DOCSLIB.ORG

A Dissertation Entitled the Regulatory Role of Mixed Lineage Kinase 4

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Dissertation Entitled the Regulatory Role of Mixed Lineage Kinase 4 A Dissertation entitled The Regulatory Role of Mixed Lineage Kinase 4 Beta in MAPK Signaling and Ovarian Cancer Cell Invasion by Widian F. Abi Saab Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology _________________________________________ Dr. Deborah Chadee, Committee Chair _________________________________________ Dr. Douglas Leaman, Committee Member _________________________________________ Dr. Fan Dong, Committee Member _________________________________________ Dr. John Bellizzi, Committee Member _________________________________________ Dr. Max Funk, Committee Member _________________________________________ Dr. Robert Steven, Committee Member _________________________________________ Dr. William Taylor, Committee Member _________________________________________ Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo May 2013 Copyright 2013, Widian Fouad Abi Saab This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Regulatory Role of Mixed Lineage Kinase 4 Beta in MAPK Signaling and Ovarian Cancer Cell Invasion by Widian F. Abi Saab Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology The University of Toledo May 2013 Mixed lineage kinase 4 (MLK4) is a member of the MLK family of mitogen- activated protein kinase kinase kinases (MAP3Ks). As components of a three-tiered signaling cascade, MAP3Ks promote activation of mitogen-activated protein kinase (MAPK), which in turn regulates different cellular processes including proliferation and invasion. Here, we show that the beta form of MLK4 (MLK4β), unlike its close relative, MLK3, and other known MAP3Ks, negatively regulates the activities of the MAPKs, p38, ERK and JNK, even in response to stimuli such as sorbitol or TNFα. MLK4β also negatively regulates basal, but not TNFα-induced, NF-κB activity. Moreover, MLK4β undergoes autophosphorylation and has kinase activity towards histone H2A, but has no kinase activity towards the MAP2K, MEK4/SEK1, a known substrate for MLK3 and other MAP3Ks. Furthermore, MLK4β interacts with MLK3 and inhibits MLK3 activation. In addition, MLK4 blocks matrix metalloproteinase-9 gelatinase activity and invasion in SKOV3 ovarian cancer cells, both of which are cellular responses that require MLK3. Collectively, our data establish MLK4β as a novel suppressor of MLK3 activation, MAPK signaling and cell invasion. iii This work is dedicated to my dad, Fouad Abi Saab, and mom, Nabila Abi Saab, who sacrificed a lot to provide a good education for my brother and me. I most certainly would not be where I am today if it wasn’t for them. I also dedicate this work to my brother (Rawad), my grandmas (Fayza and Samia), my aunts (Thouraya, Feryal, Noha and Sonia) and all my cousins (Yara, Ziad, Lama, Wahid, Tamara and Faisal). However, a special dedication goes to my beloved Grandma, Fayza Darweesh, who is my role model. She is my inspiration and the source of my strength and has always been my number one supporter. Her words and constant encouragement are my driving force to move forward in life. I would also like to grab this opportunity to thank my dearest friends (Alexis, Ani, Celia, Hadil, Hashem, Meenakshi, Mirella, Nancy and Natalya) who’ve been extremely encouraging and supportive throughout my Ph.D. program. Acknowledgements First, I would like to thank my advisor, Dr. Chadee, who had given me the chance to be here and who taught me most of what I currently know in this field. Dr. Chadee is a very supportive and positive person and creates a very amiable environment for her students. In addition to being successful in her field, she is also extremely compassionate and understanding. She was very supportive especially during hard times and for that I’ll be forever grateful. Not only is Dr. Chadee successful in her career, but she also has an exemplary sense of humanity which makes her a great role model for me. I would also like to thank my committee members Dr. Douglas Leaman, Dr. Fan Dong, Dr. John Bellizzi, Dr. Max Funk, Dr. Robert Steven and Dr. William Taylor for their constant input and guidance. I especially thank Dr. Taylor, Dr. Leaman and Dr. Dong, for their technical support in a number of experiments. I would like to especially thank Cathy (Dr. Yu Zhan) for teaching me most of the techniques in lab and for being a good friend. Special thanks to Natalya Blessing for being a wonderful lab mate and friend. I would also like to thank Meenakshi Bhansali for her amazing friendship and support. Last but not least, I would like to thank Dr. Leah Rider, Jenny, Alan, Peter, Sneha, April and Kyoung for being such good friends and for adding a joyful and pleasant atmosphere to our working environment. v Table of Contents Abstract .............................................................................................................................. iii Acknowledgements ..............................................................................................................v Table of Contents ............................................................................................................... vi List of Figures .................................................................................................................... ix List of Abbreviations ......................................................................................................... xi 1 Introduction………………………………………………………………………..1 1.1 The Mitogen-activated protein kinase signaling cascade ...............................1 1.2 Characteristics and functions of MAPK proteins…………………………….3 1.2.1 The ERK1/2 pathway………………………………………………..3 1.2.2 The JNK pathway…………………………………………………...7 1.2.3 The p38 pathway…………………………………………………...11 1.2.4 The ERK5 pathway………………………………………………...14 1.3 The matrix metalloproteinases……………………………………………….15 1.4 The MAP2Ks………………………………………………………………...18 1.5 The MAP3Ks………………………………………………………………...20 1.5.1 The MEKK group………………………………………………….21 1.5.2 The Raf MAP3Ks………………………………………………….23 1.5.3 The TAK1 MAP3K group…………………………………………25 1.5.4 The TAO/Tpl2 and Mos MAP3K groups………………………….27 1.5.5 The MLK family of MAP3Ks……………………………………..27 vi 1.5.5.1 The DLK subgroup ...........................................................28 1.5.5.2 The ZAK subgroup………………………………………30 1.6 The MLK subfamily…………………………………………………………31 1.6.1 MLK1 and MLK2………………………………………………….32 1.6.2 MLK3 activation…………………………………………………...33 1.7 MLK3 signaling……………………………………………………………...36 1.7.1 MLK3 signaling in cancer…………………………………………38 1.8 MLK4: characteristics and function………………………………………….39 1.9 Significance…………………………………………………………………..40 2 Materials and Methods ...........................................................................................42 2.1 Cell culture…………………………………………………………………...42 2.2 Expression vectors…………………………………………………………...43 2.3 Plasmids and siRNA transfections…………………………………………...43 2.4 Immunoblotting………………………………………………………………45 2.5 Preparation of whole cell extracts and treatments…………………………...47 2.6 Immunoprecipitation…………………………………………………………47 2.7 MLK4β kinase assay…………………………………………………………48 2.8 Cell proliferation assay………………………………………………………49 2.9 Luciferase assay……………………………………………………………...50 2.10 Invasion assay………………………………………………………………50 2.11 Gelatin zymography………………………………………………………...51 3 Results……………………………………………………………………………52 3.1 The role of MLK4β in p38 signaling………………………………………...52 vii 3.1.1 The effect of ectopic expression of MLK4β on p38 activation…...52 3.1.2 The effect of endogenous MLK4 on the activation of p38. ………54 3.2 The effect of MLK4 on MEK3/MEK6 activation….………………………..56 3.3 The role of MLK4β in NF-κB signaling……………………………………..57 3.4 Comparison of the effects of MLK4β and MLK3 on p38 activation ……….60 3.5 The effects of MLK3 and MLK4 on ERK and JNK activation……………..62 3.6 MLK4β is not an upstream activator of MEK4……………………………...65 3.7 MLK4β kinase activity……………………………...……………………….67 3.8 The effect of MLK4β on MLK3 activation………………………………….69 3.9 The correlation between MLK4β expression and active MLK3 in different cell lines……………………………………………………………...……………….72 3.10 MLK4β associates with MLK3……………………………………………..75 3.11 The effect of MLK4 on cell proliferation…………………………………..77 3.12 MLK3 is required for cell invasion in ovarian cancer cells………………...79 3.13 MLK4β inhibits SKOV3 cell invasion……………………………………..81 3.14 MLK3 regulates MMP-2 and MMP-9 enzyme activity…………………….82 3.15 MLK4β reduces MMP-9 activity in SKOV3 cells…………………………85 4 Discussion………………………………………………………………………..86 References……………………………………………………………………………….95 viii List of Figures 1-1 The MAPK signaling cascade ..................................................................................2 1-2 The Ras/Raf/ERK1/2 signaling pathway .................................................................6 1-3 JNK-mediated apoptosis…………………………………………………………10 1-4 The p38 MAPK signaling pathway………………………………………………13 1-5 MMP-2 and -9: structure and activation…………………………………………17 1-6 The NF-κB pathway……………………………………………………………...26 1-7 Signaling of the DLK family of MAP3Ks……………………………………….29 1-8 The structural domains of MLKs………………………………………………...31 1-9 Model mechanism of MLK3 activation by Cdc42………………………………35 3-10 MLK4β expression inhibits basal and stimulus-induced p38 activation ...............54 3-11 Elevated active p38 in MLK4 knockdown cells…………………………………55
Load more

Recommended publications
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
    [Show full text]
  • Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§
    392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2].
    [Show full text]
  • N-Glycan Trimming in the ER and Calnexin/Calreticulin Cycle
    Neurotransmitter receptorsGABA and A postsynapticreceptor activation signal transmission Ligand-gated ion channel transport GABAGABA Areceptor receptor alpha-5 alpha-1/beta-1/gamma-2 subunit GABA A receptor alpha-2/beta-2/gamma-2GABA receptor alpha-4 subunit GABAGABA receptor A receptor beta-3 subunitalpha-6/beta-2/gamma-2 GABA-AGABA receptor; A receptor alpha-1/beta-2/gamma-2GABA receptoralpha-3/beta-2/gamma-2 alpha-3 subunit GABA-A GABAreceptor; receptor benzodiazepine alpha-6 subunit site GABA-AGABA-A receptor; receptor; GABA-A anion site channel (alpha1/beta2 interface) GABA-A receptor;GABA alpha-6/beta-3/gamma-2 receptor beta-2 subunit GABAGABA receptorGABA-A receptor alpha-2receptor; alpha-1 subunit agonist subunit GABA site Serotonin 3a (5-HT3a) receptor GABA receptorGABA-C rho-1 subunitreceptor GlycineSerotonin receptor subunit3 (5-HT3) alpha-1 receptor GABA receptor rho-2 subunit GlycineGlycine receptor receptor subunit subunit alpha-2 alpha-3 Ca2+ activated K+ channels Metabolism of ingested SeMet, Sec, MeSec into H2Se SmallIntermediateSmall conductance conductance conductance calcium-activated calcium-activated calcium-activated potassium potassium potassiumchannel channel protein channel protein 2 protein 1 4 Small conductance calcium-activatedCalcium-activated potassium potassium channel alpha/beta channel 1 protein 3 Calcium-activated potassiumHistamine channel subunit alpha-1 N-methyltransferase Neuraminidase Pyrimidine biosynthesis Nicotinamide N-methyltransferase Adenosylhomocysteinase PolymerasePolymeraseHistidine basic
    [Show full text]
  • Regulation of Skeletal Muscle Metabolism and Development by Small, Non-Coding Rnas: Implications for Insulin Resistance and Type 2 Diabetes Mellitus
    From the Department of Molecular Medicine and Surgery Karolinska Institutet, Stockholm, Sweden Regulation of Skeletal Muscle Metabolism and Development by Small, Non-Coding RNAs: Implications for Insulin Resistance and Type 2 Diabetes Mellitus Rasmus Sjögren Stockholm 2018 All previously published papers were reproduced with permission from the publisher. © 2017 by the American Diabetes Association ® Diabetes 2017 Jul; 66(7): 1807-1818 Reprinted with permission from the American Diabetes Association ® Published by Karolinska Institutet. Printed by Eprint AB, 2018. © Rasmus Sjögren, 2018. ISBN 978-91-7831-057-9 Department of Molecular Medicine and Surgery Regulation of Skeletal Muscle Metabolism and Development by Small, Non-Coding RNAs: Implications for Insulin Resistance and Type 2 Diabetes Mellitus THESIS FOR DOCTORAL DEGREE (Ph.D.) by Rasmus Sjögren Defended on: Wednesday the 13th of June 2018, 12:30 pm Hillarpsalen, Retzius väg 8, Stockholm Principal Supervisor: Opponent: Prof Juleen R. Zierath Prof Markus Stoffel Karolinska Institutet Swiss Federal Institute of Technology in Zurich Department of Molecular Medicine and Surgery Department of Biology Division of Integrative Physiology Division of Metabolism and Metabolic Diseases Co-supervisor(s): Examination Board: Prof Anna Krook Prof Ulf Eriksson Karolinska Institutet Karolinska Insitutet Department of Physiology and Pharmacology Department of Medical Biochemistry and Bio- Division of Integrative Physiology physics Division of Vascular Biology Prof Eckardt Treuter Karolinska Insitutet Department of Biosciences and Nutrition Division of Epigenome Regulation Prof Lena Eliasson Lund University Department of Clinical Sciences, Malmö Division of Islet Cell Exocytosis ABSTRACT microRNAs (miRNAs) are a class of epigenetic post-transcriptional regulators. These short (~22 nucleotides) non-coding RNAs can potently reduce protein abundance through direction of the RNA-induced silencing complex to targeted genes.
    [Show full text]
  • Diverse Physiological Functions for Dual-Specificity MAP Kinase
    Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes.
    [Show full text]
  • G Protein Regulation of MAPK Networks
    Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Anti-CA1 / Carbonic Anhydrase 1 Antibody (ARG65670)
    Product datasheet [email protected] ARG65670 Package: 100 μl, 50 μl anti-CA1 / Carbonic Anhydrase 1 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes CA1 / Carbonic Anhydrase 1 Tested Reactivity Ms, Rat Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name CA1 / Carbonic Anhydrase 1 Antigen Species Human Immunogen Full length fusion protein of Human CA1. Conjugation Un-conjugated Alternate Names Carbonic anhydrase I; EC 4.2.1.1; Carbonate dehydratase I; Carbonic anhydrase B; Car1; HEL-S-11; CA-I; Carbonic anhydrase 1; CAB Application Instructions Application table Application Dilution WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control WB: Mouse liver tissue Calculated Mw 29 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (pH 7.3), 0.05% Sodium azide and 50% Glycerol Preservative 0.05% Sodium azide Stabilizer 50% Glycerol Concentration 0.9 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol CA1 Gene Full Name carbonic anhydrase I Background Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide.
    [Show full text]
  • MAPK4 Overexpression Promotes Tumor Progression Via Noncanonical Activation of AKT/Mtor Signaling
    The Journal of Clinical Investigation RESEARCH ARTICLE MAPK4 overexpression promotes tumor progression via noncanonical activation of AKT/mTOR signaling Wei Wang,1 Tao Shen,1 Bingning Dong,1 Chad J. Creighton,2,3 Yanling Meng,1 Wolong Zhou,1 Qing Shi,1 Hao Zhou,1 Yinjie Zhang,1 David D. Moore,1 and Feng Yang1 1Department of Molecular and Cellular Biology, 2Department of Medicine, and 3Dan L. Duncan Cancer Center, Baylor College of Medicine, Houston, Texas, USA. MAPK4 is an atypical MAPK. Currently, little is known about its physiological function and involvement in diseases, including cancer. A comprehensive analysis of 8887 gene expression profiles in The Cancer Genome Atlas (TCGA) revealed that MAPK4 overexpression correlates with decreased overall survival, with particularly marked survival effects in patients with lung adenocarcinoma, bladder cancer, low-grade glioma, and thyroid carcinoma. Interestingly, human tumor MAPK4 overexpression also correlated with phosphorylation of AKT, 4E-BP1, and p70S6K, independent of the loss of PTEN or mutation of PIK3CA. This led us to examine whether MAPK4 activates the key metabolic, prosurvival, and proliferative kinase AKT and mTORC1 signaling, independent of the canonical PI3K pathway. We found that MAPK4 activated AKT via a novel, concerted mechanism independent of PI3K. Mechanistically, MAPK4 directly bound and activated AKT by phosphorylation of the activation loop at threonine 308. It also activated mTORC2 to phosphorylate AKT at serine 473 for full activation. MAPK4 overexpression induced oncogenic outcomes, including transforming prostate epithelial cells into anchorage-independent growth, and MAPK4 knockdown inhibited cancer cell proliferation, anchorage-independent growth, and xenograft growth. We concluded that MAPK4 can promote cancer by activating the AKT/mTOR signaling pathway and that targeting MAPK4 may provide a novel therapeutic approach for cancer.
    [Show full text]
  • Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights Into Their Mechanisms of Action
    International Journal of Molecular Sciences Review Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights into Their Mechanisms of Action Agnieszka Taracha, Grzegorz Kotarba and Tomasz Wilanowski * Laboratory of Signal Transduction, Nencki Institute of Experimental Biology of Polish Academy of Sciences, 3 Pasteur St., 02-093 Warsaw, Poland; [email protected] (A.T.); [email protected] (G.K.) * Correspondence: [email protected]; Tel.: +48-22-5892-311 Received: 21 August 2018; Accepted: 19 September 2018; Published: 20 September 2018 Abstract: In recent years, the TFCP2 (transcription factor cellular promoter 2)/TFCP2L1 (TFCP2- like 1)/UBP1 (upstream binding protein 1) subfamily of transcription factors has been attracting increasing attention in the scientific community. These factors are very important in cancer, Alzheimer’s disease, and other human conditions, and they can be attractive targets for drug development. However, the interpretation of experimental results is complicated, as in principle, any of these factors could substitute for the lack of another. Thus, studying their hitherto little known functions should enhance our understanding of mechanisms of their functioning, and analogous mechanisms might govern their functioning in medically relevant contexts. For example, there are numerous parallels between placental development and cancer growth; therefore, investigating the roles of TFCP2, TFCP2L1, and UBP1 in the placenta may help us better understand their functioning in cancer, as is evidenced by the studies of various other proteins and pathways. Our review article aims to call the attention of the scientific community to these neglected functions, and encourage further research in this field.
    [Show full text]
  • Targeting the Mitogen-Activated Protein Kinase Pathway in the Treatment of Malignant Melanoma David J
    Targeting the Mitogen-Activated Protein Kinase Pathway in the Treatment of Malignant Melanoma David J. Panka, Michael B. Atkins, and James W. Mier Abstract The mitogen-activated protein kinase (MAPK; i.e., Ras ^ Raf ^ Erk) pathway is an attractive target for therapeutic intervention in melanoma due to its integral role in the regulation of proliferation, invasiveness, and survival and the recent availability of pharmaceutical agents that inhibit the various kinases and GTPases that comprise the pathway. Genetic studies have identified activating mutations in either B-raf or N-ras in most cutaneous melanomas. Other studies have delineated the contribution of autocrine growth factors (e.g., hepatocyte growth factor and fibroblast growth factor) to MAPK activation in melanoma. Still, others have emphasized the consequences of the down-modulation of endogenous raf inhibitors, such as Sprouty family members (e.g., SPRY2) and raf-1kinase inhibitory protein, in the regulation of the pathway. The diversity of molecular mechanisms used by melanoma cells to ensure the activity of the MAPK pathway attests to its importance in the evolution of the disease and the likelihood that inhibitors of the pathway may prove to be highly effective in melanoma treatment. MAPK inhibition has been shown to result in the dephosphorylation of the proapoptotic Bcl-2 family members Bad and Bim. This process in turn leads to caspase activation and, ultimately, the demise of melanoma cells through the induction of apoptosis. Several recent studies have identified non ^ mitogen-activated protein/ extracellular signal-regulated kinase kinase ^ binding partners of raf and suggested that the prosurvival effects of raf and the lethality of raf inhibition are mediated through these alternative targets, independent of the MAPK pathway.
    [Show full text]
  • G Protein-Coupled Receptor Signalling in Neuroendocrine Systems
    117 G PROTEIN-COUPLED RECEPTOR SIGNALLING IN NEUROENDOCRINE SYSTEMS ‘Location, location, location’: activation and targeting of MAP kinases by G protein-coupled receptors L M Luttrell Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA and The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, Durham, North Carolina 27705, USA (Requests for offprints should be addressed to L M Luttrell, N3019 The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, 508 Fulton Street, Durham, North Carolina 27710, USA; Email: [email protected]) Abstract A growing body of data supports the conclusion that G protein-coupled receptors can regulate cellular growth and differentiation by controlling the activity of MAP kinases. The activation of heterotrimeric G protein pools initiates a complex network of signals leading to MAP kinase activation that frequently involves cross-talk between G protein-coupled receptors and receptor tyrosine kinases or focal adhesions. The dominant mechanism of MAP kinase activation varies significantly between receptor and cell type. Moreover, the mechanism of MAP kinase activation has a substantial impact on MAP kinase function. Some signals lead to the targeting of activated MAP kinase to specific extranuclear locations, while others activate a MAP kinase pool that is free to translocate to the nucleus and contribute to a mitogenic response. Journal of Molecular Endocrinology (2003) 30, 117–126 Introduction between intracellular receptor domains and the GDP-bound G subunit of a heterotrimeric G The G protein-coupled receptors (GPCRs) make protein triggers GTP for GDP exchange on the G up the largest superfamily of cell surface receptors subunit and dissociation of the GTP-bound G in the human genome, where they are represented subunit from the G heterodimer.
    [Show full text]