Functional genomics to study protein secretion stress in Aspergillus niger Silva Pinheiro Carvalho, N.D.

Citation Silva Pinheiro Carvalho, N. D. (2011, June 7). Functional genomics to study protein secretion stress in Aspergillus niger. Retrieved from https://hdl.handle.net/1887/17685

Version: Corrected Publisher’s Version Licence agreement concerning inclusion of doctoral thesis in the License: Institutional Repository of the University of Leiden Downloaded from: https://hdl.handle.net/1887/17685

Note: To cite this publication please use the final published version (if applicable).

Summary Summary & Samenvatting & Supplementary material

122 Summary & Samenvatting & Supplementary material Summary

Summary

In its natural habitat, Aspergillus niger usually grows on complex plant biopolymers. To be able to consume these nutrients, the fungus secretes a wide range of enzymes like amylases, xylanases, pectinases, cellulases, proteases, to break down the polymers into smaller molecules (monosaccharides or amino acids), that can be then taken up by the cell. The high secretion capacity of A. niger has drawn a lot of research towards the production of homologous and heterologous proteins to be used in different branches of the food, medical and textile industries. While the production yields of homologous protein are often high, the production of heterologous proteins has revealed more problematic. Several studies suggest that these problems usually arise post-translationally, within different steps of the secretory pathway. A major bottleneck is the protein synthesis and subsequent folding of secretory proteins that takes place in the ER. If the flow of new proteins into this organelle is higher than the rate at which the proteins are folded and delivered to the next organelle in the pathway, proteins begin to accumulate in the ER lumen, posing a risk to the cell. To counteract this stress, the UPR pathway is triggered, which results in activating the HacA transcription factor responsible for the induced expression of foldases and chaperones that support protein folding. At the ER, proteins also encounter quality control checkpoints that validate their aptness to continue in the secretory pathway. Misfolded proteins are recognized and targeted to the ERAD pathway to become degraded by the proteasome. In this thesis we have focused our studies towards a better understanding of different processes involved in the protein secretion pathway that might act as bottlenecks for homologous and heterologous protein production. We have given particular attention to the molecular mechanisms of folding and quality control that take place in the ER, in order to be able to improve and develop new strategies for heterologous protein production by A. niger . In Chapter 1 a general outline is given of the secretory pathway of eukaryotes, with special attention to the UPR and ERAD pathways. Additionally, an overview of the commonly pointed bottlenecks that have been encountered on protein production, together with the current tools used by the modern science to broaden the knowledge on filamentous fungi. To generate gene knock-out mutants in filamentous fungi through homologous recombination is very time consuming which hampers the functional analysis of predicted genes from genome sequences. In Chapter 2 we present several methods that will boast functional genomics in A. niger . We describe the construction of a set of strains where the kusA gene has been deleted, resulting in recipient strains in which deletions of essential and non-essential genes can be easily achieved, as shown in the case of the ireA and hacA genes, respectively. To overcome the disadvantages of having a compromised NHEJ pathway, we also describe the construction of a transiently disrupted kusA strain. For complementation of ∆kusA mutants we present an approach based on autonomously replicating plasmids, in which the mutant phenotype can be maintained or lost by regulating (on/off) the selective pressure. Chapter 3 describes the cloning and functional characterization of the A. niger gmtA gene. Phylogenetic analysis showed that gmtA clusters

123 Summary Summary & Samenvatting & Supplementary material

together with well characterized GDP-mannose transporters from other fungal species and YFP tagging of GmtA proved its localization at Golgi equivalents. The isolation and characterization of a secretion related small GTPase, srgC , is also described. The ∆srgC mutant phenotype showed reduced growth and the inability to form conidiospores at high temperatures and in addition, our microscopy results point to a role of SrgC in the organization, morphology and Golgi functions. Chapter 4 describes the effect of the deletion of five genes involved in ERAD under i) normal growth conditions, ii) conditions of chemically induced ER stress and iii) by expressing an UPR-inducing heterologous protein (Glucoamylase-Gus). The results indicate that a functional ERAD pathway is not required for normal growth, but a defective ERAD pathway increases intracellular levels of the heterologous protein in study, indicating that this quality control pathway might impose a bottleneck on heterologous protein production by being (partially) responsible for their degradation. In Chapter 5, we have focused our study on i) the physiology of a genetically engineered A. niger strain that expresses only the activated form of the transcription factor HacA and ii) its transcriptome profile obtained using Affymetrix GeneChip analysis. GO enrichment analysis reflected a broader role of HacA in the cells, leading on one hand to the enrichment of secretory pathway processes (e.g.: folding and secretion) and an expansion of the endomembrane system ((phospho)lipid and inositol metabolism); on the other hand, a putative involvement of HacA on the negative regulation of extracellular enzymes expression (RESS mechanism) to counteract secretion stress. In the last Chapter ( Chapter 6 ) we summarize and discuss the main conclusions of this thesis and look ahead on how our studies on UPR and ERAD might help us to further improve heterologous protein production in A. niger

124 Summary & Samenvatting & Supplementary material Samenvatting

Samenvatting

Aspergillus niger groeit in zijn natuurlijke omgeving op complexe plantaardige biopolymeren. Om deze voedingsstoffen te kunnen consumeren, scheidt de schimmel een verscheidenheid aan enzymen uit, zoals amylases, xylanases, pectinases, cellulases en proteases, om de polymeren af te breken in kleinere moleculen (monosacchariden of aminozuren) die door de cel kunnen worden opgenomen. De hoge secretie capaciteit van A. niger heeft er voor gezorgd dat er veel onderzoek wordt gedaan naar de productie van homologe en heterologe eiwitten die kunnen worden gebruikt in verschillende takken van de medische-, textiel- en voedingsindustrie. De hoeveelheid geproduceerde homologe eiwitten is vaak groot, terwijl de opbrengst van heterologe eiwitten vaak problematisch laag is. Verscheidene studies wijzen erop dat deze problemen post-translationeel zijn en plaatsvinden tijdens verscheidene stappen in de secretie route. Een van de grootste problemen is de eiwitsynthese en de hierop volgende vouwing van secretie eiwitten in het endoplasmatisch reticulum (ER). Als de stroom van nieuwe eiwitten groter is dan het tempo waarin deze eiwitten kunnen worden gevouwen en afgeleverd bij het volgende organel in de route, vindt er eiwit accumulatie plaats, wat stress veroorzaakt in de cel. Om deze stress tegen te gaan wordt de Unfolded Protein Response (UPR) route geactiveerd, resulterend in activatie van de transcriptie factor HacA, welke verantwoordelijk is voor de geïnduceerde expressie van foldases en chaperones betrokken bij eiwit vouwing. In het ER worden eiwitten ook gecontroleerd of ze geschikt zijn om de secretieroute in te gaan. Niet goed gevouwen eiwitten worden herkend en via de ER Associated Degradation (ERAD) route en afgebroken in het proteasoom. In dit proefschrift hebben we onze studie gericht op het beter begrijpen van de verschillende processen die betrokken zijn bij eiwit secretie en mogelijk de oorzaak zijn van lage eiwitproductie. We hebben vooral onze aandacht gericht op het moleculaire mechanisme van eiwit vouwing en kwaliteitscontrole in het ER, om zo in staat te zijn nieuwe strategieën voor heterologe eiwitproductie in A. niger te ontwikkelen en te verbeteren. In Hoofdstuk 1 wordt een algemeen overzicht gegeven van de secretie route in eukaryoten, met speciale aandacht voor de UPR en ERAD routes. Bovendien worden de knelpunten besproken die zich voordoen bij eiwitproductie, samen met de huidige technieken die in de moderne wetenschap worden gebruikt om de kennis van filamenteuze schimmels te vergroten. Het verkrijgen van gen deletie mutanten door middel van homologe recombinatie is tijdrovend en hierdoor limiterend voor de functionele analyse van voorspelde genen in genoom sequenties. In Hoofdstuk 2 presenteren we verschillende methoden die de functionele genomics in A. niger kunnen verbeteren. We beschrijven de constructie van een aantal stammen waarin het kusA gen is gedeleteerd, resulterend in stammen waar deleties van essentiële en non-essentiële genen gemakkelijk kan worden verwezenlijkt, zoals met de ireA en hacA genen aangetoond is. Om de nadelen van een gecomprimeerde NHEJ route te overbruggen beschrijven we ook de constructie van een omkeerbare kusA deletie stam. Voor complementatie van ∆kusA mutanten stellen we een benadering voor die gebruik maakt van autoreplicerende plasmiden waarbij het

125 Samenvatting Summary & Samenvatting & Supplementary material

mutante fenotype behouden of verwijderd kan worden door regulatie van selectiedruk. Hoofdstuk 3 beschrijft het kloneren en de functionele analyse van het A. niger gmtA gen. Fylogenetische analyse laat zien dat gmtA clustert bij de uitgebreid gekarakteriseerde GDP- mannose transporters van andere schimmelsoorten en YFP-labeling van GmtA bewijst dat de locatie ervan bij Golgi equivalenten ligt. De isolatie en karakterisatie van een secretie gerelateerde kleine GTPase, srgC , is ook beschreven. Het fenotype van de ∆srgC mutant heeft verminderde groei en het onvermogen conidiosporen te vormen bij hoge temperaturen en daarbij laten onze microscopie resultaten zien dat SrgC een rol speelt in de organisatie, morfologie en Golgi functies. Hoofdstuk 4 beschrijft het effect van de deletie van vijf genen die betrokken zijn in ERAD onder i) normale groei condities ii) condities van chemisch geïnduceerd ER stress en iii) door expressie van een UPR-geïnduceerd heteroloog eiwit (Glucoamylase-Gus). Het resultaat wijst erop dat een functionele ERAD route niet noodzakelijk is voor normale groei maar een defecte ERAD route verhoogt het intracellulair niveau van het onderzochte heterologe eiwit. Dit wijst erop dat deze kwaliteitscontrolerende route een knelpunt veroorzaakt voor heterologe eiwit productie door (gedeeltelijk) verantwoordelijk te zijn voor hun degradatie. In Hoofdstuk 5 focussen we onze studie op i) de fysiologie van een genetisch gemanipuleerde A. niger stam dat alleen de geactiveerde vorm van transcriptiefactor HacA tot expressie brengt en ii) het transcriptoom profiel verkregen door het gebruik van Affymetrix GeneChip analyse. GO verrijkingsanalyse reflecteert een bredere rol van HacA in de cellen, leidend aan de ene kant tot verrijking van de secretie routes (bv. vouwen en secretie) en een expansie en van endomembraan systeem ((fosfo)lipide en inositol metabolisme); aan de andere kant een vermeende rol van HacA op de negatieve regulatie van extracellulaire enzym expressie (RESS mechanisme) om secretie stress tegen te gaan. In het laatste hoofdstuk ( Hoofdstuk 6) geven we een samenvatting en discussie over de hoofdconclusies van dit proefschrift en kijken we verder naar hoe onze studies over UPR en ERAD ons kunnen helpen het heterologe eiwit productie in A. niger verder te verbeteren.

126 Summary & Samenvatting & Supplementary material Sup. material !

Supplementary material

Chapter 3:

Table S1. Primers used in this study.

Primer name Sequence (5’ to 3’) Target sequence

gmtA-P1F AAGGGCTTCGGAGGTTGACT gmtA 5’deletion flank/ gmtA deletion

gmtA-P7R CACCATGGTGACTGGATTCAATGAGTG gmtA 5’deletion flank

gmtA-P6R CCTCAACCGCACGAAACCTTA gmtA 3’deletion flank/ gmtA deletion

gmtA-P10F GTGCCGGCGCTGGTGCTGGCGCCGGTGCCATGGCTGAAGGCAAGAAGACCG gmtA 3’deletion flank

gmtA-P8F CACTCATTGAATCCAGTCACCATGGTGAGCAAGGGCGAGGAGCT YFP

gmtA-P9R GCCAGCACCAGCGCCGGCACCCTTGTACAGCTCGTCCATGCCG YFP

gmtA-P11F TCGGAGGTTGACTTTGAGTGG YFP-GmtA fusion construct

gmtA-P12R ACTTTGCGAGGCCTCGCCACA YFP-GmtA fusion construct

gmta-HYG-P11rev AGAATTAAATGGTACTCGAGGGTGACTGGATTCAATGAGTGTC gmtA deletion

gmta-Hyg-P12for ACTTGTTTAGAGGTAATCCTTCTTTCTAGAATCGATTTGCCTAGAGATCAAC gmtA deletion Restriction sites added are underlined.

! 127 Sup. material Summary & Samenvatting & Supplementary material !

Table S2. List of selected GDP-mannose transporters from a diversity of fungi. Protein sequences of these were used for the construction of a phylogenetic tree (Supplementary Fig. S1).

Species Locus tag GeneID Protein name Reference Aspergillus flavus AFLA_048230 7911640 predicted Aspergillus oryzae AO090009000688 5989036 VRG4/SQV7 Aspergillus terreus ATEG_09457 4353765 predicted Aspergillus niger An17g02140 4989537 GmtA this study Aspergillus clavatus ACLA_009020 4706353 predicted Aspergillus nidulans AN8848.3 2868445 GmtA Jackson-Hayes et al. 2008 Aspergillus nidulans AN9298.3 2867878 GmtB Jackson-Hayes et al.2008 Schizosaccharomyces pombe SPAC144.18 2542850 predicted Gibberella zeae FG02598.1 2784046 hypothetical Magnaporthe grisea MGG_08858 2679844 hypothetical Sclerotinia sclerotiorum SS1G_00430 5494635 predicted Neurospora crassa NCU06198 3879062 predicted Cryptococcus neoformans AAY85624 68137387 GMT1 Cottrell et al. 2007 Cryptococcus neoformans AAR96298 40886754 GMT2 Cottrell et al. 2007 Ustilago maydis UM01062.1 3629085 hypothetical Malassezia globosa MGL_0485 5857016 hypothetical Saccharomyces cerevisiae YGL225W 852647 ScVRG4 Dean et al. 1997 Schizophyllum commune XP_003032622.1

Candida glabrata CAGL0H09196g 2888653 CgVRG4 Nishikawa et al. 2002a Candida albicans CaO19.8817 3641828 CaVRG4 Nishikawa et al. 2002b Pichia pastoris PAS_chr3_0916 8200270 PpVIG4 Arakawa et al. 2006

128 ! Summary & Samenvatting & Supplementary material Sup. material !

Figure S1. Phylogenetic tree of fungal GDP-mannose transporters from a selection of taxonomically diverse fungi. The blocks colored in light blue and red represent the Ascomycota and Basidiomycota phylums, respectively; on the right is shown the division of the species by the respective classes. The scale bar corresponds to a genetic distance of 0.01 substitution per position.

! 129 Sup. material Summary & Samenvatting & Supplementary material !

Figure S2. Predicted transmembrane topology of the respective GDP-mannose transporters (GmtA) of Aspergillus nidulans (A) and Aspergillus niger (B) according to TMHMM (http://www.cbs.dtu.dk/services/TMHMM/). Horizontal red bars represent potential transmembrane domains.

A

B

130 ! Summary & Samenvatting & Supplementary material Sup. material !

Figure S3. Southern analysis of gmtA deletion and respective complemented strain. Genomic DNA was digested with PstI and probed with a fragment corresponding to the gmtA 5’-flanking region obtained from !gmtA deletion cassette by digesting with BglII and XhoI. Lane 1 corresponds to MA70.15 recipient strain (wt gmtA), lane 2 corresponds to "gmtA#1, a "gmtA/gmtA heterokaryon strain, and lane 3 corresponds to one of the gmtA complemented strain (Ren2.1). Band sizes of the hybridizing fragments are as predicted and indicated on the right. For the "gmtA/heterokaryon the two signals correspond to the wild-type locus (2.5 kb) and the gmtA deleted locus (4 kb); in the case of the gmtA complemented strain the two signals correspond to the deleted locus (4 kb) and the vector (5 kb).

! 131 Sup. material Summary & Samenvatting & Supplementary material !

Figure S4. Phylogenetic tree of secretion related Subfamilies small GTPases from Saccharomyces cerevisiae (ScYPT/Sec4) and Homo sapiens (HsRab) and Aspergillus niger. The identification of A. niger proteins SrgA (An14g00010), SrgB Ypt5/Rab5 (An09g06790), SrgC (An15g05740) and SrgD (An07g10340) as well as SarA (An01g04040) Ypt10 have been described (Punt et al., 2001, Veldhuisen et al., 1997. The other A. niger Ypt6/Rab6/SrgC proteins were identified in the A. niger genome Rab24 sequence (Pel et al., 2007). The scale bar corresponds to a genetic distance of 0.1 Ypt7/Rab7_9 substitution per position. Database entries used to Ypt11/Rab33 retrieve sequences are for S. cerevisiae (Sc): ARF1 (P11076), ARF2 (P19146) ARF3 Sar (CAA99291), SAR1 (P20606), YPT1 (P01123), SEC4 (P07560), YPT31 (P38555), YPT32 (P51996), YPT51 (P36017), YPT52 (P36018), Arf YPT53 (P36019), YPT6 (Q99260), YPT7 (P32939) YPT10 (P38146), YPT11(P48559); for Homo sapiens (Hs): Sar1A (Q9NR31), Arf1 (P84077), Arf6 (P62330), Rab9A (P51151), Ypt3/Rab11 Rab7A (P51149), Rab33B (Q9H082), Rab3A (P20336), Rab8B (Q92930), Rab1A (P62820), Rab14(P61106), Rab4B (P61018), Rab2A Rab2_4_14/SrgD (P61019), Rab2B (Q8WUD1), Rab11B (Q15907), Rab6A (P20340), Rab24 (Q969Q5), Rab5A (P20339), Rab5C (P51148); for Ypt1/Rab1/SrgB Aspergillus niger (An) Hypothetical proteins with nr An02g06400 (A2QDA7), An04g02470 Sec4/Rab3_8/SrgA (A2QI69), An14g02260 (A2R2X2), An01g06060 (A2Q8Z1), An12g00040 (A2QY55), An18g02210 (A2RA78), An02g07780 (A2QDP0), An08g03690 (A2QQU0), and An11g01790 (A2QVK9).!

132 ! Summary & Samenvatting & Supplementary material Sup. material !

Figure S5. Southern analysis of YFP-GmtA integration at the pyrG locus (A) and respective gmtA deletion (B). (A) Genomic DNA was digested with BamHI and probed with a 2.3 kb pyrG fragment, digested from pAF3 using XhoI. (B) Genomic DNA was digested with PstI and probed with a fragment corresponding to the gmtA 5’-flanking region obtained from the gmtA deletion cassette by digesting with BglII and XhoI. Band sizes of the hybridizing fragments are as predicted and indicated on the right of each blot.

! 133 Sup. material Summary & Samenvatting & Supplementary material !

Chapter 5:

Table S1A. All differentially expressed genes in HacACA. (Available only upon request: [email protected])

CA Table S1B. Overview of the 616 HacA up-regulated genes in the 3 time points..

Gene ID Description An01g00290 similarity to hypothetical protein encoded by An17g00430 - Aspergillus niger An01g00560 strong similarity to signal peptidase subunit Sec11 - Saccharomyces cerevisiae An01g01300 hypothetical protein An01g02280 hypothetical protein An01g02640 strong similarity to O-methyltransferase B omtB - Aspergillus parasiticus An01g02660 strong similarity to hypothetical protein encoded by An03g05810 - Aspergillus niger An01g02870 similarity to hypothetical protein SPAC227.06 - Schizosaccharomyces pombe An01g02910 strong similarity to hypothetical ARE1-like protein F3I17.5 - Arabidopsis thaliana An01g03100 strong similarity to manganese resistance protein 1 Mnr1 - Saccharomyces cerevisiae An01g04040 secretion-associated GTP-binding protein sarA - Aspergillus niger An01g04320 strong similarity to COPII vesicle coat component protein Erv46 - Saccharomyces cerevisiae An01g04600 PDI related protein A prpA - Aspergillus niger An01g04760 similarity to hypothetical protein B12K8.10 - Neurospora crassa An01g05200 strong similarity to DPM2 - Mus musculus An01g05540 similarity to hypothetical protein T27E13.9 - Arabidopsis thaliana An01g05670 strong similarity to H+-transporting ATPase Pma1 - Saccharomyces cerevisiae An01g06550 strong similarity to protein kinase Ire1 - Saccharomyces cerevisiae An01g06670 strong similarity to peptidyl-prolyl isomerase FKBP-21 - Neurospora crassa An01g06800 strong similarity to alkaline ceramidase Ypc1 - Saccharomyces cerevisiae An01g07320 strong similarity to embryogenesis protein H beta 58 - Mus musculus An01g07330 similarity to brefeldin A-inhibited guanine nucleotide-exchange protein 2 - Homo sapiens An01g07640 similarity to hypothetical membrane protein YPL087w - Saccharomyces cerevisiae An01g07900 leucine zipper cpcA - Aspergillus niger [putative frameshift] An01g07930 strong similarity to hypothetical protein encoded by An11g05030 - Aspergillus niger An01g08170 strong similarity to DNA repair endonuclease rad1p - Schizosaccharomyces pombe An01g08300 similarity to hypothetical conserved protein VC1938 - Vibrio cholerae An01g08420 strong similarity to calcium-binding protein precursor cnx1p - Schizosaccharomyces pombe An01g08460 strong similarity to the mannosyltransferase Alg12 - Saccharomyces cerevisiae An01g08530 kexin precursor kexB - Aspergillus niger

134 ! Summary & Samenvatting & Supplementary material Sup. material !

An01g08550 strong similarity to aminotriazole resistance protein Atr1 - Saccharomyces cerevisiae An01g08620 strong similarity to hypothetical protein SPBC2A9.05c - Schizosaccharomyces pombe An01g08660 similarity to ankyrin Ank - Drosophila melanogaster [truncated ORF] An01g08670 similarity to nucleolin C23 - Cricetulus griseus An01g08870 strong similarity to component of COPII-coated vesicles Erv25 - Saccharomyces cerevisiae An01g09260 strong similarity to aldehyde dehydrogenase (NADP+) - Homo sapiens An01g09480 strong similarity to phosphatidylserine synthase pS232 - Triticum aestivum An01g09800 strong similarity to hypothetical protein encoded by ORF G4P06 - Aspergillus nidulans An01g10070 strong similarity to signal recognition particle chain Sec65 - Saccharomyces cerevisiae An01g10730 similarity to plasma membrane bound receptor from patent DE19627237-A1 - Sus scrofa An01g10900 similarity to hypothetical la costa protein lcs - Drosophila melanogaster An01g10970 strong similarity to quinate transporter qa-y - Neurospora crassa similarity to acetyl transferase of an indole-3-acetic acid producing gene cluster ORF5 - An01g11140 Azospirillum brasilense An01g11420 hypothetical protein An01g11630 strong similarity to translocation complex component Sss1 - Saccharomyces cerevisiae An01g12290 similarity to CCAAT displacement protein CASP - Homo sapiens An01g12370 similarity to hypothetical protein SPCC285.11 - Schizosaccharomyces pombe An01g12430 strong similarity to hypothetical protein CAF32157.1 - Neurospora crassa An01g12520 strong similarity to beta-ketoacyl reductase rhlG - Pseudomonas aeruginosa An01g12720 similarity to tumour suppressor protein TSA305 from patent WO9928457-A1 - Homo sapiens similarity to BAX-associated protein fragment SEQ ID NO:242 from patent WO200264766-A2 - An01g12810 Saccharomyces cerevisiae An01g12990 strong similarity to hypothetical membrane protein YJL091c - Saccharomyces cerevisiae An01g13070 strong similarity to signal recognition particle receptor Sec63 - Saccharomyces cerevisiae An01g13220 strong similarity to 150 kDa oxygen regulated protein ORP150 - Rattus norvegicus An01g13390 similarity to hypothetical protein CAD21062.1 - Neurospora crassa An01g13640 similarity to nitrate assimilation regulatory protein nirA - Aspergillus nidulans An01g14100 weak similarity to stress protein Herp - Mus musculus An01g14140 strong similarity to CDPdiacylglycerol--inositol 3-phosphatidyltransferase - Rattus norvegicus An01g14250 strong similarity to delta subunit of the coatomer delta-coat protein CopD - Bos taurus strong similarity to delta subunit of the coatomer delta-coat protein CopD - Bos taurus [deleted An01g14260 ORF] An01g14420 similarity to soluble epoxide hydrolase SEH - Homo sapiens An01g14810 weak similarity to hypothetical protein SPAC19B12.02c - Schizosaccharomyces pombe An01g14820 similarity to hypothetical membrane protein YNL283c - Saccharomyces cerevisiae An01g14840 similarity to hypothetical protein SC4B10.33 - Streptomyces coelicolor

! 135 Sup. material Summary & Samenvatting & Supplementary material !

An02g01410 hypothetical protein strong similarity to component of the endoplasmic reticulum protein translocation machinery An02g01510 Sec62 - Saccharomyces cerevisiae strong similarity to p150 component of the COPII coat of secretory pathway vesicles Sec31 - An02g01690 Saccharomyces cerevisiae strong similarity to vacuolar H(+)-transporting ATPase subunit B Vma2 - Saccharomyces An02g02020 cerevisiae An02g02260 strong similarity to hypothetical membrane protein YMR155w - Saccharomyces cerevisiae An02g02640 similarity to Golgi membrane protein Yip1 - Saccharomyces cerevisiae An02g02980 strong similarity to protein influencing Itr1 expression Die2 - Saccharomyces cerevisiae An02g03130 hypothetical protein strong similarity to UDP-N-acetylglucosamine--dolichyl-phosphate N- An02g03240 acetylglucosaminephosphotransferase Alg7 - Saccharomyces cerevisiae An02g03300 strong similarity to vacuolar ATPase subunit F - Neurospora crassa An02g03460 similarity to hypothetical protein YIL041w - Saccharomyces cerevisiae An02g03600 hypothetical protein An02g04050 similarity to protein-tyrosine phosphatase P-TEN - Homo sapiens An02g04120 similarity to protein SEQ ID NO:13148 from patent EP1074617-A2 - Homo sapiens An02g04210 strong similarity to chloride channel CLC-3 - Tilapia mossambica An02g04250 similarity to protein p58 - Rattus norvegicus An02g04530 strong similarity to cyclopropane-fatty-acyl-phospholipid synthase - Escherichia coli An02g04580 strong similarity to hypothetical protein YAL049c - Saccharomyces cerevisiae An02g05120 hypothetical protein An02g05150 strong similarity to C-8,7 sterol isomerase - Arabidopsis thaliana An02g05180 hypothetical protein strong similarity to branched-chain alpha-ketoacid dehydrogenase kinase BCKDK - Rattus An02g05610 norvegicus An02g05870 strong similarity to coatomer beta subunit copB2 - Homo sapiens [putative frameshift] An02g05890 strong similarity to protein disulfide-isomerase pdi1 - Caenorhabditis elegans An02g06300 similarity to naaladase II - Homo sapiens An02g06870 strong similarity to RAD50-interacting protein 1 RINT-1 - Homo sapiens An02g07090 strong similarity to ASNA1 product arsenite translocating ATPase - Homo sapiens An02g07100 hypothetical protein An02g07610 strong similarity to mannitol transporter mat1 - Apium graveolens An02g07730 similarity to growth regulator ING1 - Mus musculus [truncated ORF] An02g07780 strong similarity to ADP-ribosylation factor 6 ARF6 - Homo sapiens An02g08060 similarity to hypothetical protein YGL144c - Saccharomyces cerevisiae

136 ! Summary & Samenvatting & Supplementary material Sup. material !

An02g08450 secretory gene nsfA - Aspergillus niger An02g08840 similarity to rabkinesin-6 - Mus musculus An02g09180 similarity to mucin-like protein Muc1 - Saccharomyces cerevisiae An02g09290 hypothetical protein An02g09350 strong similarity to sulfate transport protein shst2 - Stylosanthes hamata strong similarity to hypothetical Ca2+-transporting ATPase Spf1 - Saccharomyces cerevisiae An02g09470 [truncated ORF] An02g09550 strong similarity to protein het-c2 - Podospora anserina An02g09910 strong similarity to fatty acid elongase Fen1 - Saccharomyces cerevisiae An02g10270 strong similarity to protein involved in vacuolar protein sorting Vps54 - Saccharomyces cerevisiae An02g10490 strong similarity to endo-1,3(4)-beta-glucanase bg1 - Phaffia rhodozyma similarity to protein kinase/ankyrin homologue SEQ ID NO:334 from patent WO9955865-A1 - An02g10560 Mus musculus An02g11290 similarity to phosphoinositide-specific phospholipase C lc1p - Schizosaccharomyces pombe An02g11420 dipeptidyl aminopeptidase type IV dapB - Aspergillus niger An02g11810 strong similarity to hypothetical conserved protein 12F11.50 - Neurospora crassa An02g11990 similarity to protein involved in protein secretion sec20 - Candida albicans An02g12050 similarity to V-ATPase assembly protein Vma21 - Saccharomyces cerevisiae An02g12630 strong similarity to glucosyltransferase Alg6 - Saccharomyces cerevisiae An02g13080 similarity to N epsilon-(indole-3-acetyl)-L-lysine synthase iaaL - Pseudomonas syringae An02g13410 similarity to acetyl-coenzyme A transporter AT-1 - Homo sapiens strong similarity to protein involved in glycosylphosphatidylinositol biosynthesis pig-C - Homo An02g13570 sapiens An02g13670 similarity to human secreted protein fragment from patent WO9909155-A1 - Homo sapiens An02g14070 weak similarity to hypothetical protein encoded by An11g01490 - Aspergillus niger An02g14450 secretory pathway Ca2+-ATPase pmrA - Aspergillus niger An02g14560 oligosaccharyltransferase alpha subunit ostA - Aspergillus niger An02g14800 protein disulfide isomerase A pdiA - Aspergillus niger strong similarity to dolichyl-diphosphooligosaccharide-protein glycotransferase gamma chain An02g14930 Ost3 - Saccharomyces cerevisiae strong similarity to human transmembrane protein HTMPN-23 from patent WO9961471-A2 - An02g14940 Homo sapiens An03g02270 similarity to dihydropyridine receptor Fgalpha1S - Rana catesbeiana An03g02430 strong similarity to mannitol dehydrogenase mtlD - Pseudomonas fluorescens An03g02530 similarity to hypothetical proteinase encoded by SCD8A.14c - Streptomyces coelicolor An03g02590 hypothetical protein An03g02770 strong similarity to hypothetical protein YLR361c - Saccharomyces cerevisiae

! 137 Sup. material Summary & Samenvatting & Supplementary material !

An03g02820 strong similarity to hypothetical lipase Cvt17 - Saccharomyces cerevisiae An03g02990 similarity to alphaN-acetylglucosamine transferase GNT1 - Kluyveromyces lactis similarity to potential regulator of leucine permease gene expression Sac3 - Saccharomyces An03g03940 cerevisiae An03g04190 similarity to cellulase #2 from patent US2003036176-A1 - Xanthomonas campestris An03g04210 similarity to component of the exocyst Sec8 - Saccharomyces cerevisiae An03g04340 strong similarity to ER membrane translocation facilitator Sec61 - Yarrowia lipolytica strong similarity to UDP-glucose:dolichyl-phosphate glucosyltransferase Alg5 - Saccharomyces An03g04410 cerevisiae An03g04430 strong similarity to hypothetical protein EAA61229.1 - Aspergillus nidulans An03g04720 strong similarity to serine threonine protein kinase SNF1 - Cochliobolus carbonum An03g04770 similarity to hypothetical protein CAD11383.1 - Neurospora crassa An03g04910 strong similarity to clathrin coat assembly protein AP19 - Camptotheca acuminata An03g04940 strong similarity to Erv41 - Saccharomyces cerevisiae An03g05960 strong similarity to epoxide hydrolase cEH - Corynebacterium sp. An03g06330 strong similarity to 2,3-dihydroxybiphenyl-1,2-dioxygenase bphC - Pseudomonas stutzeri An03g06410 strong similarity to methyl sterol oxidase Erg25 - Saccharomyces cerevisiae An03g06420 similarity to hypothetical protein encoded by An08g08870 - Aspergillus niger An03g06540 strong similarity to arylsulfatase ars-1 - Neurospora crassa strong similarity to hypothetical transcription regulator protein CAA91958.1 - An03g06760 Schizosaccharomyces pombe An03g06840 hypothetical protein An03g06880 strong similarity to carboxypeptidase Y-sorting protein Pep1 - Saccharomyces cerevisiae An03g06900 strong similarity to exocytosis protein Sec10 - Saccharomyces cerevisiae An03g06910 strong similarity to hypothetical 32.0k protein - Neurospora crassa An03g06940 strong similarity to UPD-GlcNAc transporter MNN2-2 - Kluyveromyces lactis An04g00340 strong similarity to myo-inositol transport protein Itr2 - Saccharomyces cerevisiae An04g00350 hypothetical protein An04g00360 strong similarity to transport vesicle formation protein Sec13 - Saccharomyces cerevisiae An04g00500 similarity to transcription activator prnA - Aspergillus nidulans An04g00600 strong similarity to hypothetical ER-to-Golgi transporter Lag1 - Saccharomyces cerevisiae strong similarity to hydroxymethylglutaryl-coenzyme A reductase hmg1p - Schizosaccharomyces An04g00610 pombe [truncated ORF] An04g00630 strong similarity to hypothetical protein CAC28557.1 - Neurospora crassa strong similarity to hypothetical coiled-coil protein similar to human congenital heart disease An04g00670 protein CAC05252.1 - Schizosaccharomyces pombe An04g00970 similarity to hypothetical transmembrane protein orf375 - Bradyrhizobium japonicum

138 ! Summary & Samenvatting & Supplementary material Sup. material !

An04g01260 strong similarity to golgi alpha-1,6 mannosyltransferase subunit Anp1 - Saccharomyces cerevisiae An04g01320 strong similarity to fatty acid desaturase from patent WO9846764-A1 - Homo sapiens An04g01390 strong similarity to amino acid transporter ATA1 - Homo sapiens An04g01600 strong similarity to hypothetical protein B1D1.80 - Neurospora crassa An04g01720 similarity to DnaJ protein SIS1 - Cryptococcus curvatus An04g01780 strong similarity to hypothetical protein YAR002c-a - Saccharomyces cerevisiae An04g01950 strong similarity to zinc-metalloprotease Ste24 - Saccharomyces cerevisiae An04g01990 similarity to protein ZW10 homolog HZW10 - Homo sapiens An04g02020 strong similarity to cyclophilin cypB - Aspergillus nidulans An04g02050 similarity to hypoxia-induced protein #21 from patent WO200246465-A2 - Homo sapiens An04g02240 similarity to RanGTP-binding protein NXT1 - Homo sapiens An04g02250 questionable ORF strong similarity to ornithine decarboxylase ODC - Paracoccidioides brasiliensis [putative An04g02420 frameshift] An04g02480 strong similarity to lipid phosphoinositide phosphatase Sac1 - Saccharomyces cerevisiae strong similarity to cell cycle regulation protein-4 (CECRP-4) from patent WO9964593-A2 - An04g02650 Homo sapiens An04g02870 weak similarity to histone H1 - Nicotiana tabacum An04g02880 strong similarity to glutaminyl-peptide cyclotransferase QPCT - Homo sapiens An04g02970 similarity to dimethylaniline monooxygenase FMO - Sus scrofa An04g03460 phytase phyA - Aspergillus niger An04g03580 similarity to hypothetical protein BAA97223.1 - Arabidopsis thaliana An04g03620 similarity to 2-dehydro-3-deoxyphosphoheptonate aldolase - Arabidopsis thaliana An04g03650 hypothetical protein weak similarity to phosphatidic acid phosphatase ATPAP2 from patent WO200005385-A1 - An04g03870 Arabidopsis thaliana An04g04080 similarity to hypothetical negative acting factor related protein - Neurospora crassa An04g04230 hypothetical protein An04g04240 strong similarity to phosphate transport protein GvPT - Glomus versiforme strong similarity to hypothetical protein SPAC1486.02c - Schizosaccharomyces pombe [truncated An04g04800 ORF] strong similarity to undecaprenyl phosphate synthase Rer2 from patent WO200121650-A2 - An04g05250 Saccharomyces cerevisiae An04g05310 strong similarity to vacuolar H(+)-transporting ATPase subunit Vph1 - Saccharomyces cerevisiae An04g05740 similarity to arylamine N-acetyltransferase NAT1 - Homo sapiens An04g05820 similarity to transcription regulator Rfg1 - Candida albicans An04g05840 weak similarity to phospholipid-cholesterol acyltransferase - Aeromonas hydrophila

! 139 Sup. material Summary & Samenvatting & Supplementary material !

An04g05980 strong similarity to v-SNARE Vti1 - Saccharomyces cerevisiae An04g06310 strong similarity to hypothetical protein CAB91735.2 - Neurospora crassa An04g06760 hypothetical protein An04g06840 similarity to ATPase Drs2 - Saccharomyces cerevisiae An04g06960 strong similarity to NADPH-ferrihemoprotein reductase 1 CPR1 - Petroselinum crispum An04g06990 strong similarity to alpha 1,2-mannosidase IC - Homo sapiens An04g07000 hypothetical protein An04g07040 strong similarity to clathrin light chain Clc1 - Saccharomyces cerevisiae [putative frameshift] An04g07120 similarity to protein FRM2 involved in fatty acid regulation - Saccharomyces cerevisiae An04g07160 similarity to hypothetical protein MLD14.3 - Arabidopsis thaliana An04g07190 similarity to hypothetical transcription regulator protein - Schizosaccharomyces pombe An04g07240 similarity to maltose pathway regulatory protein Mal13 - Saccharomyces cerevisiae strong similarity to hypothetical peptidase 48 family protein SPAP14E8.04 - An04g07380 Schizosaccharomyces pombe [truncated ORF] An04g07430 similarity to hypothetical protein encoded by An07g09430 - Aspergillus niger strong similarity to translation initiation factor eIF-2 alpha chain kinase HRI - Oryctolagus An04g08580 cuniculus An04g08590 strong similarity to DNA photolyase phr1 - Trichoderma harzianum similarity to polynucleotide sequence SEQ ID NO:3913 from patent WO200058473-A2 - Homo An04g08690 sapiens An04g08820 strong similarity to glucosyltransferase Alg8 - Saccharomyces cerevisiae An04g08830 similarity to Golgi membrane protein Emp47 - Saccharomyces cerevisiae An04g09020 similarity to twinfilin A Twf1 - Saccharomyces cerevisiae An04g10140 hypothetical protein An05g00130 similarity to cell wall synthesis protein KRE9 - Candida albicans An05g00140 similarity to signal recognition particle receptor beta chain Srp102 - Saccharomyces cerevisiae An05g00200 strong similarity to ankyrin repeat-containing protein Akr1 - Saccharomyces cerevisiae An05g00880 strong similarity to dnaJ protein homolog Scj1 - Saccharomyces cerevisiae An05g01350 hypothetical protein strong similarity to hypothetical protein related to host-specific AK-toxin Akt2 B23L21.350 - An05g01890 Neurospora crassa An05g02360 strong similarity to hypothetical protein encoded by An18g01530 - Aspergillus niger An06g01100 strong similarity to mannosyltransferase Alg1 - Saccharomyces cerevisiae An06g01200 strong similarity to endosomal protein Emp70 - Saccharomyces cerevisiae An06g01630 strong similarity to hypothetical protein KIAA1134 - Homo sapiens An06g01720 strong similarity to Ariadne protein ari - Drosophila melanogaster An06g01810 strong similarity to protein PL6 - Homo sapiens

140 ! Summary & Samenvatting & Supplementary material Sup. material !

An07g01800 hypothetical protein An07g01970 strong similarity to cytoplasmic metalloproteinase mepB - Aspergillus fumigatus An07g02060 similarity to myo-inositol transporter 2 - Schizosaccharomyces pombe An07g02150 similarity to hypothetical AAA family ATPase Cj0377 - Campylobacter jejuni An07g02170 similarity to transport protein Bos1 - Saccharomyces cerevisiae An07g02250 strong similarity to hypothetical DNA methylase SPAC27D7.08c - Schizosaccharomyces pombe An07g02380 weak similarity to T-2 toxin biosynthesis protein TRI7 - Fusarium sporotrichioides An07g03050 similarity to hypothetical integral membrane protein SCC53.26c - Streptomyces coelicolor An07g03130 strong similarity to mitochondrial cation transporter Mmt1 - Saccharomyces cerevisiae An07g03200 strong similarity to adaptor complex AP-1 medium chain AP47 - Mus musculus An07g03380 similarity to UDP-glucose ceramide glucosyltransferase UGCG - Mus musculus An07g03410 similarity to hypothetical membrane protein YDL237w - Saccharomyces cerevisiae An07g03420 similarity to hypothetical protein SPAC17A5.16 - Schizosaccharomyces pombe An07g03440 similarity to hypothetical protein YHR045w - Saccharomyces cerevisiae An07g03680 strong similarity to repressor protein qutR - Aspergillus nidulans An07g03690 strong similarity to amino acid transporter ata2 - Homo sapiens An07g03760 strong similarity to 100 kDa coactivator snd1 - Homo sapiens An07g03880 serine proteinase pepC - Aspergillus niger An07g03880 serine proteinase pepC - Aspergillus niger strong similarity to dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48kD chain An07g04190 DDOST - Gallus gallus An07g04730 strong similarity to gene #6 associated peptide #4 from patent WO200107459-A1 - Homo sapiens An07g04880 weak similarity to translation initiation factor eIF-2 alpha chain kinase HCR - Rattus norvegicus An07g04940 strong similarity to alpha-1,6-mannosyltransferase Hoc1 - Saccharomyces cerevisiae An07g05520 strong similarity to O-methyltransferase B omtB - Aspergillus parasiticus An07g05620 strong similarity to transcription elongation factor Rtf1 - Saccharomyces cerevisiae An07g05620 strong similarity to transcription elongation factor Rtf1 - Saccharomyces cerevisiae An07g05670 strong similarity to hypothetical membrane protein YOR389w - Saccharomyces cerevisiae An07g06030 strong similarity to coatomer gamma subunit 2 copg2 - Homo sapiens An07g06150 strong similarity to lanosterol synthase erg7p - Schizosaccharomyces pombe An07g06190 similarity to hypothetical related to COP1-interacting protein CIP8 - Neurospora crassa An07g06230 hypothetical protein An07g06280 strong similarity to maleylacetoacetate isomerase maiA - Aspergillus nidulans An07g06430 strong similarity to glycoprotein glucosyltransferase gpt1p - Schizosaccharomyces pombe An07g06770 strong similarity to delta-6 desaturase - Mucor rouxii An07g06990 strong similarity to hypothetical protein SPCC594.04c - Schizosaccharomyces pombe

! 141 Sup. material Summary & Samenvatting & Supplementary material !

An07g07340 strong similarity to luminal ER-protein retention receptor ERD2 - Kluyveromyces marxianus An07g07500 strong similarity to ABC-type vacuolar membrane protein hmt1p - Schizosaccharomyces pombe An07g08220 strong similarity to clathrin associated epsin 2A - Homo sapiens An07g08350 strong similarity to hypothetical protein YPL067c - Saccharomyces cerevisiae An07g08510 hypothetical protein An07g08830 strong similarity to adaptor protein Yap180 - Saccharomyces cerevisiae An07g09170 strong similarity to breast cancer resistance protein 1 BCRP1 - Mus musculus An07g09350 strong similarity to hypothetical protein Rv0303 - Mycobacterium tuberculosis An07g09570 strong similarity to phosphatidate cytidylyltransferase Cds1 - Saccharomyces cerevisiae An07g09610 strong similarity to hypothetical protein B24H17.130 - Neurospora crassa An07g09650 similarity to chitin synthase III like Chs7 - Saccharomyces cerevisiae [truncated ORF] An07g09690 strong similarity to sterol C-24(28) reductase sts1p - Schizosaccharomyces pombe An07g09840 similarity to tetracyclin resistance protein tetA - Escherichia coli An07g10280 strong similarity to hypothetical protein B17C10.170 - Neurospora crassa An07g10350 protein O-mannosyl transferase pmtA - Aspergillus niger An07g10370 strong similarity to high-affinity glucose transporter HGT1 - Kluyveromyces lactis An07g10420 strong similarity to cell division cycle protein Cdc50 - Saccharomyces cerevisiae An08g00290 strong similarity to golgin-160 related protein Rud3 - Saccharomyces cerevisiae An08g00430 strong similarity to precursor of carboxypeptidase Kex1 - Saccharomyces cerevisiae strong similarity to phosphatidyl-N-methylethanolamine N-methyltransferase Opi3 - An08g00560 Saccharomyces cerevisiae An08g00750 strong similarity to hypothetical conserved protein SPBP35G2.02 - Schizosaccharomyces pombe An08g00810 similarity to tetracyclin resistance protein TetH - Pasteurella multocida An08g00900 strong similarity to hypothetical protein BAB22431.1 - Mus musculus [putative frameshift] An08g01030 strong similarity to vacuolar protein sorting protein Vps29 - Saccharomyces cerevisiae An08g01210 strong similarity to hypothetical 105-kDa kinase-like protein - Mus musculus An08g01250 weak similarity to COP1-interacting protein 7 CIP7 - Arabidopsis thaliana An08g01360 similarity to hypothetical protein G11A3.030 - Neurospora crassa An08g01410 strong similarity to ER-Golgi transport protein Sft2 - Saccharomyces cerevisiae An08g01440 similarity to hypothetical protein SCD19.11 - Streptomyces coelicolor An08g01480 strong similarity to tRNA ligase Trl1 - Saccharomyces cerevisiae An08g03000 strong similarity to H+-transporting ATPase chain C Vma5 - Saccharomyces cerevisiae An08g03270 strong similarity to beta-COP Sec26 - Saccharomyces cerevisiae An08g03570 similarity to slow myosin heavy chain MyHC3 - Coturnix Coturnix An08g03590 strong similarity to precursor of protein Emp24 - Saccharomyces cerevisiae An08g03640 strong similarity to HC-toxin efflux pump TOXA - Cochliobolus carbonum

142 ! Summary & Samenvatting & Supplementary material Sup. material !

strong similarity to hypothetical edoplasmic reticulum associated protein - Schizosaccharomyces An08g03960 pombe An08g03970 strong similarity to hypothetical protein CAE47902.1 - Aspergillus fumigatus An08g04000 strong similarity to hypothetical transcription factor CAE47904.1 - Aspergillus fumigatus An08g04120 similarity to hypothetical mold-specific protein MS8 - Ajellomyces capsulatus An08g04260 similarity to hypothetical protein YNL191w - Saccharomyces cerevisiae An08g04400 similarity to membrane protein Zrg17 - Saccharomyces cerevisiae An08g04430 similarity to cap-binding protein 4EHP - Homo sapiens An08g04450 similarity to hypothetical guanosine-diphosphatase - Schizosaccharomyces pombe An08g04870 similarity to beta transducin-like protein het-e1 - Podospora anserina An08g04990 strong similarity to carnitine acetyl transferase facC - Aspergillus nidulans An08g05570 similarity to secretory protein Sec5 - Saccharomyces cerevisiae strong similarity to hypothetical zinc-finger transcription factor CAD28447.1 - Aspergillus An08g06030 fumigatus An08g06200 similarity to mitochondrial import protein Metaxin - Homo sapiens An08g06250 strong similarity to benzoate 4-monooxygenase cytochrome P450 53 bphA - Aspergillus niger An08g06270 similarity to adenosine deaminase - Mus musculus An08g06330 strong similarity to epsilon-COP - Cricetulus griseus An08g06420 similarity to hypothetical protein SPBC405.03c - Schizosaccharomyces pombe An08g06750 strong similarity to regulator protein Rav1 - Saccharomyces cerevisiae An08g06780 strong similarity to transport protein Uso1 - Saccharomyces cerevisiae An08g07020 similarity to mannosyl transferase Alg9 - Saccharomyces cerevisiae An08g07090 similarity to protein Sim1 - Saccharomyces cerevisiae An08g07560 similarity to hypothetical protein CAD37151.1 - Aspergillus fumigatus An08g08020 similarity to bialaphos acetylhydrolase bah - Streptomyces hygroscopicus An08g08090 similarity to hypothetical protein CAD21290.1 - Neurospora crassa An08g09000 strong similarity to ubiquitin like protein Dsk2 - Saccharomyces cerevisiae An08g09430 similarity to notchless Nle - Drosophila melanogaster An08g09500 similarity to kinesin light chain - Loligo pealei An08g10570 strong similarity to hypothetical membrane protein YLR386w - Saccharomyces cerevisiae An08g10650 strong similarity to transport protein Sec24 - Saccharomyces cerevisiae An08g10730 similarity to hypothetical protein SPAC19B12.06c - Schizosaccharomyces pombe An08g10750 strong similarity to hypothetical protein SPBC3B8.06 - Schizosaccharomyces pombe An08g11120 weak similarity to protein PRO4400 from patent WO200073348-A2 - Homo sapiens An09g00580 similarity to hypothetical transcription activator SPAC139.03 - Schizosaccharomyces pombe An09g00620 similarity to estradiol 17-beta-dehydrogenase HSD17B1 - Rattus norvegicus An09g00630 strong similarity to hypothetical cipC - Aspergillus nidulans

! 143 Sup. material Summary & Samenvatting & Supplementary material !

An09g00650 similarity to hypothetical protein F9K20.18 - Arabidopsis thaliana strong similarity to glycosylphosphatidylinositol-anchored beta(1-3)glucanosyltransferase gel3 - An09g00670 Aspergillus fumigatus An09g01240 strong similarity to phospholipase B - Penicillium notatum An09g01710 similarity to epoxide hydrolase from patent EP879890-A - grobacterium radiobacter An09g02530 strong similarity to hypothetical protein EAA60542.1 - Aspergillus nidulans strong similarity to isobutene-forming enzyme and benzoate 4-hydroxylase P450rm - Rhodotorula An09g03210 minuta An09g04170 strong similarity to protein Sly1 - Saccharomyces cerevisiae An09g04580 strong similarity to palmitoyl-protein thioesterase - Rattus norvegicus An09g04660 strong similarity to meiotic mRNA stability protein kinase Ume5 - Saccharomyces cerevisiae An09g04680 similarity to hepatic glucose transport protein GLUT2 - Rattus norvegicus An09g04880 hypothetical protein An09g05420 similarity to signal peptidase subunit Spc3 - Saccharomyces cerevisiae strong similarity to COP-coated vesicle membrane protein P24 homolog lbrA - Polysphondylium An09g05490 pallidum An09g05600 similarity to hypothetical protein CAD11369.1 - Neurospora crassa An09g05880 strong similarity to alpha-glucosidase ModA - Dictyostelium discoideum An09g06130 similarity to hypothetical protein CAD21257.1 - Neurospora crassa An09g06260 similarity to mutanase mutA - Aspergillus oryzae strong similarity to immunogenic protein #11392 from patent WO200181581-A2 - An09g06340 Propionibacterium acnes An09g06510 strong similarity to human transmembrane from patent WO200056891-A2 - Homo sapiens An10g00340 similarity to PTH11 - Magnaporthe grisea An11g00010 similarity to antiviral GTPase Mx1 - Oncorhynchus mykiss An11g00220 similarity to ferric reductase cfl1 - Candida albicans similarity to protein participating in extracellular/cell surface phenomena Ecm33 - Saccharomyces An11g01190 cerevisiae An11g01240 similarity to filamentous growth protein Dfg5 - Saccharomyces cerevisiae An11g01260 weak similarity to hypothetical protein encoded by B1D4.080 - Neurospora crassa An11g01270 similarity to amino acid permease Mmp1 - Saccharomyces cerevisiae An11g01550 strong similarity to cytochrome P450 52A4 - Candida maltosa similarity to glucose-6-phosphate/phosphate-translocator GPT - Zea mays [putative sequencing An11g02020 error] An11g02090 strong similarity to hypothetical protein CAD70545.1 - Neurospora crassa An11g02220 similarity to hypothetical protein SPBC18H10.09 - Schizosaccharomyces pombe An11g02230 strong similarity to lanosterol 14 alpha-demethylase (P450(14DM)) CYP51 - Penicillium italicum

144 ! Summary & Samenvatting & Supplementary material Sup. material !

strong similarity to GTP:alpha-D-mannose-1-phosphate guanylyltransferase MPG1 - Hypocrea An11g02380 jecorina strong similarity to protein involved in vesicle transport in the secretory pathway YAL048c - An11g02760 Saccharomyces cerevisiae An11g02840 strong similarity to hypothetical protein SPAC637.13c - Schizosaccharomyces pombe An11g02990 strong similarity to astaxanthin synthetase from patent EP1035206 - Phaffia rhodozyma An11g03060 strong similarity to salicylate hydroxylase sal - Pseudomonas putida An11g03460 strong similarity to vegetative incompatibility factor het-e1 - Podospora anserina An11g03570 strong similarity to cytochrome P450 monooxygenase TRI4 - Fusarium sporotrichioides An11g03760 strong similarity to hypothetical protein BAC67939.1 - Streptomyces avermitilis An11g04180 dnaK-type molecular chaperone bipA - Aspergillus niger strong similarity to developmental regulator of asexual and sexual reproduction dopA - An11g04750 Aspergillus nidulans An11g04830 strong similarity to hypothetical protein EAA64933.1 - Aspergillus nidulans An11g04880 weak similarity to hypothetical novel nuclear protein NNP-1 var - Mus musculus An11g05110 similarity to death-associated protein kinase DAPK1 - Homo sapiens strong similarity to transposase of transposable element Tan1 - Aspergillus niger [putative An11g05300 pseudogene] An11g05330 strong similarity to diacylglycerol pyrophosphate phosphatase Dpp1 - Saccharomyces cerevisiae strong similarity to F-actin capping protein alpha-1 subunit CapZ - Mus musculus [truncated An11g05460 ORF] An11g05600 strong similarity to alcohol dehydrogenase alkJ - Pseudomonas oleovorans An11g05650 similarity to golgi peripheral membrane protein p65 GRASP65 - Rattus norvegicus An11g05680 similarity to cytochrome P450 3A13 - Mus musculus An11g05970 weak similarity to muramidase-2 - Enterococcus hirae An11g06040 similarity to choline kinase CK1 - Glycine max An11g06420 strong similarity to sequence 253 from patent WO0100804 - Corynebacterium glutamicum An11g06480 weak similarity to antigenic protein f86.aa from patent WO9859071 - Borrelia burgdorferi An11g06770 strong similarity to skin cell protein from patent WO9955865-A1 - Rattus sp. An11g06960 strong similarity to aminopeptidase II pepP - Escherichia coli An11g07530 similarity to protein Notchless - Drosophila melanogaster An11g07610 weak similarity to transcriptional activator Mut3 - Pichia angusta An11g07660 similarity to exo-1,3-beta-glucanase Xog - Candida ablicans An11g07720 hypothetical protein An11g07780 strong similarity to multidrug resistance-associated protein Mrp2 - Oryctolagus cuniculus An11g08010 similarity to hypothetical protein SPCC1281.02c - Schizosaccharomyces pombe An11g08020 strong similarity to G-11 integral membrane protein PTH11 - Magnaporthe grisea

! 145 Sup. material Summary & Samenvatting & Supplementary material !

strong similarity to hypothetical sterigmatocystin biosythesis monooxygenase stcW - Aspergillus An11g08030 nidulans An11g08080 strong similarity to cDNA O-methyltransferase mt-I - Aspergillus parasiticus An11g09430 weak similarity to hypothetical protein encoded by An03g01410 - Aspergillus niger An11g09890 strong similarity to mannosyltransferase 1 PMT1 - Candida albicans An11g10080 weak similarity to hypothetical protein CAE76369.1 - Neurospora crassa An11g10210 similarity to anaphase-promoting complex subunit APC5 - Homo sapiens An11g10330 strong similarity to hypothetical membrane protein YPR091c - Saccharomyces cerevisiae strong similarity to gene expression regulator An13 from patent WO200257456-A2 - Unclassified An11g10870 organism An11g10950 strong similarity to unc-50 related protein UNCL - Rattus norvegicus An11g11180 strong similarity to hypothetical protein encoded by SPBC1198.08 - Schizosaccharomyces pombe An11g11240 strong similarity to translation releasing factor RF-1 precursor MRF1 - Kluyveromyces lactis strong similarity to interferon-induced double-stranded RNA-activated protein kinase inhibitor An11g11250 P58 - Homo sapiens strong similarity to hypothetical oxysterol binding protein homologue Swh1 - Saccharomyces An12g00120 cerevisiae An12g00140 weak similarity to mucin-like protein Muc1 - Saccharomyces cerevisiae An12g00340 similarity to alpha 1,2-mannosidase IB - Homo sapiens An12g00580 weak similarity to heat shock protein dnaJ - Brucella ovis An12g00630 strong similarity to triacylglycerol lipase Tgl2 - Saccharomyces cerevisiae An12g00800 strong similarity to C2-domain family vesicle protein GLUT4 - Rattus norvegicus An12g00980 similarity to hypothetical protein encoded by An18g01730 - Aspergillus niger An12g01360 strong similarity to hypothetical cytochrome P450 protein 2E4.050 - Neurospora crassa An12g01640 weak similarity to mucin - Sus scrofa similarity to polypeptide SEQ ID NO 29028 from patent WO200171042-A2 - Drosophila An12g01650 melanogaster strong similarity to cytochrome P450 monooxygenase stcS - Aspergillus nidulans [putative An12g02080 frameshift] An12g02180 similarity to hypothetical protein encoded by An12g09970 - Aspergillus niger An12g02190 strong similarity to hypothetical protein encoded by An12g09960 - Aspergillus niger An12g02450 strong similarity to alpha-glucan synthase mok1p - Schizosaccharomyces pombe An12g03150 strong similarity to multidrug resistance protein atrD - Aspergillus nidulans An12g03500 weak similarity to hypothetical protein CAD71089.1 - Neurospora crassa An12g03580 strong similarity to microsomal glutathione S-transferase 3 MGST3 - Homo sapiens An12g03880 similarity to hypothetical protein SPCC4B3.12 - Schizosaccharomyces pombe An12g03980 strong similarity to hypothetical protein AAN52526.1 - Pichia angusta

146 ! Summary & Samenvatting & Supplementary material Sup. material !

An12g04050 similarity to hypothetical protein b1011 - Escherichia coli An12g04510 strong similarity to benzoate 4-monooxygenase cytochrome P450 53 bphA - Aspergillus niger An12g04830 strong similarity to coatomer protein zeta chain Ret3 - Saccharomyces cerevisiae An12g04880 hypothetical protein An12g05170 similarity to hypothetical protein AAM35689.1 - Xanthomonas axonopodis An12g05360 strong similarity to cholesterol 24-hydroxylase - Mus musculus similarity to protein fragment SEQ ID NO:6347 from patent EP1033405-A2 - Arabidopsis An12g07770 thaliana An12g07940 similarity to hypothetical protein Y48E1B.1 - Caenorhabditis elegans [truncated ORF] An12g08560 strong similarity to proteinase SlpE - Streptomyces lividans An12g08700 hypothetical protein An12g08750 similarity to hypothetical protein At2g21120 - Arabidopsis thaliana An12g08890 similarity to hypothetical protein EAA72664.1 - Gibberella zeae An12g09780 weak similarity to alkyl salicylate esterase salE - Acinetobacter sp. An12g10280 similarity to hypothetical protein 1A9.40 - Neurospora crassa weak similarity to hypothetical protein encoded by An02g14500 - Aspergillus niger [truncated An12g10330 ORF] An12g10380 strong similarity to chitin synthase C chsC - Aspergillus fumigatus An12g10830 similarity to hypothetical protein EAA74834.1 - Gibberella zeae An12g10840 hypothetical protein strong similarity to 1-acylglycerol-3-phosphate O-acyltransferase from patent WO200001713-A2 An13g00040 - Mortierella ramanniana An13g00110 strong similarity to 1-phosphatidylinositol 4-kinase Stt4 - Saccharomyces cerevisiae An13g00140 similarity to splicing factor YT521 - Rattus norvegicus An13g00300 strong similarity to hypothetical protein B14D6.440 - Neurospora crassa An13g00620 strong similarity to 80K protein H precursor G19P1 - Homo sapiens An13g00740 similarity to cyclopropane-fatty-acyl-phospholipid synthase - Escherichia coli An13g00780 strong similarity to hypothetical protein CAD21419.1 - Neurospora crassa An13g01280 strong similarity to hypothetical protein EAA64035.1 - Aspergillus nidulans An13g01300 strong similarity to gamma-glutamyl transpeptidase GGT1 - Homo sapiens An13g01960 strong similarity to alcohol dehydrogenase alkJ - Pseudomonas putida An13g02410 weak similarity to hypothetical cation transporter DRA0361 - Deinococcus radiodurans An13g02990 similarity to hypothetical protein EAA71271.1 - Gibberella zeae An13g04060 strong similarity to hypothetical protein encoded by An07g08820 - Aspergillus niger strong similarity to FLO11 gene expression regulator At14 from patent WO200257456-A2 - An13g04070 Unclassified organism An13g04080 strong similarity to cytochrome P450 monooxygenase P450II - Gibberella fujikuroi

! 147 Sup. material Summary & Samenvatting & Supplementary material !

An14g00150 similarity to hypothetical protein B24H17.110 - Neurospora crassa An14g00190 weak similarity to hypothetical protein At2g17590 - Arabidopsis thaliana An14g00210 similarity to Golgi membrane protein Yip1 - Saccharomyces cerevisiae An14g00270 weak similarity to dolichol-phosphate-mannose synthase DPM3 - Homo sapiens An14g00620 strong similarity to aminopeptidase from patent WO9628542-A1 - Aspergillus oryzae An14g00870 weak similarity to hypothetical protein K06A9.1a - Caenorhabditis elegans strong similarity to glycosylphosphatidylinositol anchor synthesis protein Mcd4 - Saccharomyces An14g00900 cerevisiae An14g01170 similarity to hypothetical protein B7F18.110 - Neurospora crassa An14g01180 similarity to hypothetical protein encoded by An02g08790 - Aspergillus niger An14g01440 strong similarity to succinate-semialdehyde dehydrogenase SSADH - Rattus norvegicus An14g01630 similarity to nitrosoguanidine resistance factor Sng1 - Saccharomyces cerevisiae strong similarity to hypothetical DEAD/DEAH-box RNA helicase SPAC694.02 - An14g01730 Schizosaccharomyces pombe An14g02200 strong similarity to EST an_2365 - Aspergillus niger An14g02280 similarity to hypothetical protein encoded by An02g01160 - Aspergillus niger An14g02990 similarity to hypothetical protein KIAA1715 - Homo sapiens An14g03360 strong similarity to choline-transport mutant SCT1 supressor protein - Saccharomyces cerevisiae An14g03910 strong similarity to alpha-1,2-mannosyltransferase kre2 - Candida albicans strong similarity to hypothetical protein SPAC1093.01 with conserved domain PF01535 duf17p - An14g04040 Schizosaccharomyces pombe strong similarity to hypothetical protein SPAC1093.01 with conserved domain PF01535 duf17p - An14g04040 Schizosaccharomyces pombe An14g04490 weak similarity to hypothetical protein AF1318 - Archaeoglobus fulgidus An14g04970 weak similarity to hypothetical zinc-finger protein SPAC19A8.10 - Schizosaccharomyces pombe An14g05100 strong similarity to hypothetical protein alr2987 - Nostoc sp. An14g05150 similarity to ubiquitin specific protease Ubp1 - Saccharomyces cerevisiae An14g05410 strong similarity to hypothetical protein CAD21189.1 - Neurospora crassa An14g05910 strong similarity to mannosyltransferase Alg2 - Saccharomyces cerevisiae An14g06060 strong similarity to alpha-1,2-mannosyltransferase Ttp1 - Saccharomyces cerevisiae An14g06440 strong similarity to protein of sequence 1 from patent WO0075305 - Candida albicans An14g06550 strong similarity to hypothetical membrane protein YNL011c - Saccharomyces cerevisiae An14g06610 strong similarity to GTP-binding protein GTPBP1 - Homo sapiens strong similarity to N-acetylglucosaminyl-phosphatidylinositol deacetylase PIGL - Rattus An14g06640 norvegicus An14g06830 strong similarity to hypothetical membrane protein Ptm1 - Saccharomyces cerevisiae An14g07030 strong similarity to p-nitrobenzyl esterase pnbA - Bacillus subtilis

148 ! Summary & Samenvatting & Supplementary material Sup. material !

An15g00520 strong similarity to hypothetical membrane protein YJR044c - Saccharomyces cerevisiae An15g00540 strong similarity to hypothetical protein B13O20.120 - Neurospora crassa An15g00630 strong similarity to sphingolipid metabolism Sur1 - Saccharomyces cerevisiae strong similarity to hypothetical protein GABA-A receptor epsilon subunit - Caenorhabditis An15g00640 elegans weak similarity to suppressor of telomeric repression-7 STR7 from patent WO9612811-A2 - An15g01300 Saccharomyces cerevisiae strong similarity to hypothetical cleft lip and palate transmembrane protein 1 CLPTM1 - Homo An15g01350 sapiens An15g01380 strong similarity to Synaptobrevin homolog v-SNARE Sec22 - Saccharomyces cerevisiae An15g01420 strong similarity to glucosidase I Cwh41 - Saccharomyces cerevisiae An15g01460 strong similarity to Cwh8 - Saccharomyces cerevisiae An15g01510 strong similarity to P-type ATPase Drs2 - Saccharomyces cerevisiae An15g01520 strong similarity to multidomain vesicle coat protein Sec16 - Saccharomyces cerevisiae strong similarity to signal peptide-containing protein SIGP from patent WO9933981-A2 - Homo An15g01680 sapiens An15g02310 hypothetical protein An15g02400 similarity to hypothetical protein CG11840 - Drosophila melanogaster An15g02680 strong similarity to tetracyclin resistance protein tetA - Escherichia coli strong similarity to protein involved in actin distribution and bipolar budding Rsv167 - An15g02760 Saccharomyces cerevisiae An15g02930 strong similarity to ABC transporter CDR4 - Candida albicans An15g02960 similarity to hypothetical protein CAD37071.1 - Neurospora crassa An15g04370 similarity to proline dipeptidase from patent JP11318454-A - Microbacterium esteraromaticum An15g04380 strong similarity to phenylacetate 2-hydroxylase phacA - Aspergillus nidulans An15g04490 strong similarity to myosin I myoA - Aspergillus nidulans similarity to protein fragment SEQ ID NO:49734 from patent EP1033405-A2 - Arabidopsis An15g04690 thaliana An15g05080 weak similarity to hypothetical protein CAD21084.1 - Neurospora crassa An15g05090 strong similarity to polyketide synthase FUM5 - Gibberella moniliformis An15g05120 similarity to alkaline ceramidase Ypc1 - Saccharomyces cerevisiae An15g05650 strong similarity to SR-protein-specific serine kinase SRPK2 - Homo sapiens An15g05840 similarity to hypothetical protein CAC28841.2 - Neurospora crassa An15g05960 weak similarity to hypothetical protein AAF54945.1 - Drosophila melanogaster strong similarity to aminonitrophenyl propanediol resistance protein Anp1 - Saccharomyces An15g06230 cerevisiae An15g06820 strong similarity to hypothetical protein SPAC3H5.09c - Schizosaccharomyces pombe An15g06890 hypothetical protein [truncated ORF]

! 149 Sup. material Summary & Samenvatting & Supplementary material !

An15g06890 hypothetical protein [truncated ORF] An15g06910 similarity to educed expression in colorectal cancer protein rec - Homo sapiens An15g07720 strong similarity to carboxyphosphonoenolpyruvate mutase - Streptomyces hygroscopicus An15g07730 strong similarity to 3-isopropylmalate dehydratase leu1 - Rhizopus niveus An16g00010 similarity to alcohol dehydrogenase orfB from patent WO9807867-A2 - Lactococcus lactis An16g01200 strong similarity to choline permease Hnm1 - Saccharomyces cerevisiae An16g01290 strong similarity to hypothetical protein encoded by An02g05930 - Aspergillus niger An16g01550 strong similarity to hypothetical protein B23I11.160 - Neurospora crassa strong similarity to hypothetical inorganic phosphate transporter and regulator of Pho81p Pho88 - An16g01820 Saccharomyces cerevisiae An16g01890 strong similarity to hypothetical protein encoded by An14g02280 - Aspergillus niger An16g02040 strong similarity to Cys2-His2 zinc finger transcription factor ACEI - Hypocrea jecorina An16g02460 strong similarity to alpha subunit of the coatomer complex Ret1 - Saccharomyces cerevisiae An16g02500 strong similarity to tryptophan synthase trpB - Aspergillus nidulans An16g03320 strong similarity to transport protein Sec24A - Homo sapiens An16g03450 similarity to hypothetical protein YNL051w - Saccharomyces cerevisiae similarity to n-acetylglucosaminyl-phosphatidylinositol biosynthetic protein gpi1p - An16g03530 Schizosaccharomyces pombe An16g04330 strong similarity to mannose phospho-dolichol synthase dpm1 - Hypocrea jecorina An16g04640 strong similarity to hypothetical protein SPCC1281.03c - Schizosaccharomyces pombe An16g05370 similarity to zinc-finger protein Glo3 - Saccharomyces cerevisiae An16g06350 strong similarity to delta(6)-desaturase - Mucor rouxii An16g06750 similarity to D-stereospecific aminopeptidase - Ochrobactrum anthropi An16g06890 weak similarity to fibrinogen-binding protein - Staphylococcus aureus An16g07180 strong similarity to vanillin dehydrogenase VDH from patent EP0845532 - Unclassified organism An16g07380 strong similarity to hypothetical cDNA MGC:7080 - Mus musculus strong similarity to endoplasmatic reticulum signal peptidase subunit Spc2 - Saccharomyces An16g07390 cerevisiae An16g07620 strong similarity to endoplasmatic reticulum oxidising protein Ero1 - Saccharomyces cerevisiae An16g07970 similarity to autocrine motility factor receptor Amfr - Mus musculus An16g08090 strong similarity to hypothetical protein B2J23.120 - Neurospora crassa An16g08140 similarity to salicylate hydroxylase sal - Pseudomonas putida An16g08180 similarity to palmitylated serine/threonine kinase PKL12 - Mus musculus [putative frameshift] An16g08420 similarity to hypothetical integral membrane protein SC10B7.28 - Streptomyces coelicolor An16g08470 similarity to hypothetical cell growth regulator OS-9 - Homo sapiens strong similarity to dolichyl-phosphate-D-mannose--protein O-mannosyltransferase Pmt4 - An16g08490 Saccharomyces cerevisiae

150 ! Summary & Samenvatting & Supplementary material Sup. material !

strong similarity to translation initiation factor 3 47 kDa subunit stt3p - Schizosaccharomyces An16g08570 pombe An16g08610 similarity to trichothecene 3-O-acetyltransferase TRI101 - Fusarium sporotrichioides strong similarity to component of ER protein-translocation subcomplex Sec71 from patent An16g08830 WO9949028-A1 - Saccharomyces cerevisiae An16g09150 strong similarity to hypothetical protein BM-021 - Homo sapiens An16g09180 strong similarity to low affinity zinc transport protein Zrt2 - Saccharomyces cerevisiae An16g09300 weak similarity to RING finger protein ReMembR-H2 - Arabidopsis thaliana An17g00090 weak similarity to translocation protein Sec72 - Saccharomyces cerevisiae An17g00390 strong similarity to aminopeptidase from patent WO9628542-A1 - Aspergillus oryzae weak similarity to dTDP-glucose 4,6-dehydratase protein_id CAB05932.1 - Streptococcus An17g00550 pneumoniae strong similarity to peripheral membrane protein required for vacuolar protein sorting Vps17 - An17g00560 Saccharomyces cerevisiae An17g01100 similarity to hypothetical protein SPAC637.04 - Schizosaccharomyces pombe An17g01170 strong similarity to hypothetical membrane protein YOR154w - Saccharomyces cerevisiae An17g01420 strong similarity to hypothetical transport protein SPCC830.08c - Schizosaccharomyces pombe An17g01440 strong similarity to peroxisomal membrane protein PEX3 - Pichia angusta An17g01550 strong similarity to Na+-H+ antiporter Nha2 - Saccharomyces cerevisiae An17g01560 strong similarity to sucrose transport protein SUT1 - Oryza sativa An17g01955 similarity to rhoGAP homolog DdRacGAP - Dictyostelium discoideum similarity to heptaprenyl diphosphate synthetase ORFII from patent EP699761-A2 - Bacillus An17g01965 stearothermophilus similarity to heptaprenyl diphosphate synthetase ORFII from patent EP699761-A2 - Bacillus An17g01965 stearothermophilus An17g02030 strong similarity to 2-acyltransferase from patent WO9413814-A - Zea mays An17g02180 similarity to hypothetical eIF-3 p110 subunit - Caenorhabditis elegans An17g02290 strong similarity to myosin Myo2 - Saccharomyces cerevisiae An17g02340 strong similarity to cytosolic serine--tRNA ligase Ses1 - Saccharomyces cerevisiae An18g00100 similarity to hypothetical protein PA1213 - Pseudomonas aeruginosa An18g00740 hypothetical protein An18g01290 strong similarity to hypothetical protein encoded by An13g01340 - Aspergillus niger An18g01320 strong similarity to extracellular protease precursor Bar1 - Saccharomyces cerevisiae An18g01690 strong similarity to hypothetical protein YOR155c - Saccharomyces cerevisiae An18g01840 similarity to zinc-cluster transcription factor fcr1 - Candida albicans An18g02020 disulfide isomerase tigA - Aspergillus niger An18g02150 similarity to hypothetical protein CAF05965.1 - Neurospora crassa

! 151 Sup. material Summary & Samenvatting & Supplementary material !

An18g02170 strong similarity to mannosyltransferase Ktr5 - Saccharomyces cerevisiae strong similarity to nitrate assimilation regulatory protein nirA - Aspergillus nidulans [truncated An18g02340 ORF] strong similarity to Dol-P-Man dependent alpha(1-3) mannosyltransferase Alg3 - Saccharomyces An18g02360 cerevisiae An18g02490 strong similarity to ARF guanine-nucleotide exchange factor 2 Gea2 - Saccharomyces cerevisiae An18g02600 hypothetical protein An18g02760 similarity to hypothetical protein T21J18.40 - Arabidopsis thaliana An18g02770 weak similarity to hypothetical protein encoded by An07g09090 - Aspergillus niger strong similarity to ORF2319 polynucleotide sequence SEQ ID NO:4637 from patent An18g03070 WO200058473-A2 - Homo sapiens An18g03200 strong similarity to actin like protein act2p - Schizosaccharomyces pombe An18g03280 similarity to hypothetical protein B13D24.040 - Neurospora crassa An18g03490 similarity to cation-dependent mannose 6-phosphate receptor precursor CD-MPR - Bos taurus An18g03580 similarity to hypothetical protein SPBC543.08 - Schizosaccharomyces pombe An18g03660 similarity to ser/thr protein kinase Prk1 - Saccharomyces cerevisiae An18g03920 strong similarity to defender against apoptotic cell death DAD1 - Homo sapiens An18g04240 strong similarity to Snf1 interacting protein Sip3 - Saccharomyces cerevisiae An18g04260 similarity to secreted protein HNTME13 from patent WO9839446-A2 - Homo sapiens An18g04670 similarity to UDP-N-acetylglucosamine transporter SLC35A3 - Homo sapiens An18g05220 strong similarity to gamma-butyrobetaine hydroxylase - Pseudomonas sp. An18g05470 similarity to C-3 sterol dehydrogenase Erg26 - Saccharomyces cerevisiae An18g05850 strong similarity to hypothetical protein SPAC30C2.08 - Schizosaccharomyces pombe An18g05890 similarity to pyruvate dehydrogenase phosphatase isoenzyme 1 PDP1 - Rattus norvegicus An18g05910 strong similarity to hypothetical glycosyl transferase SPCC330.08 - Schizosaccharomyces pombe An18g06120 strong similarity to secreted protein vc33_1 from patent WO200011015-A1 - Homo sapiens An18g06220 strong similarity to alpha-mannosidase Mns1 - Saccharomyces cerevisiae An18g06290 strong similarity to calcium P-type ATPase nca-1 - Neurospora crassa An18g06430 weak similarity to chorion gene s18 - Ceratitis capitata An18g06470 strong similarity to DnaJ-like protein MTJ1 - Mus musculus An18g06740 strong similarity to hypothetical protein YHR181w - Saccharomyces cerevisiae An19g00320 strong similarity to vacuolar H(+)/Ca(2+) exchanger Vcx1 - Saccharomyces cerevisiae An19g00330 strong similarity to vacuolar H(+)/Ca(2+) exchanger Vcx1 - Saccharomyces cerevisiae An19g00340 strong similarity to vacuolar H(+)/Ca(2+) exchanger Vcx1 - Saccharomyces cerevisiae An19g00360 similarity to hypothetical protein encoded by An08g05310 - Aspergillus niger

152 ! Summary & Samenvatting & Supplementary material Sup. material !

Table S1C. List of HacACA up-regulated genes that contain at least one UPRE sequence within a region of -400 bp from the start codon.

Fold change Gene Gene ID Description HacACA-1/ HacACA-2/ HacACA-3/ name HacAWT HacAWT HacAWT Protein folding An01g04600 prpA PDI related protein A – A. niger 4.6 4.3 4.3 An02g14800 pdiA protein disulfide isomerase – A. niger 2.8 3.1 3.1 An04g02020 cypB strong similarity to cyclophilin – A. nidulans 2.9 3.5 3.5 An11g04180 bipA dnaK-type molecular chaperone – A. niger 4.6 4.5 4.7 An18g02020 tigA disulfide isomerase – A. niger 3.2 3.2 3.3 strong similarity to endoplasmatic reticulum oxidising protein An16g07620 eroA 4.9 5.7 6.2 Ero1 – S. cerevisiae Lipid metabolism strong similarity to cyclopropane-fatty-acyl-phospholipid 2.2 1.9 1.9 An02g04530 synthase - E. coli 1.8 1.9 1.9 An02g05150 strong similarity to C-8,7 sterol isomerase – A. thaliana similarity to phosphoinositide-specific phospholipase C lc1p – S. 1.2* 1.6* 1.7 An02g11290 pombe 6.1 6.4 6.6 An02g13410 similar to acetyl-coenzyme A transporter AT-1 – H. sapiens weak similarity to dolichol-phosphate-mannose synthase DPM3 - 1.7 2.1 2.1 An14g00270 H. sapiens Transport (related) within the cell ERV46 (YAL042w) – involved in COPII vesicle fusion– S. An01g04320 ERV46 3.9 4.8 4.6 cerevisiae strong similarity to component of the ER protein translocation An02g01510 SEC62 1.9 2.4 2.5 machinery Sec62 – S. cerevisiae strong similarity to the p150 component of the COPII coat of An02g01690 SEC31 2.6 2.7 2.6 secretory pathway vesicles Sec31 – S. cerevisiae

An07g02170 BOS1 similarity to transport protein Bos1 – S. cerevisiae

strong similarity to coatomer gamma subunit 2 copg2 – H. An07g06030 2.3 2.0 2.0 sapiens

An08g05570 SEC5 similarity to secretory protein Sec5 – S. cerevisiae 1.6 1.9 2.0 Glycosylation An03g04410 ALG5 similar to glucosyltransferase ALG5 – S. cerevisiae 4.1 4.5 4.7 strong similarity to subunit of oligosacharyltransferase complex– An07g04190 WBP1 3.4 3.7 3.8 S. cerevisiae

! 153 Sup. material Summary & Samenvatting & Supplementary material !

ERAD strong similarity to ER membrane translocation facilitator Sec61 An03g04340 2.6 2.6 2.6 – Y. lipolytica 2.0 2.9 3.5 An04g06990 similarity to alpha 1,2-mannosidase IB – H. sapiens strong similarity to hypothetical protein GABA-A receptor An15g00640 derA 4.0 6.0 6.4 epsilon subunit – C. elegans Other 2.0 2.1 2.2 An01g02280 hypothetical protein strong similarity to calcium-binding protein precursor cnx1p – S. 2.8 3.0 3.1 An01g08420 pombe YMR155 strong similarity to hypothetical membrane protein YMR155w – 3.3 4.0 4.0 An02g02260 w S. cerevisiae 2.4 3.0 3.0 An02g12050 VMA21 similarity to V-ATPase assembly protein Vma21 – S. cerevisiae strong similarity to human transmembrane protein HTMPN-23 – 3.6 4.2 4.5 An02g14940 H. sapiens 1.6 1.6 1.7 An04g02050 similarity to hypoxia-induced protein – H. sapiens strong similarity to serine threonine protein kinase SNF1 – C. 1.5 1.5 1.6 An03g04720 carbonum similarity to hypothetical negative acting factor related protein – 1.8 2.3 2.5 An04g04080 N. crassa 1.9 1.8 1.8 An04g06310 strong similarity to hypothetical protein CAB91735.2 – N. crassa similarity to hypothetical protein encoded by An07g09430 – A. 2.4 4.0 4.4 An04g07430 niger strong similarity to hypothetical protein related to host-specific 1.5 1.6 1.9 An05g01890 AK-toxin Akt2 B23L21.350 – N. crassa strong similarity to hypothetical protein encoded by An18g01530 1.8 2.1 2.3 An05g02360 – A. niger 1.6 2.0 2.1 An07g03880 pepC serine proteinase pepC – A. niger strong similarity to breast cancer resistance protein 1 BCRP1 – 1.5 1.7 1.7 An07g09170 M. musculus similarity to hypothetical mold-specific protein MS8 – A. 1.8 2.3 2.4 An08g04120 capsulatus 2.7 2.7 2.9 An11g07530 similarity to protein Notchless – D. melanogaster strong similarity to alpha-glucan synthase mok1p - 1.8 1.7 1.8 An12g02450 Schizosaccharomyces pombe 2.1 2.9 3.1 An12g08700 hypothetical protein 1.5 1.9 2.0 An14g00190 weak similarity to hypothetical protein At2g17590 – A. thaliana 2.1 2.4 2.8 An16g09150 strong similarity to hypothetical protein BM-021 – H. sapiens

154 ! Summary & Samenvatting & Supplementary material Sup. material !

strong similarity to cytosolic serine--tRNA ligase Ses1 – S. 1.5 1.5 1.5 An17g02340 SES1 cerevisiae 1.4 1.4 1.6 An18g03660 PRK1 similarity to ser/thr protein kinase Prk1 – S. cerevisiae strong similarity to defender against apoptotic cell death DAD1 – 2.8 3.4 3.7 An18g03920 H. sapiens 6.8 8.0 8.5 An18g04260 similarity to secreted protein HNTME13 – H. sapiens 2.1 1.9 2.0 An18g06290 strong similarity to calcium P-type ATPase nca-1 – N. crassa *Not significantly differentially expressed

! 155 Sup. material Summary & Samenvatting & Supplementary material !

Table S2. GO analysis of biological processes enriched in the up-regulated set of genes in HacACA.

# genes # all GO term Description FDR Genes enriched enriched genes An02g07090,An02g05870,An12g04830,An01g14250,An15g01510,An07g06030,An GO:0006890 retrograde vesicle-mediated transport, Golgi to ER 1.89E-05 9 17 16g02460,An16g05370,An09g04170, posttranslational protein targeting to membrane, GO:0031204 2.01E-05 6 7 An02g01510,An03g04340,An01g11630,An16g08830,An01g13070,An11g04180, translocation GO:0006490 oligosaccharide-lipid intermediate assembly 2.01E-05 6 7 An02g12630,An18g05910,An04g08820,An14g05910,An18g02360,An06g01100, GO:0090114 COPII-coated vesicle budding 6.73E-05 6 8 An02g01690,An15g01520,An16g03320,An04g00360,An01g04040,An08g10650, GO:0007035 vacuolar acidification 1.56E-03 4 5 An04g05310,An02g02020,An17g01550,An08g06750, GO:0006493 protein amino acid O-linked glycosylation 1.56E-03 4 5 An07g10350,An16g08490,An11g09890,An14g03910, An08g09000,An18g06220,An05g00880,An03g06880,An02g05890,An04g01720,An GO:0030433 ER-associated protein catabolic process 3.67E-03 7 20 11g04180, SRP-dependent cotranslational protein targeting to GO:0006616 3.75E-03 4 6 An03g04340,An01g11630,An16g08830,An11g04180, membrane, translocation GO:0006986 response to unfolded protein 7.34E-03 6 17 An05g00880,An03g02770,An11g04180,An01g13220,An08g01480,An01g06550, An18g03660,An07g08830,An07g10420,An12g00120,An17g02290,An16g08470,An GO:0006897 endocytosis 9.90E-03 13 70 01g07330,An15g01510,An02g03460,An05g00200,An15g04490,An04g07040,An02 g07780, GO:0015786 UDP-glucose transport 1.19E-02 3 4 An03g06940,An11g02020,An18g04260, GO:0048199 vesicle targeting, to, from or within Golgi 2.39E-02 3 5 An15g01520,An01g04040,An16g05370, GO:0006751 glutathione catabolic process 2.39E-02 3 5 An08g04260,An11g11180,An13g01300, GO:0006901 vesicle coating 2.39E-02 3 5 An15g01520,An01g04040,An16g05370, GO:0006465 signal peptide processing 2.39E-02 3 5 An01g00560,An09g05420,An16g07390, An13g00110,An01g14140,An09g01240,An14g00900,An11g06770,An01g12990,An GO:0030384 phosphoinositide metabolic process 2.54E-02 7 29 04g02480, GO:0006895 Golgi to endosome transport 3.91E-02 4 11 An01g07330,An08g01410,An07g08220,An11g04750, GO:0051345 positive regulation of hydrolase activity 4.11E-02 3 6 An04g00360,An08g10570,An01g06550, An08g00560,An15g00630,An14g03360,An15g01460,An04g00600,An02g09910,An GO:0008610 lipid biosynthetic process 4.18E-02 15 104 07g09690,An11g06770,An09g00620,An01g07640,An01g14140,An14g00900,An01 g12990,An13g00040,An04g05250, !

156 ! Summary & Samenvatting & Supplementary material Sup. material !

Table S3. GO analysis of biological processes enriched in the down-regulated set of genes in HacACA.

# genes # all GO term Description FDR Genes enriched enriched genes GO:0006544 glycine metabolic process 6.39E-03 4 8 An08g03070,An08g04390,An15g03260,An14g01150, GO:0008645 hexose transport 6.39E-03 4 8 An02g14380,An02g03540,An11g01100,An16g04160, An09g00260,An11g01120,An02g03590,An16g04160,An11g108 GO:0006012 galactose metabolic process 6.39E-03 6 20 90,An02g11320, An04g02090,An07g04300,An08g02260,An11g02550,An02g143 GO:0006096 glycolysis 7.63E-03 6 21 80,An16g05420, An18g01170,An02g07930,An07g03980,An06g01660,An04g048 GO:0006979 response to oxidative stress 1.56E-02 14 110 70,An16g06100,An02g05830,An08g02310,An02g11320,An16g0 0920,An11g10890,An02g12140,An11g02040,An15g03220, GO:0005982 starch metabolic process 1.70E-02 4 11 An04g06920,An01g10930,An11g03340,An04g06910, GO:0046185 aldehyde catabolic process 1.70E-02 4 11 An01g07030,An08g07290,An10g00510,An17g01530, An11g01120,An10g00510,An17g01530,An11g03110,An01g069 GO:0006071 glycerol metabolic process 2.19E-02 5 19 70, propionate metabolic process, GO:0019679 2.25E-02 3 6 An04g05620,An16g07110,An15g01920, methylcitrate cycle An04g02090,An07g04300,An08g02260,An11g02550,An02g143 GO:0006094 gluconeogenesis 2.30E-02 6 28 80,An16g05420, An04g06920,An01g10930,An01g01540,An11g10990,An01g103 GO:0005984 disaccharide metabolic process 2.45E-02 5 20 50, An04g05620,An11g02550,An12g04640,An16g07110,An08g072 GO:0006083 acetate metabolic process 2.45E-02 5 20 90, GO:0006740 NADPH regeneration 2.86E-02 4 13 An16g05420,An11g02040,An02g12140,An08g07290, An12g00030,An07g02210,An15g05450,An01g06970,An02g121 GO:0019321 pentose metabolic process 3.17E-02 7 40 40,An04g05860,An11g02040, GO:0006567 threonine catabolic process 3.23E-02 3 7 An08g07290,An15g03260,An17g01530, An14g04400,An07g02160,An08g10530,An12g07850,An15g019 GO:0006099 tricarboxylic acid cycle 3.50E-02 5 22 20, GO:0015812 gamma-aminobutyric acid transport 4.47E-02 4 15 An02g09540,An16g02000,An14g01850,An03g00430, GO:0033609 oxalate metabolic process 4.51E-02 3 8 An07g08390,An10g00510,An17g01530,

! 157 Sup. material Summary & Samenvatting & Supplementary material !

Table S4. Expression values of selected genes related to enriched GO terms of ER associated processes.

Gene Fold change GO-term name: A. Gene ID Description HacACA-1/ HacACA-2/ HacACA-3/ HacACA-2/ HacACA-2/ HacACA-3/ Biological niger or S. HacAWT HacAWT HacAWT HacACA-1 HacACA-3 HacACA-1 Process cerevisiae Signal recognition particle strong similarity to signal recognition particle 68K protein An01g02800 1.4 1.3 1.3 -1.1 1.0 -1.1 * SRP68 – C. lupus similarity to 72-kD protein of the signal recognition An04g06890 1.5 1.2 1.2 -1.2 1.0 -1.1 * particle SRP72 – C. lupus strong similarity to signal recognition particle chain Sec65 An01g10070 SEC65 1.9 1.9 1.8 1.0 1.0 1.0 * – S. cerevisiae similarity to signal sequence receptor alpha chain – C. An15g06470 1.6 1.5 1.5 -1.1 -1.1 -1.1 * lupus familiaris An07g05800 similarity to signal recognition particle protein srp14 1.6 1.7 1.7 1.1 1.0 1.1 * similarity to signal recognition particle 54K protein SRP54 An09g06320 SRP54 1.2 1.2 1.1 -1.1 1.0 -1.1 * – S. cerevisiae Signal peptidase cleavage strong similarity to signal peptidase subunit Sec11 – S. An01g00560 SEC11 3.4 4.5 4.7 1.3 1.1 1.4 GO:0006465 cerevisiae strong similarity to signal peptidase subunit Spc2 – S. An16g07390 SPC2 3.2 4.0 4.6 1.2 1.2 1.5 GO:0006465 cerevisiae An09g05420 similarity to signal peptidase subunit Spc3 – S. cerevisiae 4.7 5.4 5.9 1.1 1.1 1.2 GO:0006465 SRP dependent translocation strong similarity to ER membrane translocation facilitator GO:0031204 An03g04340 2.6 2.6 2.6 1.0 1.0 1.0 Sec61 – Y. lipolytica GO:0006465 strong similarity to ER protein-translocation complex An01g03820 SBH2 1.9 2.3 2.3 1.2 1.0 1.2 * subunit Sbh2 – S. cerevisiae strong similarity to translocation complex component Sss1 GO:0031204 An01g11630 SSS1 2.6 2.9 3.0 1.1 1.0 1.1 – S. cerevisiae GO:0006465 strong similarity to component of the ER protein An02g01510 SEC62 1.9 2.4 2.5 1.2 1.0 1.3 GO:0031204 translocation machinery Sec62 – S. cerevisiae An01g13070 strong similarity to signal recognition particle receptor SEC63 3.9 5.0 5.3 1.3 1.1 1.3 GO:0031204 Sec63 – S. cerevisiae An16g08830 strong similarity to component of ER protein-translocation GO:0031204 SEC71 2.7 3.0 3.1 1.1 1.0 1.2 subcomplex Sec71 - S. cerevisiae GO:0006465 strong similarity to signal sequence receptor alpha subunit An15g01670 1.2 1.4 1.4 1.2 1.0 1.2 * SRP101 – Y. lipolytica Protein folding ER An04g02020 cypB strong similarity to cyclophilin cypB – A. nidulans 2.9 3.5 3.5 1.2 1.0 1.2 * GO:0031204 An11g04180 bipA dnaK-type molecular chaperone bipA – A. niger 4.6 4.5 4.7 1.0 1.1 1.0 GO:0030433 GO:0006465

158 ! Summary & Samenvatting & Supplementary material Sup. material !

GO:0006986 An02g14800 pdiA protein disulfide isomerase A pdiA – A. niger 2.8 3.1 3.1 1.1 1.0 1.1 * An18g02020 tigA disulfide isomerase tigA – A. niger 3.2 3.2 3.3 1.0 1.0 1.0 * An01g04600 prpA PDI related protein A prpA – A. niger 4.6 4.3 4.3 -1.1 1.0 -1.1 * An01g00160 hacA Hac1 b-zip transcription factor 1.1 1.4 1.4 1.3 1.0 1.3 * strong similarity to protein disulfide-isomerase pdi1 - C. An02g05890 epsA 1.7 1.7 1.7 1.0 1.0 1.0 GO:0030433 elegans strong similarity to endoplasmatic reticulum oxidising An16g07620 eroA 4.9 5.7 6.2 1.2 1.1 1.3 * protein Ero1 – S. cerevisiae UDP-Glc/Gal endoplasmic reticulum nucleotide sugar An18g04260 6.8 8.0 8.5 1.2 1.1 1.2 * transporter similarity to flavin adenine dinucleotide synthase Fad1 – S. An08g07810 1.4 1.0 1.1 -1.2 1.1 -1.2 * cerevisiae strong similarity to GTP-cyclohydrolase II RIB1 – P. An08g06370 1.1 1.1 1.1 1.0 1.0 1.0 * guilliermondii similarity to N-oxide-forming dimethylaniline An12g06490 1.1 1.0 1.0 0.9 1.0 -1.1 * monooxygenase FMO1 – H. sapiens An18g06470 strong similarity to DnaJ-like protein MTJ1 – M. musculus 2.8 2.9 3.1 1.0 1.1 1.1 * strong similarity to dnaJ protein homolog Scj1 – An05g00880 SCJ1 5.1 4.9 5.1 1.0 1.0 1.0 GO:0030433 Saccharomyces cerevisiae GO:0006986 An01g06670 CypB strong similarity to peptidyl-prolyl isomerase FKBP- 1.9 1.9 1.8 1.0 1.0 1.0 21 – N. crassa An01g13220 strong similarity to 150 kDa oxygen regulated protein LhsA 7.8 7.8 8.1 1.0 1.0 1.0 GO:0006986 ORP150 –R. norvegicus ER Quality Control An15g01420 CWH41 similar to glucosidase I CWH41 – S. cerevisiae 4.2 4.2 4.3 1.0 1.0 1.0 * An09g05880 ROT2 similar to alpha-glucosidase II ROT2 - S. cerevisiae 3.4 2.9 3.1 -1.1 1.0 -1.1 * similar to beta subunit of an ER alpha-glucosidase – S. An13g00620 3.2 3.1 3.4 1.0 1.1 1.0 * cerevisiae An07g06430 KRE5 similar to glucosyltransferase KRE5 – S. cerevisiae 4.5 4.0 4.0 -1.1 1.0 -1.1 * An18g06220 MNS1 similar to alpha-mannosidase MNS1 – S. cerevisiae 4.2 4.7 5.0 1.0 1.1 1.1 GO:0030433 An04g06990 strong similarity to alpha 1,2-mannosidase IC – H.sapiens 2.0 2.9 3.5 1.2 1.2 1.8 * An12g00340 HTM1 similar to mannosidase HTM1 – S. cerevisiae 3.2 2.9 3.1 -1.1 1.1 1.0 * ER-associated protein catabolic process An08g09000 strong similarity to ubiquitin like protein Dsk2 1.8 1.7 1.9 1.0 1.1 1.1 GO:0030433 An03g06880 PEP1 strong similarity to carboxypeptidase Y-sorting protein 2.4 2.4 2.6 1.0 1.1 1.1 GO:0030433 An04g01720 similarity to DnaJ protein SIS1 -Cryptococcus curvatus; 1.8 2.3 2.2 1.2 1.0 1.2 GO:0030433 Unfolded Protein Response An03g02770 phosphoesterase involved in downregulation of the UPR 1.4 1.4 1.6 1.0 1.1 1.1 GO:0006986 An08g01480 TRL1 strong similarity to tRNA ligase Trl1 –S. cerevisiae 1.7 2.1 2.2 1.2 1.1 1.3 GO:0006986 GO:0006986 An01g06550 IRE1 strong similarity to protein kinase Ire1 –S. cerevisiae 2.0 2.1 2.1 1.0 1.0 1.0 GO:0051345

! 159 Sup. material Summary & Samenvatting & Supplementary material !

Table S5. Expression values of selected genes related to enriched GO terms associated with vesicle transport within the cell.

Gene Fold change GO-term name: A. Gene ID Description HacACA-1/ HacACA-2/ HacACA-3/ HacACA-2/ HacACA-2/ HacACA-3/ Biological niger or S. HacAWT HacAWT HacAWT HacACA-1 HacACA-3 HacACA-1 Process cerevisiae Golgi to ER retrograde transport (COPI) strong similarity to ASNA1 product arsenite translocating GO:0006890! An02g07090 1.6 1.7 1.6 1.0 1.0 1.0 ATPase - Homo sapiens strong similarity to coatomer protein zeta chain Ret3 - GO:0006890! An12g04830 RET3 1.8 2.3 2.3 1.2 1.0 1.2 Saccharomyces cerevisiae strong similarity to coatomer beta subunit copB2 - Homo GO:0006890! An02g05870 1.9 1.5 1.5 -1.2 1.0 -1.2 sapiens [putative frameshift] strong similarity to delta subunit of the coatomer delta-coat GO:0006890! An01g14250 1.8 2.0 2.0 1.1 1.0 1.1 protein CopD - Bos taurus strong similarity to P-type ATPase Drs2 - Saccharomyces GO:0006890! An15g01510 DRS2 2.1 1.8 1.9 -1.1 1.0 -1.1 cerevisiae strong similarity to coatomer gamma subunit 2 copg2 - GO:0006890! An07g06030 2.3 2.0 2.0 -1.1 1.0 -1.1 Homo sapiens GO:0006890 similarity to zinc-finger protein Glo3 - Saccharomyces An16g05370 GLO3 2.3 2.4 2.5 1.0 1.0 1.1 GO:0006901 cerevisiae GO:0048199 strong similarity to protein Sly1 - Saccharomyces An09g04170 SLY1 2.6 3.0 3.0 1.2 1.0 1.2 GO:0006890 cerevisiae weak similarity to COPI-interacting protein 7 CIP7 - An08g01250 2.2 1.9 2.0 -1.1 1.0 -1.1 * Arabidopsis thaliana An08g06330 strong similarity to epsilon-COP - Cricetulus griseus 2.0 2.1 2.2 1.1 1.0 1.1 * strong similarity to ADP-ribosylation factor. GTPase of the An08g03690 SRF2 1.2 1.4 1.4 1.1 1.1 1.2 * Rassuperfamily. Arf2p - Saccharomyces cerevisae COPII ER to Golgi strong similarity to the p150 component of the COPII coat An02g01690 SEC31 of secretory pathway vesicles Sec31 - Saccharomyces 2.6 2.7 2.6 1.0 1.0 1.0 GO:0090114! cerevisiae GO:0090114 An15g01520 SEC16 vesicle coat protein Sec16 - Saccharomyces cerevisiae 2.6 2.4 2.4 -1.1 1.0 -1.1 GO:0006901 GO:0048199 strong similarity to transport protein Sec24A - An16g03320 SEC24 3.0 2.5 2.6 -1.2 1.0 -1.1 GO:0090114! Saccharomyces cerevisiae strong similarity to transport vesicle formation protein An04g00360 SEC13 2.1 2.1 2.1 1.0 1.0 1.0 GO:0090114! Sec13p - Saccharomyces cerevisiae GO:0090114 SARA strong similarity to GTPase. GTP-binding protein An01g04040 SAR1p 1.4 1.5 1.5 1.1 1.0 1.1 GO:0006901 of the ARF family - Saccharomyces cerevisae GO:0048199 An08g10650 SEC24 strong similarity to transport protein Sec24p - 2.7 2.2 2.3 -1.2 1.0 -1.1 GO:0090114

160 ! Summary & Samenvatting & Supplementary material Sup. material !

Saccharomyces cerevisiae strong similarity to beta-COP Sec26p - Saccharomyces An08g03270 SEC26 1.9 2.1 2.0 1.1 1.0 1.1 * cerevisiae SEC23 (YPR181c) – COPII complex SU GTPase- *! An01g04730 SEC23 1.8 1.7 1.7 -1.1 1.1 1.0 activating protein *! An08g03590 EMP24 EMP24 (YGL200c) – COPII vesicle membrane component 2.7 3.1 3.1 1.2 1.0 1.2 *! An04g01780 ERP1 ERP1 (YAR002c-a) – COPII vesicle component 2.9 3.5 3.7 1.2 1.1 1.3 *! An09g05490 ERP3 ERP3 (YDL018c) – p24 family protein 2.3 2.8 3.0 1.2 1.1 1.3 * An04g08830 EMP47 EMP47 (YFL048c) – COPII vesicle membrane component 2.9 3.0 3.1 1.0 1.0 1.1 ! *! An08g03960 ERV29 ERV29 (YGR284c) – glycoprotein cargo receptor 2.8 3.5 3.4 1.2 1.0 1.2 *! An02g04250 similarity to protein p58 - Rattus norvegicus 3.5 4.2 4.3 1.2 1.0 1.2 *! An03g04940 ERV41 ERV41 (YML067c) – involved in COPII vesicle fusion 4.8 4.6 4.9 1.0 1.1 1.0 * An01g04320 ERV46 ERV46 (YAL042w) – involved in COPII vesicle fusion 3.9 4.8 4.6 1.2 1.0 1.2 !

Golgi to endosome transport similarity to brefeldin A-inhibited guanine nucleotide- 2.0 1.8 1.9 -1.1 1.1 1.0 An01g07330 GO:0006895 exchange protein 2 - Homo sapiens strong similarity to ER-Golgi transport protein Sft2 - 2.0 2.5 2.6 1.2 1.1 1.3 GO:0006895! An08g01410 SFT2 Saccharomyces cerevisiae strong similarity to clathrin associated epsin 2A - Homo 1.7 1.5 1.4 -1.1 1.0 -1.2 GO:0006895! An07g08220 sapiens strong similarity to developmental regulator of asexual and 2.2 2.2 2.3 1.0 1.0 1.1 GO:0006895! An11g04750 dopA sexual reproduction dopA - Aspergillus strong similarity to clathrin associated epsin 2A - Homo 1.7 1.5 1.4 -1.1 1.0 -1.2 An07g08220 * sapiens similarity to multicopy suppressor Sys1 - Saccharomyces 1.3 1.8 1.8 1.3 1.0 1.4 An16g03420 SYS1 * cerevisiae Endocytosis similarity to ser/thr protein kinase Prk1 - Saccharomyces 1.4 1.4 1.6 1.0 1.1 1.1 An18g03660 PRK1 GO:0006897 cerevisiae strong similarity to adaptor protein Yap180 - 1.5 1.7 1.7 1.1 1.0 1.1 GO:0006897! An07g08830 YAP180 Saccharomyces cerevisiae strong similarity to cell division cycle protein Cdc50 - 1.5 1.7 1.9 1.1 1.1 1.2 GO:0006897 An07g10420 CDC50 ! Saccharomyces cerevisiae strong similarity to hypothetical oxysterol binding protein 1.5 1.5 1.6 1.0 1.0 1.0 GO:0006897! An12g00120 SWH1 homologue Swh1 - Saccharomyces cerevisiae

! 161 Sup. material Summary & Samenvatting & Supplementary material !

strong similarity to myosin Myo2 -Saccharomyces 1.7 1.9 2.0 1.1 1.0 1.2 GO:0006897! An17g02290 MYO2 cerevisiae similarity to hypothetical cell growth regulator OS-9 - 5.2 5.4 5.7 1.0 1.1 1.1 GO:0006897! An16g08470 Homo sapiens similarity to brefeldin A-inhibited guanine nucleotide- 2.0 1.8 1.9 -1.1 1.1 1.0 GO:0006897 An01g07330 ! exchange protein 2 - Homo sapiens strong similarity to P-type ATPase Drs2 -Saccharomyces 2.1 1.8 1.9 -1.1 1.0 -1.1 GO:0006897! An15g01510 DRS2 cerevisiae (BAR) domain of Saccharomyces cerevisiae Golgi vesicle 2.1 2.4 2.6 1.2 1.1 1.2 GO:0006897! An02g03460 protein of 36 kDa and similar proteins strong similarity to ankyrin repeat-containing protein Akr1 2.4 2.3 2.3 1.0 1.0 1.0 GO:0006897! An05g00200 ARK1 - Saccharomyces cerevisiae 1.7 1.6 1.6 -1.1 1.0 -1.1 GO:0006897! An15g04490 myoA strong similarity to myosin I myoA -Aspergillus nidulans strong similarity to clathrin light chain Clc1 - 1.6 1.7 1.7 1.1 1.0 1.1 GO:0006897! An04g07040 CLC1 Saccharomyces cerevisiae strong similarity to ADP-ribosylation factor 6 ARF6 - 1.6 1.8 1.9 1.2 1.0 1.2 GO:0006897! An02g07780 ARF6 Saccharomyces cerevisiae

162 ! Summary & Samenvatting & Supplementary material Sup. material !

Table S6. Expression values of selected genes related to enriched GO terms associated with glycosylation processes.

Gene Fold change GO-term name: A. Gene ID Description HacACA-1/ HacACA-2/ HacACA-3/ HacACA-2/ HacACA-2/ HacACA-3/ Biological niger or S. HacAWT HacAWT HacAWT HacACA-1 HacACA-3 HacACA-1 Process cerevisiae Oligosaccharide-lipid intermediate assembly strong similarity to glucosyltransferase ALG6 - An02g12630 ALG6 2.9 2.8 2.9 1.0 1.0 1.0 GO:0006490 Saccharomyces cerevisiae strong similarity to probable glycosyl transferase An18g05910 6.7 6.9 7.3 1.0 1.1 1.1 GO:0006490 SPCC330.08 - Schizosaccharomyces pombe strong similarity to glucosyltransferase ALG8 - An04g08820 ALG8 2.8 2.5 2.4 -1.1 1.0 -1.1 GO:0006490 Saccharomyces cerevisiae similar to mannosyltransferase ALG2 - Saccharomyces An14g05910 ALG2 4.3 5.1 5.4 1.2 1.1 1.3 GO:0006490 cerevisiae similar to mannosyltransferase ALG3 - Saccharomyces An18g02360 ALG3 3.8 4.6 4.7 1.2 1.0 1.2 GO:0006490 cerevisiae strong similarity to mannosyltransferase mntA - An06g01100 2.3 2.5 2.5 1.1 1.0 1.1 GO:0006490 Dictyostelium discoideum mannose phospho-dolichol synthase DPMA- An16g04330 DPM1 2.8 3.5 3.6 1.3 1.0 1.3 * Saccharomyces cerevisiae strong similarity to dolichyl-phosphate An01g05200 DPM2 2.0 3.1 3.3 1.6 1.0 1.7 * mannosyltransferase DPM2 weak similarity to dolichol-phosphate-mannose An14g00270 1.7 2.1 2.1 1.3 1.0 1.3 * synthase DPM3 - Homo sapiens similar to glucosyltransferase ALG5 - Saccharomyces An03g04410 ALG5 4.1 4.5 4.7 1.1 1.0 1.1 * cerevisiae similar to N-acetylglucosaminephosphotransferase ALG7- An02g03240 ALG7 5.7 7.5 7.9 1.3 1.1 1.4 * Saccharomyces cerevisiae An02g14940 RFT1 similar to flippase RFT1 - Saccharomyces cerevisiae 3.6 4.2 4.5 1.2 1.1 1.2 * similarity to mannosyl transferase ALG9 - An08g07020 ALG9 2.6 2.4 2.5 -1.1 1.0 1.0 * Saccharomyces cerevisiae strong similarity to dolichol kinase Sec59 - An04g03960 SEC59 1.5 1.3 1.3 -1.1 1.0 -1.1 * Saccharomyces cerevisiae An04g03130 strong similarity to putative flipping of Dol-P-Man/Glc 1.3 1.5 1.6 1.2 1.0 1.2 * strong similarity to mannosyltransferase ALG12 - An01g08460 ALG12 3.0 2.5 2.6 -1.2 1.0 -1.1 GO:0000009 Saccharomyces cerevisiae strong similarity to glucosyltransferase ALG10 - An02g02980 ALG10 2.8 2.7 2.4 1.0 -1.1 -1.1 * Saccharomyces cerevisiae Oligosaccharyl transferase complex strong similarity to subunit of oligosacharyltransferase 3.6 3.6 3.7 1.0 1.0 1.0 An02g14560 OST1 * complex strong similarity to subunit of oligosacharyltransferase 3.4 3.7 3.8 1.1 1.0 1.1 An07g04190 WBP1 * complex

! 163 Sup. material Summary & Samenvatting & Supplementary material !

strong similarity to subunit of oligosacharyltransferase 2.8 3.4 3.7 1.2 1.1 1.3 An18g03920 OST2 * complex strong similarity to subunit of oligosacharyltransferase 2.7 3.0 3.2 1.1 1.0 1.2 An02g14930 OST3 * complex strong similarity to subunit of oligosacharyltransferase 3.3 3.3 3.5 1.0 1.1 1.1 An16g08570 SST2 * complex strong similarity to subunit of oligosacharyltransferase An08g07485** * complex UDP-glucose transport similarity to UPD-GlcNAc transporter Golgi!MNN2-2 - 2.3 2.7 2.7 1.2 1.0 1.2 An03g06940 GO:0015786 Kluyveromyces lactis similarity to glucose-6-phosphate/phosphate-translocator 1.8 1.8 1.9 1.0 1.0 1.1 An11g02020 GO:0015786 GPT - Zea mays 6.8 8.0 8.5 1.2 1.1 1.2 An18g04260 similarities to some probable UDP-galactose transporters GO:0015786 1.4 1.5 1.4 1.0 1.0 1.0 An08g10400 strong similarity to UDP-Gal transporter * 1.3 1.4 1.4 1.1 1.0 1.1 An17g02140 strong similarity to GDP-Man transporter * 1.8 1.8 1.9 1.0 1.0 1.1 An11g02020 strong similarity to GDP-Man transporter * Protein amino acid O-linked glycosylation 2.3 2.5 2.6 1.1 1.0 1.1 An07g10350 pmtA protein O-mannosyl transferase pmtA - Aspergillus niger GO:0006493 strong similarity to dolichyl-phosphate-D-mannose-- 2.1 1.9 2.0 -1.1 1.1 1.0 An16g08490 PMT4 protein O-mannosyltransferase Pmt4 - Saccharomyces GO:0006493 cerevisiae strong similarity to mannosyltransferase 1 PMT1 - 3.1 3.0 2.9 1.0 1.0 -1.1 An11g09890 GO:0006493 Candida albicans strong similarity to alpha-1,2-mannosyltransferase kre2 - 2.1 2.3 2.5 1.1 1.1 1.2 An14g03910 GO:0006493 Candida albicans GPI anchor biosynthesis Protein involved in the synthesis of GlcNAc-PI. the first 1.7 1.9 1.9 1.1 1.0 1.1 An16g03530 GPI1 * intermediate in the synthesis of (GPI) anchors Protein involved in the synthesis of GlcNAc-PI. the first 1.5 1.6 1.5 1.0 1.0 1.0 An02g13570 GPI2 * intermediate in the synthesis of (GPI) anchors Protein involved in the synthesis of GlcNAc-PI. the first 1.1 1.3 1.3 1.2 1.0 1.2 An01g09910 GPI3 * intermediate in the synthesis of (GPI) anchors Protein involved in the synthesis of GlcNAc-PI. the first 1.1 1.0 1.1 1.0 1.0 1.0 An02g09230 GPI15 * intermediate in the synthesis of (GPI) anchors Protein involved in the synthesis of GlcNAc-PI. the first 1.4 1.3 1.3 -1.1 1.0 1.0 An16g01530 GPI19 * intermediate in the synthesis of (GPI) anchors ER membrane protein involved in the second step of 1.7 1.7 1.6 1.0 1.0 1.0 An14g06640 GPI12 * glycosylphosphatidylinositol (GPI) anchor assembly. the

164 ! Summary & Samenvatting & Supplementary material Sup. material !

de-N-acetylation of the N- acetylglucosaminylphosphatidylinositol intermediate; Protein involved in the inositol acylation of glucosaminyl phosphatidylinositol (GlcN-PI) to form 2.7 3.0 3.4 1.1 1.1 1.3 An01g12990 GWT1 glucosaminyl(acyl)phosphatidylinositol (GlcN(acyl)PI). * an intermediate in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. third step Glycosylphosphatidylinositol-alpha 1.4 1.4 1.4 1.5 1.0 1.1 1.1 An12g01880 GPI14 mannosyltransferase I. involved in GPI anchor * biosynthesis. requires Pbn1p for function. forth step Essential component of glycosylphosphatidylinositol- 1.0 -1.1 -1.1 1.0 1.0 1.0 An17g00780 PBN1 * mannosyltransferase I. Protein involved in glycosylphosphatidylinositol (GPI) 2.1 1.9 1.9 -1.1 1.0 -1.1 An14g00900 MCD4 anchor synthesis; multimembrane-spanning protein that * localizes to the endoplasmic reticulum; step 5 mannosyltransferase that transfers the second mannose in 1.4 1.3 1.3 -1.1 1.0 1.0 An16g01530 GPI18 * glycosylphosphatidylinositol biosynthesis. step 6 Integral membrane protein involved in glycosylphosphatidylinositol (GPI) anchor synthesis; 1.5 1.3 1.3 -1.1 1.0 -1.1 An04g04110 GPI10 putative alpha 1.2 mannosyltransferase required for * addition of the third mannose onto the GPI core structure. step 7 ER membrane protein involved in a late step of glycosylphosphatidylinositol (GPI) anchor assembly; 1.3 1.1 1.1 -1.1 1.0 -1.2 An10g00480 GPI11 * involved in the addition of phosphoethanolamine to the multiply mannosylated GPI intermediat. step 9 ER membrane localized phosphoryltransferase that adds phosphoethanolamine onto the third mannose residue of 1.2 -1.1 -1.1 -1.4 1.0 -1.2 An09g02800 GPI13 * the glycosylphosphatidylinositol (GPI) anchor precursor. step 9 ER membrane localized phosphoryltransferase that adds phosphoethanolamine onto the third mannose residue of 1.0 1.1 1.0 1.0 -1.1 -1.1 An04g05100 GPI13 * the glycosylphosphatidylinositol (GPI) anchor precursor. step 9 Subunit of the GPI (glycosylphosphatidylinositol):protein 1.4 1.0 1.0 -1.4 1.0 -1.4 An08g10720 GAA1 * transamidase complex Subunit of the GPI (glycosylphosphatidylinositol):protein 3.0 3.3 3.5 1.1 1.1 1.2 An04g02650 GAB1 * transamidase complex Subunit of the GPI (glycosylphosphatidylinositol):protein 2.4 2.2 2.3 -1.1 1.1 1.0 An11g06770 GPI16 * transamidase complex Subunit of the GPI (glycosylphosphatidylinositol):protein 1.1 1.1 1.2 1.0 1.0 1.0 An07g09270 GPI17 * transamidase complex Subunit of the GPI (glycosylphosphatidylinositol):protein 1.5 1.6 1.6 1.0 1.0 1.1 An01g13530 GPI8 * transamidase complex

! 165 Sup. material Summary & Samenvatting & Supplementary material !

Integral plasma membrane protein involved in the 1.6 1.6 1.6 1.0 1.0 1.0 An15g00030 ScLas21 synthesis of the glycosylphosphatidylinositol (GPI) core * structure; mutations affect cell wall integrity

166 ! Summary & Samenvatting & Supplementary material Sup. material !

Table S7. Expression values of selected genes related to enriched GO terms associated with lipid metabolic processes.

Gene Fold change GO-term name: A. Gene ID Description HacACA-1/ HacACA-2/ HacACA-3/ HacACA-2/ HacACA-2/ HacACA-3/ Biological niger or S. HacAWT HacAWT HacAWT HacACA-1 HacACA-3 HacACA-1 Process cerevisiae Lipid metabolism strong similarity to phosphatidyl-N-methylethanolamine N- 1.7 2.0 1.8 1.2 -1.1 1.1 An08g00560 GO:0008610 methyltransferase Opi3 strong similarity to sphingolipid metabolism Sur1 - 1.9 2.0 2.1 1.0 1.1 1.1 An15g00630 SUR1 GO:0008610 Saccharomyces cerevisiae strong similarity to choline-transport mutant SCT1 1.7 1.7 1.7 1.0 1.0 1.0 An14g03360 GO:0008610 supressor protein 2.5 3.1 3.3 1.2 1.1 1.4 An15g01460 CWH8 strong similarity to Cwh8 - Saccharomyces cerevisiae GO:0008610 strong similarity to hypothetical ER-to-Golgi transporter 2.1 2.4 2.4 1.2 1.0 1.2 An04g00600 LAG1 GO:0008610 Lag1 - Saccharomyces cerevisiae strong similarity to sterol C-24(28) reductase sts1p - 1.7 1.8 1.7 1.0 1.0 1.0 An07g09690 GO:0008610 Schizosaccharomyces pombe similarity to estradiol 17-beta-dehydrogenase HSD17B1 - 2.8 4.2 4.1 1.5 1.0 1.5 An09g00620 GO:0008610 Rattus norvegicus strong similarity to fatty acid elongase Fen1 - 1.7 1.6 1.6 -1.1 1.0 1.0 An02g09910 FEN1 GO:0008610 Saccharomyces cerevisiae strong similarity to undecaprenyl phosphate synthase Rer2 3.1 3.9 4.2 1.3 1.1 1.3 An04g05250 RER2 from patent WO200121650-A2 - Saccharomyces GO:0008610 cerevisiae 2.2 2.8 2.8 1.3 1.0 1.3 An13g00040 1-acylglycerol-3-phosphate O-acyltransferase GO:0008610 conserved hypothetical protein similar to alkaline 2.1 2.4 2.5 1.1 1.0 1.2 An01g07640 GO:0008610 phytoceramidase strong similarity to CDPdiacylglycerol--inositol 3- 2.4 3.2 3.2 1.3 1.0 1.4 An01g14140 GO:0008610 phosphatidyltransferase strong similarity to glycosylphosphatidylinositol anchor 2.1 1.9 1.9 -1.1 1.0 -1.1 An14g00900 MCD4 GO:0008610 synthesis protein Mcd4 - Saccharomyces cerevisiae 2.7 3.0 3.4 1.1 1.1 1.3 An01g12990 GWT1 GPI anchor biosynthesis protein Gwt1 GO:0008610 similar to acetyl-coenzyme A transporter AT-1 - Homo 6.1 6.4 6.6 1.0 1.0 1.1 An02g13410 * sapiens strong similarity to carnitine acetyl transferase FacC - 2.7 2.5 2.5 -1.1 1.0 -1.1 An08g04990 * Emericella nidulans strong similarity fatty acid desaturase from patent 3.1 3.1 3.3 1.0 1.1 1.1 An04g01320 * WO9846764-A1 - Homo sapiens strong similarity to alkaline ceramidase Ypc1p - 6.1 10.5 11.4 1.7 1.1 1.9 An01g06800 YPC1 * Saccharomyces cerevisiae

! 167 Sup. material Summary & Samenvatting & Supplementary material !

3.3 4.5 5.2 1.4 1.1 1.6 An16g06350 strong similarity to delta(6)-desaturase - Mucor rouxii * strong similarity to methyl sterol oxidase ERG25 - 4.2 6.4 7.3 1.5 1.1 1.7 An03g06410 ERG25 * Saccharomyces cerevisiae strong similarity to cytochrome P450 erg5 - 1.5 1.6 1.7 1.1 1.0 1.1 An11g03230 ERG5 * Saccharomyces cerevisiae weak similarity to insulin induced protein 1 INSIG1 - 1.6 1.6 1.7 1.0 1.1 1.1 An04g02050 * Homo sapiens strong similarity to putative lipase Cvt17p - 1.8 2.0 2.1 1.1 1.1 1.2 An03g02820 CVT17 * Saccharomyces cerevisiae strong similarity to sterol transmethylase ERG6 - Candida 1.4 1.4 1.4 1.0 1.0 1.0 An14g01590 * albicans similarity to palmitylated serine/threonine kinase PKL12 - 1.8 1.9 2.1 1.0 1.1 1.1 An16g08180 * Mus musculus similarity to protein FRM2 involved in fatty acid regulation 1.7 1.8 1.8 1.1 1.0 1.1 An04g07120 FRM2 * - Saccharomyces cerevisiae 1.8 1.8 2.0 1.0 1.1 1.1 An07g06770 strong similarity to delta-6 desaturase - Mucor rouxii * weak similarity to regulatory protein UPC2 - 2.0 1.8 1.8 -1.1 1.0 -1.1 An15g05840 UPC2 * Saccharomyces cerevisiae strong similarity to very long-chain fatty acyl-CoA 1.7 2.5 2.7 1.5 1.1 1.6 An07g09190 FAT1 * synthetase FAT1 - Saccharomyces cerevisiae Phosphoinositide metabolism 1.8 1.9 2.0 1.1 1.0 1.1 GO:0030384! An13g00110 strong similarity to 1-phosphatidylinositol 4-kinase Stt4 2.1 1.8 1.8 -1.1 1.0 -1.2 GO:0030384! An09g01240 strong similarity to phospholipase B - strong similarity to lipid phosphoinositide phosphatase 1.9 1.8 2.0 1.0 1.1 1.1 GO:0030384! An04g02480 Sac1 2.4 2.2 2.3 -1.1 1.1 1.0 GO:0008610 An11g06770 GPI transamidase component Gpi16 GO:0030384 strong similarity to myo-inositol transport protein ITR2 - 2.2 3.0 3.4 1.3 1.1 1.5 An04g00340 ITR2 * Saccaromyces cerevisiae strong similarity to N-acetylglucosaminyl- 1.7 1.7 1.6 1.0 1.0 1.0 An14g06640 * phosphatidylinositol deacetylase PIGL - Rattus norvegicus

168 ! Summary & Samenvatting & Supplementary material Sup. material !

Table S8. Expression values of selected genes related to the GO terms “hydrolase activity”, “glutathione catabolic processes” and “vacuolar acidification”.

Gene Fold change GO-term name: A. Gene ID Description niger or S. HacACA-1/ HacACA-2/ HacACA-3/ HacACA-2/ HacACA-2/ HacACA-3/ Biological cerevisiae HacAWT HacAWT HacAWT HacACA-1 HacACA-3 HacACA-1 Process Hydrolase activity strong similarity to transport vesicle formation protein 2.1 2.1 2.1 1.0 1.0 1.0 GO:0051345 An04g00360 SEC13 Sec13 - Saccharomyces cerevisiae strong similarity to hypothetical membrane protein 1.5 1.5 1.5 1.0 1.0 1.0 GO:0051345 An08g10570 YLR386w- Saccharomyces cerevisiae Glutathione catabolic process An08g04260 glutamine amidotransferase 1.8 2.1 2.4 1.2 1.1 1.3 GO:0006751 An11g11180 glutamate carboxypeptidase 1.5 1.5 1.5 1.0 1.0 1.0 GO:0006751 An13g01300 strong similarity to gamma-glutamyl transpeptidase GGT1 1.6 1.7 1.7 1.1 1.0 1.1 GO:0006751 Vacuolar acidification strong similarity to vacuolar H(+)-transporting ATPase 1.5 1.8 1.7 1.2 1.0 1.2 GO:0007035 An04g05310 VHP1 ! subunit Vph1 - Saccharomyces strong similarity to vacuolar H(+)-transporting ATPase 1.6 1.6 1.5 1.0 1.0 0.9 GO:0007035! An02g02020 subunit B Vma2 strong similarity to Na+-H+ antiporter Nha2 - 3.2 3.6 3.8 1.1 1.0 1.2 GO:0007035! An17g01550 NHA2 Saccharomyces cerevisiae strong similarity to regulator protein Rav1 -Saccharomyces 1.9 2.0 2.0 1.1 1.0 1.0 GO:0007035! An08g06750 RAV1 cerevisiae

! 169 Sup. material Summary & Samenvatting & Supplementary material !

Table S9. Expression values of selected down-regulated genes related to enriched GO terms.

Gene Fold change GO-term name: A. Gene ID Description HacACA-1/ HacACA-2/ HacACA-3/ HacACA-2/ HacACA-2/ HacACA-3/ Biological niger or S. HacAWT HacAWT HacAWT HacACA-1 HacACA-3 HacACA-1 Process cerevisiae Glycolysis/Gluconeogenesis -2 -2 -2 1.0 1.0 1.1 GO:0006096 An04g02090 pyc pyruvate carboxylase pyc - Aspergillus niger GO:0006094 strong similarity to 3-methylcrotonyl-CoA carboxylase -1.7 -2 -2 1.0 1.0 -1.1 GO:0006096 An07g04300 (MCC) biotin-containing alpha subunit MCCA - Homo GO:0006094 sapiens strong similarity to phosphoglycerate kinase pgkA - -1.4 -1.7 -1.7 -1.1 -1.1 -1.2 GO:0006096 An08g02260 pgkA Aspergillus nidulans GO:0006094 strong similarity to phosphoenolpyruvate carboxykinase -3.3 -3.3 -3.3 1.1 1.0 1.1 GO:0006096 An11g02550 GO:0006094 KlPck1 - Kluyveromyces lactis GO:0006083 GO:0006096 An02g14380 hxk hexokinase hxk - Aspergillus niger -1.7 -1.7 -1.7 1.0 1.0 1.0 GO:0006094 GO:0008645 strong similarity to glucose-6-phosphate isomerase Pgi1 - -1.7 -1.4 -1.7 1.0 -1.1 -1.1 GO:0006096 An16g05420 PGI1 GO:0006094 Saccharomyces cerevisiae GO:0006740 Alcohol catabolic/metabolic process glucose-6-phosphat 1-dehydrogenase gsdA - Aspergillus -1.4 -1.7 -1.7 1.0 1.0 1.0 GO:0019321 An02g12140 gsdA GO:0006979 niger GO:0006740 weak similarity to acetate regulatory gene FacB - -2.5 -2 -1.7 1.3 1.1 1.4 An02g01140 facB * Aspergillus niger strong similarity to L-iditol 2-dehydrogenase Sor1 - -2.5 -2 -1.7 1.4 1.1 1.5 An12g00030 SOR1 GO:0019321 Saccharomyces cerevisiae strong similarity to succinate-semialdehyde dehydrogenase -2 -1.7 -1.7 1.3 -1.1 1.1 An04g02610 * NAD(P)+ gabD - Escherichia coli strong similarity to alcohol dehydrogenase of patent EP -2 -2 -2 1.1 1.0 1.1 An02g02060 * 0845532-A 19 strong similarity to acetate--CoA ligase facA - Aspergillus -2 -2 -2.5 1.0 -1.1 -1.1 An04g05620 facA GO:0006083 nidulans GO:0019679 similarity to sequence 28 from patent WO0032789 - -1.7 -1.4 -1.7 1.1 -1.1 1.0 An12g04640 GO:0006083 Mangifera indica strong similarity to acetyl-CoA hydrolase Ach1 - -5 -5 -5 1.1 1.0 1.0 An16g07110 ACH1 GO:0006083 Saccharomyces cerevisiae strong similarity to 2-ketoaldonate reductase yiaE - -1.7 -2 -2 -1.1 -1.1 -1.2 An01g07030 GO:0019679 Escherichia coli strong similarity to alcohol dehydrogenase Sfa1 - -1.7 -1.7 -1.7 1.0 1.0 1.0 GO:0046185 An10g00510 SFA1 Saccharomyces cerevisiae GO:0006071

170 ! Summary & Samenvatting & Supplementary material Sup. material !

GO:0033609 GO:0046185 alcohol-dehydrogenase adhA from patent WO8704464-A - -5 -5 -5 1.1 1.0 1.1 GO:0006071 An17g01530 adhA Aspergillus niger GO:0006567 GO:0033609 strong similarity to carboxyphosphonoenolpyruvate mutase -1.7 -1.7 -1.7 1.1 -1.1 1.0 An07g08390 GO:0033609 - Streptomyces hygroscopicus Carboxylic Acid Metabolism strong similarity to mitochondrial malate dehydrogenase -1.4 -1.7 -1.7 -1.1 1.0 -1.2 GO:0006099! An07g02160 MDH1 Mdh1 - Saccharomyces cerevisiae strong similarity to mitochondrial aconitate hydratase Aco1 -1.4 -2 -2.5 -1.2 -1.1 -1.2 GO:0006099! An08g10530 ACO1 - Saccharomyces cerevisiae strong similarity to fumarate hydratase fumR - Rhizopus -1.4 -2 -2 -1.2 1.0 -1.2 GO:0006099 An12g07850 ! oryzae strong similarity to succinate dehydrogenase iron-sulfur -1.7 -1.7 -2 -1.1 1.0 -1.2 GO:0006099! An14g04400 SDH2 protein subunit Sdh2 - Saccharomyces cerevisiae GO:0006099 strong similarity to methylcitrate synthase mcsA - -5 -3.3 -3.3 1.1 1.1 1.2 An15g01920 mcsA GO:0019679 Aspergillus nidulans similarity to dopa decarboxylase 3 DDC3 patent -5 -2.5 -2.5 2.0 1.1 2.2 An01g11320 * WO9960136-A1 - Aspergillus oryzae strong similarity to malate dehydrogenase mdh - -1.4 -1.4 -1.7 1.0 -1.1 -1.1 An05g00990 * Methanothermus fervidus -1.4 -1.7 -1.7 -1.2 1.0 -1.2 An11g00530 strong similarity to ATP citrate lyase - Homo sapiens * Carbon Metabolic/Catabolic Process strong similarity to glycine decarboxylase subunit T Gcv1 - -2.5 -2.5 -2.5 -1.2 1.2 1.0 An08g03070 GCV1 GO:0006544 Saccharomyces cerevisiae strong similarity to glycine decarboxylase subunit H Fun40 -2.5 -2.5 -2.5 -1.1 1.0 -1.1 An08g04390 FUN40 GO:0006544 - Saccharomyces cerevisiae -2 -1.7 -1.7 1.2 1.1 1.3 GO:0006544 An15g03260 strong similarity to threonine aldolase - Ashbya gossypii GO:0006567 strong similarity to glycine dehydrogenase component P - -2.5 -3.3 -2.5 -1.2 1.1 -1.1 An14g01150 GO:0006544 Pisum sativum -10 -10 -10 -1.1 1.0 -1.1 An09g00260 aglC alpha-galactosidase aglC - Aspergillus niger GO:0006012 strong similarity to NADPH-dependent aldehyde reductase -2 -2.5 -3.3 -1.2 -1.1 -1.4 GO:0006012 An11g01120 - Sporobolomyces salmonicolor GO:0006071 strong similarity to UDP-glucose-hexose-1-phosphate -2.5 -2.5 -2.5 -1.1 1.1 1.0 GO:0006012! An02g03590 GAL7 uridylyltransferase Gal7 - Saccharomyces cerevisiae strong similarity to galactokinase Gal1 - Saccharomyces -1.7 -1.4 -1.4 1.1 1.0 1.1 GO:0006012 An16g04160 GAL1 cerevisiae GO:0008645 similarity to UDP-glucose 4-epimerase Gal10 - -2 -2 -2 1.1 1.0 1.1 GO:0006012 An11g10890 GAL10 Saccharomyces cerevisiae GO:0006979

! 171 Sup. material Summary & Samenvatting & Supplementary material !

-2.5 -3.3 -3.3 1.0 1.0 -1.1 GO:0006012 An02g11320 GAL10 similar to UDP-glucose epimerase GAL10 GO:0006979 -5 -10 -10 -2.5 -1.1 -2.5 An04g06920 AgdA extracellular alpha-glucosidase - Aspergillus niger * -10 -10 -10 -1.4 1.0 -1.4 An01g10930 AgdB Putative #–glucosidase - agdB - Aspergillus niger GO:0005982 GO:0005984 -370 -50 -50 -1.4 1.0 -1.4 An11g03340 AamA acid alpha-amylase - Aspergillus niger GO:0005982 strong similarity to alpha-amylase precursor AMY - -5 -5 -5 -1.1 1.0 -1.1 An09g03100 AmyA * Aspergillus shirousamii -10 -25 -25 -2.5 -1.1 -3.3 An03g06550 GlaA glucan 1,4-alpha-glucosidase glaA - Aspergillus niger * transcription regulator of maltose utilization amyR - -3.3 -3.3 -3.3 -1.1 1.0 -1.1 An04g06910 AmyR GO:0005982 Aspergillus niger strong similarity to alpha,alpha-trehalase treA - Aspergillus -3.3 -3.3 -3.3 -1.2 1.0 -1.1 An01g01540 GO:0005984 nidulans strong similarity to trehalose-6-phosphate phosphatase TPP -2.5 -2.5 -3.3 1.0 -1.1 -1.1 An11g10990 TPP from patent WO200116357-A2 - Saccharomyces GO:0005984 cerevisiae strong similarity to secreted beta-galactosidase lacA - -2 -2.5 -2.5 -1.1 1.0 -1.1 An01g10350 lacA GO:0005984 Aspergillus niger strong similarity to methanol dehydrogenase Mdh - -2 -1.7 -1.7 1.1 1.0 1.1 An11g03110 GO:0006071 Bacillus methanolicus -2.5 -1.7 -1.7 1.4 1.1 1.5 An04g04890 strong similarity to glycerol kinase GK - Mus musculus * strong similarity to ribose-phosphate pyrophosphokinase -2 -1.7 -2 1.1 -1.1 1.0 GO:0019321 An07g02210 PRPS1 Prps1 - Saccharomyces cerevisiae strong similarity to NADPH-dependent carbonyl reductase -2.5 -2.5 -2.5 -1.1 1.0 1.0 GO:0019321 An15g05450 S1 - Candida magnoliae strong similarity to D-arabinose dehydrogenase Ara1 - -1.7 -2 -2 -1.1 1.0 1.0 An01g06970 ARA1 GO:0019321 Saccharomyces cerevisiae GO:0006071 strong similarity to ribose-phosphate pyrophosphokinase -1.7 -1.7 -1.7 1.0 1.0 1.0 GO:0019321 An04g05860 PRS2 Prs2 - Saccharomyces cerevisiae GO:0019321 strong similarity to phosphogluconate dehydrogenase Gnd1 -1.4 -1.7 -1.7 -1.1 -1.1 -1.2 GO:0006970 An11g02040 GND1 - Saccharomyces cerevisiae GO:0006740

strong similarity to 42 kDa endochitinase Tham-ch - -2 -2 -2 1.0 1.1 1.1 An01g05360 * Trichoderma hamatum weak similarity to the endo-1,4-betaxylanase gene product -2 -1.2 -1.2 1.7 1.1 1.9 An16g03330 * CAA93120.1 - Ascochyta pisi strong similarity to sorbitol dehydrogenase gutB - Bacillus -2.5 -1.7 -1.7 1.7 1.0 1.8 An01g03480 * subtilis

172 ! Summary & Samenvatting & Supplementary material Sup. material !

strong similarity to the putative endo alpha-1,4 -3.3 -3.3 -3.3 1.0 1.1 1.1 An02g11360 * polygalactosaminidase precusor gene - Pseudomonas sp strong similarity to glucose sensor RGT2 - Saccharomyces -5 -10 -10 -1.4 1.0 -1.4 An12g07450 RGT2 * cerevisiae strong similarity to phosphoacetylglucosamine mutase -1.7 -1.7 -2 1.1 -1.1 1.0 An18g05160 * AGM1 - Candida albicans strong similarity to 123K chain alpha,alpha-trehalose- -2.5 -3.3 -2.5 -1.1 1.0 -1.1 An07g08720 TSL1 phosphate synthase (UDP-forming) TSL1 - Saccharomyces * cerevisiae similarity to glucanase ZmGnsN3 of patent -1.7 -1.4 -1.7 1.1 1.0 1.0 An12g09130 * WO200073470-A2 - Zea mays strong similarity to glutamine--fructose-6-phosphate -2.5 -1.4 -1.4 1.7 1.0 1.7 An03g05940 GFA1 * transaminase gfa1 - Saccharomyces cerevisiae weak similarity to putative polysaccharide synthase -1.7 -1.4 -1.7 1.0 1.0 1.0 An12g00100 * homolog cap3B - Streptococcus pneumoniae -2.5 -2.5 -2.5 1.0 1.0 1.0 An02g10310 strong similarity to glycogen synthase - Neurospora crassa * strong similarity to phosphomannose isomerase manA - -1.4 -1.7 -1.7 0.9 1.0 0.9 An08g06350 * Aspergillus nidulans Transporters strong similarity to hexose transporter Hxt3 - -2 -2 -2 -1.1 1.1 1.0 An02g03540 HXT3 GO:0008645 Saccharomyces cerevisiae strong similarity to high-affinity glucose transporter HGT1 -5 -5 -5 -1.1 1.0 -1.1 An11g01100 GO:0008645 - Kluyveromyces lactis strong similarity to choline permease Hnm1 - -5 -3.3 -3.3 1.6 1.0 1.6 GO:0015812! An02g09540 HNM1 Saccharomyces cerevisiae strong similarity to GABA permease gabA - Aspergillus -5 -3.3 -3.3 1.3 -1.1 1.2 GO:0015812! An16g02000 nidulans strong similarity to GABA permease Uga4 - -1.7 -2 -1.7 -1.1 1.0 -1.1 GO:0015812! An14g01850 UGA4 Saccharomyces cerevisiae strong similarity to permease involved in fumonisin -1.4 -1.4 -1.4 1.0 1.0 1.1 GO:0015812 An03g00430 degradation from patent WO200105980-A1 - Exophiala ! spinifera Response to oxidative stress strong similarity to poly(ADP-ribose) polymerase NAP -3.3 -3.3 -3.3 -1.1 1.0 -1.2 An18g01170 GO:0006979 protein from patent WO200004173-A1 - Zea mays strong similarity to precursor of linoleate diol synthase - -3.3 -3.3 -3.3 1.0 1.0 1.0 An02g07930 GO:0006979 Gaeumannomyces graminis strong similarity to osmotic sensitivity MAP Kinase OSM1 -1.7 -1.7 -2 1.0 1.0 1.0 An07g03980 GO:0006979 - Pyricularia grisea strong similarity to thioredoxin peroxidase PMP20 - Mus -2.5 -2.5 -2.5 1.0 -1.1 -1.1 An06g01660 GO:0006979 musculus strong similarity to superoxide dismutase Sod2 - -1.4 -1.7 -1.7 -1.1 -1.1 -1.1 An04g04870 SOD2 GO:0006979 Saccharomyces cerevisiae

! 173 Sup. material Summary & Samenvatting & Supplementary material !

similarity to glutathione S-transferase GST1 - Ascaris -2.5 -2 -2 1.3 1.1 1.4 An16g06100 GO:0006979 suum strong similarity to mannitol-1-phosphate 5-dehydrogenase -2.5 -2.5 -2 1.2 1.0 1.2 An02g05830 GO:0006979 mtlD - Streptococcus mutans similarity to HC-toxin non-ribosomal peptide synthase -2.5 -2.5 -2.5 -1.1 1.1 1.0 An08g02310 GO:0006979 HTS1 - Cochliobolus carbonum strong similarity to peroxisomal membrane protein PMP20 -2.5 -2.5 -2.5 -1.1 1.1 1.0 An16g00920 GO:0006979 - Candida boidinii strong similarity to member of the subfamily of yeast -1.4 -1.7 -1.7 -1.1 1.0 -1.1 An15g03220 GRX4 GO:0006979 glutaredoxins Grx4 - Saccharomyces cerevisiae

GO:0006096: glycolysis; GO:0006094: gluconeogenesis; GO:0006083: acetate metabolic process; GO:0008645: hexose transport; GO:0006740: NADPH regeneration; GO:0019321: pentose metabolic process; GO:0006979: response to oxidative stress; GO:0006083: acetate metabolic process; GO:0019679: propionate metabolic process; GO:0046185: aldehyde catabolic process; GO:0006071: glycerol metabolic process; GO:0033609: oxalate metabolic process; GO:0006567: threonine catabolic process; GO:0006099: tricarboxylic acid cycle; GO:0006544: glycine metabolic process; GO:0006012: galactose metabolic process; GO:0005982: starch metabolic process; GO:0005984: disaccharide metabolic process; GO:0015812: gamma-aminobutyric acid transport

174 ! Summary & Samenvatting & Supplementary material Sup. material !

Table S10. Commonly induced and repressed genes in the HacACA strain and A. niger strains treated with DTT and Tunicamycin and expressing tPA (Guillemette et al., 2007).

Category Gene ID Induced An01g13220*, An02g14800*, An01g04600*, An01g08420*, An11g04180*, An16g07620*, An18g02020, An04g02020, Protein folding An11g11250, An05g00880 Translocation/signal peptidase An03g04340, An01g13070, An16g08830, An17g00090, An01g03820, An01g11630, An01g10070, An04g06890, complex An16g07390, An09g05420*, An01g00560, An15g06470 An14g05910, An18g02360, An03g04410*, An02g03240, An07g06430, An07g04190, An02g14560, An18g03920, Glycosylation An02g14930, An16g08570, An18g04260*, An18g06220, An12g00340, An09g05880, An13g00620, An15g01420, An16g04330, An04g05250, An01g05200, An02g14940 An03g04940*, An01g04320, An04g08830, An02g02640, An14g00210, An02g08450, An02g05870, An07g07340, Vesicle trafficking/transport An09g04170, An02g11990, An08g00290, An08g06780 Proteolytic degradation An16g06750, An08g09000, An01g12720 An02g13410*, An11g02990, An08g00560, An02g07610, An16g01820, An07g09840, An16g09180, An12g03150, Lipid/inositol metabolism An19g00320 Transcription An07g03760 Translation An14g06610, An04g08580 Stress related An12g03580, An01g14100 Cell cycle an DNA processing An01g08170 Other An11g04750, An14g07030 An08g03960*, An08g03970, An09g00650*, An14g02470, An16g08470, An08g08090, An04g02250, An08g00900, Unclassified An14g01990, An08g04260, An07g10280, An09g06130, An08g03970, An15g01680, An18g06120, An14g06550, An18g06740, An11g10800, An18g01690, An02g02260 Repressed Protein fate An06g01610, An13g02540, An02g00960, An04g1440 Vesicle trafficking/transport An09g02930 Lipid metabolism An16g01880, An03g03550, An02g09540, An16g06090 Amino acid metabolism An15g06700, An01g14730, An07g04300 Phosphate metabolism An12g01910 C-compound and carbohydrate An19g00100, An16g06800, An02g11320, An09g00260, An01g01540 metabolism Metabolism of vitamins, cofactors and An01g04250 prosthetic groups Cellular transport An01g01620, An12g10320, An07g06240, An08g04670, An16g06740, An03g00680 Cell rescue, defense and virulence An18g00980, An16g05920 Nucleotide/nitrogen and sulfur An10g00800, An18g01220 metabolism

! 175 Sup. material Summary & Samenvatting & Supplementary material !

Other An16g05910, An15g06140 An02g06440, An14g01820, An02g08050, An16g03330, An08g02300, An02g08330, An03g03530, An03g00840, Unclassified An08g07150, An11g01660, An18g01000, An12g02660, An13g01520, An16g05930, An02g00120

176 ! Summary & Samenvatting & Supplementary material Sup. material !

Fig. S1. Growth profiles of A. niger HacAWT (A, B, C) and HacACA (D, E, F) triplicate batch cultures. Dry weight biomass -1 concentration (gDWkg ) as a function of time (h) illustrates the growth of the cultures. The maximum specific growth rate for each culture was determined from the slope (#) of the ln transformation of biomass (Cbiomass) (lnX) in the exponential growth phase as a function of time (h), as well from log transformation of alkali addition as a function of time (h). Dash-line represents the end of the exponential growth phase (depletion of glucose).

! A B

6 2 6 2 ! 5 5 -1 1 ! = 0.21 h , 1 ! )

) 2 -1 R = 0.9795. -1 4 -1 4

! = 0.22 h , kg

kg 2 lnx lnx R = 0.9929. DW ! DW 3 0 3 0

(g (g

! 2 biomass 2 biomass C

C -1 -1 ! 1 1

0 -2 0 -2 ! 0 6 12 18 24 30 36 0 6 12 18 24 30 36 Time (h) Time (h) !

C D

6 2 ! -1 ! = 0.22 h , 6 2

LOS(alkali addition) -1 R2 = 0.9478. ! = 0.21 h , 5 R2 = 0.9366.

! 5 1 ) 1 -1 ) 4 (C ln -1 4 kg

! 6 12 18 24 30 36 kg

DW 6 12 18 24 30 36 biomass

Time (h) lnx 3 0 DW Time (h)

(g 3 -1 0

-1 ! = 0.23 h , (g ! = 0.21 h ,

2 ) 2 ! 2 R = 0.9997. R = 0.9992. biomass 2 biomass C -1 C -1 1 ! 1

0 -2 ! 0 6 12 18 24 30 36 0 -2 0 6 12 18 24 30 36 Time (h) Time (h)

! 177 Sup. material Summary & Samenvatting & Supplementary material !

!

! E F 6 2 6 2 -1 ! = 0.20 h , R2 = 0.9634. ! 5 5

1 1 ) ) -1

-1 4 4

! -1 kg kg 6 12 18 24 30 36

= 0.20 h , lnx ! lnx DW Time (h) DW 3 R2 = 0.9991. 0 3 0

(g

(g -1 ! ! = 0.20 h , 2 2 2 biomass R = 0.9900. biomass C ! C -1 -1 1 1

! 0 -2 0 -2 0 6 12 18 24 30 36 0 6 12 18 24 30 36 ! Time (h) Time (h)

!

!

!

!

!

!

!

!

!

!

178 ! Summary & Samenvatting & Supplementary material Sup. material !

Fig. S2: Network maps of related up-regulated GO-terms.

!

! 179 GO:0008150 biological_process

GO:0055067 GO:0030433 GO:0051345 GO:0019538 GO:0019637 GO:0009100 GO:0005975 GO:0009607 GO:0051789 GO:0006751 GO:0061024 GO:0006629 monovalent ER-associated positive GO:0051179 protein organophosphate glycoprotein carbohydrate response response glutathione membrane lipid metabolic inorganic protein regulation localization metabolic metabolic metabolic metabolic to biotic to protein catabolic organization process cation catabolic of hydrolase process process process process stimulus stimulus process homeostasis process activity

GO:0030004 GO:0044267 GO:0044262 GO:0016044 GO:0044255 GO:0009101 GO:0009311 cellular GO:0006986 GO:0033036 GO:0051641 GO:0051234 GO:0051604 cellular GO:0008610 GO:0043412 cellular GO:0006885 cellular cellular glycoprotein GO:0070085 oligosaccharide monovalent response macromolecule cellular establishment protein protein lipid biosynthetic macromolecule carbohydrate regulation membrane lipid metabolic biosynthetic glycosylation metabolic inorganic to unfolded localization localization of localization maturation metabolic process modification metabolic of pH organization process process process cation protein process process homeostasis

GO:0051691 GO:0070727 GO:0051649 GO:0046486 GO:0006644 GO:0006464 GO:0009312 GO:0030641 GO:0008104 GO:0051648 GO:0016485 GO:0043413 cellular cellular establishment GO:0006810 glycerolipid phospholipid protein oligosaccharide regulation protein vesicle protein macromolecule oligosaccharide macromolecule of localization transport metabolic metabolic modification biosynthetic of cellular localization localization processing glycosylation metabolic localization in cell process process process process pH process

GO:0051605 GO:0034613 GO:0045184 GO:0051650 GO:0030384 GO:0051453 GO:0055085 GO:0046907 GO:0016192 GO:0010324 GO:0016050 protein GO:0006486 cellular establishment establishment GO:0015780 phosphoinositide GO:0045851 regulation transmembrane intracellular vesicle-mediated membrane vesicle maturation protein protein of protein of vesicle nucleotide-sugar transport metabolic pH reduction of intracellular transport transport transport invagination organization by peptide amino acid glycosylation localization localization localization process pH bond cleavage

GO:0033365 GO:0006465 GO:0006493 GO:0006487 GO:0015031 GO:0006903 GO:0048193 GO:0016197 GO:0015781 GO:0006900 GO:0051452 protein GO:0006897 signal protein protein protein vesicle Golgi vesicle endosome pyrimidine membrane intracellular localization endocytosis peptide amino acid O-linked amino acid N-linked transport targeting transport transport nucleotide-sugar transport budding pH reduction in organelle processing glycosylation glycosylation

GO:0070972 GO:0006488 GO:0006886 GO:0048199 GO:0006890 protein GO:0006892 GO:0006888 GO:0015786 GO:0006901 dolichol-linked GO:0007035 intracellular vesicle retrograde localization post-Golgi vesicle-mediated ER to Golgi vesicle-mediated UDP-glucose vesicle oligosaccharide vacuolar protein targeting, to, from or within vesicle-mediated in endoplasmic transport transport transport coating biosynthetic acidification transport Golgi transport, Golgi to ER reticulum process

GO:0045047 GO:0006612 GO:0090114 GO:0006895 GO:0006490 protein protein COPII-coated Golgi to endosome oligosaccharide-lipid intermediate targeting targeting vesicle transport assembly to ER to membrane budding

GO:0006613 GO:0006620 GO:0065002 cotranslational posttranslational intracellular protein protein protein targeting targeting transmembrane to membrane to membrane transport

GO:0006614 GO:0031204 SRP-dependent posttranslational cotranslational protein protein targeting targeting to membrane, translocation to membrane

GO:0006616 SRP-dependent cotranslational protein targeting to membrane, translocation Fig. S3: Network maps of related down-regulated GO-terms.

! GO:0008150 biological_process

GO:0006081 GO:0005975 GO:0044281 GO:0051186 GO:0006979 GO:0015749 GO:0015849 GO:0009308 cellular GO:0015837 carbohydrate small molecule cofactor response monosaccharide organic amine metabolic aldehyde amine transport metabolic metabolic metabolic to oxidative transport acid transport process metabolic process process process stress process

GO:0044262 GO:0042180 GO:0006519 GO:0005976 GO:0016051 GO:0016052 GO:0044283 GO:0006066 GO:0044282 GO:0006082 GO:0044106 GO:0006732 GO:0046185 GO:0008645 GO:0046942 cellular cellular cellular polysaccharide carbohydrate carbohydrate small molecule alcohol small molecule organic cellular coenzyme aldehyde hexose carboxylic carbohydrate ketone amino acid and derivative metabolic biosynthetic catabolic biosynthetic metabolic catabolic acid metabolic amine metabolic metabolic catabolic transport acid transport metabolic metabolic metabolic process process process process process process process process process process process process process

GO:0044264 GO:0034637 GO:0044275 GO:0019362 GO:0044042 GO:0005984 GO:0005996 GO:0046165 GO:0046164 GO:0019751 GO:0043436 GO:0016054 cellular cellular cellular GO:0006084 pyridine GO:0006865 glucan disaccharide monosaccharide alcohol alcohol polyol oxoacid organic polysaccharide carbohydrate carbohydrate acetyl-CoA metabolic nucleotide amino acid transport metabolic metabolic metabolic biosynthetic catabolic metabolic metabolic acid catabolic metabolic biosynthetic catabolic process metabolic process process process process process process process process process process process process

GO:0006073 GO:0006091 GO:0046496 GO:0046364 GO:0019318 GO:0019321 GO:0046365 GO:0019400 GO:0019752 GO:0015812 cellular GO:0009310 generation GO:0046356 nicotinamide monosaccharide hexose pentose monosaccharide alditol carboxylic gamma-aminobutyric glucan amine catabolic of precursor acetyl-CoA catabolic nucleotide biosynthetic metabolic metabolic catabolic metabolic acid metabolic acid transport metabolic process metabolites process metabolic process process process process process process process and energy process

GO:0005982 GO:0019319 GO:0006012 GO:0006006 GO:0019320 GO:0006071 GO:0032787 GO:0033609 GO:0046395 GO:0006520 GO:0006099 GO:0006739 starch hexose galactose glucose hexose glycerol monocarboxylic oxalate carboxylic cellular tricarboxylic NADP metabolic metabolic biosynthetic metabolic metabolic catabolic metabolic acid metabolic metabolic acid catabolic amino acid metabolic acid cycle process process process process process process process process process process process

GO:0009066 GO:0009069 GO:0006007 GO:0006090 GO:0006083 GO:0019541 GO:0009063 aspartate serine glucose pyruvate acetate propionate cellular GO:0006740 family family catabolic metabolic metabolic metabolic amino acid catabolic NADPH regeneration amino acid metabolic amino acid metabolic process process process process process process process

GO:0019679 GO:0009068 GO:0006544 propionate aspartate GO:0006094 GO:0006096 glycine metabolic family gluconeogenesis glycolysis metabolic process, methylcitrate amino acid catabolic process cycle process

GO:0006567 threonine catabolic process