DOCSLIB.ORG

Multiscale Genomic Analysis of The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Multiscale Genomic Analysis of The University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 5-2009 Multiscale Genomic Analysis of the Corticolimbic System: Uncovering the Molecular and Anatomic Substrates of Anxiety-Related Behavior Khyobeni Mozhui University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Mental and Social Health Commons, Nervous System Commons, and the Neurosciences Commons Recommended Citation Mozhui, Khyobeni , "Multiscale Genomic Analysis of the Corticolimbic System: Uncovering the Molecular and Anatomic Substrates of Anxiety-Related Behavior" (2009). Theses and Dissertations (ETD). Paper 180. http://dx.doi.org/10.21007/etd.cghs.2009.0219. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. Multiscale Genomic Analysis of the Corticolimbic System: Uncovering the Molecular and Anatomic Substrates of Anxiety-Related Behavior Document Type Dissertation Degree Name Doctor of Philosophy (PhD) Program Anatomy and Neurobiology Research Advisor Robert W. Williams, Ph.D. Committee John D. Boughter, Ph.D. Eldon E. Geisert, Ph.D. Kristin M. Hamre, Ph.D. Jeffery D. Steketee, Ph.D. DOI 10.21007/etd.cghs.2009.0219 This dissertation is available at UTHSC Digital Commons: https://dc.uthsc.edu/dissertations/180 MULTISCALE GENOMIC ANALYSIS OF THE CORTICOLIMBIC SYSTEM: UNCOVERING THE MOLECULAR AND ANATOMIC SUBSTRATES OF ANXIETY-RELATED BEHAVIOR A Dissertation Presented for The Graduate Studies Council The University of Tennessee Health Science Center In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy From The University of Tennessee By Khyobeni Mozhui 2009 Chapter 2 © 2007 by Springer Netherlands Chapter 3 © 2008 by Nature Publishing Group Chapter 5 © 2008 by Mozhui et al. All other material © 2009 by Khyobeni Mozhui All rights reserved ii ACKNOWLEDGEMENTS My heartfelt gratitude to my research supervisor and mentor, Dr. Rob Williams, for the guidance and inspiration I have received from him. I am thankful for the many opportunities he has provided to develop my scientific faculties. Beyond his role as my research adviser, he has also instilled in me a sense of confidence and independence. I consider him a rare and brilliant teacher. I also thank all the members of my committee, Drs. John Boughter, Eldon Geisert, Kristin Hamre, and Jeff Steketee, for their advice and their critical and constructive comments. I feel most fortunate to have this group to guide me during the course of my research. I must also thank Drs. Susan Brasser and Chris Lemon. They were my guides during the early stages of my studies. And I express my most sincere gratitude to Dr. Matt Ennis for giving me courage and counsel, and to Dr. Bill Armstrong for his support during unexpected and trying times. And to Dr. David Smith, I remain thankful. I extend my gratitude to Dr. Lu Lu, Dr. Daniel Ciobanu, Arthur Centeno, and all the other members of the Williams’ Lab. Their help have been invaluable. I am also thankful to Dr. Andrew Holmes for being such a beneficial collaborator. I acknowledge all the funding sources that have sponsored my graduate studies (NIAAA INIA grants grants U01AA13499, U24AA13513, and U01AA014425; NIDA, NIMH, and NIAAA grant P20-DA 21131; NCI NMHCC grant U01CA105417). Finally, to my dear ones, I am truly grateful. Apvü and Apo for their ceaseless love, their blessings, and their fervent prayers. Dear Sis, for the courage and strength I draw from her. And Ashley, for her cherished company, her encouraging words, and her excitement over my research and dissertation. iii ABSTRACT Genetic diversity generates variation at multiple phenotypic levels, ranging from the most basic molecular to higher-order cognitive and behavioral traits. The far-reaching impact that genes have on higher traits is apparent in several neuropsychiatric conditions such as stress and anxiety disorders. Like most, if not all, neural phenotypes, stress, anxiety, and other emotion-related traits are extremely complex and are defined by the interplay of multiple genetic, environmental, experiential, and epigenetic factors. The work presented in this dissertation is a multi-scalar, integrative analysis of the molecular and neuroanatomic substrates that underlie emotion-related behavior. The amygdala is a principle component of the limbic system that controls emotionality. Using BXD recombinant inbred (RI) mice as model organisms, the anatomy and cellular architecture of the amygdala—specifically, the basolateral amygdala (BLA)—was examined to assess the level of structural variation in this brain region. Quantitative trait locus (QTL) analysis was done to identify genetic loci that modulate the neuroanatomical traits of the BLA. The BXD RI mice were also tested using a variety of behavioral assays, and this showed a significant association between the BLA size and emotion- related behavior. The effect of chronic stress on subsequent behavior and endocrine- response was also examined in several genetically diverse inbred mice. Finally, to explore the molecular mediators of stress and anxiety, microarrays were used to assay gene expression in three key corticolimbic brain regions—the prefrontal cortex, amygdala, and hippocampus. Several large transcriptome data sets were also analyzed. These expression data sets brought focus on an interval on mouse distal chromosome 1 that modulates diverse neural and behavioral traits, and also controls the expression of a plethora of genes. This QTL rich region on mouse distal chromosome 1 (Qrr1) provides insights into how the information in the DNA sequence is conveyed by networks of co-regulated genes that may in turn modulate networks of inter-related phenotypes. iv TABLE OF CONTENTS CHAPTER 1. INTRODUCTION .................................................................................1 1.1 Complex Traits.......................................................................................................1 1.2 Genetics of Neural and Behavioral Phenotypes.......................................................1 1.3 Neuroanatomy of Stress and Emotion-Related Behavior.........................................2 1.4 Mapping Loci that Modulate Complex Traits..........................................................3 1.4.1 Basics of QTL Analysis............................................................................3 1.4.2 Inbred and Recombinant Inbred Mice.......................................................4 1.5 Systems Genetics Approach to Complex Traits.......................................................6 1.5.1 Gene Expression as an Intermediate Phenotype........................................6 1.5.2 Systems Genetics .....................................................................................6 1.6 Organization of the Dissertation..............................................................................7 CHAPTER 2. GENETIC AND STRUCTURAL ANALYSIS OF THE BASOLATERAL AMYGDALA COMPLEX IN BXD RECOMBINANT INBRED MICE .............................................................................................................9 2.1 Synopsis ................................................................................................................9 2.2 Introduction............................................................................................................9 2.3 Materials and Methods..........................................................................................11 2.3.1 Subjects..................................................................................................11 2.3.2 Fixation and Sectioning..........................................................................11 2.3.3 Volumetric Measurement .......................................................................11 2.3.4 Stereological Methods............................................................................13 2.3.5 Statistics.................................................................................................14 2.3.6 Genotyping and QTL Mapping...............................................................14 2.4 Results..................................................................................................................15 2.4.1 Volume of the BLA Complex.................................................................15 2.4.2 BLA Cell Counts....................................................................................17 2.4.3 QTL Analysis for BLA Volume .............................................................18 2.4.4 QTL Specificity......................................................................................21 2.4.5 Correlations between BLA Volume and Cell Populations.......................21 2.4.6 Neuroanatomical Correlates of BLA and Comparative QTL Analysis ....24 2.4.7 Behavioral Correlates of BLA and Comparative QTL Analysis..............26 2.4.8 Candidate Genes ....................................................................................29 2.5 Discussion ............................................................................................................31 2.5.1 Summary................................................................................................31
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • DEDD (NM 001039712) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC310813 DEDD (NM_001039712) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: DEDD (NM_001039712) Human Untagged Clone Tag: Tag Free Symbol: DEDD Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG
    [Show full text]
  • Open Targets Platform: New Developments and Updates Two Years On
    D1056–D1065 Nucleic Acids Research, 2019, Vol. 47, Database issue Published online 20 November 2018 doi: 10.1093/nar/gky1133 Open Targets Platform: new developments and updates two years on Denise Carvalho-Silva1,2,*, Andrea Pierleoni1,2, Miguel Pignatelli1,2, ChuangKee Ong1,2, Luca Fumis1,2, Nikiforos Karamanis1,2, Miguel Carmona1,2, Adam Faulconbridge1,2, Andrew Hercules1,2, Elaine McAuley1,2, Alfredo Miranda1,2, Gareth Peat1,2, Michaela Spitzer1,2, Jeffrey Barrett2,3, David G. Hulcoop2,4, Eliseo Papa2,5, Gautier Koscielny2,4 and Ian Dunham1,2,* 1European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Wellcome Genome Campus, Hinxton, Cambridgeshire CB10 1SD, UK, 2Open Targets, Wellcome Genome Campus, Hinxton, Cambridgeshire CB10 1SD, UK, 3Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge CB10 1SA, UK, 4GSK, Medicines Research Center, Gunnels Wood Road, Stevenage, SG1 2NY, UK and 5Biogen, Cambridge, MA 02142, USA Received September 14, 2018; Revised October 22, 2018; Editorial Decision October 23, 2018; Accepted October 26, 2018 ABSTRACT user support, social media and bioinformatics forum engagement. The Open Targets Platform integrates evidence from genetics, genomics, transcriptomics, drugs, animal models and scientific literature to score INTRODUCTION and rank target-disease associations for drug Drug discovery is a long and costly endeavour characterized target identification. The associations are dis- by high failure rates. Failure often occurs at the later stages played in an intuitive user interface (https://www. of the drug discovery pipeline and the reasons for the low targetvalidation.org), and are available through success are largely twofold: lack of safety and/or lack of ef- a REST-API (https://api.opentargets.io/v3/platform/ ficacy.
    [Show full text]
  • Characterization of Genomic Copy Number Variation in Mus Musculus Associated with the Germline of Inbred and Wild Mouse Populations, Normal Development, and Cancer
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 4-18-2019 2:00 PM Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer Maja Milojevic The University of Western Ontario Supervisor Hill, Kathleen A. The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Maja Milojevic 2019 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Genetics and Genomics Commons Recommended Citation Milojevic, Maja, "Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer" (2019). Electronic Thesis and Dissertation Repository. 6146. https://ir.lib.uwo.ca/etd/6146 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract Mus musculus is a human commensal species and an important model of human development and disease with a need for approaches to determine the contribution of copy number variants (CNVs) to genetic variation in laboratory and wild mice, and arising with normal mouse development and disease. Here, the Mouse Diversity Genotyping array (MDGA)-approach to CNV detection is developed to characterize CNV differences between laboratory and wild mice, between multiple normal tissues of the same mouse, and between primary mammary gland tumours and metastatic lung tissue.
    [Show full text]
  • Supplemental Table 7 HCC-Related Genes Differentially Expressed Between Control and RCLG/Alb-Cre Transgenic Mice
    Supplemental Table 7 HCC-related genes differentially expressed between control and RCLG/Alb-Cre transgenic mice (average of three biological replicates >2 fold-change, t-test p < 0.05) Fold difference Gene symbol Description (Full name) (RCLG/Alb-Cre vs con) Lcn2 lipocalin 2 7.8899 IGKV16-104 Immunoglobulin Kappa light chain V gene segment 6.5300 IGHG1 Immunoglobulin heavy chain C gene segment 6.4945 Orm2 orosomucoid 2 5.3184 IGHG2B Immunoglobulin heavy chain C gene segment 3.5573 Slpi secretory leukocyte peptidase inhibitor 3.5081 Rgs16 regulator of G-protein signaling 16 3.1999 Dffa DNA fragmentation factor, alpha subunit 3.0666 Saa1 serum amyloid A 1 2.9429 Tmem176b transmembrane protein 176B 2.8218 Orm3 orosomucoid 3 2.7805 IGHG2C Immunoglobulin heavy chain C gene segment 2.7015 S100a8 S100 calcium binding protein A8 (calgranulin A) 2.6769 Ocel1 occludin/ELL domain containing 1 2.6553 Ly6e lymphocyte antigen 6 complex, locus E 2.5509 Itih3 inter-alpha trypsin inhibitor, heavy chain 3 2.5345 Nr0b2 nuclear receptor subfamily 0, group B, member 2 2.5118 Saa3 serum amyloid A 3 2.4707 Spp1 secreted phosphoprotein 1 2.4077 Gats opposite strand transcription unit to Stag3 2.3934 Tmem176a transmembrane protein 176A 2.3734 Tsc22d3 TSC22 domain family 3 2.3724 Cp ceruloplasmin 2.2608 C4b complement component 4B (Childo blood group) 2.2089 Gm1381 gene model 1381, (NCBI) 2.1777 Itih4 inter alpha-trypsin inhibitor, heavy chain 4 2.1524 S100a9 S100 calcium binding protein A9 (calgranulin B) 2.124 Vnn3 vanin 3 2.0685 Cd5l CD5 antigen-like 2.0606
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Supplementary Table 1 the Identified Bis-Probe Captured Enzymes After Liquid Chromatography-Tandem Mass Spectrometry Analysis of Adscs Treated with BME
    Supplementary Table 1 The identified Bis-probe captured enzymes after liquid chromatography-tandem mass spectrometry analysis of ADSCs treated with BME. Protein names Accession Gene names Mass Length Gene ontology (biological process) Gene ontology (molecular function) Number (Da) Dolichyl-diphosphooligosaccharide-- P04843 RPN1 68,569 607 RNA binding [GO:0003723] cellular protein modification process protein glycosyltransferase subunit 1 [GO:0006464] protein N-linked glycosylation [GO:0006487] protein N-linked glycosylation via asparagine [GO:0018279] Ras-related protein Rab-21 Q9UL25 RAB21 24,348 225 GDP binding [GO:0019003]; GTPase anterograde axonal transport KIAA0118 activity [GO:0003924]; GTP binding [GO:0008089] [GO:0005525] regulation of axon extension [GO:0030516] E3 ubiquitin/ISG15 ligase TRIM25 Q14258 TRIM25 EFP 70,973 630 interferon-gamma-mediated signaling cadherin binding [GO:0045296]; ligase RNF147 pathway [GO:0060333] activity [GO:0016874]; metal ion binding ZNF147 [GO:0046872]; RIG-I binding [GO:0039552]; RNA binding [GO:0003723]; ubiquitin protein ligase activity [GO:0061630] D-3-phosphoglycerate O43175 PHGDH 56,651 533 electron transfer activity [GO:0009055]; brain development [GO:0007420] dehydrogenase PGDH3 L-malate dehydrogenase activity glial cell development [GO:0021782] [GO:0030060]; NAD binding neural tube development [GO:0021915] [GO:0051287]; phosphoglycerate neuron projection development dehydrogenase activity [GO:0004617] [GO:0031175] Cdc42 effector protein 1 Q00587 CDC42EP1 40,295 391 positive regulation of
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Recent Advances in Drosophila Models of Charcot-Marie-Tooth Disease
    International Journal of Molecular Sciences Review Recent Advances in Drosophila Models of Charcot-Marie-Tooth Disease Fukiko Kitani-Morii 1,2,* and Yu-ichi Noto 2 1 Department of Molecular Pathobiology of Brain Disease, Kyoto Prefectural University of Medicine, Kyoto 6028566, Japan 2 Department of Neurology, Kyoto Prefectural University of Medicine, Kyoto 6028566, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-75-251-5793 Received: 31 August 2020; Accepted: 6 October 2020; Published: 8 October 2020 Abstract: Charcot-Marie-Tooth disease (CMT) is one of the most common inherited peripheral neuropathies. CMT patients typically show slowly progressive muscle weakness and sensory loss in a distal dominant pattern in childhood. The diagnosis of CMT is based on clinical symptoms, electrophysiological examinations, and genetic testing. Advances in genetic testing technology have revealed the genetic heterogeneity of CMT; more than 100 genes containing the disease causative mutations have been identified. Because a single genetic alteration in CMT leads to progressive neurodegeneration, studies of CMT patients and their respective models revealed the genotype-phenotype relationships of targeted genes. Conventionally, rodents and cell lines have often been used to study the pathogenesis of CMT. Recently, Drosophila has also attracted attention as a CMT model. In this review, we outline the clinical characteristics of CMT, describe the advantages and disadvantages of using Drosophila in CMT studies, and introduce recent advances in CMT research that successfully applied the use of Drosophila, in areas such as molecules associated with mitochondria, endosomes/lysosomes, transfer RNA, axonal transport, and glucose metabolism.
    [Show full text]
  • Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach
    Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds.
    [Show full text]