DOCSLIB.ORG

Investigating the Effects of Human Carbonic Anhydrase 1 Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigating the Effects of Human Carbonic Anhydrase 1 Expression Investigating the effects of human Carbonic Anhydrase 1 expression in mammalian cells Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Xiaochen Liu, BSc, MSc January 2016 ABSTRACT Amyotrophic Lateral Sclerosis (ALS) is one of the most common motor neuron diseases with a crude annual incidence rate of ~2 cases per 100,000 in European countries, Japan, United States and Canada. The role of Carbonic Anhydrase 1 (CA1) in ALS pathogenesis is completely unknown. Previous unpublished results from Dr. Jian Liu have shown in the spinal cords of patients with sporadic amyotrophic lateral sclerosis (SALS) there is a significant increased expression of CA1 proteins. The purpose of this study is to examine the effect of CA1 expression in mammalian cells, specifically, whether CA1 expression will affect cellular viability and induce apoptosis. To further understand whether such effect is dependent upon CA1 enzymatic activity, three CA1 mutants (Thr199Val, Glu106Ile and Glu106Gln) were generated using two- step PCR mutagenesis. Also, a fluorescence-based assay using the pH-sensitive fluorophore Pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) to measure the anhydrase activity was developed. The assay has been able to circumvent the requirement of the specialized equipment by utilizing a sensitive and fast microplate reader and demonstrated that three - mutants are enzymatically inactive under the physiologically relevant HCO3 dehydration reaction which has not been tested before by others. The data show that transient expression of CA1 in Human Embryonic Kidney 293 (HEK293), African Green Monkey Kidney Fibroblast (COS7) and Human Breast Adenocarcinoma (MCF7) cell lines did not induce significant changes to the cell viability at 36hrs using the Water Soluble Tetrazolium-8 (WST8) assay. Wild-type CA1 significantly reduced cell viability in HEK293 using a virally transduced inducible stable expression system at 96hrs and 144hrs of protein induction whereas out of the two mutants used only Thr199Val induced significant toxicity at 144hrs. Wild-type CA1 has also been found i to protect COS7 cells against doxycycline-induced toxicity at 96hrs and 144hrs of protein induction whereas no protective effect was seen by the mutants. Using flow cytometry analysis the results has shown wild-type CA1 expression significantly increased Caspase-3 activation and its downstream molecule Poly (ADP-Ribose) Polymerase 1 (PARP-1) cleavage at 96hrs whereas Glu106Ile only significantly increased Caspase-3 activation. In conclusion, this study marks the first time where CA1 expression has shown to directly cause significant apoptotic toxicity in HEK293 cells and protect against doxycycline-induced toxicity in COS7 cells. Although the implication of this study in ALS requires further investigation, the results here suggest in healthy cells increased levels of CA1 expression may cause onset of toxicity, whereas when cells undergo stress, increased CA1 expression can be protective to prevent further loss in cell viabilities. Despite numerous previous studies that have examined CA1 as potential diseases marker, these results represent for the first time in understanding the effect of CA1 in mammalian cells. ii ACKNOWLEDGEMENTS First and foremost, I would like to express my gratitude to my supervisors, Dr. Jian Liu and Prof. Samar Hasnain. This thesis would not have been possible without their guidance, suggestions, as well as patience in the past four years. Thank you sincerely for giving me the opportunity to undertake this journey in science. I would like to express sincerest gratitude to Dr. Tatsuhiko Kadowaki for his time and patience during the past four years in helping me during the experimental stages. I am grateful for Dr. Ferdinand Kappes for his invaluable help for providing me the DNA plasmids for setting up the inducible stable cell lines as well as his guidance throughout this process. I am grateful for the help of Dr. Meng Huee Lee for allowing me to conduct experiments using his equipment, his guidance during the experimental stage, as well as lending his valuable reagents and DNA plasmids that were crucial for my experiments. I would like to say thank you to Dr. Minyan Wang for her kindness and allowing me to use her equipment. I would like to express gratitude to Dr. David Ruiz-Carillo, Prof. Zhiliang Lv, and Dr. Hebin Liu for their help and suggestions. I want to say thank you to the technicians Mr. Deyi Lu, Miss. Qiaoli Feng, Mrs. Yan Zhang, Mr. Ziwen Xie, Mr. Zhongkai Huang and Mrs. Sijing Meng for their time and help. I want to thank my PhD colleagues in the lab Miss. Xiaoyang Zhang, Mr. Hao Zhang, Mr. Xiaofeng Dong as well as all the other PhD students for their company and help. iii I would like to express appreciation for the PhD Scholarship provided by XJTLU and the University of Liverpool which allowed me to pursue this PhD. Last but not least, I want to thank my parents, Dr. Bo Liu and Dr. Naixia Wang for their love, care and support over the past 26 years and their support during the PhD process. I would also like to thank Miss. Yiran Qian for her love and encouragements when I needed it the most. iv TABLE OF CONTENTS Title page Abstract i Acknowledgements iii Table of contents v List of figures and table ix Supplementary figure and list of appendices xi Glossary of abbreviations xii Chapter One Theoretical background 1 Part One: Background to ALS and the proteins involved 1 Etiology of ALS 1 ALS genetics 4 Superoxide dismutase 1 (SOD1) 4 TAR-DNA Binding protein (TARDBP) 8 Fused in sarcoma (FUS) 11 Hexanucleotide repeat expansion in C9ORF72 13 Other genes associated with ALS 17 Non-genetic causes of ALS 18 Part Two: Carbonic Anhydrase – its biological function and role in human diseases 20 The biological functions of the carbonic anhydrases (CA) 20 Members of the CA family 22 CA1 gene expression and physiological function 24 The enzymatic mechanism of CA1 27 Role of CA in the nervous system 33 CA1 and human disease 39 Potential role of CA1 in motor neuron degeneration in ALS 40 v References 46 Chapter Two Fluorescence-based assay for measuring CA1 enzyme activity 67 Introduction 67 The catalytic process of CA 67 The importance of the Thr199 and Glu106 residues in CA1 catalysis 68 Generating CA1 inactive mutants – what the studies have shown 72 Measuring CA enzyme activity 74 The manometric method 74 The colorimetric method 75 The electrometric method 76 The spectrophotometric method 77 Aim of the study 81 Materials and methods 83 Mutagenesis to generate site directed CA1 mutants 83 Protein expression and purification 87 pH vs. fluorescence calibration and UV spectra profile for the enzyme assay 88 Fluorescence-based assay for measuring relative CA1 anhydrase activity 89 Results 91 Establishing a modified method for measuring CA1 anhydrase activity 91 The linear relationship between pH and Pyranine fluorescence 94 bCA2 exhibits in vitro activity linearly correlated with the concentration 95 Mutant CA1 proteins do not retain activity in vitro 101 Discussion 106 Development of a modified fluorescence-based assay of measuring CA activities 106 Mutant CA1 are enzymatically inactive in vitro 108 References 115 vi Chapter Three Investigating the effect of CA1 in mammalian cells by transient expression 118 Introduction 118 Effect of CA1 expression on cell survival 118 Measuring CA1-induced cell viability changes 119 Aim of the study 120 Materials and methods 122 Cell culture 122 Transient transfection of human CA1 into mammalian cells 122 Cell viability via WST8 assay 122 Western blot analysis 123 Results 124 Effect of transient CA1 expression in COS7 cell line 124 Effect of transient CA1 expression in HEK293 cell line 125 Effect of transient CA1 expression in MCF7 cell line 126 Discussion 127 Possible explanations for non-significant changes due to CA1 expression 127 Discussion of the study approach 129 References 131 Chapter Four Investigating the effect of CA1 in mammalian cells by induced stable expression 134 Introduction 134 CA isoforms and cell viability 134 CA and optimization of intracellular pH 134 CA1 and cell toxicity 135 Using the lentiviral inducible expression system for studying CA1 136 Materials and methods 138 Cell culture 138 vii Lentiviral stable cell line production 138 Immunofluorescence 140 Western blot analysis 140 Cell viability assay 141 Flow cytometry analysis 141 Results 142 COS7 and HEK293 cells stably express eGFP and CA1 upon induction 142 Doxycycline induced significant toxicity in COS7 cells 146 Wild-type CA1 protein protect COS7 cells from doxycycline induced toxicity 148 Expression of CA1 proteins induces apoptosis in HEK293 cells 150 Discussion 153 Novel discovery of intracellular CA1-induced toxicity in HEK293 cells 153 Wild-type CA1 expression briefly mitigated doxycycline induced toxicity 154 in COS7 cells Different response to CA1 may be due to differences in cell-environment 155 CA1 mutants causing cellular toxicity and its implications 156 References 159 Chapter Five Concluding Remarks: Improved understanding for the role of CA1 162 in human disease and ALS Study objective and experimental approach 162 Brief summary of results presented in previous chapters 163 Possibility of CA1-induced toxicity in HEK293 cells is activity dependent 163 Increased CA1 expression can transiently mitigate doxycycline-induced stress 166 Summary 168 References 170 viii LIST OF FIGURES AND TABLE Page no. Figure 1.1. Protein sequence alignment between CA1 and CA2. 27 Figure 1.2. Schematic drawing of the CA1 protein. 28 Figure 1.3. Zinc-bound histidines and water in the CA1 active site. 29 Figure 1.4. Equations showing the principles of the CA reversible hydration of CO2 30 Figure 1.5. The four histidines assisting proton transfer in CA1. 31 Figure 1.6. Thr199 and Glu106 residues in CA1. 32 Figure 1.7. Protein sequence alignment between human CA3 to CA1 and CA2.
Load more

Recommended publications
  • Anti-CA1 / Carbonic Anhydrase 1 Antibody (ARG65670)
    Product datasheet [email protected] ARG65670 Package: 100 μl, 50 μl anti-CA1 / Carbonic Anhydrase 1 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes CA1 / Carbonic Anhydrase 1 Tested Reactivity Ms, Rat Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name CA1 / Carbonic Anhydrase 1 Antigen Species Human Immunogen Full length fusion protein of Human CA1. Conjugation Un-conjugated Alternate Names Carbonic anhydrase I; EC 4.2.1.1; Carbonate dehydratase I; Carbonic anhydrase B; Car1; HEL-S-11; CA-I; Carbonic anhydrase 1; CAB Application Instructions Application table Application Dilution WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control WB: Mouse liver tissue Calculated Mw 29 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (pH 7.3), 0.05% Sodium azide and 50% Glycerol Preservative 0.05% Sodium azide Stabilizer 50% Glycerol Concentration 0.9 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol CA1 Gene Full Name carbonic anhydrase I Background Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide.
    [Show full text]
  • An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas Reinhardtii
    H OH metabolites OH Review An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas reinhardtii Ashok Aspatwar 1,* ID , Susanna Haapanen 1 and Seppo Parkkila 1,2 1 Faculty of Medicine and Life Sciences, University of Tampere, FI-33014 Tampere, Finland; [email protected].fi (S.H.); [email protected].fi (S.P.) 2 Fimlab, Ltd., and Tampere University Hospital, FI-33520 Tampere, Finland * Correspondence: [email protected].fi; Tel.: +358-46-596-2117 Received: 11 January 2018; Accepted: 10 March 2018; Published: 13 March 2018 Abstract: Carbonic anhydrases (CAs) are metalloenzymes that are omnipresent in nature. − + CAs catalyze the basic reaction of the reversible hydration of CO2 to HCO3 and H in all living organisms. Photosynthetic organisms contain six evolutionarily different classes of CAs, which are namely: α-CAs, β-CAs, γ-CAs, δ-CAs, ζ-CAs, and θ-CAs. Many of the photosynthetic organisms contain multiple isoforms of each CA family. The model alga Chlamydomonas reinhardtii contains 15 CAs belonging to three different CA gene families. Of these 15 CAs, three belong to the α-CA gene family; nine belong to the β-CA gene family; and three belong to the γ-CA gene family. The multiple copies of the CAs in each gene family may be due to gene duplications within the particular CA gene family. The CAs of Chlamydomonas reinhardtii are localized in different subcellular compartments of this unicellular alga. The presence of a large number of CAs and their diverse subcellular localization within a single cell suggests the importance of these enzymes in the metabolic and biochemical roles they perform in this unicellular alga.
    [Show full text]
  • A Survey of the Ce-Tubulin Gene Family in Chicken: Unexpected Sequence Heterogeneity in the Polypeptides Encoded by Five Expressed Genes
    The EMBO Journal vol.7 no.4 pp.931 -940, 1988 A survey of the ce-tubulin gene family in chicken: unexpected sequence heterogeneity in the polypeptides encoded by five expressed genes Lisa F.Pratt1 and Don W.Cleveland encoding both a- and ,B-tubulin lay beneath this heterogeneity of microtubule utilization (see Cleveland and Sullivan, 1985; Department of Biological Chemistry, The Johns Hopkins University Cleveland, 1987). For ,3-tubulin, extensive analyses in School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205, USA chicken (Sullivan and Cleveland, 1984; Sullivan et al., 1985, 'Present address: Division of Clinical Immunology, Scripps Clinic and 1986a,b; Murphy et al., 1987; Montiero and Cleveland, Research Foundation, 10666 N. Torrey Pines Road, La Jolla, CA 92037, USA 1988), mouse (Lewis et al., 1985a; Sullivan and Cleveland, 1986; Wang et al., 1986) and human (Hall et al., 1983; Lee Communicated by K.Weber et al., 1983; Lewis et al., 1985b; Sullivan and Cleveland, 1986) have revealed six functional vertebrate f-tubulins. At To characterize the a-tubulin gene family in chicken, we least four [and probably five-see Lopata and Cleveland have isolated five chicken a-tubulin genes and determined (1987)] of these represent distinct ,B-tubulin isotypes whose the majority of the sequences of the encoded polypep- sequences (particularly within a carboxy-terminal variable tides. Three of these (cA3, ca5/6 and ca8) encode novel, domain) have been evolutionarily conserved (Sullivan and expressed a-tubulins that have not previously been Cleveland, 1986; Wang et al., 1986). analyzed, whereas one gene segment is a pseudogene and For a-tubulin, the analyses are less complete.
    [Show full text]
  • Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights Into Their Mechanisms of Action
    International Journal of Molecular Sciences Review Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights into Their Mechanisms of Action Agnieszka Taracha, Grzegorz Kotarba and Tomasz Wilanowski * Laboratory of Signal Transduction, Nencki Institute of Experimental Biology of Polish Academy of Sciences, 3 Pasteur St., 02-093 Warsaw, Poland; [email protected] (A.T.); [email protected] (G.K.) * Correspondence: [email protected]; Tel.: +48-22-5892-311 Received: 21 August 2018; Accepted: 19 September 2018; Published: 20 September 2018 Abstract: In recent years, the TFCP2 (transcription factor cellular promoter 2)/TFCP2L1 (TFCP2- like 1)/UBP1 (upstream binding protein 1) subfamily of transcription factors has been attracting increasing attention in the scientific community. These factors are very important in cancer, Alzheimer’s disease, and other human conditions, and they can be attractive targets for drug development. However, the interpretation of experimental results is complicated, as in principle, any of these factors could substitute for the lack of another. Thus, studying their hitherto little known functions should enhance our understanding of mechanisms of their functioning, and analogous mechanisms might govern their functioning in medically relevant contexts. For example, there are numerous parallels between placental development and cancer growth; therefore, investigating the roles of TFCP2, TFCP2L1, and UBP1 in the placenta may help us better understand their functioning in cancer, as is evidenced by the studies of various other proteins and pathways. Our review article aims to call the attention of the scientific community to these neglected functions, and encourage further research in this field.
    [Show full text]
  • The Observed Alteration in BCL2 Expression Following Lithium
    www.nature.com/scientificreports OPEN The observed alteration in BCL2 expression following lithium treatment is infuenced by the Received: 26 August 2016 Accepted: 26 March 2018 choice of normalization method Published: xx xx xxxx Damri Odeya1,2, Agam Galila1,2 & Toker Lilah3,4 Upregulation of B-cell CLL/lymphoma (BCL)2 expression following lithium treatment is seemingly well established and has been related to the neuroprotective property of the drug. However, while demonstrated by some (but not all) studies based on low-throughput techniques (e.g. qPCR) this efect is not refected in high-throughput studies, such as microarrays and RNAseq. This manuscript presents a systematic review of currently available reports of lithium’s efect on BCL2 expression. To our surprise, we found that the majority of the literature does not support the efect of lithium onBCL 2 transcript or protein levels. Moreover, among the positive reports, several used therapeutically irrelevant lithium doses while others lack statistical power. We also noticed that numerous low-throughput studies normalized the signal using genes/proteins afected by lithium, imposing possible bias. Using wet bench experiments and reanalysis of publicly available microarray data, here we show that the reference gene chosen for normalization critically impacts the outcome of qPCR analyses of lithium’s efect on BCL2 expression. Our fndings suggest that experimental results might be severely afected by the choice of normalizing genes, and emphasize the need to re- evaluate stability of these genes in the context of the specifc experimental conditions. Upregulation of B-cell CLL/lymphoma (BCL)2 transcript following chronic lithium treatment is considered to be well established1.
    [Show full text]
  • Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
    ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature.
    [Show full text]
  • Expression of Carbonic Anhydrase II
    Biochemical Genetics, VoL 33, Nos. 11/12, 1995 Expression of Carbonic Anhydrase II (CA II) Promoter-Reporter Fusion Genes in Multiple Tissues of Transgenic Mice Does Not Replicate Normal Patterns of Expression Indicating Complexity of CA II Regulation in Vivo Robert P. Erickson, 1,2,4 Judy Grimes, 1 Patrick J. Venta, 3 and Richard E. Tashian 3 Received 6 June 1995 Final5 Sept. 1995 Although the proximal, 5' 115 bp of the human carbonic anhydrase II (CA II) gene was sufficient for expression of a reporter gene in some transfected cell lines, we found previously that 1100 bp of this promoter (or 500 bp of the mouse CA II promoter) was not sufficient for expression in transgenic mice. We have now studied the expression of linked reporter genes in mice transgenic for either (1) l 1 kb of the human 5' promoter or (2) 8 kb of the human 5' promoter with mouse sequences from the first exon, part of the first intron (since a CpG island spans this region), and the 3' sequences of the gene. Expression was found in both cases, but the tissue specificity was not appropriate for CA II. Although there was a difference in the sensitivity of the assays used, the frst construct led to expression in many tissues, while the second construct was expressed only in spleen. These findings indicate considerable complexity of DNA control regions for in vivo CA II expression. KEY WORDS: transgenic mice; carbonic anhydrase; promoter analysis; transcription; DNA control regions. Angel Charity for Children-Wings for Genetic Research, Steele Memorial Children's Re- search Center, Department of Pediatrics, University of Arizona, Tucson, Arizona.
    [Show full text]
  • Regulation and Roles of Carbonic Anhydrases IX and XII
    HEINI KALLIO Regulation and Roles of Carbonic Anhydrases IX and XII ACADEMIC DISSERTATION To be presented, with the permission of the board of the Institute of Biomedical Technology of the University of Tampere, for public discussion in the Auditorium of Finn-Medi 5, Biokatu 12, Tampere, on December 2nd, 2011, at 12 o’clock. UNIVERSITY OF TAMPERE ACADEMIC DISSERTATION University of Tampere, Institute of Biomedical Technology Tampere University Hospital Tampere Graduate Program in Biomedicine and Biotechnology (TGPBB) Finland Supervised by Reviewed by Professor Seppo Parkkila Docent Peppi Karppinen University of Tampere University of Oulu Finland Finland Professor Robert McKenna University of Florida USA Distribution Tel. +358 40 190 9800 Bookshop TAJU Fax +358 3 3551 7685 P.O. Box 617 [email protected] 33014 University of Tampere www.uta.fi/taju Finland http://granum.uta.fi Cover design by Mikko Reinikka Acta Universitatis Tamperensis 1675 Acta Electronica Universitatis Tamperensis 1139 ISBN 978-951-44-8621-0 (print) ISBN 978-951-44-8622-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://acta.uta.fi Tampereen Yliopistopaino Oy – Juvenes Print Tampere 2011 There is a crack in everything, that’s how the light gets in. -Leonard Cohen 3 CONTENTS CONTENTS .......................................................................................................... 4 LIST OF ORIGINAL COMMUNICATIONS...................................................... 7 ABBREVIATIONS .............................................................................................
    [Show full text]
  • Transcriptome Analysis of Hippocampal Subfields Identifies
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.05.935759. this version posted February 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. It is made available under a CC-BY 4.0 International license. Manuscript submitted to Hippocampus Transcriptome analysis of hippocampal subfields identifies gene expression profiles associated with long-term active place avoidance memory Rayna M. Harris1†, Hsin-Yi Kao2‡, Juan Marcos Alarcón3, André A. Fenton2,3, Hans A. Hofmann1 *For correspondence: [email protected] (RMH) 1Deptartment Integrative Biology; Institute for Cell and Molecular Biology, The 2 Present address: †Department of University of Texas at Austin; Center for Neural Science; Neuroscience Institute at the Neurobiology, Physiology and New York University Langone Medical Center, New York University; 3Dept. of Pathology; Behavior, University of California, Davis; ‡Neurology Department, The Robert F. Furchgott Center for Neural and Behavioral Science, SUNY Downstate University of Michigan, Ann Arbor Health Sciences University Abstract The hippocampus plays a critical role in storing and retrieving spatial information. By targeting the dorsal hippocampus and manipulating specific "candidate" molecules using pharmacological and genetic manipulations, we have previously discovered that long-term active place avoidance memory requires transient activation of particular molecules in dorsal hippocampus. These molecules include amongst others, the persistent kinases Ca-calmodulin kinase II (CaMKII) and the atypical protein kinase C isoform PKC / for acquisition of the conditioned behavior, whereas persistent activation of the other atypical PKC, protein kinase M zeta (PKM ) is necessary for maintaining the memory for at least a month. It nonetheless remains unclear what other molecules and their interactions maintain active place avoidance long-term memory, and the candidate molecule approach is both impractical and inadequate to identify new candidates since there are so many to survey.
    [Show full text]
  • Functional and Immunohistological Studies on Cancer-Associated Carbonic Anhydrase Ix
    D868etukansi.kesken.fm Page 1 Monday, January 16, 2006 1:35 PM D 868 OULU 2006 D 868 UNIVERSITY OF OULU P.O. Box 7500 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA D SERIES EDITORS Mari Leppilampi MEDICA MariLeppilampi ASCIENTIAE RERUM NATURALIUM Professor Mikko Siponen FUNCTIONAL AND BHUMANIORA IMMUNOHISTOLOGICAL Professor Harri Mantila STUDIES ON CANCER- CTECHNICA Professor Juha Kostamovaara ASSOCIATED CARBONIC DMEDICA Professor Olli Vuolteenaho ANHYDRASE IX ESCIENTIAE RERUM SOCIALIUM Senior assistant Timo Latomaa FSCRIPTA ACADEMICA Communications Officer Elna Stjerna GOECONOMICA Senior Lecturer Seppo Eriksson EDITOR IN CHIEF Professor Olli Vuolteenaho EDITORIAL SECRETARY Publication Editor Kirsti Nurkkala FACULTY OF MEDICINE, DEPARTMENT OF CLINICAL CHEMISTRY, DEPARTMENT OF PATHOLOGY, ISBN 951-42-7993-X (nid.) UNIVERSITY OF OULU ISBN 951-42-7994-8 (PDF) ISSN 0355-3221 ACTA UNIVERSITATIS OULUENSIS D Medica 868 MARI LEPPILAMPI FUNCTIONAL AND IMMUNOHISTOLOGICAL STUDIES ON CANCER-ASSOCIATED CARBONIC ANHYDRASE IX Academic Dissertation to be presented with the assent of the Faculty of Medicine, University of Oulu, for public discussion in the Auditorium 7 of Oulu University Hospital, on February 17th, 2006, at 12 noon OULUN YLIOPISTO, OULU 2006 Copyright © 2006 Acta Univ. Oul. D 868, 2006 Supervised by Professor Seppo Parkkila Docent Tuomo Karttunen Reviewed by Docent Teuvo Hentunen Professor Claudiu Supuran ISBN 951-42-7993-X (nid.) ISBN 951-42-7994-8 (PDF) http://herkules.oulu.fi/isbn9514279948/ ISSN 0355-3221 http://herkules.oulu.fi/issn03553221/ OULU UNIVERSITY PRESS OULU 2006 Leppilampi, Mari, Functional and immunohistological studies on cancer-associated carbonic anhydrase IX Faculty of Medicine, Department of Clinical Chemistry, Department of Pathology, University of Oulu, P.O.Box 5000, FI-90014 University of Oulu, Finland Acta Univ.
    [Show full text]
  • CA8 (NM 004056) Human Tagged ORF Clone – RG210228 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG210228 CA8 (NM_004056) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CA8 (NM_004056) Human Tagged ORF Clone Tag: TurboGFP Symbol: CA8 Synonyms: CA-RP; CA-VIII; CALS; CAMRQ3; CARP Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG210228 representing NM_004056 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGACCTGAGCTTCATCGAAGATACCGTCGCCTTCCCCGAGAAGGAAGAGGATGAGGAGGAAGAAG AGGAGGGTGTGGAGTGGGGCTACGAGGAAGGTGTTGAGTGGGGTCTGGTGTTTCCTGATGCTAATGGGGA ATACCAGTCTCCTATTAACCTAAACTCAAGAGAGGCTAGGTATGACCCCTCGCTGTTGGATGTCCGCCTC TCCCCAAATTATGTGGTGTGCCGAGACTGTGAAGTCACCAATGATGGACATACCATTCAGGTTATCCTGA AGTCAAAATCAGTTCTTTCGGGAGGACCATTGCCTCAAGGGCATGAATTTGAACTGTACGAAGTGAGATT TCACTGGGGAAGAGAAAACCAGCGTGGTTCTGAGCACACGGTTAATTTCAAAGCTTTTCCCATGGAGCTC CATCTGATCCACTGGAACTCCACTCTGTTTGGCAGCATTGATGAGGCTGTGGGGAAGCCGCACGGAATCG CCATCATTGCTCTGTTTGTTCAGATAGGAAAGGAACATGTTGGCTTGAAGGCTGTGACTGAAATCCTCCA AGATATTCAGTATAAGGGGAAGTCCAAAACAATACCTTGCTTTAATCCTAACACTTTATTACCAGACCCT CTGCTGCGGGATTACTGGGTGTATGAAGGCTCTCTCACCATCCCACCTTGCAGTGAAGGTGTCACCTGGA TATTATTCCGATACCCTTTAACTATATCCCAGCTACAGATAGAAGAATTTCGAAGGCTGAGGACACATGT TAAGGGGGCAGAACTTGTGGAAGGCTGTGATGGGATTTTGGGAGACAACTTTCGGCCCACTCAGCCTCTT AGTGACAGAGTCATTAGAGCTGCATTTCAG
    [Show full text]
  • CA8 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science CA8 Rabbit pAb Catalog No.: A7544 Basic Information Background Catalog No. The protein encoded by this gene was initially named CA-related protein because of A7544 sequence similarity to other known carbonic anhydrase genes. However, the gene product lacks carbonic anhydrase activity (i.e., the reversible hydration of carbon Observed MW dioxide). The gene product continues to carry a carbonic anhydrase designation based 33kDa on clear sequence identity to other members of the carbonic anhydrase gene family. The absence of CA8 gene transcription in the cerebellum of the lurcher mutant in mice with a Calculated MW neurologic defect suggests an important role for this acatalytic form. Mutations in this 32kDa gene are associated with cerebellar ataxia, mental retardation, and dysequilibrium syndrome 3 (CMARQ3). Polymorphisms in this gene are associated with osteoporosis, Category and overexpression of this gene in osteosarcoma cells suggests an oncogenic role. Alternative splicing results in multiple transcript variants. Primary antibody Applications WB, IHC Cross-Reactivity Human, Mouse Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 767 P35219 IHC 1:50 - 1:200 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 1-290 of human CA8 (NP_004047.3). Synonyms CA8;CA-RP;CA-VIII;CALS;CAMRQ3;CARP Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using CA8 antibody (A7544) at 1:1000 dilution.
    [Show full text]