DOCSLIB.ORG

Regulation and Roles of Carbonic Anhydrases IX and XII

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation and Roles of Carbonic Anhydrases IX and XII HEINI KALLIO Regulation and Roles of Carbonic Anhydrases IX and XII ACADEMIC DISSERTATION To be presented, with the permission of the board of the Institute of Biomedical Technology of the University of Tampere, for public discussion in the Auditorium of Finn-Medi 5, Biokatu 12, Tampere, on December 2nd, 2011, at 12 o’clock. UNIVERSITY OF TAMPERE ACADEMIC DISSERTATION University of Tampere, Institute of Biomedical Technology Tampere University Hospital Tampere Graduate Program in Biomedicine and Biotechnology (TGPBB) Finland Supervised by Reviewed by Professor Seppo Parkkila Docent Peppi Karppinen University of Tampere University of Oulu Finland Finland Professor Robert McKenna University of Florida USA Distribution Tel. +358 40 190 9800 Bookshop TAJU Fax +358 3 3551 7685 P.O. Box 617 [email protected] 33014 University of Tampere www.uta.fi/taju Finland http://granum.uta.fi Cover design by Mikko Reinikka Acta Universitatis Tamperensis 1675 Acta Electronica Universitatis Tamperensis 1139 ISBN 978-951-44-8621-0 (print) ISBN 978-951-44-8622-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://acta.uta.fi Tampereen Yliopistopaino Oy – Juvenes Print Tampere 2011 There is a crack in everything, that’s how the light gets in. -Leonard Cohen 3 CONTENTS CONTENTS .......................................................................................................... 4 LIST OF ORIGINAL COMMUNICATIONS...................................................... 7 ABBREVIATIONS .............................................................................................. 8 TIIVISTELMÄ ................................................................................................... 11 ABSTRACT ........................................................................................................ 13 1. INTRODUCTION ......................................................................................... 15 2. REVIEW OF THE LITERATURE ............................................................... 17 2.1 The importance of acid-base balance ...................................................... 17 2.2 The carbonic anhydrase isozyme family ................................................. 18 2.2.1 Historical and general aspects ...................................................... 18 2.2.2 Catalytic mechanism .................................................................... 19 2.2.3 Carbonic anhydrase-related proteins ............................................ 22 2.3 Expression and function of carbonic anhydrase isozymes ...................... 23 2.3.1 Cytosolic isozymes (I, II, III, VII, XIII) ....................................... 23 2.3.2 Mitochondrial isozymes (VA and VB) ........................................ 27 2.3.3 Secretory isozyme (VI) ................................................................ 27 2.3.4 Membrane-bound isozymes (IV, XIV, XV) ................................. 28 2.3.5 Membrane-bound isozyme IX ...................................................... 31 2.3.5.1 General aspects ................................................................ 31 2.3.5.2 Expression in normal tissues ............................................ 32 2.3.5.3 Expression in neoplastic tissues ....................................... 34 2.3.5.4 Knockout mouse model ................................................... 35 2.3.5.5 Functional role ................................................................. 36 2.3.6 Membrane-bound isozyme XII .................................................... 39 2.3.6.1 General aspects ................................................................ 39 2.3.6.2 Expression in normal tissues ............................................ 40 2.3.6.3 Expression in neoplastic tissues ....................................... 41 2.4 Carbonic anhydrases in embryonic development ................................... 43 2.4.1 Carbonic anhydrases I, II, III and VI ............................................ 43 2.5 Regulation of carbonic anhydrases ......................................................... 45 4 2.5.1 Carbonic anhydrase II ...................................................................45 2.5.2 Carbonic anhydrase IX .................................................................46 2.5.3 Carbonic anhydrase XII ................................................................50 3. AIMS OF THE STUDY .................................................................................52 4. MATERIALS AND METHODS ...................................................................53 4.1 Cell lines (II, IV) .....................................................................................53 4.2 Protein expression analyses .....................................................................53 4.2.1 Antibodies (I, IV) .........................................................................53 4.2.2 Immunohistochemistry (I) ............................................................54 4.2.3 Immunocytochemistry (IV) ..........................................................56 4.3 mRNA expression analyses .....................................................................57 4.3.1 Quantitative real-time PCR (QRT-PCR) (II-IV) .........................57 4.3.1.1 Human cancer-derived and normal cell lines (II) ............57 4.3.1.2 Car9Ǧ/Ǧ mice tissue samples (III)......................................58 4.3.1.3 Murine tissue samples (IV) ..............................................58 4.3.1.4 HeLa cell line samples (IV) .............................................58 4.3.1.5 Human pancreatic and breast cancer cell line samples (IV) .....................................................................59 4.3.1.6 U373, HeLa and Su.86.86 cell line samples (IV) ............59 4.3.1.7 RNA extraction and cDNA synthesis (II-IV) ..................59 4.3.1.8 Quantitative real-time PCR (II-IV)..................................59 4.3.2 MediSapiens data (IV) ..................................................................63 4.3.3 cDNA microarray (III) .................................................................63 4.3.3.1 Experimental procedure ...................................................63 4.3.3.2 Data analysis ....................................................................64 4.4 siRNA-mediated gene silencing (IV) ......................................................64 4.5 Cell growth analyses (IV) .......................................................................65 4.6 Production of recombinant human NCCRP1 using a bacterial expression system (IV) ...........................................................................66 4.6.1 Construction of recombinant human NCCRP1 ............................66 4.6.2 Production and purification of recombinant human NCCRP1 .......................................................................................67 4.7 Mass spectrometry (IV) ...........................................................................68 4.8 Bioinformatic analyses (IV) ....................................................................68 4.9 Statistical analyses (III, IV) ....................................................................69 5. RESULTS ......................................................................................................70 5 5.1 Influence of different treatments on CA9, CA12 and NCCRP1 mRNA levels in human cell lines (II, IV) .............................................. 70 5.2 Roles of CA IX and CA XII during mouse organogenesis (I, III) .......................................................................................................... 72 5.2.1 Expression of CA IX and CA XII during mouse embryonic development (I) .......................................................... 72 5.2.2 Genome-wide mRNA expression profiling in the gastric mucosa of Car9Ǧ/Ǧ mice (III) ........................................................ 73 5.3 Characterization of recombinant human NCCRP1 (IV) ......................... 74 5.3.1 Bioinformatic analyses ................................................................. 74 5.3.2 Biochemical properties ................................................................. 76 5.3.3 Subcellular localization ................................................................ 77 5.4 mRNA expression of NCCRP1 (IV) ....................................................... 77 5.4.1 Expression of Nccrp1 in mouse tissues ........................................ 77 5.4.2 Expression of NCCRP1 in human normal and cancer- derived tissues .............................................................................. 78 5.4.3 Expression of NCCRP1 in human pancreatic and breast cancer cell lines ............................................................................ 78 5.5 Silencing of NCCRP1 and CA9 (IV) ...................................................... 78 5.5.1 The functional connection between NCCRP1 and CA9 ............... 78 5.5.2 Influence of NCCRP1 silencing on cell growth ........................... 79 6. DISCUSSION ................................................................................................ 80 6.1 CA9 and CA12 are regulated by growth factors in human cell lines ........................................................................................................ 80 6.2 CA IX and CA XII expression during mouse organogenesis ................. 82 6.2.1 CA IX and CA XII are expressed in several tissues during mouse embryonic development ........................................ 82 6.2.2 Transcriptional
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2
    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
    [Show full text]
  • P-Glycoprotein-Mediated Chemoresistance Is Reversed by Carbonic Anhydrase XII Inhibitors
    www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 P-glycoprotein-mediated chemoresistance is reversed by carbonic anhydrase XII inhibitors Joanna Kopecka1, Gregory M. Rankin2, Iris C. Salaroglio1, Sally-Ann Poulsen2,*, Chiara Riganti1,* 1Department of Oncology, University of Torino, 10126 Torino, Italy 2Eskitis Institute for Drug Discovery, Griffith University, Brisbane, Nathan, Queensland, 4111, Australia *These authors contributed equally to this work Correspondence to: Sally-Ann Poulsen, email: [email protected] Chiara Riganti, email: [email protected] Keywords: carbonic anhydrase XII, P-glycoprotein, doxorubicin, chemoresistance, intracellular pH Received: August 26, 2016 Accepted: October 28, 2016 Published: November 03, 2016 ABSTRACT Carbonic anhydrase XII (CAXII) is a membrane enzyme that maintains pH homeostasis and sustains optimum P-glycoprotein (Pgp) efflux activity in cancer cells. Here, we investigated a panel of eight CAXII inhibitors (compounds 1–8), for their potential to reverse Pgp mediated tumor cell chemoresistance. Inhibitors (5 nM) were screened in human and murine cancer cells (colon, lung, breast, bone) with different expression levels of CAXII and Pgp. We identified three CAXII inhibitors (compounds 1, 2 and 4) that significantly (≥ 2 fold) increased the intracellular retention of the Pgp-substrate and chemotherapeutic doxorubicin, and restored its cytotoxic activity. The inhibitors lowered intracellular pH to indirectly impair Pgp activity. Ca12-knockout assays confirmed that the chemosensitizing property of the compounds was dependent on active CAXII. Furthermore, in a preclinical model of drug-resistant breast tumors compound 1 (1900 ng/kg) restored the efficacy of doxorubicin to the same extent as the direct Pgp inhibitor tariquidar. The expression of carbonic anhydrase IX had no effect on the intracellular doxorubicin accumulation.
    [Show full text]
  • An Investigation Into the Carbonic Anhydrase Isozymes from Zea
    This file is part of the following reference: Tems, Ursula (2009) Characterization of the carbonic anhydrase isozymes of zea mays. PhD thesis, James Cook University. Access to this file is available from: http://eprints.jcu.edu.au/8807 Characterization of the Carbonic Anhydrase Isozymes of Zea mays Thesis submitted by Ursula TEMS B.Sc. Hons (JCU) February 2009 for the degree of Doctor of Philosophy in the School of Pharmacy and Molecular Sciences James Cook University Statement of Sources I declare that this thesis is my own work and has not been submitted in any form for another degree or diploma at any university or other institution of tertiary education. Information derived from the published or unpublished work of others has been acknowledged in the text and a list of references is given. Signature Date i Statement of Access I, the undersigned, author of this work, understand that James Cook University will make this thesis available for use within the University Library and, via the Australian Digital Theses network, for use elsewhere. I understand that, as an unpublished work, a thesis has significant protection under the Copyright Act and; I do not wish to place any further restriction on access to this work. Signature Date Declaration I, the undersigned, the author of this work, declare that the electronic copy of this thesis provided to the James Cook University Library is an accurate copy of the print thesis submitted, within the limits of the technology available. Signature Date ii Acknowledgements I would like to express my sincere gratitude to my supervisor Jim Burnell for his enthusiasm, encouragement and guidance.
    [Show full text]
  • CDH12 Cadherin 12, Type 2 N-Cadherin 2 RPL5 Ribosomal
    5 6 6 5 . 4 2 1 1 1 2 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 A A A A A A A A A A A A A A A A A A A A C C C C C C C C C C C C C C C C C C C C R R R R R R R R R R R R R R R R R R R R B , B B B B B B B B B B B B B B B B B B B , 9 , , , , 4 , , 3 0 , , , , , , , , 6 2 , , 5 , 0 8 6 4 , 7 5 7 0 2 8 9 1 3 3 3 1 1 7 5 0 4 1 4 0 7 1 0 2 0 6 7 8 0 2 5 7 8 0 3 8 5 4 9 0 1 0 8 8 3 5 6 7 4 7 9 5 2 1 1 8 2 2 1 7 9 6 2 1 7 1 1 0 4 5 3 5 8 9 1 0 0 4 2 5 0 8 1 4 1 6 9 0 0 6 3 6 9 1 0 9 0 3 8 1 3 5 6 3 6 0 4 2 6 1 0 1 2 1 9 9 7 9 5 7 1 5 8 9 8 8 2 1 9 9 1 1 1 9 6 9 8 9 7 8 4 5 8 8 6 4 8 1 1 2 8 6 2 7 9 8 3 5 4 3 2 1 7 9 5 3 1 3 2 1 2 9 5 1 1 1 1 1 1 5 9 5 3 2 6 3 4 1 3 1 1 4 1 4 1 7 1 3 4 3 2 7 6 4 2 7 2 1 2 1 5 1 6 3 5 6 1 3 6 4 7 1 6 5 1 1 4 1 6 1 7 6 4 7 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m
    [Show full text]
  • Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed.
    [Show full text]
  • Anti-CA1 / Carbonic Anhydrase 1 Antibody (ARG65670)
    Product datasheet [email protected] ARG65670 Package: 100 μl, 50 μl anti-CA1 / Carbonic Anhydrase 1 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes CA1 / Carbonic Anhydrase 1 Tested Reactivity Ms, Rat Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name CA1 / Carbonic Anhydrase 1 Antigen Species Human Immunogen Full length fusion protein of Human CA1. Conjugation Un-conjugated Alternate Names Carbonic anhydrase I; EC 4.2.1.1; Carbonate dehydratase I; Carbonic anhydrase B; Car1; HEL-S-11; CA-I; Carbonic anhydrase 1; CAB Application Instructions Application table Application Dilution WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control WB: Mouse liver tissue Calculated Mw 29 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (pH 7.3), 0.05% Sodium azide and 50% Glycerol Preservative 0.05% Sodium azide Stabilizer 50% Glycerol Concentration 0.9 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol CA1 Gene Full Name carbonic anhydrase I Background Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide.
    [Show full text]
  • The Design, Optimization and Testing of Y Chromosome
    THE DESIGN, OPTIMIZATION AND TESTING OF Y CHROMOSOME SHORT TANDEM REPEAT MEGAPLEXES by Richard Schoske submitted to the Faculty of the College of Arts and Sciences of American University in Partial Fulfillment of the requirements for the Degree of Doctor of Philosophy in Chemistry Chair: ________________________ Dr. James Girard ________________________ Dr. Albert Cheh ________________________ Dr. John M. Butler ______________________________ Dean of the College _________________ Date 2003 American University Washington, D.C. 20016 THE DESIGN, OPTIMIZATION AND TESTING OF Y CHROMOSOME SHORT TANDEM REPEAT MEGAPLEXES BY Richard Schoske ABSTRACT A multiplex polymerase chain reaction (PCR) assay capable of the simultaneous amplifying 20 Y chromosome short tandem repeat (STR) markers has been developed and tested to aid human testing and population studies. These markers include all of the Y-STR markers that make up the “extended haplotype” used in Europe (DYS19, DYS385 a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, and YCAII a/b) plus the additional polymorphic Y-STR markers (DYS437, DYS438, DYS439, DYS447, DYS448, DYS388, DYS460, and GATA H4). The Y-STR 20plex is the first to include a simultaneous amplification of all the markers within the European “minimal” and “extended haplotype.” A subset of the Y-STR 20plex primers, the Y-STR 9plex was also developed and tested. The Y-STR 9plex contains only the markers within the European minimal haplotype. Lastly, a Y-STR 11plex was designed and tested. The markers within the Y-STR 11plex are DYS385 a/b, DYS447, DYS448, DYS450, DYS456, DYS458 and DYS 464 a/b/c/d. ii Validation experiments were performed in order to assess the reliability of the haplotypes generated by these newly designed Y-STR multiplexes.
    [Show full text]
  • An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas Reinhardtii
    H OH metabolites OH Review An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas reinhardtii Ashok Aspatwar 1,* ID , Susanna Haapanen 1 and Seppo Parkkila 1,2 1 Faculty of Medicine and Life Sciences, University of Tampere, FI-33014 Tampere, Finland; [email protected].fi (S.H.); [email protected].fi (S.P.) 2 Fimlab, Ltd., and Tampere University Hospital, FI-33520 Tampere, Finland * Correspondence: [email protected].fi; Tel.: +358-46-596-2117 Received: 11 January 2018; Accepted: 10 March 2018; Published: 13 March 2018 Abstract: Carbonic anhydrases (CAs) are metalloenzymes that are omnipresent in nature. − + CAs catalyze the basic reaction of the reversible hydration of CO2 to HCO3 and H in all living organisms. Photosynthetic organisms contain six evolutionarily different classes of CAs, which are namely: α-CAs, β-CAs, γ-CAs, δ-CAs, ζ-CAs, and θ-CAs. Many of the photosynthetic organisms contain multiple isoforms of each CA family. The model alga Chlamydomonas reinhardtii contains 15 CAs belonging to three different CA gene families. Of these 15 CAs, three belong to the α-CA gene family; nine belong to the β-CA gene family; and three belong to the γ-CA gene family. The multiple copies of the CAs in each gene family may be due to gene duplications within the particular CA gene family. The CAs of Chlamydomonas reinhardtii are localized in different subcellular compartments of this unicellular alga. The presence of a large number of CAs and their diverse subcellular localization within a single cell suggests the importance of these enzymes in the metabolic and biochemical roles they perform in this unicellular alga.
    [Show full text]
  • Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights Into Their Mechanisms of Action
    International Journal of Molecular Sciences Review Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights into Their Mechanisms of Action Agnieszka Taracha, Grzegorz Kotarba and Tomasz Wilanowski * Laboratory of Signal Transduction, Nencki Institute of Experimental Biology of Polish Academy of Sciences, 3 Pasteur St., 02-093 Warsaw, Poland; [email protected] (A.T.); [email protected] (G.K.) * Correspondence: [email protected]; Tel.: +48-22-5892-311 Received: 21 August 2018; Accepted: 19 September 2018; Published: 20 September 2018 Abstract: In recent years, the TFCP2 (transcription factor cellular promoter 2)/TFCP2L1 (TFCP2- like 1)/UBP1 (upstream binding protein 1) subfamily of transcription factors has been attracting increasing attention in the scientific community. These factors are very important in cancer, Alzheimer’s disease, and other human conditions, and they can be attractive targets for drug development. However, the interpretation of experimental results is complicated, as in principle, any of these factors could substitute for the lack of another. Thus, studying their hitherto little known functions should enhance our understanding of mechanisms of their functioning, and analogous mechanisms might govern their functioning in medically relevant contexts. For example, there are numerous parallels between placental development and cancer growth; therefore, investigating the roles of TFCP2, TFCP2L1, and UBP1 in the placenta may help us better understand their functioning in cancer, as is evidenced by the studies of various other proteins and pathways. Our review article aims to call the attention of the scientific community to these neglected functions, and encourage further research in this field.
    [Show full text]
  • Structural Characterization of Beta Carbonic Anhydrases from Higher Plants
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1998 Structural Characterization of Beta Carbonic Anhydrases From Higher Plants. Michael H. Bracey Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Bracey, Michael H., "Structural Characterization of Beta Carbonic Anhydrases From Higher Plants." (1998). LSU Historical Dissertations and Theses. 6655. https://digitalcommons.lsu.edu/gradschool_disstheses/6655 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type o f computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.
    [Show full text]