DOCSLIB.ORG

Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ 392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2]. The recent completion of the Arabidopsis thaliana (At) genome sequence presents a new opportunity to identify 1369-5266/01/$ — see front matter and isolate the large gene families encoding MAPKs and © 2001 Elsevier Science Ltd. All rights reserved. their immediate upstream regulators, MAPK kinases Abbreviations (MAPKKs) and MAPKK kinases (MAPKKKs) on the basis At Arabidopsis thaliana of sequence conservation (Table 1). Various combinations CTR1 CONSTITUTIVE TRIPLE RESPONSE 1 of this large set of genes provide the diversity and specificity DSP dual specificity MAPK phosphatase EDR1 ENHANCED DISEASE RESISTANCE 1 necessary to transmit a broad spectrum of signals in plants. ERK extracellular signal-regulated kinase The challenge ahead is to develop additional tools to better MAPK (or MPK) mitogen-activated protein kinase define the components of plant MAPK cascades and to MAPKK MAPK kinase determine the specific roles of individual MAPK cascade MAPKKK MAPKK kinase MEK/MKK MAPK kinase genes in particular signal transduction pathways. MEKK MAPKK kinase MKP MAPK phosphatase A general background to MAPK signaling cascades has MMK Medicago MAPK been provided by excellent reviews on organisms from Ms Medicago sativa NPK1 Nicotiana protein kinase yeast, to mammals, to plants [2,5,6]. In this review, we offer Nt Nicotiana tabacum the first glance at the coding capacity for MAPK cascade PTP phosphotyrosine phosphatase genes in the Arabidopsis genome (Table 1), and focus on SA salicylic acid the most recent progress in the identification of plant SAMK stress-activated MAPK SAR systemic acquired resistance MAPK, MAPKK, and MAPKKK genes in specific signal SIMK salt-induced MAPK transduction pathways (Figure 1). We also discuss the SIMKK SIMK kinase emerging feature of antagonistic interactions between SIPK salicylic-acid-inducible protein kinase MAPK signaling cascades (Figure 2). WIPK wound-inducible protein kinase Plant MAPK cascade genes Introduction Known eukaryotic MAPKs can be divided into three Plants possess integrated signaling networks that mediate main subfamilies on the basis of their structural charac- the perception of and responses to the hormones, nutri- teristics, which often correlate with their functions in ents, and environmental cues and stresses that govern distinct signal transduction pathways [7]. However, all plant growth and development. Our current knowledge plant MAPK genes described so far belong to a single of plant signal transduction pathways has come from the group, the so-called extracellular signal-regulated kinase identification of the sensors and receptors that perceive (ERK) subfamily. In mammals, members of this the signal, and of the transcription factors and target subfamily are mainly responsible for the transduction of genes that coordinate the response [1]. What is missing mitogenic signals but, in plants, ERKs seem to have from our understanding of most plant signal transduction evolved in such a way as to be able to transmit a broader pathways, however, is the identity of the regulatory range of stimuli [8]. Plant MAP kinase signaling cascades Tena et al. 393 Figure 1 Plant Arabidopsis Tobacco Alfalfa Arabidopsis Tobacco Signal Bacterial Oxidative Fungal Salt Abiotic Mitosis elicitor stress elicitor stress stresses cytokinesis Sensor FLS2? AtHK1? MAPKKK AtMEKK1 AtANP1 AtMEKK1 NtNPK1 (NtNPK1) (AtANP1) AtMKK4/5 NtMEK2 MsSIMKK AtMKK1/2 NtMEK1 ∗∗ MAPKK (NtMEK2) (AtMKK4/5) (AtMKK4/5) (NtSIPKK) (MsSIMKK) (MsSIMKK) (NtMEK2) AtMPK3/6 AtMPK3/6 NtSIPK/WIPK MsSIMK AtMPK4 NtNtf6 ∗∗ MAPK (NtWIPK/SIPK) (AtMPK3/6) (AtMPK6) (MsMMK2) (MsMMK3) (MsSAMK/SIMK ∗) (MsSAMK/SIMK ∗) (NtSIPK) Target GST6, HSP18.2 (+) HMGR(+) PAL(+) ??? genes GH3, ER7 (–) PAL(+) Negative AtMKP1? AtMKP1? ? ? MsMP2C? ? regulator AtPTP1? AtPTP1? Current Opinion in Plant Biology MAPK cascades in diverse plant signal transduction pathways. NtNQK1, and tobacco NtNTF6 is NtNRK1. The negative regulators A general schematic presentation of signal transduction pathways is shown here are limited to known MAPK-specific phosphatases: dual- shown on the left. FLS2 is the putative receptor for the flagellin peptide specificity MAPK phosphatase (AtMKP1), phosphotyrosine elicitor flg22. AtHK1 is the putative histidine kinase osmosensor. The phosphatase (AtPTP1), and protein phosphatase 2C (MsMP2C). ER7, functionally defined MAPK-cascade components are shown in bold. auxin-inducible enhancer; GH3 auxin-inducible promoter; GST, MAPK, MAPKK and MAPKKK homologs in three plant species, tobacco glutathione-S-transferase; HMGR, 3-hydroxy-3-methylglutaryl CoA (Nt), alfalfa (Ms) and Arabidopsis (At) are shown. *Alfalfa MsSAMK is reductase; HSP, heat shock protein; PAL, phenylalanine ammonia-lyase; MsMMK4, MsSIMK is MsMMK1. **Tobacco NtMEK1 is the same as (+) positive regulation; (–) negative regulation. In terms of physiological roles, the best-characterized plant a combination of physiological, genetic and/or biochemical MAPK proteins are from Medicago sativa (alfalfa), Nicotiana data. A global survey of the MAPK cascade gene expression tabacum (tobacco) and Arabidopsis. A whole-genome survey patterns using customized microarrays in Arabidopsis could of the MAPK genes and the genes encoding their upstream help to establish their functionality. A more systematic regulators (MAPKKs and MAPKKKs) is, however, currently nomenclature of MAPK cascade genes would also facilitate possible only in Arabidopsis (Table 1). According to our information exchange among research groups working on sequence search criteria with highly conserved signature different plant species (see Figure 1 and Table 1). motifs, there are 23 MAPK and 9 MAPKK genes in the Arabidopsis genome (Table 1). The sequences of putative MAPK cascades in hormonal responses MAPKKK genes [4] are more divergent than those of other Extensive studies have linked MAPKs with mitogenic members of the MAPK cascades. In the Arabidopsis stimuli in mammalian cells, thus providing the generic genome, a comprehensive database search has identified name for this subclass of protein kinases. In plants, auxin more than 25 MAPKKK gene candidates on the basis of (as a mitogen) has previously been linked to MAPK acti- sequence conservation in the kinase domain (Table 1). The vation in tobacco BY-2 cells [14]; however, at that time, the MAPKKK gene candidates can be divided into at least two extreme sensitivity of plant MAPKs to mechanical stress main subfamilies, typified by their mammalian homologs: was not recognized. Other researchers were unable to Raf-like (e.g. AtCTR1 and AtEDR1) and MEKK-like show auxin activation of MAPK using the same system, (e.g. AtANP1 and AtMEKK1) [9,10•,11••–13••]. The true but did stimulate a strong MAPK-like activation by simply functional proof of any MAPK cascade component requires re-suspending BY-2 cells in fresh medium or treating the 394 Cell signalling and gene regulation Table 1 MAPK cascades components in the Arabidopsis genome. Total Minimal signature cDNA Function described Subfamilies number motif described Members Act. Loop MAPK 23 TxYVxxRWYRAPE 9 3: Group 1: AtMPK3, AtMPK6 3 TEY AtMPK3, 4, 6 Group 2: AtMPK4, AtMPK5 5 TEY [10•,11••,43••] Group 3: AtMPK1, AtMPK2, AtMPK7 4 TEY Group 4: AtMPK8, AtMPK9 8 TDY Group 5: AtMHK 3 TEY Members MAPKK 9 [ST]xxGTxxYMxPER 5 4: Group 1: AtMEK1, AtMKK2 3 AtMEK1, AtMKK2 Group 2: AtMKK4, AtMKK5 2 AtMKK4, 5 [25] Group 3: AtMKK3 1 (T Asai, G Tena, Group 4: No described cDNA 3 unpublished data) Putative members MAPKKK
Load more

Recommended publications
  • Diverse Physiological Functions for Dual-Specificity MAP Kinase
    Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes.
    [Show full text]
  • Plant-To-Plant Communication Triggered by Systemin Primes Anti
    www.nature.com/scientificreports OPEN Plant-to-plant communication triggered by systemin primes anti- herbivore resistance in tomato Received: 10 February 2017 Mariangela Coppola1, Pasquale Cascone2, Valentina Madonna1, Ilaria Di Lelio1, Francesco Accepted: 27 October 2017 Esposito1, Concetta Avitabile3, Alessandra Romanelli 4, Emilio Guerrieri 2, Alessia Vitiello1, Published: xx xx xxxx Francesco Pennacchio1, Rosa Rao1 & Giandomenico Corrado1 Plants actively respond to herbivory by inducing various defense mechanisms in both damaged (locally) and non-damaged tissues (systemically). In addition, it is currently widely accepted that plant- to-plant communication allows specifc neighbors to be warned of likely incoming stress (defense priming). Systemin is a plant peptide hormone promoting the systemic response to herbivory in tomato. This 18-aa peptide is also able to induce the release of bioactive Volatile Organic Compounds, thus also promoting the interaction between the tomato and the third trophic level (e.g. predators and parasitoids of insect pests). In this work, using a combination of gene expression (RNA-Seq and qRT-PCR), behavioral and chemical approaches, we demonstrate that systemin triggers metabolic changes of the plant that are capable of inducing a primed state in neighboring unchallenged plants. At the molecular level, the primed state is mainly associated with an elevated transcription of pattern -recognition receptors, signaling enzymes and transcription factors. Compared to naïve plants, systemin-primed plants were signifcantly more resistant to herbivorous pests, more attractive to parasitoids and showed an increased response to wounding. Small peptides are nowadays considered fundamental signaling molecules in many plant processes and this work extends the range of downstream efects of this class of molecules to intraspecifc plant-to-plant communication.
    [Show full text]
  • G Protein Regulation of MAPK Networks
    Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Polypeptide Hormones1
    Polypeptide Hormones1 Clarence A. Ryan* and Gregory Pearce Institute of Biological Chemistry, Washington State University, Pullman, Washington 99164–6340 Polypeptide signaling is an emerging field in plant developing assays for biological activity and physical biology, particularly in areas of defense, fertilization, detection. The isolations of systemin and phytosulfo- Downloaded from https://academic.oup.com/plphys/article/125/1/65/6098950 by guest on 30 September 2021 growth, and development. Until 1991, polypeptide kines did not result from direct searches for polypep- hormones and pheromones were thought to be only tide hormones, but from the use of the scientific found in animals and yeast, and it was thought that method in seeking the causes of specific biological plants had evolved signaling systems that did not effects, including the systemic signal(s) for plant de- include polypeptide signals. Following the initial dis- fense (systemin) and the cause of the conditioned covery in 1991 of the 18-amino acid polypeptide de- medium response (phytosulfokines). It would be fu- fense hormone systemin and its precursor prosyste- tile to directly seek polypeptide hormones in plants min in tomato leaves (6, 9), several plant polypeptide without some indication that the particular process signals have been isolated and characterized or else involved a polypeptide ligand. Mutational analyses identified by gene tagging (3, 5, 13, 15). In addition, and gene isolation have been powerful tools in iden- several genes have been identified in plants that code tifying regulatory genes that code for polypeptide for proteins having extracellular Leu-rich domains ligands, and for genes that code for LRR receptors to (LRRs) (1, 4, 7, 12, 14) that are typical of polypeptide- effect biological function.
    [Show full text]
  • ERK Cascade Pathway
    Biochemistry and Biophysics Reports 7 (2016) 10–19 Contents lists available at ScienceDirect Biochemistry and Biophysics Reports journal homepage: www.elsevier.com/locate/bbrep Glutamine up-regulates MAPK phosphatase-1 induction via activation of Ca2 þ- ERK cascade pathway Otgonzaya Ayush a, Zhe Wu Jin c, Hae-Kyoung Kim b, Yu-Rim Shin d, Suhn-Young Im e, Hern-Ku Lee b,n a Department of Dermatology, Medical University, Mongolian National University of Medical Sciences, Ulaanbaatar, Mongolia b Departments of Immunology and Institute for Medical Science, Chonbuk National University Medical School, Jeonju, Republic of Korea c Department of Anatomy and Histology and Embryology, Yanbian University Medical College, YanJi City, Jilin Province, China d Biofoods Story, Inc, 477 Jeonjucheon-seoro, Wansan-gu, Jeonju, Jeonbuk 560-821, Republic of Korea e Department of Biological Sciences, College of Natural Sciences, Chonnam National University, Gwangju, Republic of Korea article info abstract Article history: The non-essential amino acid L-glutamine (Gln) displays potent anti-inflammatory activity by deacti- Received 3 February 2016 vating p38 mitogen activating protein kinase and cytosolic phospholipase A2 via induction of MAPK Received in revised form phosphatase-1 (MKP-1) in an extracellular signal-regulated kinase (ERK)-dependent way. In this study, 9 May 2016 the mechanism of Gln-mediated ERK-dependency in MKP-1 induction was investigated. Gln increased Accepted 11 May 2016 ERK phosphorylation and activity, and phosphorylations of Ras, c-Raf, and MEK, located in the upstream Available online 12 May 2016 pathway of ERK, in response to lipopolysaccharidein vitro and in vivo. Gln-induced dose-dependent 2 þ Keywords: transient increases in intracellular calcium ([Ca ]i) in MHS macrophage cells.
    [Show full text]
  • Lipopolysaccharide Macrophage Responses to Tristetraprolin
    Dual-Specificity Phosphatase 1 and Tristetraprolin Cooperate To Regulate Macrophage Responses to Lipopolysaccharide This information is current as of August 28, 2019. Tim Smallie, Ewan A. Ross, Alaina J. Ammit, Helen E. Cunliffe, Tina Tang, Dalya R. Rosner, Michael L. Ridley, Downloaded from Christopher D. Buckley, Jeremy Saklatvala, Jonathan L. Dean and Andrew R. Clark J Immunol 2015; 195:277-288; Prepublished online 27 May 2015; http://www.jimmunol.org/ doi: 10.4049/jimmunol.1402830 http://www.jimmunol.org/content/195/1/277 Supplementary http://www.jimmunol.org/content/suppl/2015/05/27/jimmunol.140283 Material 0.DCSupplemental at Aston Univ - SciTech Faculty Team on August 28, 2019 References This article cites 65 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/195/1/277.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 The Authors All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Dual-Specificity Phosphatase 1 and Tristetraprolin Cooperate To Regulate Macrophage Responses to Lipopolysaccharide Tim Smallie,*,1 Ewan A.
    [Show full text]
  • Provide Concise Answers in the Space Provided After Each Question. If You Need More Space, Continue on the Backside of the Page
    Bio 328. Spring 2005 KEY Test #3 Provide concise answers in the space provided after each question. If you need more space, continue on the backside of the page. The potential value of each answer is 4 points unless otherwise noted in the margin. 1. (a) In the Figure below, circle the histidine kinase domain of ETR1. (b) Describe an experiment and results that revealed whether histidine kinase activity is required for ETR1 function. Ans.: Scientists found that a modified gene that coded for an ETR1 protein that had an only slightly altered histidine kinase domain, but no histidine kinase activity, could substitute for a wild-type gene and maintain full ethylene sensitivity. (c) What is the functional relationship of ETR1 to CTR1 and how does ethylene binding change this relationship, and thus change the function of CTR1? Ans. : In the absence of bound ethylene ETR1 binds to CTR1 allowing CTR1 to inhibit the activity of a positive regulator EIN2. When ethylene binds to ETR1, it releases CTR1 and this de-represses EIN2. 2. (a) Define what is EIN3, compare its relative level in wild-type plants in the presence and absence of ethylene, and indicate by what mechanism ethylene changes the level of EIN3. Ans.: EIN3 is a transcription factor that induces the transcription of ethylene responsive genes. Its level is higher in the presence than in the absence of ethylene, because ethylene presence on its receptors results in the inactivation of two F-box proteins, EBF1 and EBF2. In the absence of ethylene these proteins would promote the ubiquitination and subsequent destruction of EIN3.
    [Show full text]
  • Hydrogen Peroxide Is Generated Systemically in Plant Leaves by Wounding and Systemin Via the Octadecanoid Pathway
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 6553–6557, May 1999 Plant Biology Hydrogen peroxide is generated systemically in plant leaves by wounding and systemin via the octadecanoid pathway MARTHA OROZCO-CARDENAS AND CLARENCE A. RYAN* Institute of Biological Chemistry, Washington State University, Pullman, WA 99163-6340 Contributed by Clarence A. Ryan, March 29, 1999 ABSTRACT Hydrogen peroxide (H2O2) generated in re- been shown to cause the oxidative burst in plant cell suspension sponse to wounding can be detected at wound sites and in cultures (2, 3, 11). OGA and systemin, an 18-aa polypeptide distal leaf veins within 1 hr after wounding. The response is signal, activated the induction of proteinase inhibitors in leaves systemic and maximizes at about 4–6 hr in both wounded and of tomato plants (12–14), but systemin did not generate an unwounded leaves, and then declines. The timing of the oxidative burst when added to tomato cell suspension cultures response corresponds with an increase in wound-inducible (15). However, within 9 hr of the addition of systemin to the polygalacturonase (PG) mRNA and enzyme activity previ- suspension cultures, the generation of ROS in response to ously reported, suggesting that oligogalacturonic acid (OGA) OGA was increased 16-fold over the response in the absence fragments produced by PG are triggering the H2O2 response. of systemin (15). The addition of cycloheximide to the cells Systemin, OGA, chitosan, and methyl jasmonate (MJ) all before systemin addition inhibited the potentiation, suggesting induce the accumulation of H2O2 in leaves. Tomato plants that systemin may be inducing synthesis of the oxidase or of a transformed with an antisense prosystemin gene produce cell component that enhances the activity of the oxidase in the neither PG activity or H2O2 in leaves in response to wounding, presence of OGA.
    [Show full text]
  • G Protein-Coupled Receptor Signalling in Neuroendocrine Systems
    117 G PROTEIN-COUPLED RECEPTOR SIGNALLING IN NEUROENDOCRINE SYSTEMS ‘Location, location, location’: activation and targeting of MAP kinases by G protein-coupled receptors L M Luttrell Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA and The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, Durham, North Carolina 27705, USA (Requests for offprints should be addressed to L M Luttrell, N3019 The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, 508 Fulton Street, Durham, North Carolina 27710, USA; Email: [email protected]) Abstract A growing body of data supports the conclusion that G protein-coupled receptors can regulate cellular growth and differentiation by controlling the activity of MAP kinases. The activation of heterotrimeric G protein pools initiates a complex network of signals leading to MAP kinase activation that frequently involves cross-talk between G protein-coupled receptors and receptor tyrosine kinases or focal adhesions. The dominant mechanism of MAP kinase activation varies significantly between receptor and cell type. Moreover, the mechanism of MAP kinase activation has a substantial impact on MAP kinase function. Some signals lead to the targeting of activated MAP kinase to specific extranuclear locations, while others activate a MAP kinase pool that is free to translocate to the nucleus and contribute to a mitogenic response. Journal of Molecular Endocrinology (2003) 30, 117–126 Introduction between intracellular receptor domains and the GDP-bound G subunit of a heterotrimeric G The G protein-coupled receptors (GPCRs) make protein triggers GTP for GDP exchange on the G up the largest superfamily of cell surface receptors subunit and dissociation of the GTP-bound G in the human genome, where they are represented subunit from the G heterodimer.
    [Show full text]
  • Mitogen-Activated Protein Kinase and Its Activator Are Regulated by Hypertonic Stress in Madin-Darby Canine Kidney Cells
    Mitogen-activated protein kinase and its activator are regulated by hypertonic stress in Madin-Darby canine kidney cells. T Itoh, … , N Ueda, Y Fujiwara J Clin Invest. 1994;93(6):2387-2392. https://doi.org/10.1172/JCI117245. Research Article Madin-Darby canine kidney cells behave like the renal medulla and accumulate small organic solutes (osmolytes) in a hypertonic environment. The accumulation of osmolytes is primarily dependent on changes in gene expression of enzymes that synthesize osmolytes (sorbitol) or transporters that uptake them (myo-inositol, betaine, and taurine). The mechanism by which hypertonicity increases the transcription of these genes, however, remains unclear. Recently, it has been reported that yeast mitogen-activated protein (MAP) kinase and its activator, MAP kinase-kinase, are involved in osmosensing signal transduction and that mutants in these kinases fail to accumulate glycerol, a yeast osmolyte. No information is available in mammals regarding the role of MAP kinase in the cellular response to hypertonicity. We have examined whether MAP kinase and MAP kinase-kinase are regulated by extracellular osmolarity in Madin-Darby canine kidney cells. Both kinases were activated by hypertonic stress in a time- and osmolarity-dependent manner and reached their maximal activity within 10 min. Additionally, it was suggested that MAP kinase was activated in a protein kinase C- dependent manner. These results indicate that MAP kinase and MAP kinase-kinase(s) are regulated by extracellular osmolarity. Find the latest version:
    [Show full text]
  • Dual-Specificity Phosphatases in Immunity and Infection
    International Journal of Molecular Sciences Review Dual-Specificity Phosphatases in Immunity and Infection: An Update Roland Lang * and Faizal A.M. Raffi Institute of Clinical Microbiology, Immunology and Hygiene, Universitätsklinikum Erlangen, Friedrich-Alexander-Universität Erlangen-Nürnberg, 91054 Erlangen, Germany * Correspondence: [email protected]; Tel.: +49-9131-85-22979 Received: 15 May 2019; Accepted: 30 May 2019; Published: 2 June 2019 Abstract: Kinase activation and phosphorylation cascades are key to initiate immune cell activation in response to recognition of antigen and sensing of microbial danger. However, for balanced and controlled immune responses, the intensity and duration of phospho-signaling has to be regulated. The dual-specificity phosphatase (DUSP) gene family has many members that are differentially expressed in resting and activated immune cells. Here, we review the progress made in the field of DUSP gene function in regulation of the immune system during the last decade. Studies in knockout mice have confirmed the essential functions of several DUSP-MAPK phosphatases (DUSP-MKP) in controlling inflammatory and anti-microbial immune responses and support the concept that individual DUSP-MKP shape and determine the outcome of innate immune responses due to context-dependent expression and selective inhibition of different mitogen-activated protein kinases (MAPK). In addition to the canonical DUSP-MKP, several small-size atypical DUSP proteins regulate immune cells and are therefore also reviewed here. Unexpected and complex findings in DUSP knockout mice pose new questions regarding cell type-specific and redundant functions. Another emerging question concerns the interaction of DUSP-MKP with non-MAPK binding partners and substrate proteins.
    [Show full text]