the signaling pathways in freshly isolated T cells (10), polyclonally parallel detection of Th2 cytokine hyperexpression in atopics as stimulated T cells (11, 12), allergen-specific T cell clones and lines pooled samples by microarray, and individually by ELISA. In ad- (13, 14), polarized Th1/Th2 cell lines (15–20), and in animal mod- dition, several novel atopy-associated genes were identified, and els (21). A consistent finding in the studies was the substantial the preferential expression of these genes in atopics was validated in HDM-stimulated CD4ϩ T cells from an additional panel of atopic patients and nonatopic controls, both as pooled samples by Telethon Institute for Child Health Research, and Centre for Child Health Research, Faculty of Medicine and Dentistry, University of Western Australia, Perth, Western microarray and individually by quantitative RT-PCR. We addi- Australia tionally demonstrate differential expression of these novel genes in Received for publication November 1, 2005. Accepted for publication January an unrelated T cell response system, notably activation which is 30, 2006. driven by the bacterial superantigen staphylococcal enterotoxin B The costs of publication of this article were defrayed in part by the payment of page (SEB). charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by the National Health and Medical Research Council of Australia and Pfizer Pharmaceuticals. 3 Abbreviations used in this paper: HDM, house dust mite; SEB, staphylococcal en- 2 Address correspondence and reprint requests to Prof. Patrick G. Holt, Division of terotoxin B; PPD, purified protein derivative; qRT-PCR, quantitative RT-PCR; QT, Cell Biology, Telethon Institute for Child Health Research, P.O. Box 855, West Perth, quality threshold; MB, multivariate empirical Bayes; SR, stimulation ratio; DTH, WA 6872, Australia. E-mail address: [email protected] delayed-type hypersensitivity. Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 The Journal of Immunology 4767 Materials and Methods the novel Th2-associated genes detected by microarray screening, using Subjects more precise qRT-PCR methodology. Microarray data were analyzed in the open-source statistical software R Subjects were volunteers aged 11–58 years. Atopic status to HDM was (͗www.r-project.org/͘), using several additional add-on packages from the determined by skin prick test (wheal Ն5 mm) and/or positive serum HDM- Bioconductor Project (͗www.bioconductor.org/͘) (35) including affy, specific IgE (Ն0.35 kU/L). The study was approved by our institutional affyQCReport, affyPLM, annotate, hgu133a, hgu133plus2, limma, q human ethics committee. value, and time course. The probe-level model algorithm (Refs. 34 and 36, ͗http://stat-www.berkeley.edu/users/bolstad/Dissertation/ Cell preparation and culture methodologies Bolstad_2004_Disseration.pdf͘), which is based on the robust multi- array average algorithm (37), was used for background subtraction, nor- PBMC were cultured as detailed (24) with medium alone or containing ␮ malization, and summarization of probe set intensities. All microarrays optimal stimulatory concentrations of 10 g/ml HDM (Dermatophagoides within each experiment were of comparable quality as assessed using the pteronyssinus; CSL) or 10 ␮g/ml purified protein derivative (PPD; Myco- ␮ affyQCReport package. Microarray scan images were checked for spatial bacterium tuberculosis; CSL), 200 ng/ml SEB (Sigma-Aldrich), 1 g/ml defects/artifacts using diagnostic plots from the affyPLM package. RNA PHA (Murex Biotech), or soluble anti-CD3 and 20 U/ml rIL-2 (Cetus). integrity was confirmed by the Affymetrix RNA degradation controls Optimal concentrations of in vitro stimuli were established in forerunner (GAPDH and actin, 3Ј–5Ј ratios Ͻ3). dose response experiments using
Load more

Recommended publications
  • Genetic Analysis of Retinopathy in Type 1 Diabetes
    Genetic Analysis of Retinopathy in Type 1 Diabetes by Sayed Mohsen Hosseini A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by S. Mohsen Hosseini 2014 Genetic Analysis of Retinopathy in Type 1 Diabetes Sayed Mohsen Hosseini Doctor of Philosophy Institute of Medical Science University of Toronto 2014 Abstract Diabetic retinopathy (DR) is a leading cause of blindness worldwide. Several lines of evidence suggest a genetic contribution to the risk of DR; however, no genetic variant has shown convincing association with DR in genome-wide association studies (GWAS). To identify common polymorphisms associated with DR, meta-GWAS were performed in three type 1 diabetes cohorts of White subjects: Diabetes Complications and Control Trial (DCCT, n=1304), Wisconsin Epidemiologic Study of Diabetic Retinopathy (WESDR, n=603) and Renin-Angiotensin System Study (RASS, n=239). Severe (SDR) and mild (MDR) retinopathy outcomes were defined based on repeated fundus photographs in each study graded for retinopathy severity on the Early Treatment Diabetic Retinopathy Study (ETDRS) scale. Multivariable models accounted for glycemia (measured by A1C), diabetes duration and other relevant covariates in the association analyses of additive genotypes with SDR and MDR. Fixed-effects meta- analysis was used to combine the results of GWAS performed separately in WESDR, ii RASS and subgroups of DCCT, defined by cohort and treatment group. Top association signals were prioritized for replication, based on previous supporting knowledge from the literature, followed by replication in three independent white T1D studies: Genesis-GeneDiab (n=502), Steno (n=936) and FinnDiane (n=2194).
    [Show full text]
  • Targeting Hedgehog Signalling Through the Ubiquitylation Process: the Multiple Roles of the HECT-E3 Ligase Itch
    cells Review Targeting Hedgehog Signalling through the Ubiquitylation Process: The Multiple Roles of the HECT-E3 Ligase Itch Paola Infante 1,†, Ludovica Lospinoso Severini 2,† , Flavia Bernardi 2, Francesca Bufalieri 2 and Lucia Di Marcotullio 2,3,* 1 Center for Life NanoScience@Sapienza, Istituto Italiano di Tecnologia, 00161 Rome, Italy; [email protected] 2 Department of Molecular Medicine, University of Rome La Sapienza, 00161 Rome, Italy; [email protected] (L.L.S.); fl[email protected] (F.B.); [email protected] (F.B.) 3 Istituto Pasteur-Fondazione Cenci Bolognetti, University of Rome La Sapienza, 00161 Rome, Italy * Correspondence: [email protected]; Tel.: +39-06-49255657 † These authors contributed equally to this work. Received: 28 December 2018; Accepted: 26 January 2019; Published: 29 January 2019 Abstract: Hedgehog signalling (Hh) is a developmental conserved pathway strongly involved in cancers when deregulated. This important pathway is orchestrated by numerous regulators, transduces through distinct routes and is finely tuned at multiple levels. In this regard, ubiquitylation processes stand as essential for controlling Hh pathway output. Although this post-translational modification governs proteins turnover, it is also implicated in non-proteolytic events, thereby regulating the most important cellular functions. The HECT E3 ligase Itch, well known to control immune response, is emerging to have a pivotal role in tumorigenesis. By illustrating Itch specificities on Hh signalling key components, here we review the role of this HECT E3 ubiquitin ligase in suppressing Hh-dependent tumours and explore its potential as promising target for innovative therapeutic approaches. Keywords: Hedgehog; cancer; ubiquitylation; Itch; Numb; β-arrestin2; GLI1; SuFu; Patched1 1.
    [Show full text]
  • Table S1| Differential Expression Analysis of the Atopy Transcriptome
    Table S1| Differential expression analysis of the atopy transcriptome in CD4+ T-cell responses to allergens in atopic and nonatopic subjects Probe ID S.test Gene Symbol Gene Description Chromosome Statistic Location 7994280 10.32 IL4R Interleukin 4 receptor 16p11.2-12.1 8143383 8.95 --- --- --- 7974689 8.50 DACT1 Dapper, antagonist of beta-catenin, homolog 1 14q23.1 8102415 7.59 CAMK2D Calcium/calmodulin-dependent protein kinase II delta 4q26 7950743 7.58 RAB30 RAB30, member RAS oncogene family 11q12-q14 8136580 7.54 RAB19B GTP-binding protein RAB19B 7q34 8043504 7.45 MAL Mal, T-cell differentiation protein 2cen-q13 8087739 7.27 CISH Cytokine inducible SH2-containing protein 3p21.3 8000413 7.17 NSMCE1 Non-SMC element 1 homolog (S. cerevisiae) 16p12.1 8021301 7.15 RAB27B RAB27B, member RAS oncogene family 18q21.2 8143367 6.83 SLC37A3 Solute carrier family 37 member 3 7q34 8152976 6.65 TMEM71 Transmembrane protein 71 8q24.22 7931914 6.56 IL2R Interleukin 2 receptor, alpha 10p15-p14 8014768 6.43 PLXDC1 Plexin domain containing 1 17q21.1 8056222 6.43 DPP4 Dipeptidyl-peptidase 4 (CD26) 2q24.3 7917697 6.40 GFI1 Growth factor independent 1 1p22 7903507 6.39 FAM102B Family with sequence similarity 102, member B 1p13.3 7968236 5.96 RASL11A RAS-like, family 11, member A --- 7912537 5.95 DHRS3 Dehydrogenase/reductase (SDR family) member 3 1p36.1 7963491 5.83 KRT1 Keratin 1 (epidermolytic hyperkeratosis) 12q12-q13 7903786 5.72 CSF1 Colony stimulating factor 1 (macrophage) 1p21-p13 8019061 5.67 SGSH N-sulfoglucosamine sulfohydrolase (sulfamidase) 17q25.3
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Nedd4 family interacting protein 2 Gene Symbol Ndfip2 Organism Mouse Gene Summary Description Not Available Gene Aliases 0710001O20Rik, 2810436B12Rik, 9130207N19Rik, N4wbp5a, mKIAA1165 RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.290669 Ensembl Gene ID ENSMUSG00000053253 Entrez Gene ID 76273 Assay Information Unique Assay ID qMmuCED0039954 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000181969, ENSMUST00000138283, ENSMUST00000136040 Amplicon Context Sequence AGCAGAGCCCAGTCCTGCTCGGTTACTCAGTGCTGATACAATTGGAGGAATTGG GTAACGAGCAGCCTTCCAGCACGTGACGCTTCCGACGTGGCCGTTAGCGTAATC AGAGTTACACTATTACTCTTGTCCAGTGCTTTACTTTCT Amplicon Length (bp) 117 Chromosome Location 14:105308153-105308299 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 99 R2 0.996 cDNA Cq 20.52 cDNA Tm (Celsius) 83.5 gDNA Cq 23.84 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ndfip2, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Variation in Genomic Landscape of Clear Cell Renal Cell Carcinoma
    ARTICLE Received 30 May 2014 | Accepted 3 Sep 2014 | Published 29 Oct 2014 DOI: 10.1038/ncomms6135 Variation in genomic landscape of clear cell renal cell carcinoma across Europe Ghislaine Scelo1,*, Yasser Riazalhosseini2,3,*, Liliana Greger4,*, Louis Letourneau3,*, Mar Gonza`lez-Porta4,*, Magdalena B. Wozniak1, Mathieu Bourgey3, Patricia Harnden5, Lars Egevad6, Sharon M. Jackson5, Mehran Karimzadeh2,3, Madeleine Arseneault2,3, Pierre Lepage3, Alexandre How-Kit7, Antoine Daunay7, Victor Renault7,He´le`ne Blanche´7, Emmanuel Tubacher7, Jeremy Sehmoun7, Juris Viksna8, Edgars Celms8, Martins Opmanis8, Andris Zarins8, Naveen S. Vasudev5, Morag Seywright9, Behnoush Abedi-Ardekani1, Christine Carreira1, Peter J. Selby5, Jon J. Cartledge10, Graham Byrnes1, Jiri Zavadil1, Jing Su4, Ivana Holcatova11, Antonin Brisuda12, David Zaridze13, Anush Moukeria13, Lenka Foretova14, Marie Navratilova14, Dana Mates15, Viorel Jinga16, Artem Artemov17, Artem Nedoluzhko18, Alexander Mazur17, Sergey Rastorguev18, Eugenia Boulygina18, Simon Heath19, Marta Gut19, Marie-Therese Bihoreau20, Doris Lechner20, Mario Foglio20, Ivo G. Gut19, Konstantin Skryabin17,18, Egor Prokhortchouk17,18, Anne Cambon-Thomsen21, Johan Rung4, Guillaume Bourque2,3, Paul Brennan1,Jo¨rg Tost20, Rosamonde E. Banks5,AlvisBrazma4 & G. Mark Lathrop2,3,7,20,w The incidence of renal cell carcinoma (RCC) is increasing worldwide, and its prevalence is particularly high in some parts of Central Europe. Here we undertake whole-genome and transcriptome sequencing of clear cell RCC (ccRCC), the most common form of the disease, in patients from four different European countries with contrasting disease incidence to explore the underlying genomic architecture of RCC. Our findings support previous reports on frequent aberrations in the epigenetic machinery and PI3K/mTOR signalling, and uncover novel pathways and genes affected by recurrent mutations and abnormal transcriptome patterns including focal adhesion, components of extracellular matrix (ECM) and genes encoding FAT cadherins.
    [Show full text]
  • Supplementary Data
    Supplemental figures Supplemental figure 1: Tumor sample selection. A total of 98 thymic tumor specimens were stored in Memorial Sloan-Kettering Cancer Center tumor banks during the study period. 64 cases corresponded to previously untreated tumors, which were resected upfront after diagnosis. Adjuvant treatment was delivered in 7 patients (radiotherapy in 4 cases, cyclophosphamide- doxorubicin-vincristine (CAV) chemotherapy in 3 cases). 34 tumors were resected after induction treatment, consisting of chemotherapy in 16 patients (cyclophosphamide-doxorubicin- cisplatin (CAP) in 11 cases, cisplatin-etoposide (PE) in 3 cases, cisplatin-etoposide-ifosfamide (VIP) in 1 case, and cisplatin-docetaxel in 1 case), in radiotherapy (45 Gy) in 1 patient, and in sequential chemoradiation (CAP followed by a 45 Gy-radiotherapy) in 1 patient. Among these 34 patients, 6 received adjuvant radiotherapy. 1 Supplemental Figure 2: Amino acid alignments of KIT H697 in the human protein and related orthologs, using (A) the Homologene database (exons 14 and 15), and (B) the UCSC Genome Browser database (exon 14). Residue H697 is highlighted with red boxes. Both alignments indicate that residue H697 is highly conserved. 2 Supplemental Figure 3: Direct comparison of the genomic profiles of thymic squamous cell carcinomas (n=7) and lung primary squamous cell carcinomas (n=6). (A) Unsupervised clustering analysis. Gains are indicated in red, and losses in green, by genomic position along the 22 chromosomes. (B) Genomic profiles and recurrent copy number alterations in thymic carcinomas and lung squamous cell carcinomas. Gains are indicated in red, and losses in blue. 3 Supplemental Methods Mutational profiling The exonic regions of interest (NCBI Human Genome Build 36.1) were broken into amplicons of 500 bp or less, and specific primers were designed using Primer 3 (on the World Wide Web for general users and for biologist programmers (see Supplemental Table 2) [1].
    [Show full text]
  • Supplementary Table S1. List of Differentially Expressed
    Supplementary table S1. List of differentially expressed transcripts (FDR adjusted p‐value < 0.05 and −1.4 ≤ FC ≥1.4). 1 ID Symbol Entrez Gene Name Adj. p‐Value Log2 FC 214895_s_at ADAM10 ADAM metallopeptidase domain 10 3,11E‐05 −1,400 205997_at ADAM28 ADAM metallopeptidase domain 28 6,57E‐05 −1,400 220606_s_at ADPRM ADP‐ribose/CDP‐alcohol diphosphatase, manganese dependent 6,50E‐06 −1,430 217410_at AGRN agrin 2,34E‐10 1,420 212980_at AHSA2P activator of HSP90 ATPase homolog 2, pseudogene 6,44E‐06 −1,920 219672_at AHSP alpha hemoglobin stabilizing protein 7,27E‐05 2,330 aminoacyl tRNA synthetase complex interacting multifunctional 202541_at AIMP1 4,91E‐06 −1,830 protein 1 210269_s_at AKAP17A A‐kinase anchoring protein 17A 2,64E‐10 −1,560 211560_s_at ALAS2 5ʹ‐aminolevulinate synthase 2 4,28E‐06 3,560 212224_at ALDH1A1 aldehyde dehydrogenase 1 family member A1 8,93E‐04 −1,400 205583_s_at ALG13 ALG13 UDP‐N‐acetylglucosaminyltransferase subunit 9,50E‐07 −1,430 207206_s_at ALOX12 arachidonate 12‐lipoxygenase, 12S type 4,76E‐05 1,630 AMY1C (includes 208498_s_at amylase alpha 1C 3,83E‐05 −1,700 others) 201043_s_at ANP32A acidic nuclear phosphoprotein 32 family member A 5,61E‐09 −1,760 202888_s_at ANPEP alanyl aminopeptidase, membrane 7,40E‐04 −1,600 221013_s_at APOL2 apolipoprotein L2 6,57E‐11 1,600 219094_at ARMC8 armadillo repeat containing 8 3,47E‐08 −1,710 207798_s_at ATXN2L ataxin 2 like 2,16E‐07 −1,410 215990_s_at BCL6 BCL6 transcription repressor 1,74E‐07 −1,700 200776_s_at BZW1 basic leucine zipper and W2 domains 1 1,09E‐06 −1,570 222309_at
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]
  • A SARS-Cov-2 Protein Interaction Map Reveals Targets for Drug Repurposing
    Article A SARS-CoV-2 protein interaction map reveals targets for drug repurposing https://doi.org/10.1038/s41586-020-2286-9 A list of authors and affiliations appears at the end of the paper Received: 23 March 2020 Accepted: 22 April 2020 A newly described coronavirus named severe acute respiratory syndrome Published online: 30 April 2020 coronavirus 2 (SARS-CoV-2), which is the causative agent of coronavirus disease 2019 (COVID-19), has infected over 2.3 million people, led to the death of more than Check for updates 160,000 individuals and caused worldwide social and economic disruption1,2. There are no antiviral drugs with proven clinical efcacy for the treatment of COVID-19, nor are there any vaccines that prevent infection with SARS-CoV-2, and eforts to develop drugs and vaccines are hampered by the limited knowledge of the molecular details of how SARS-CoV-2 infects cells. Here we cloned, tagged and expressed 26 of the 29 SARS-CoV-2 proteins in human cells and identifed the human proteins that physically associated with each of the SARS-CoV-2 proteins using afnity-purifcation mass spectrometry, identifying 332 high-confdence protein–protein interactions between SARS-CoV-2 and human proteins. Among these, we identify 66 druggable human proteins or host factors targeted by 69 compounds (of which, 29 drugs are approved by the US Food and Drug Administration, 12 are in clinical trials and 28 are preclinical compounds). We screened a subset of these in multiple viral assays and found two sets of pharmacological agents that displayed antiviral activity: inhibitors of mRNA translation and predicted regulators of the sigma-1 and sigma-2 receptors.
    [Show full text]
  • NDFIP1 Antibody (Center) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap13449c
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 NDFIP1 Antibody (Center) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13449c Specification NDFIP1 Antibody (Center) - Product Information Application WB,E Primary Accession Q9BT67 Other Accession Q5U2S1, Q8R0W6, NP_085048.1 Reactivity Human Predicted Mouse, Rat Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 24899 Antigen Region 77-106 NDFIP1 Antibody (Center) - Additional Information Gene ID 80762 Anti-NDFIP1 Antibody (Center) at 1:1000 dilution + PC-3 whole cell lysate Other Names Lysates/proteins at 20 µg per lane. NEDD4 family-interacting protein 1, Breast Secondary Goat Anti-Rabbit IgG, (H+L), cancer-associated protein SGA-1M, NEDD4 Peroxidase conjugated at 1/10000 dilution. WW domain-binding protein 5, Putative Predicted band size : 25 kDa MAPK-activating protein PM13, Putative NF-kappa-B-activating protein 164, Putative Blocking/Dilution buffer: 5% NFDM/TBST. NFKB and MAPK-activating protein, NDFIP1, N4WBP5 NDFIP1 Antibody (Center) - Background Target/Specificity This NDFIP1 antibody is generated from The protein encoded by this gene belongs to a rabbits immunized with a KLH conjugated small group of evolutionarily conserved synthetic peptide between 77-106 amino proteins with three transmembrane domains. It acids from the Central region of human is a potential target for ubiquitination by the NDFIP1. Nedd4 family of proteins. This protein is thought to be part of a family of integral Golgi Dilution membrane proteins. WB~~1:1000 NDFIP1 Antibody (Center) - References Format Purified polyclonal antibody supplied in PBS Mund, T., et al. Proc. Natl. Acad. Sci. U.S.A.
    [Show full text]
  • Functional Genomic Annotation of Genetic Risk Loci Highlights Inflammation and Epithelial Biology Networks in CKD
    BASIC RESEARCH www.jasn.org Functional Genomic Annotation of Genetic Risk Loci Highlights Inflammation and Epithelial Biology Networks in CKD Nora Ledo, Yi-An Ko, Ae-Seo Deok Park, Hyun-Mi Kang, Sang-Youb Han, Peter Choi, and Katalin Susztak Renal Electrolyte and Hypertension Division, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania ABSTRACT Genome-wide association studies (GWASs) have identified multiple loci associated with the risk of CKD. Almost all risk variants are localized to the noncoding region of the genome; therefore, the role of these variants in CKD development is largely unknown. We hypothesized that polymorphisms alter transcription factor binding, thereby influencing the expression of nearby genes. Here, we examined the regulation of transcripts in the vicinity of CKD-associated polymorphisms in control and diseased human kidney samples and used systems biology approaches to identify potentially causal genes for prioritization. We interro- gated the expression and regulation of 226 transcripts in the vicinity of 44 single nucleotide polymorphisms using RNA sequencing and gene expression arrays from 95 microdissected control and diseased tubule samples and 51 glomerular samples. Gene expression analysis from 41 tubule samples served for external validation. 92 transcripts in the tubule compartment and 34 transcripts in glomeruli showed statistically significant correlation with eGFR. Many novel genes, including ACSM2A/2B, FAM47E, and PLXDC1, were identified. We observed that the expression of multiple genes in the vicinity of any single CKD risk allele correlated with renal function, potentially indicating that genetic variants influence multiple transcripts. Network analysis of GFR-correlating transcripts highlighted two major clusters; a positive correlation with epithelial and vascular functions and an inverse correlation with inflammatory gene cluster.
    [Show full text]
  • Gene-Expression and in Vitro Function of Mesenchymal Stromal Cells Are Affected in Juvenile Myelomonocytic Leukemia
    Myeloproliferative Disorders SUPPLEMENTARY APPENDIX Gene-expression and in vitro function of mesenchymal stromal cells are affected in juvenile myelomonocytic leukemia Friso G.J. Calkoen, 1 Carly Vervat, 1 Else Eising, 2 Lisanne S. Vijfhuizen, 2 Peter-Bram A.C. ‘t Hoen, 2 Marry M. van den Heuvel-Eibrink, 3,4 R. Maarten Egeler, 1,5 Maarten J.D. van Tol, 1 and Lynne M. Ball 1 1Department of Pediatrics, Immunology, Hematology/Oncology and Hematopoietic Stem Cell Transplantation, Leiden University Med - ical Center, the Netherlands; 2Department of Human Genetics, Leiden University Medical Center, Leiden, the Netherlands; 3Dutch Childhood Oncology Group (DCOG), The Hague, the Netherlands; 4Princess Maxima Center for Pediatric Oncology, Utrecht, the Nether - lands; and 5Department of Hematology/Oncology and Hematopoietic Stem Cell Transplantation, Hospital for Sick Children, University of Toronto, ON, Canada ©2015 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.126938 Manuscript received on March 5, 2015. Manuscript accepted on August 17, 2015. Correspondence: [email protected] Supplementary data: Methods for online publication Patients Children referred to our center for HSCT were included in this study according to a protocol approved by the institutional review board (P08.001). Bone-marrow of 9 children with JMML was collected prior to treatment initiation. In addition, bone-marrow after HSCT was collected from 5 of these 9 children. The patients were classified following the criteria described by Loh et al.(1) Bone-marrow samples were sent to the JMML-reference center in Freiburg, Germany for genetic analysis. Bone-marrow samples of healthy pediatric hematopoietic stem cell donors (n=10) were used as control group (HC).
    [Show full text]