Differentiation Involved in Early Th1 and Th2 Cell Genome-Wide

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation This information is current as Riikka J. Lund, Maritta Löytömäki, Tiina Naumanen, Craig of September 28, 2021. Dixon, Zhi Chen, Helena Ahlfors, Soile Tuomela, Johanna Tahvanainen, Joonas Scheinin, Tiina Henttinen, Omid Rasool and Riitta Lahesmaa J Immunol 2007; 178:3648-3660; ; doi: 10.4049/jimmunol.178.6.3648 Downloaded from http://www.jimmunol.org/content/178/6/3648 References This article cites 43 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/178/6/3648.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 28, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation1 Riikka J. Lund,2* Maritta Lo¨yto¨ma¨ki,2*† Tiina Naumanen,* Craig Dixon,* Zhi Chen,* Helena Ahlfors,*‡ Soile Tuomela,*† Johanna Tahvanainen,*§ Joonas Scheinin,* Tiina Henttinen,* Omid Rasool,* and Riitta Lahesmaa3* Th cell subtypes, Th1 and Th2, are involved in the pathogenesis or progression of many immune-mediated diseases, such as type 1 diabetes and asthma, respectively. Defining the molecular networks and factors that direct Th1 and Th2 cell differentiation will help to understand the pathogenic mechanisms causing these diseases. Some of the key factors regulating this differentiation have been identified, however, they alone do not explain the process in detail. To identify novel factors directing the early differentiation, we have studied the transcriptomes of human Th1 and Th2 cells after 2, 6, and 48 h of polarization at the genome scale. Based on our current and previous studies, 288 genes or expressed sequence tags, representing ϳ1–1.5% of the human genome, are Downloaded from regulated in the process during the first 2 days. These transcriptional profiles revealed genes coding for components of certain pathways, such as RAS oncogene family and G protein-coupled receptor signaling, to be differentially regulated during the early Th1 and Th2 cell differentiation. Importantly, numerous novel genes with unknown functions were identified. By using short- hairpin RNA knockdown, we show that a subset of these genes is regulated by IL-4 through STAT6 signaling. Furthermore, we demonstrate that one of the IL-4 regulated genes, NDFIP2, promotes IFN-␥ production by the polarized human Th1 lymphocytes. http://www.jimmunol.org/ Among the novel genes identified, there may be many factors that play a crucial role in the regulation of the differentiation process together with the previously known factors and are potential targets for developing therapeutics to modulate Th1 and Th2 responses. The Journal of Immunology, 2007, 178: 3648–3660. helper cell subtypes, Th1 and Th2, originate from com- STAT1 signaling are important in driving Th1 polarization, mon naive precursor cells (Thp) in response to Ag and whereas IL-4/STAT6 signaling directs Th2 polarization (2). Tran- T cytokine stimulation. Although Th cells have a crucial scription factors TBX21 (T-bet) and GATA3 are also among the role in host defense against intracellular and extracellular patho- key factors required for the Th1 and Th2 differentiation, respec- gens, disturbances in the balance between Th1 and Th2 responses tively (3–6). Although many of the players implicated in the reg- by guest on September 28, 2021 can promote or lead to pathogenesis of immune-mediated diseases. ulation of differentiation have been recognized, the current model Enhanced Th2 response is involved in atopic diseases, such as as such is still too simple to explain the process in detail, and other asthma, whereas a dominating Th1 response is implicated in cer- yet unknown factors are likely to be involved. tain autoimmune diseases, like type 1 diabetes or rheumatoid ar- Recently, an increasing number of studies have used DNA mi- thritis (1). To understand the molecular mechanisms driving the croarrays to identify new factors involved in the Th1 and Th2 pathogenesis of these diseases, it is important to elucidate the early polarization in humans and mice (7–14). However, all of these differentiation process of Th1 and Th2 cells in detail. studies have focused on studying a limited number of primarily A number of the central factors involved in directing the differ- known genes. We have previously elucidated the regulation of entiation process have been identified. IL-12/STAT4 and IFN-␥/ ϳ9300 genes, most with known functions, during the early differ- entiation of human Th1 and Th2 cells (10, 15). In the present study, we have extended the previous work by exploring the reg- *Centre for Biotechnology, University of Turku and Åbo Akademi University, Turku, ulation of the rest of the genes in the human genome. Based on the Finland; †Graduate School of Biomedical Sciences, University of Turku, Turku, Fin- ‡ combination of our current and previous studies, 288 genes or land; The National Graduate School in Informational and Structural Biology, Åbo 4 ϳ Akademi University, Turku, Finland; and §Drug Discovery Graduate School, Uni- expressed sequence tags (ESTs), representing 1–1.5% of the versity of Turku, Turku, Finland human genome, are differentially regulated during the first 2 days Received for publication March 9, 2005. Accepted for publication December of Th1 and Th2 cell polarization. Moreover, we demonstrate that 21, 2006. a panel of these genes or ESTs are induced by IL-4 through the The costs of publication of this article were defrayed in part by the payment of page STAT6 signaling or play a role in regulation of IFN-␥ production. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Materials and Methods 1 This work was supported by the Academy of Finland, Sigrid Juse´lius Foundation, National Technology Agency of Finland, Turku Graduate School of Biomedical Sci- In vitro differentiation of Th1 and Th2 cells ences, National Graduate School in Informational and Structural Biology, Drug Dis- Induction of human Th1 and Th2 cell differentiation was performed as covery Graduate School, Ida Montin Foundation, Finnish Society of Allergology and ϩ Immunology, Pulmonary Association Heli, Jenny and Antti Wihuri Foundation, previously described (10). Briefly, CD4 T cells isolated (Ficoll Isolation Va¨ino¨and Laina Kivi Foundation, Allergy Research Foundation of South-Western Paque; Amersham Biosciences and Dynal Biotech) from cord blood (Turku Finland, and Turku University Hospital Fund. 2 R.J.L. and M.L. made an equal contribution to this work. 4 Abbreviations used in this paper: EST, expressed sequence tag; CT, threshold cycle; 3 Address correspondence and reprint requests to Prof. Riitta Lahesmaa, Turku Centre shRNA, short-hairpin RNA. for Biotechnology, University of Turku and Åbo Akademi University, P.O. Box 123, FIN-20521, Turku, Finland. E-mail address: riitta.lahesmaa@btk.fi Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org The Journal of Immunology 3649 Table I. Primers and probes used in the real-time RT-PCR 1) 5Ј-6(FAM)-PROBE-(TAMRA)-3Ј 2) 5Ј-PRIMER 1–3Ј Public ID Gene Symbol 3) 5Ј-PRIMER 2–3Ј AW152437 1) 2) 5Ј-AGCTGAGAAGAATGAAGAGGACATA-3Ј 3) 5Ј-GTTCACAGCCCCTATGG-3Ј AW139719 1) 2) 5Ј-AGACTGGTTTGTTTTCACTTGAGGT-3Ј 3) 5Ј-GTTTTCCCAGGAGTCTGAGGC-3Ј R98767 1) 2) 5Ј-TTTGCCTCAAATCCATTACCAA-3Ј 3) 5Ј-AACTAGTCAAGTGTGATATAATCAGATTTGC-3Ј AA489100 1) 2) 5Ј-GAAAGCAATATGTTTAGCAGCTGTTT-3Ј 3) 5Ј-ACATTTATGCCTGGATTAAATAACAATAGT-3Ј BF056901 1) 2) 5Ј-AAATAAGGCCTAGGTCCGTCTATTG-3Ј 3) 5Ј-CGGCCTCGACCTTCAAAGA-3Ј AI494573 1) Downloaded from 2)5Ј-GCTGGGAAATCTACAAGTCACCTTA-3Ј 3)5Ј-TTGCTGGCCATTTTATTGTTGAG-3Ј AA088177 1) 2) 5Ј-ATGCAAGGTGGAATTTTGGG-3Ј 3) 5Ј-GTATTGCAGTTGTGGAAGAGCAGA-3Ј BE748563 1) 2) 5Ј-CCTTTCACTGCCATGGAATGA-3Ј 3) 5Ј-AGAAAATGCAAGCTCCCCATAA-3Ј http://www.jimmunol.org/ AI674404 1) 2) 5Ј-CTGGAACCTTGAGGCCTTCA-3Ј 3) 5Ј-GCCCCAATCTATGGACAGACA-3Ј AL389942 1) 5Ј-TGTGACAATGATTCTTTAGC-3Ј 2) 5Ј-CACGGGATCAGAGGGAACTAATA-3Ј 3) 5Ј-ACCAGAAGCCTCAGCAGTCC-3Ј AA237039 1) 5Ј-TTTATGCAGCGCACTGTCAGACTTCCAA-3Ј 2) 5Ј-GATGCATCTGCTTTTAACCCTTTT-3Ј 3) 5Ј-TTACGGAATGCTGTGGTACTCAA-3Ј AW629527 FLJ41238 1) 5Ј-ACCCATTTTGATTGAGACCTACACAGGGC-3Ј 2) 5Ј-TGGAAGAGGAAAGAAACTGATGGT-3Ј by guest on September 28, 2021 3) 5Ј-GCGGTTTCCAATGAATGACA-3Ј J04617 EF1␣ 1) 5Ј-AGCGCCGGCTATGCCCCTG-3Ј 2) 5Ј-CTGAACCATCCAGGCCAAAT-3Ј 3) 5Ј-GCCGTGTGGCAATCCAAT-3Ј NM_016651 DACT1 1) 5Ј-CACGAACTCGCCCTCGCTCACACT-3Ј 2) 5Ј-AGCAGAGCAATTACACCACCAA-3Ј 3) 5Ј-AGTCTGGACAAACTGGGACCAA-3Ј NM_005815 ZNF443 1) 5Ј-TCTCTTGGCTCACTTGCTTTCTACGACATG-3Ј 2) 5Ј-GAATGTAAGGAATGTGGGAAAGC-3Ј 3) 5Ј-CATAGGATTTCTCTCTCATGTGAATTCT-3Ј University Central Hospital, Turku,
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Targeting Hedgehog Signalling Through the Ubiquitylation Process: the Multiple Roles of the HECT-E3 Ligase Itch

    Targeting Hedgehog Signalling Through the Ubiquitylation Process: the Multiple Roles of the HECT-E3 Ligase Itch

    cells Review Targeting Hedgehog Signalling through the Ubiquitylation Process: The Multiple Roles of the HECT-E3 Ligase Itch Paola Infante 1,†, Ludovica Lospinoso Severini 2,† , Flavia Bernardi 2, Francesca Bufalieri 2 and Lucia Di Marcotullio 2,3,* 1 Center for Life NanoScience@Sapienza, Istituto Italiano di Tecnologia, 00161 Rome, Italy; [email protected] 2 Department of Molecular Medicine, University of Rome La Sapienza, 00161 Rome, Italy; [email protected] (L.L.S.); fl[email protected] (F.B.); [email protected] (F.B.) 3 Istituto Pasteur-Fondazione Cenci Bolognetti, University of Rome La Sapienza, 00161 Rome, Italy * Correspondence: [email protected]; Tel.: +39-06-49255657 † These authors contributed equally to this work. Received: 28 December 2018; Accepted: 26 January 2019; Published: 29 January 2019 Abstract: Hedgehog signalling (Hh) is a developmental conserved pathway strongly involved in cancers when deregulated. This important pathway is orchestrated by numerous regulators, transduces through distinct routes and is finely tuned at multiple levels. In this regard, ubiquitylation processes stand as essential for controlling Hh pathway output. Although this post-translational modification governs proteins turnover, it is also implicated in non-proteolytic events, thereby regulating the most important cellular functions. The HECT E3 ligase Itch, well known to control immune response, is emerging to have a pivotal role in tumorigenesis. By illustrating Itch specificities on Hh signalling key components, here we review the role of this HECT E3 ubiquitin ligase in suppressing Hh-dependent tumours and explore its potential as promising target for innovative therapeutic approaches. Keywords: Hedgehog; cancer; ubiquitylation; Itch; Numb; β-arrestin2; GLI1; SuFu; Patched1 1.
  • An Immunoevasive Strategy Through Clinically-Relevant Pan-Cancer Genomic and Transcriptomic Alterations of JAK-STAT Signaling Components

    An Immunoevasive Strategy Through Clinically-Relevant Pan-Cancer Genomic and Transcriptomic Alterations of JAK-STAT Signaling Components

    bioRxiv preprint doi: https://doi.org/10.1101/576645; this version posted March 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. An immunoevasive strategy through clinically-relevant pan-cancer genomic and transcriptomic alterations of JAK-STAT signaling components Wai Hoong Chang1 and Alvina G. Lai1, 1Nuffield Department of Medicine, University of Oxford, Old Road Campus, Oxford, OX3 7FZ, United Kingdom Since its discovery almost three decades ago, the Janus ki- Although cytokines are responsible for inflammation in nase (JAK)-signal transducer and activator of transcription cancer, spontaneous eradication of tumors by endoge- (STAT) pathway has paved the road for understanding inflam- nous immune processes rarely occurs. Moreover, the matory and immunity processes related to a wide range of hu- dynamic interaction between tumor cells and host immu- man pathologies including cancer. Several studies have demon- nity shields tumors from immunological ablation, which strated the importance of JAK-STAT pathway components in overall limits the efficacy of immunotherapy in the clinic. regulating tumor initiation and metastatic progression, yet, the extent of how genetic alterations influence patient outcome is far from being understood. Focusing on 133 genes involved in Cytokines can be pro- or anti-inflammatory and are inter- JAK-STAT signaling, we found that copy number alterations dependent on each other’s function to maintain immune underpin transcriptional dysregulation that differs within and homeostasis(3).
  • S41467-020-18249-3.Pdf

    S41467-020-18249-3.Pdf

    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
  • Impact of Chromosome 9 Numerical Imbalances in Oral Squamous Cell Carcinoma: a Pilot Grid-Based Centromere Analysis

    Impact of Chromosome 9 Numerical Imbalances in Oral Squamous Cell Carcinoma: a Pilot Grid-Based Centromere Analysis

    diagnostics Communication Impact of Chromosome 9 Numerical Imbalances in Oral Squamous Cell Carcinoma: A Pilot Grid-Based Centromere Analysis 1, 1, 2, Efthymios Kyrodimos y , Aristeidis Chrysovergis y , Nicholas Mastronikolis y, Evangelos Tsiambas 3,*, Christos Riziotis 4,5,* , Dimitrios Roukas 6, Panagiotis Fotiades 7, Chara Stavraka 8 , Vasileios Ragos 9, Minas Paschopoulos 10 and Vasileios Papanikolaou 1 1 1st ENT Department, Hippocration General Hospital, University of Athens, 115 27 Athens, Greece; [email protected] (E.K.); [email protected] (A.C.); [email protected] (V.P.) 2 ENT Department, Medical School, University of Patras, 265 04 Patras, Greece; [email protected] 3 Department of Cytopathology, 417 Veterans Army Hospital (NIMTS), 115 21 Athens, Greece 4 Theoretical and Physical Chemistry Institute, Photonics for Nanoapplications Laboratory, National Hellenic Research Foundation, 11635 Athens, Greece 5 Defence & Security Research Institute, University of Nicosia, CY-2417 Nicosia, Cyprus 6 Department of Psychiatry, 417 Veterans Army Hospital (NIMTS), 115 21 Athens, Greece; [email protected] 7 Department of Surgery, 424 General Army Hospital, 564 29 Thessaloniki, Greece; [email protected] 8 Department of Medical Oncology, Guy’s and St Thomas National Health System Foundation Trust, London SE1 9RT, UK; [email protected] 9 Department of Maxillofacial Surgery, Medical School, University of Ioannina, 455 00 Ioannina, Greece; [email protected] 10 Department of Obstetrics and Gynaecology, School of Health Sciences, University of Ioannina, 455 00 Ioannina, Greece; [email protected] * Correspondence: [email protected] (E.T.); [email protected] (C.R.); Tel.: +00306946939414 (E.T.) These authors are equally contributed. y Received: 16 June 2020; Accepted: 14 July 2020; Published: 21 July 2020 Abstract: Oral squamous cell carcinoma (OSCC) is considered an aggressive malignancy, mainly due to its increased propensity to provide local and distant lymph node metastases.
  • Cutting Edge: Expression of IRF8 in Gastric Epithelial Cells Confers

    Cutting Edge: Expression of IRF8 in Gastric Epithelial Cells Confers

    Cutting Edge: Expression of IRF8 in Gastric Epithelial Cells Confers Protective Innate Immunity against Helicobacter pylori Infection This information is current as of September 27, 2021. Ming Yan, Hongsheng Wang, Jiafang Sun, Wei Liao, Peng Li, Yin Zhu, Chengfu Xu, Jungsoo Joo, Yan Sun, Sadia Abbasi, Alexander Kovalchuk, Nonghua Lv, Warren J. Leonard and Herbert C. Morse III J Immunol published online 3 February 2016 Downloaded from http://www.jimmunol.org/content/early/2016/02/02/jimmun ol.1500766 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2016/02/02/jimmunol.150076 Material 6.DCSupplemental Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published February 3, 2016, doi:10.4049/jimmunol.1500766 Th eJournal of Cutting Edge Immunology Cutting Edge: Expression of IRF8 in Gastric Epithelial Cells Confers Protective Innate Immunity against Helicobacter pylori Infection x x Ming Yan,*,1 Hongsheng Wang,†,1 Jiafang Sun,† Wei Liao,‡, Peng Li,‡, { † Yin Zhu, ChengfuXu,*JungsooJoo,*YanSun,*SadiaAbbasi,{ x Alexander Kovalchuk,† Nonghua Lv, Warren J.
  • Table S1| Differential Expression Analysis of the Atopy Transcriptome

    Table S1| Differential Expression Analysis of the Atopy Transcriptome

    Table S1| Differential expression analysis of the atopy transcriptome in CD4+ T-cell responses to allergens in atopic and nonatopic subjects Probe ID S.test Gene Symbol Gene Description Chromosome Statistic Location 7994280 10.32 IL4R Interleukin 4 receptor 16p11.2-12.1 8143383 8.95 --- --- --- 7974689 8.50 DACT1 Dapper, antagonist of beta-catenin, homolog 1 14q23.1 8102415 7.59 CAMK2D Calcium/calmodulin-dependent protein kinase II delta 4q26 7950743 7.58 RAB30 RAB30, member RAS oncogene family 11q12-q14 8136580 7.54 RAB19B GTP-binding protein RAB19B 7q34 8043504 7.45 MAL Mal, T-cell differentiation protein 2cen-q13 8087739 7.27 CISH Cytokine inducible SH2-containing protein 3p21.3 8000413 7.17 NSMCE1 Non-SMC element 1 homolog (S. cerevisiae) 16p12.1 8021301 7.15 RAB27B RAB27B, member RAS oncogene family 18q21.2 8143367 6.83 SLC37A3 Solute carrier family 37 member 3 7q34 8152976 6.65 TMEM71 Transmembrane protein 71 8q24.22 7931914 6.56 IL2R Interleukin 2 receptor, alpha 10p15-p14 8014768 6.43 PLXDC1 Plexin domain containing 1 17q21.1 8056222 6.43 DPP4 Dipeptidyl-peptidase 4 (CD26) 2q24.3 7917697 6.40 GFI1 Growth factor independent 1 1p22 7903507 6.39 FAM102B Family with sequence similarity 102, member B 1p13.3 7968236 5.96 RASL11A RAS-like, family 11, member A --- 7912537 5.95 DHRS3 Dehydrogenase/reductase (SDR family) member 3 1p36.1 7963491 5.83 KRT1 Keratin 1 (epidermolytic hyperkeratosis) 12q12-q13 7903786 5.72 CSF1 Colony stimulating factor 1 (macrophage) 1p21-p13 8019061 5.67 SGSH N-sulfoglucosamine sulfohydrolase (sulfamidase) 17q25.3
  • Molecular Characterization of Acquired Tolerance of Tumor Cells to Picropodophyllin (PPP)

    Molecular Characterization of Acquired Tolerance of Tumor Cells to Picropodophyllin (PPP)

    Molecular Characterization of Acquired Tolerance of Tumor Cells to Picropodophyllin (PPP) Jamileh Hashemi1*, Claire Worrall2, Daiana Vasilcanu2,Ma˚rten Frykna¨s3, Luqman Sulaiman1, Mohsen Karimi1, Wen-Hui Weng1¤a, Weng-Onn Lui1, Christina Rudduck1¤b, Magnus Axelson1, Helena Jernberg-Wiklund3, Leonard Girnita2, Olle Larsson2, Catharina Larsson1 1 Department of Molecular Medicine and Surgery, Center for Molecular Medicine, Karolinska Institutet, Karolinska University Hospital, CMM L8:01, Stockholm, Sweden, 2 Department of Oncology-Pathology, Karolinska Institutet, Karolinska University Hospital, CCK R8:04, Stockholm, Sweden, 3 Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden Abstract Background: Picropodophyllin (PPP) is a promising novel anti-neoplastic agent that efficiently kills tumor cells in vitro and causes tumor regression and increased survival in vivo. We have previously reported that PPP treatment induced moderate tolerance in two out of 10 cell lines only, and here report the acquired genomic and expression alterations associated with PPP selection over 1.5 years of treatment. Methodology/Principal Findings: Copy number alterations monitored using metaphase and array-based comparative genomic hybridization analyses revealed largely overlapping alterations in parental and maximally tolerant cells. Gain/ amplification of the MYC and PVT1 loci in 8q24.21 were verified on the chromosome level. Abnormalities observed in connection to PPP treatment included regular gains and losses, as well as homozygous losses in 10q24.1-q24.2 and 12p12.3- p13.2 in one of the lines and amplification at 5q11.2 in the other. Abnormalities observed in both tolerant derivatives include amplification/gain of 5q11.2, gain of 11q12.1-q14.3 and gain of 13q33.3-qter.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name Nedd4 family interacting protein 2 Gene Symbol Ndfip2 Organism Mouse Gene Summary Description Not Available Gene Aliases 0710001O20Rik, 2810436B12Rik, 9130207N19Rik, N4wbp5a, mKIAA1165 RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.290669 Ensembl Gene ID ENSMUSG00000053253 Entrez Gene ID 76273 Assay Information Unique Assay ID qMmuCED0039954 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000181969, ENSMUST00000138283, ENSMUST00000136040 Amplicon Context Sequence AGCAGAGCCCAGTCCTGCTCGGTTACTCAGTGCTGATACAATTGGAGGAATTGG GTAACGAGCAGCCTTCCAGCACGTGACGCTTCCGACGTGGCCGTTAGCGTAATC AGAGTTACACTATTACTCTTGTCCAGTGCTTTACTTTCT Amplicon Length (bp) 117 Chromosome Location 14:105308153-105308299 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 99 R2 0.996 cDNA Cq 20.52 cDNA Tm (Celsius) 83.5 gDNA Cq 23.84 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ndfip2, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
  • Deletion of 11Q in Neuroblastomas Drives Sensitivity to PARP Inhibition Elena Sanmartín1,2, Lisandra Munoz~ 1,2, Marta Piqueras3, J

    Deletion of 11Q in Neuroblastomas Drives Sensitivity to PARP Inhibition Elena Sanmartín1,2, Lisandra Munoz~ 1,2, Marta Piqueras3, J

    Published OnlineFirst August 22, 2017; DOI: 10.1158/1078-0432.CCR-17-0593 Personalized Medicine and Imaging Clinical Cancer Research Deletion of 11q in Neuroblastomas Drives Sensitivity to PARP Inhibition Elena Sanmartín1,2, Lisandra Munoz~ 1,2, Marta Piqueras3, J. Antoni Sirerol1,2, Pablo Berlanga2,4, Adela Canete~ 2,4, Victoria Castel2,4, and Jaime Font de Mora1,2 Abstract Purpose: Despite advances in multimodal therapy, neuroblas- define a subgroup of neuroblastomas with higher sensitivity to tomas with hemizygous deletion in chromosome 11q (20%– PARP inhibitors. Noteworthy, concomitant treatment with ola- 30%) undergo consecutive recurrences with poor outcome. We parib and DNA alkylating agent temozolomide potently inhibited hypothesized that patients with 11q-loss may share a druggable growth of cell lines harboring 11q-loss. This drug synergism was molecular target(s) that can be exploited for a precision medicine less potent when temozolomide was exchanged for cisplatin or strategy to improve treatment outcome. irinotecan. Intact 11q cells concomitantly treated with ATM Experimental Design: SNP arrays were combined with next- inhibitor displayed growth arrest and enhanced apoptosis, reveal- generation sequencing (NGS) to precisely define the deleted ing a role for ATM in the mechanism that mediates sensitivity to region in 17 primary 11q-loss neuroblastomas and identify allelic temozolomide–olaparib. Interestingly, functional TP53 is variants in genes relevant for neuroblastoma etiology. We required for efficacy of this treatment. In an in vivo model, assessed PARP inhibitor olaparib in combination with other coadministration of temozolomide–olaparib resulted in sus- chemotherapy medications using both in vitro and in vivo models. tained xenograft regression.
  • Chloride Channels Regulate Differentiation and Barrier Functions

    Chloride Channels Regulate Differentiation and Barrier Functions

    RESEARCH ARTICLE Chloride channels regulate differentiation and barrier functions of the mammalian airway Mu He1†*, Bing Wu2†, Wenlei Ye1, Daniel D Le2, Adriane W Sinclair3,4, Valeria Padovano5, Yuzhang Chen6, Ke-Xin Li1, Rene Sit2, Michelle Tan2, Michael J Caplan5, Norma Neff2, Yuh Nung Jan1,7,8, Spyros Darmanis2*, Lily Yeh Jan1,7,8* 1Department of Physiology, University of California, San Francisco, San Francisco, United States; 2Chan Zuckerberg Biohub, San Francisco, United States; 3Department of Urology, University of California, San Francisco, San Francisco, United States; 4Division of Pediatric Urology, University of California, San Francisco, Benioff Children’s Hospital, San Francisco, United States; 5Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Heaven, United States; 6Department of Anesthesia and Perioperative Care, University of California, San Francisco, San Francisco, United States; 7Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, United States; 8Howard Hughes Medical Institute, University of California, San Francisco, San Francisco, United States *For correspondence: Abstract The conducting airway forms a protective mucosal barrier and is the primary target of [email protected] (MH); [email protected] airway disorders. The molecular events required for the formation and function of the airway (SD); mucosal barrier, as well as the mechanisms by which barrier dysfunction leads to early onset airway [email protected] (LYJ) diseases,
  • SOCS-Mediated Immunomodulation of Natural Killer Cells T ⁎ Narelle Keating, Sandra E

    SOCS-Mediated Immunomodulation of Natural Killer Cells T ⁎ Narelle Keating, Sandra E

    Cytokine 118 (2019) 64–70 Contents lists available at ScienceDirect Cytokine journal homepage: www.elsevier.com/locate/cytokine Review article SOCS-mediated immunomodulation of natural killer cells T ⁎ Narelle Keating, Sandra E. Nicholson Walter and Eliza Hall Institute of Medical Research, Melbourne 3052, Australia Department of Medical Biology, University of Melbourne, Melbourne 3010, Australia ARTICLE INFO ABSTRACT Keywords: Natural killer (NK) cells are innate immune cells with an intrinsic ability to detect and kill infected and can- Cancer cerous cells. The success of therapies targeting immune checkpoints on CD8 cells has intensified interest in Immune checkpoints harnessing the cytolytic effector functions of NK cells for new cancer treatments. NK cell development, survival NK cells and effector activity is dependent on exposure to the cytokine interleukin (IL)-15. The suppressor ofcytokine SOCS proteins (SOCS) proteins (CIS; SOCS1-7) are important negative regulators of cytokine signaling, and both CIS and SOCS2 CIS are reported to have roles in regulating NK cell responses. Their immunomodulatory effects on NK cells suggest SOCS2 that these SOCS proteins are promising targets that can potentially form the basis of novel cancer therapies. Here we discuss the role of NK cells in tumor immunity as well as review the role of the SOCS proteins in regulating IL- 15 signaling and NK cell function. 1. Introduction success of the immune checkpoint inhibitors has stimulated efforts to harness the anti-tumor effector functions of NK cells. Whilst CTLA-4 is Cancer is a major cause of disease burden worldwide, with an es- expressed on the surface of activated murine NK cells, it does not ap- timated 8.2 million cancer-related deaths in 2012 [1] and 1,735,000 pear to be expressed on human NK cells [6].