THE ROLE OF OSTEOCYTES IN DISUSE AND MICROGRAVITY-INDUCED BONE LOSS

byMASCUETINTTT AFTCHNOG

Jordan Matthew Spatz B.S., M.S. University of Colorado at Boulder SEP 2 4 2015

Submitted to the LIBRARIES Harvard-MIT Program in Health Sciences and Technology in Partial Fulfillment of the Requirements for the Degree of I DOCTOR OF PHILOSOPHY IN HEALTH SCIENCES AND TECHNOLOGY at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY September 2015 2015 Massachusetts Institute of Technology. All rights reserved.

Signature of Author: Signature redacted Harvard-MIT Program in Health Sciences and Technology September 1st, 2015

Certified by: Signature redacted Mary L. Bouxsein, Ph.D. Associate Professor of Orthopedic Surgery, Harvard Medical School Thesis Supervisor

A A

Certified by: Signature redacted ___ i aola Divieti Pajevic, MD, Ph.D. Ass ciate Professor of Iolecular and Cell, Boston University Thesiy Supervisor Signature redacted Accepted byr. Emery N. Brown, MD, Ph.D. Director, Harv d-MIT Program in Health Sciences and Technology Professor of Computational Neuroscience & Health Sciences and Technology 2 The Role of Osteocytes in Disuse and Microgravity-Induced Bone Loss

by

Jordan Matthew Spatz B.S., M.S. University of Colorado at Boulder

Submitted to the Harvard-MIT Health Sciences and Technology September 2015, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Health Sciences and Technology Abstract

A human mission to Mars will be physically demanding and presents a variety of medical risks to crewmembers. It has been recognized for over a century that loading is fundamental for bone health, and that reduced loading, as in prolonged bed rest or space flight, leads to bone loss. Osteocytes, the most abundant bone cell type, are thought to be key mechanical sensors in bone, yet the molecular mechanism of this action remains poorly understood. Improved understanding of how osteocytes regulate skeletal responses to mechanical loading and unloading could have significant implications for treatment of bone disorders related to disuse or immobilization. Thus, we conducted in vitro and in vivo studies on osteocytes exposed to unloading to investigate their role in disuse and microgravity-induced bone loss. Specifically, we generated and characterized a novel osteocytic cell line that recapitulates the response to hormonal and mechanical stimuli of osteocytes in vivo. This novel cell line provided the first evidence of a cell-autonomous increase in sclerostin, a potent inhibitor of Wnt- signaling, following exposure to simulated microgravity. These cells were also used for a spaceflight mission after demonstrating their ability to maintain an osteocytic phenotype when cultured in a fully automated flight-certified system. Finally, we utilized murine models of unloading to show that pharmacologic inhibition of sclerostin induces bone formation and prevents disuse-induced bone loss.

Thesis Supervisor: Mary L. Bouxsein, Ph.D. Associate Professor of Orthopedic Surgery, Harvard Medical School

Thesis Supervisor: Paola Divieti Pajevic, MD, Ph.D. Associate Professor of Molecular and Cell Biology, Boston University

3 Thesis Committee

Laurence R. Young, Sc.D (Chair) Apollo Program Professor of Astronautics and Professor of Health Sciences and Technology, Director of HST PhD Program in Bioastronautics

Mary L. Bouxsein, Ph.D. (Thesis Supervisor) Associate Professor of Orthopedic Surgery, Harvard Medical School Associate Biologist, Endocrine Division, Massachusetts General Hospital Adjunct Assistant Professor, Department of Mechanical Engineering, Boston University Faculty Member, Bioastronautics Program, Harvard-MIT Division of Health Sciences and Technology

Paola Divieti Pajevic, MD, Ph.D. (Thesis Supervisor) Associate Professor of Molecular and Cell Biology, Goldman School of Dental Medicine, Boston University Associate Biologist, Endocrine Unit, Massachusetts General Hospital

Jeffrey M Karp, Ph.D. (Thesis Reader) Associate Professor, Harvard Medical School Co-Director, Center for Regenerative Therapeutics, Brigham and Women's Hospital

4 Acknowledgments

In an effort that spans so many years and milestones there are many to be thanked. My graduate school years would be nothing were it not for those who encouraged me to follow my dreams, supported my development academically, personally, and as a scientist throughout this process.

To my advisors: for always having an open-door, putting my career at the top of your list, and answering my endless questions no matter your other priorities.

Mary Bouxsein: I will always remember our afternoon advisor conversations and hope to live up to your passion for science to do my part to make the world a better place. Your dedication to always have my back, my career development as a person, and a scientist has been something I will carry forward with me throughout my life and career.

Paola Divieti Pajevic: I could not have known from coming to your lab as engineer for help to learn to grow osteocytes how much I would learn from you. I cannot thank you enough for passionately teaching me the amazing science of biology that I gained from working side-by-side with you at the bench and how to always do the best science. Thank you for the courage to allow me to try crazy ideas and for sticking with me throughout this learning journey.

Jeff Karp: Thank you for imparting to me your forward thinking and progressive perspective on advancing science throughout my M.I.T. graduate studies. I will carry with, throughout my career, your advice to change the calculus when presented with an otherwise intractable problem and remember your advice on how to think outside the box.

5 Larry Young: My passion for bioastronautics would not have led to me to M.I.T. without your foresight to believe in me. Thank you for enriching and enhancing my passion for aerospace medicine and the human exploration of the universe.

To my funding sources: Northrop Grumman Aerospace Systems Ph.D. Training Fellowship, M.I.T. Hugh Hampton Young Fellowship, the National Space Biomedical Research Institute through NASA NCC 9-58, Beth Israel Deaconess Medical Center Translational Research in Aging Training Program, and the U.S. Army Institute for Environmental Medicine Oak Ridge Science Institute for Science and Education fellowship program.

To my NASA mentors: Jean Sibonga, Scott Smith, Zara Smith, and Honglu Wu thank you for mentorship and hosting my research at the NASA Johnson Spaceflight Center.

To my U.S. Army Institute of Environmental Medicine mentors: Julie Hughes and Wayne Matheny thank you for the mentorship, friendship, and support.

To my colleagues: that helped make this thesis a reality by conducting experiments with me throughout my graduate work, but especially Rachel Ellman, Keertik Fulzele, Yili Qu, Shawn Liu, Chris Dedic, Forest Lai, Jonathan Gooi, Alison Cloutier, Leeann Louis, Miranda Van Vliet, Daniel Brooks, and Jenna Garr thank you from the bottom of my heart for the long hours and tireless dedication.

To Hank Kronenberg: thank you for always spending time to provide deep insight and teachings, shadowing in clinic, and for advice all things endocrine over the many years at M.G.H.

To Marc Wein: your starting to work with the osteocyte cell line during the mid- stretch of my thesis studies was like having an all-star baseball reliever in

6 baseball coming out of the bullpen with the bases loaded and nobody out. Thank you for all the career mentorship, opportunity to work with you both at the bench and the bedside, and always spending time to help make me a better scientist.

To Chris Adamson, Lowell Misener, Margaret Eberle, and the rest of the Calm Technologies team: thank for just being awesome for many years of dedication and answering of my endless questions on the Osteo-4 project.

To my fellow bioastronautics and M.I.T. manned vehicle colleagues: Dava Newman, Alan Natapoff, Leia Sterling, Alexander Bruno, Dan Buckland, Katelyn Burkhart, Dustin Kendrick, Conor Culliane, Nikhil Vadhavkar, Justin Kaderka, Aaron Johnson, Allie Anderson, Torin Clark, and Erika Wagner thank you for your friendship and long conversations about human space exploration and aerospace medicine.

To my M.G.H. endocrine unit colleagues: Lynn Moulton, Julia Maclaughlin, Latanya Turner, Leslie Johnson, Marie Demay, Tatsuya Kobayashi, John Potts, Henry Keutmann, Tom Gardella, Harald Jueppner, Kelly Lauter, Melissa Putnam, Paula Cohen at Beth Israel Deaconess Medical Center, and Elizabeth Zotos at M.I.T. this thesis would not have occurred without your tireless efforts of support over the many years of my graduate studies.

To my Northrop Grumman colleagues: thank you for the continued dedicated support throughout my graduate school years at M.I.T.

To the National Space Biomedical Research Institute (NSBRI): thanks to educational support and encouragement from Dr. Jeff Sutton, Dr. John Clark, and Amanda Hackler.

And last but first in my heart, to my friends and family: for all your love and support!

7 8 Biographical Note

Jordan Matthew Spatz was born in Fontana, California and raised in Los Angeles. From 2001 to 2006, he attended the University of Colorado at Boulder, earning Masters and Bachelors degrees in Aerospace Engineering Sciences. In 2006, Jordan joined Northrop Grumman Corporation as an aerospace systems engineer for two years prior to starting his doctoral studies at the Massachusetts Institute of Technology. During his tenure at M.I.T. Jordan also lead an Engineers Without Borders project to build a preschool in the Palaung hill tribe village, Ban Nor Lae, in the province of Chiang Mai, Thailand. He held fellowships from Northrop Grumman Corporation, M.I.T. Hugh Hampton Young, the National Space Biomedical Research Institute, Beth Israel Deaconess Medical Center Translational Research in Aging Training Program, and the U.S. Army Institute for Environmental Medicine Oak Ridge Science Institute for Science and Education.

9 "We found ourselves bidding goodbye to the old learn-by-heart method, and beginning the study of observing the facts and laws of nature. We learned from experiment and experience what might be expected to happen if a given set of forces started to act.

In short, our feet were set at last in the way of real knowledge. We learned, perhaps falteringly at the outset, the four steps that mark the only route to true science: how to observe, how to record, how to collate, and how to conclude."

Robert Hallowell Richards, M.I.T., 1868

10 1 INTRODUCTION 15 1.1 BACKGROUND 15 1.2 HYPOTHESIS AND RESEARCH OBJECTIVES 16 1.3 THESIS OUTLINE 16 2 OSTEOCYTE'S ROLE IN SKELETAL BIOLOGY 27 2.1 LIFE OF AN OSTEOCYTE 28 2.2 OSTEOCYTE ORCHESTRATION OF BONE HOMEOSTASIS 29 2.3 OSTEOCYTE AS BONE'S MECHANO-SENSOR 30 2.4 OSTEOCYTE ORCHESTRATION OF MINERAL HOMEOSTASIS 30 2.5 OSTEOCYTE ORCHESTRATION OF HEMATPOIESIS 31 2.6 OSTEOCYTE ORCHESTRATION OF IMMUNE FUNCTION AND FAT METABOLISM 31 2.7 SUMMARY 32 3 OSTEOCYTES: MICROGRAVITY AND DISUSE INDUCE BONE LOSS 37 3.1 SKELETAL HEALTH IN LONG DURATION SPACEFLIGHT 37 3.2 OSTEOCYTE ORCHESTRATION OF MECHANOTRANSDUCTION 38 3.3 OSTEOCYTE ORCHESTRATION OF OSTEOBLASTS IN MECHANICAL UNLOADING 39 3.4 OSTEOCYTE ORCHESTRATION OF OSTEOCLASTS IN MECHANICAL UNLOADING 40 3.5 OSTEOCYTE DEPLETED MICE ARE RESISTANT TO DISUSE-INDUCED BONE LOSS 41 3.6 OSTEOCYTE OSTEOLYSIS IN DISUSE-INDUCED BONE LOSS 41 3.7 GROUND BASED MODELS OF MICROGRAVITY AND DISUSE BONE LOSS 42 3.7.1 In-vivo (rodent) ground based models of mechanical unloading 42 3.7.2 In-vitro models of mechanical unloading 42 4 DEVELOPMENT AND CHARACTERIZATION OF A NOVEL OSTEOCYTIC CELL LINE OCY454) 49 4.1 RATIONALE 50 4.2 INTRODUCTION 50 4.3 MATERIALS AND METHODS 51 4.3.1 Osteocytic cell line 51 4.3.2 Quantitative real time pcr 52 4.3.3 Western blot 53 4.3.4 Sclerostin immunohistochemistry 53 4.3.5 Sclerostin elisa 54 4.4 RESULTS 55 4.4.1 Osteocytic cell line basal and hormonal characterization 55 4.4.2 Three-dimensional culture enhances osteocytic phenotype 63 4.5 CONCLUSION 65 5 OSTEOCYTES AS BONE'S GRAVITY SENSOR: CELL AUTONOMOUS INCREASES IN SCLEROSTIN IN MECHANICAL UNLOADING 67 5.1 RATIONALE 68 5.2 INTRODUCTION 68 5.3 MATERIALS AND METHODS 70 5.3.1 Simulated microgravity 70 5.3.2 Two dimensional laminar fluid shear stress 71 5.3.3 Three dimensional laminar fluid shear stress 71 5.3.4 Statistical Analysis 71 5.4 RESULTS 72 5.4.1 Fluid shear stress regulation of Ocy454 in two-dimensional culture 72 5.4.2 Simulated microgravity increases SOST/sclerostin and Rankl 72 5.4.3 GPCR responsiveness: SOST/Sclerostin in simulated microgravity 75 5.4.4 Long Term fluid shear stress regulation of Ocy454 76 5.5 DISCUSSION 79 5.6 CONCLUSION 82

11 6 PREPARATION FOR AN OSTEOCYTE CELL LINE EXPERIMENT TO THE INTERNATIONAL SPACE STATION 87 6.1 RATIONALE 88 6.2 KEY FINDINGS 88 6.3 FLIGHT HARDWARE FOR MICROGRAVITY BONE BIOLOGY STUDIES 89 6.4 OSTEo-4 UPGRADES FOR ISS COMPATIBILITY 90 6.4.1 Osteo-4 Fluid Pathway 93 6.5 MATERIAL AND METHODS 94 6.5.1 Cell Culture 94 6.5.1 Quantitative Real Time PCR 95 6.6 RESULTS 95 6.6.1 Osteo-4 spaceflight bioreactors 95 6.6.2 Osteocytic response to random launch vibration 97 6.6.3 Preservation of Osteo-4 bioreactors in space flight environment_ 98 6.7 CONCLUSIONS 100 7 SCLEROSTIN ANTIBODY INHIBITS SKELETAL DETERIORATION DUE TO REDUCED MECHANICAL LOADING 101 7.1 INTRODUCTION AND RATIONALE 102 7.2 PHARMACOLOGIC PREVENTION OF BONE LOSS 102 7.3 KEY FINDINGS 103 7.4 BACKGROUND 104 7.5 MATERIAL AND METHODS 105 7.5.1 Overview of study design _ 105 7.5.2 Bone mineral density and body composition 106 7.5.3 Specimen harvesting and preparation 106 7.5.4 Bone turnover markers 106 7.5.5 Histology and quantitative histomorphometry 106 7.5.6 Mechanical testing 107 7.5.7 Statistical analysis 108 7.6 RESULTS 109 76.1 Bndvmas_ 109 7.6.2 Muscle mass 109 7.6.3 Bone mineral density 109 7.6.4 Bone microarchitecture 110 7.6.5 Mid-femoral biomechanics and pFEA of the distal femur metaphysis 115 7.6.6 Serum sclerostin and bone turnover markers 117 7.6.7 Histomorphometry 118 7.7 DISCUSSION 119 7.8 CONCLUSION 122 8 SCLEROSTIN ANTIBODY INHIBITS SKELETAL DETERIORATION IN MICE EXPOSED TO PARTIAL WEIGHT-BEARING IN MICE 127 8.1 RATIONALE 127 8.2 KEY FINDINGS 128 8.3 INTRODUCTION 128 8.4 MATERIAL AND METHODS 129 8.4.1 Overview of study design _ 129 8.4.2 Partial weight-bearing (PWB) model 129 8.4.3 Bone mineral density and muscle mass 130 8.4.4 Specimen harvesting and preparation 130 8.4.5 Serum markers of bone metabolism 130 8.4.6 Bone microarchitecture 130 8.4.7 Mechanical testing _131 8.4.8 Statistical analysis 131 8.5 RESULTS 132

12 8.5.1 Body mass and muscle mass 132 8.5.2 Bone mineral density 132 8.5.3 Bone volume and microarchitecture 133 8.5.4 Femoral strength 136 8.5.5 Bone turnover markers 137 8.6 DISCUSSION 137 8.7 CONCLUSION 139 9 SERUM SCLEROSTIN INCREASES IN HEALTHY ADULT MEN IN BED REST 141 9.1 RATIONALE 142 9.2 INTRODUCTION 142 9.3 SUBJECTS AND MATERIALS 143 9.3.1 Subjects 143 9.3.2 Serum sclerostin and bone turnover markers 144 9.3.3 Bone mineral density 144 9.3.4 Statistical analysis 145 9.4 RESULTS 145 9.4.1 Serum sclerostin and PTH 145 9.4.2 Bone mineral density 146 9.4.3 Serum and urinary markers of bone turnover 146 9.5 DISCUSSION 147 9.6 CONCLUSION 149 10 SUMMARY AND CONCLUSIONS 153 10.1 SUMMARYOF HYPOTHESES 153 10.2 FUTURE WORK 154 10.3 CONCLUSIONS 155

13 List of Abbreviations

BMD Bone Mineral Density eOSTEO Enhanced OSTeoporosis Experiments on Orbit HLU Hind limb unloading ISS International Space Station NASA National Aeronautics and Space Administration NIH National Institute of Health Ocy454 Osteocyte cell line PWB Partial Weight Bearing

PGE 2 Prostaglandin E2 PTH Parathyroid hormone SclAblI Sclerostin antibody SpaceX Space Exploration Technologies Corporation STS Space Transportation System pFEA Micro-finite element analysis

14 Chapter 1

1 Introduction

1.1 Background

It has been recognized for over a century that mechanical loading is fundamental for the proper development and maintenance of the musculoskeletal system'. Reduced loading in the setting of spinal cord injury, prolonged bed rest, aging or experienced by astronauts in space flight is invariability associated with bone

Ioss2-5. Although it is known that bone responds to its mechanical environment, the mechanisms underlying this response are poorly understood6 -6 .

Osteocyte cells are the most abundant, 90% of all bone cells, yet least understood bone cell type in the human body. Recent discoveries ascribe osteocytes as the mechanostat of bone1 3, 14 ,57-60 , yet the biological mechanism of this action remains elusive. Osteocyte's dendritic morphology connected regularly throughout the mineralized matrix of bone has been shown to act as a key mechanical sensor of bone, orchestrating the action of bone forming osteoblasts and bone resorbing osteoclasts3 6'61-64 in response to mechanical stimuli. Improved understanding of the mechanisms by which osteocytes sense and regulate the skeletal response to mechanical loading at the cellular level could have significant implications for the treatment of bone disorders ranging from osteoporosis, fracture healing, disuse-induced bone loss, and microgravity- induced bone loss. Our overall hypothesis is that disuse- and microgravity- induced bone losses are regulated by osteocytes and can be mitigated by modulating their functions.

15 1.2 Hypothesis and Research Objectives

Mechanical loading is required for proper development and maintenance of the musculoskeletal system. The hypothesis and research development focus of this thesis is centered on the role of osteocytes in the skeleton's response to mechanical unloading. In addition, the thesis provides preliminary data for the preparation of the first spaceflight experiment evaluating the in-vitro effects of microgravity on isolated osteocytic cells. Four primary hypotheses were explored in this work:

Hypothesis 1: Conditionally immortalized osteocytic cell lines, derived from long bones, can be established that express markers of mature osteocytes and follow the hormonal responses of in-vivo osteocytes.

Hypothesis 2: Osteocytic cells directly sense mechanical unloading to increase SOST and sclerostin in simulated microgravity.

Hypothesis 3: Pharmacologic inhibition of sclerostin prevents disuse- induced bone loss and promotes bone formation in adult mice subjected to hind limb unloading and partial weight bearing.

Hypothesis 4: The osteocyte secreted protein sclerostin, is elevated in healthy adult men subjected to 90 days of controlled bed rest.

1.3 Thesis Outline

Chapter 2 provides a review of bone biology with an emphasis on the emerging role for osteocytes in a variety of skeletal and non-skeletal functions. Chapter 3 reviews disuse-induced and microgravity-induced bone loss in the context of osteocyte biology and the implications for developing targeted pharmaceutical therapies for both earth and long-duration space applications.

16 The precise mechanisms of how osteocytes respond to and convert mechanical stimuli to biochemical signals remain elusive because their relative inaccessibility has resulted in a lack of available in vitro models. For example, in vitro studies of osteocytes have relied upon chicken primary osteocytes6 5,66, primary murine osteocytes, or immortalized murine osteocytic cell lines67-69 that have some, but not all of the hallmark characteristics of in-vivo osteocytes. In particular, mature osteocytes are one of the few cells that produce the protein sclerostin, the product of the gene SOST47' 0'61 '70 78 . Importantly, the SOST/sclerostin pathway has been implicated in the response of bone to mechanical loading in murine models. Increased skeletal loading reduces SOST expression79 , whereas decreased mechanical loading increases it79, and sclerostin is potent negative regulator of bone mass27,36,62,72,73,75,80-83. Thus, we have focused a significant portion of this thesis on understanding the role of SOST/sclerostin regulation by osteocytes in mechanical unloading and the use of an emerging biologic, anti- sclerostin antibody, to prevent disuse and microgravity-induced bone loss.

To investigate if osteocytes have an endogenous and direct response to mechanical unloading as postulated by Wolf's Law, or if increases in SOST/sclerostin are a consequence of changes in systemic endocrine regulators, such as PTH 36 6, 1,6 3,67 ,74,84 ,85, we developed a novel osteocytic cell line (Ocy454) to study the effects of mechanical unloading on osteocytes in an isolated in-vitro model. Importantly, at the onset of this work, available osteocyte cell lines lacked significant expression of sclerostin 9 , thus limiting their use for investigating this important osteocyte-mediated mechanical-to-biochemical signaling pathway.

Chapter 4 addresses this shortcoming in understanding osteocyte research with the development and validation of a novel, long bone-derived osteocytic cell line (Ocy454) that better recapitulates the in vivo response of osteocytes to hormonal and mechanical stimuli. Our cell line's osteocytic phenotype is exemplified by a rapid, high-level expression of SOST/sclerostin that is responsive to hormonal

17 (PTH), cytokine (PGE 2) and mechanical stimuli. In Chapter 5 we utilize an in vitro ground-based model 8 6 of microgravity to show our novel osteocytic cell line increased SOST/sclerostin levels in a cell-autonomous manner that is independent, but responsive, to changes in PTH. However, earth-based cell culture unloading analogs for the study of in-vitro osteocytes cannot separate effects of fluid flow shear stress from the effects of simulated mechanical unloading. Thus, to evaluate the osteocytic response to true microgravity, our osteocyte cell line conducted an experiment onboard International Space Station (ISS) and SpaceX Dragon Crew Resupply Mission-6 (launched April 14th 2015). This set of experiments, for the first time, investigated the effect of microgravity on osteocytes cultured in-vitro in a three-dimensional scaffold. In Chapter 6, we describe the flight hardware (Osteo-4) and the development of optimized culturing conditions for maintaining an osteocytic phenotype in spaceflight bioreactors suitable for up to 7-day experiments in microgravity.

Our in vitro osteocyte experiments are important first steps towards a better understanding of the role of osteocytes in regulating the bone's response to mechanical forces. We expand upon the role of osteocyte secreted sclerostin in mechanical unloading, in Chapter 7, by showing that serum sclerostin is increased in the murine hind limb unloading (HLU) model via tail suspension. Next, we show the ability of a murine sclerostin antibody (SclAblI, Amgen, Inc.) to prevent bone loss in adult mice subjected to hind limb unloading (HLU) via tail suspension for 21 days. Interestingly, the anabolic effects of sclerostin inhibition on some bone outcomes appeared to be enhanced by normal mechanical loading.

Future missions to the Moon and Mars will also have astronauts spending a considerable amount of time in partial gravity environments. Despite the profound effects of reduced unloading on muscle atrophy and skeletal fragility in humans, there has been little investigation into the physiological effects of partial reduction of weight bearing87' 88 or the ability of emerging therapeutics to diminish the bone

18 loss in partial-gravity environments. Thus, our laboratory developed a novel model for providing chronic, titrated (i.e., 20%, 40%, 70% of normal) quadrupedal loading in mice 7'88 . We used this model to show for the first time that bone loss is linearly proportional to the changes in the reduction of mechanical loads88 . To further investigate the response to sclerostin inhibition and partial mechanical unloading, we tested the ability of sclerostin antibody to inhibit skeletal deterioration during exposure to prolonged (21-day) partial weight bearing at 20%, 40%, and 70% of normal loading. In Chapter 8, we show greater weight bearing lead to even greater benefit of SclAblI, particularly in the trabecular compartment.

Chapter 9 highlights a study in which we show serum sclerostin levels increases in humans in the setting of disuse by measuring longitudinal changes in serum sclerostin in healthy young men exposed to 90 days of bed rest8 3 demonstrating osteocyte physiology in unloaded humans. A conclusion chapter 10 provides a summary of key findings of this thesis.

19 1 Wolff, J. Das Gesetz der Transformation der Knochen Kirschwald. (1892). 2 Smith, S. M. et al. Space flight calcium: implications for astronaut health, spacecraft operations, and Earth. Nutrients 4, 2047-2068, doi:10.3390/nu4122047; 10.3390/nu4122047 (2012). 3 Morse, L. R. et al. Association between sclerostin and bone density in chronic spinal cord injury. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 27, 352-359, doi:10.1002/jbmr.546 (2012). 4 Spector, E. R., Smith, S. M. & Sibonga, J. D. Skeletal effects of long- duration head-down bed rest. Aviat Space Environ Med 80, A23-28 (2009). 5 Zwart, S. R. et al. Effects of 21 days of bed rest, with or without artificial gravity, on nutritional status of humans. J Appl Physiol 107, 54-62, doi:91136.2008 [pii] 10.11 52/jappiphysiol.91136.2008 (2009). 6 Agholme, F., Isaksson, H., Li, X., Ke, H. Z. & Aspenberg, P. Anti-sclerostin antibody and mechanical loading appear to influence metaphyseal bone independently in rats. Acta orthopaedica 82, 628-632, doi:10.3109/17453674.2011.625539 (2011). 7 Aguirre, J. 1. et al. Osteocyte apoptosis is induced by weightlessness in mice and precedes osteoclast recruitment and bone loss. J Bone Miner Res 21, 605-615, doi: 10.1 359/jbmr.060107 (2006). 8 Babij, P. et al. High bone mass in mice expressing a mutant LRP5 gene. J Bone Miner Res 18, 960-974, doi:10.1 359/jbmr.2003.18.6.960 (2003). 9 Blaber, E. A. et al. Microgravity induces pelvic bone loss through osteoclastic activity, osteocytic osteolysis, and osteoblastic cell cycle inhibition by CDKN1a/p21. PboS one 8, e61372, doi: 10. 13 7 1/ r na . n. 6 7 2[d)rA-i] (0 1)40\ I 'J . .I I IJIJUI I IaI.I.JIJ I;.UUU I '.J I. a LU It .V 1 0). 10 Bonewald, L. Osteocytes as multifunctional cells. J Musculoskelet Neuronal Interact 6, 331-333 (2006). 11 Bonewald, L. F. The amazing osteocyte. J Bone Miner Res 26, 229-238, doi:10.1002/jbmr.320 (2011). 12 Bonewald, L. F. Generation and function of osteocyte dendritic processes. J Musculoskelet Neuronal Interact 5, 321-324 (2005). 13 Bonewald, L. F. Mechanosensation and Transduction in Osteocytes. Bonekey Osteovision 3, 7-15, doi:10.1138/20060233 (2006). 14 Bonewald, L. F. & Johnson, M. L. Osteocytes, mechanosensing and Wnt signaling. Bone 42, 606-615, doi:S8756-3282(08)00008-2 [pii] 10.1016/j.bone.2007.12.224 (2008). 15 Gaudio, A. et al. Increased sclerostin serum levels associated with bone formation and resorption markers in patients with immobilization-induced bone loss. J Clin Endocrinol Metab 95, 2248-2253, doi:jc.2010-0067 [pii] 10.1210/jc.2010-0067 (2010). 16 Genetos, D. C., Kephart, C. J., Zhang, Y., Yellowley, C. E. & Donahue, H. J. Oscillating fluid flow activation of gap junction hemichannels induces ATP release from MLO-Y4 osteocytes. J Cell Physiol 212, 207-214, doi:10.1002/jcp.21021 (2007).

20 17 Harris, S. E. et al. DMP1 and MEPE expression are elevated in osteocytes after mechanical loading in vivo: theoretical role in controlling mineral quality in the perilacunar matrix. J Musculoskelet Neuronal Interact 7, 313- 315 (2007). 18 Hughes, J. M. & Petit, M. A. Biological underpinnings of Frost's mechanostat thresholds: the important role of osteocytes. J Musculoskelet Neuronal Interact 10, 128-135 (2010). 19 Jacobs, C. R., Temiyasathit, S. & Castillo, A. B. Osteocyte mechanobiology and pericellular mechanics. Annu Rev Biomed Eng 12, 369-400, doi: 10.11 46/annurev-bioeng-070909-105302 (2010). 20 Kamioka, H. et al. Primary cultures of chick osteocytes retain functional gap junctions between osteocytes and between osteocytes and osteoblasts. Microsc Microanal 13, 108-117, doi:S143192760707016X [pii] 10.1017/S143192760707016X (2007). 21 Kamioka, H. et al. Extracellular calcium causes the release of calcium from intracellular stores in chick osteocytes. Biochem Biophys Res Commun 212, 692-696, doi:S0006-291 X(85)72024-4 [pii] 10.1006/bbrc.1995.2024 (1995). 22 Kamioka, H. et al. Fluid shear stress induces less calcium response in a single primary osteocyte than in a single osteoblast: implication of different focal adhesion formation. J Bone Miner Res 21, 1012-1021, doi:10.1 359/jbmr.060408 (2006). 23 Klein-Nulend, J. et al. Sensitivity of osteocytes to biomechanical stress in vitro. FASEB J 9, 441-445 (1995). 24 Knothe Tate, M. L. "Whither flows the fluid in bone?" An osteocyte's perspective. J Biomech 36, 1409-1424 (2003). 25 Kramer, I., Keller, H., Leupin, 0. & Kneissel, M. Does osteocytic SOST suppression mediate PTH bone anabolism? Trends Endocrinol Metab 21, 237-244, doi:S1043-2760(09)00211-2 [pii] 10.1016/j.tem.2009.12.002 (2010). 26 Li, J., Rose, E., Frances, D., Sun, Y. & You, L. Effect of oscillating fluid flow stimulation on osteocyte mRNA expression. Journal of Biomechanics 45, 247-251, doi:10.1016/j.jbiomech.2011.10.037; 10.1016/j.jbiomech.2011.10.037 (2012). 27 Lin, C. et al. Sclerostin mediates bone response to mechanical unloading through antagonizing Wnt/beta-catenin signaling. J Bone Miner Res 24, 1651-1661, doi:10.1359/jbmr.090411 (2009). 28 Mikuni-Takagaki, Y. Mechanical responses and signal transduction pathways in stretched osteocytes. J Bone Miner Metab 17, 57-60 (1999). 29 Mikuni-Takagaki, Y., Suzuki, Y., Kawase, T. & Saito, S. Distinct responses of different populations of bone cells to mechanical stress. Endocrinology 137, 2028-2035 (1996). 30 Moustafa, A. et al. Mechanical loading-related changes in osteocyte sclerostin expression in mice are more closely associated with the subsequent osteogenic response than the peak strains engendered. Osteoporos Int, doi:10.1007/s00198-011-1656-4 (2011).

21 31 Nakashima, T. et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature medicine 17, 1231-1234, doi:10.1038/nm.2452; 10.1038/nm.2452 (2011). 32 Nguyen, J., Tang, S. Y., Nguyen, D. & Alliston, T. Load regulates bone formation and Sclerostin expression through a TGFbeta-dependent mechanism. PloS one 8, e53813, doi: 10.1371 /journal.pone.0053813; 10.1371/journal.pone.0053813 (2013). 33 Noble, B. S. et al. Mechanical loading: biphasic osteocyte survival and targeting of osteoclasts for bone destruction in rat cortical bone. Am J Physiol Cell Physiol 284, C934-943, doi:10.1152/ajpcell.00234.2002 00234.2002 [pii] (2003). 34 O' Brien, C. et al. in American Society for Bone and Mineral Research. (ed Journal of Bone and Mineral Research). 35 O'Brien, C. A. et a/. Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology 145, 1835-1841, doi:10.1210/en.2003-0990 en.2003-0990 [pii] (2004). 36 O'Brien, C. A. et al. Control of bone mass and remodeling by PTH receptor signaling in osteocytes. PLoS One 3, e2942, doi:10.1371/journal.pone.0002942 (2008). 37 Poole, K. E. et al. Sclerostin is a delayed secreted product of osteocytes that inhibits bone formation. FASEB J 19, 1842-1844, doi:05-4221fje [pii] 10.1096/fj.05-4221fje (2005). 38 Robling, A. G., Bellido, T. & Turner, C. H. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J Musculoskelet Neuronal Interact 6, 354 (2006). on ~ M.L-;:- f1% L%...- / r" nf R~ A -1 -1~ 1., 00 R\Ubin, C-., Oun,1 Y. W., HadUJiargyr1u, M . &t McILeQd, K. Increased expression of matrix metalloproteinase-1 in osteocytes precedes bone resorption as stimulated by disuse: evidence for autoregulation of the cell's mechanical environment? J Orthop Res 17, 354-361, doi:10.1002/jor.1100170309 (1999). 40 Santos, A., Bakker, A. D. & Klein-Nulend, J. The role of osteocytes in bone mechanotransduction. Osteoporos tnt 20, 1027-1031, doi:10.1 007/sO 198-009-0858-5 (2009). 41 Santos, A. et al. Mechanical Loading Stimulates BMP7, But Not BMP2, Production by Osteocytes. Calcif Tissue tnt, doi:10.1007/s00223-011- 9521-1 (2011). 42 Santos, A., Bakker, A. D., Zandieh-Doulabi, B., de Blieck-Hogervorst, J. M. & Klein-Nulend, J. Early activation of the beta-catenin pathway in osteocytes is mediated by nitric oxide, phosphatidyl inositol-3 kinase/Akt, and focal adhesion kinase. Biochem Biophys Res Commun 391, 364-369, doi:S0006-291X(09)02239-6 [pii] 10.1016/j.bbrc.2009.11.064 (2010). 43 Santos, A., Bakker, A. D., Zandieh-Doulabi, B., Semeins, C. M. & Klein- Nulend, J. Pulsating fluid flow modulates gene expression of proteins involved in Wnt signaling pathways in osteocytes. J Orthop Res 27, 1280- 1287, doi:10.1002/jor.20888 (2009).

22 44 Shea, J. F., Yeager, V. L. & Taylor, J. J. Bone resorption by osteocytes. Proc Soc Exp Biol Med 129, 41-43 (1968). 45 Tatsumi, S. et al. Targeted ablation of osteocytes induces osteoporosis with defective mechanotransduction. Cell Metab 5, 464-475, doi:S1550- 4131(07)00128-3 [pii] 10.101 6/j.cmet.2007.05.001 (2007). 46 Temiyasathit, S. et al. Mechanosensing by the primary cilium: deletion of Kif3A reduces bone formation due to loading. PloS one 7, e33368, doi:10.1371/journal.pone.0033368; 10.1371 /journal.pone.0033368 (2012). 47 ten Dijke, P., Krause, C., de Gorter, D. J., Lowik, C. W. & van Bezooijen, R. L. Osteocyte-derived sclerostin inhibits bone formation: its role in bone morphogenetic protein and Wnt signaling. J Bone Joint Surg Am 90 Suppl 1, 31-35, doi:90/Supplement_1/31 [pii] 10.2106/JBJS.G.01 183 (2008). 48 Tu, X. et al. Sost downregulation and local Wnt signaling are required for the osteogenic response to mechanical loading. Bone 50, 209-217, doi:10.1016/j.bone.2011.10.025 (2012). 49 Turner, C. H. & Forwood, M. R. What role does the osteocyte network play in bone adaptation? Bone 16, 283-285, doi:8756328294000522 [pii] (1995). 50 van Bezooijen, R. L. et al. Sclerostin is an osteocyte-expressed negative regulator of bone formation, but not a classical BMP antagonist. J Exp Med 199, 805-814, doi: 10.1 084/jem.20031454 jem.20031454 [pii] (2004). 51 Winkler, D. G. et al. Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. EMBO J 22, 6267-6276, doi:10.1 093/emboj/cdg599 (2003). 52 Xiao, Z. et al. Cilia-like structures and polycystin-1 in osteoblasts/osteocytes and associated abnormalities in skeletogenesis and Runx2 expression. J Biol Chem 281, 30884-30895, doi:M604772200 [pii] 10.1074/jbc.M604772200 (2006). 53 You, L. et al. Osteocytes as mechanosensors in the inhibition of bone resorption due to mechanical loading. Bone 42, 172-179, doi:S8756- 3282(07)00684-9 [pii] 10.101 6/j.bone.2007.09.047 (2008). 54 Zaman, G. et al. Osteocytes use estrogen receptor alpha to respond to strain but their ERalpha content is regulated by estrogen. J Bone Miner Res 21, 1297-1306, doi: 10.1 359/jbmr.060504 (2006). 55 Zhang, K. et al. El1/gp38 selective expression in osteocytes: regulation by mechanical strain and role in dendrite elongation. Mol Cell Biol 26, 4539-4552, doi:26/12/4539 [pii] 10.11 28/MCB.02120-05 (2006). 56 Zhao, S., Zhang, Y. K., Harris, S., Ahuja, S. S. & Bonewald, L. F. MLO-Y4 osteocyte-like cells support osteoclast formation and activation. J Bone Miner Res 17, 2068-2079, doi:10.1 359/jbmr.2002.17.11.2068 (2002). 57 Aarden, E. M., Burger, E. H. & Nijweide, P. J. Function of osteocytes in bone. J Cell Biochem 55, 287-299, doi:10.1002/jcb.240550304 (1994). 58 Bakker, A., Klein-Nulend, J. & Burger, E. Shear stress inhibits while disuse promotes osteocyte apoptosis. Biochem Biophys Res Commun 320, 1163-1168, doi:10.1016/j.bbrc.2004.06.056 S0006291X04013415 [pii] (2004).

23 59 Bonewald, L. F. Osteocytes as dynamic multifunctional cells. Ann N Y Acad Sci 1116, 281-290, doi:annals.1402.018 [pii] 10.1 196/annals.1402.018 (2007). 60 Bonewald, L. F. Osteocytes: a proposed multifunctional bone cell. J Musculoskelet Neuronal Interact 2, 239-241 (2002). 61 Bellido, - T. Downregulation of SOST/sclerostin by PTH: a novel mechanism of hormonal control of bone formation mediated by osteocytes. J Musculoskelet Neuronal Interact 6, 358-359 (2006). 62 Galli, C., Passeri, G. & Macaluso, G. M. Osteocytes and WNT: the mechanical control of bone formation. J Dent Res 89, 331-343, doi:0022034510363963 [pii] 10.1177/0022034510363963 (2010). 63 Powell, W. F., Jr. et al. Targeted ablation of the PTH/PTHrP receptor in osteocytes impairs bone structure and homeostatic calcemic responses. J Endocrinol 209, 21-32, doi:JOE-10-0308 [pii] 10.1530/JOE-10-0308 (2011). 64 Wein, M. N. et al. HDAC5 controls MEF2C-driven sclerostin expression in osteocytes. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, doi:10.1 002/jbmr.2381 [doi] (2014). 65 Nijweide, P. J. & Mulder, R. J. Identification of osteocytes in osteoblast- like cell cultures using a monoclonal antibody specifically directed against osteocytes. Histochemistry 84, 342-347 (1986). 66 van der Plas, A. & Nijweide, P. J. Isolation and purification of osteocytes. J Bone Miner Res 7, 389-396, doi:10.1002/jbmr.5650070406 (1992). 67 Woo, S. M., Rosser, J., Dusevich, V., Kalajzic, I. & Bonewald, L. F. Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differentiation in vitro nnrA- I;~+rr k,;",~ In A A;i:-- M n~ f-% n A el Q- A Q~ CAn J %ac LeratVO LJIII rmII IaLIonI III VIVU. %J on Wittner Res 26, 2U34264, doi:10.1 002/jbmr.465 (2011). 68 Ahuja, S. S. et al. CD40 ligand blocks apoptosis induced by tumor necrosis factor alpha, glucocorticoids, and etoposide in osteoblasts and the osteocyte-like cell line murine long bone osteocyte-Y4. Endocrinology 144, 1761-1769 (2003). 69 Bonewald, L. F. Establishment and characterization of an osteocyte-like cell line, MLO-Y4. J Bone Miner Metab 17, 61-65 (1999). 70 Balemans, W. et al. Identification of a 52 kb deletion downstream of the SOST gene in patients with van Buchem disease. J Med Genet 39, 91-97 (2002). 71 Balemans, W. & Van Hul, W. Human genetics of SOST. J Musculoskelet Neuronal Interact 6, 355-356 (2006). 72 Kim, C. A. et al. A known SOST gene mutation causes sclerosteosis in a familial and an isolated case from Brazilian origin. Genet Test 12, 475- 479, doi:10.1089/gte.2008.0036 (2008). 73 Kogawa, M. et al. Sclerostin regulates release of bone mineral by osteocytes by induction of carbonic anhydrase 2. J Bone Miner Res 28, 2436-2448, doi: 10.1 002/jbmr.2003 (2013).

24 74 Leupin, 0. et al. Control of the SOST bone enhancer by PTH using MEF2 transcription factors. J Bone Miner Res 22, 1957-1967, doi:10.1 359/jbmr.070804 (2007). 75 Paszty, C., Turner, C. H. & Robinson, M. K. Sclerostin: a gem from the genome leads to bone-building antibodies. J Bone Miner Res 25, 1897- 1904, doi:10.1002/jbmr.161 (2010). 76 Semenov, M., Tamai, K. & He, X. SOST is a ligand for LRP5/LRP6 and a Wnt signaling inhibitor. J Biol Chem 280, 26770-26775, doi:M504308200 [pii] 10.1074/jbc.M504308200 (2005). 77 van Bezooijen, R. L. et al. SOST expression is restricted to the great arteries during embryonic and neonatal cardiovascular development. Dev Dyn 236, 606-612, doi:10.1002/dvdy.21054 (2007). 78 van Bezooijen, R. L., ten Dijke, P., Papapoulos, S. E. & Lowik, C. W. SOST/sclerostin, an osteocyte-derived negative regulator of bone formation. Cytokine Growth Factor Rev 16, 319-327, doi:S1359- 6101(05)00042-0 [pii] 10.1016/j.cytogfr.2005.02.005 (2005). 79 Robling, A. G. et al. Mechanical stimulation of bone in vivo reduces osteocyte expression of Sost/sclerostin. J Biol Chem 283, 5866-5875, doi:M705092200 [pii] 10.1074/jbc.M705092200 (2008). 80 Moustafa, A. et al. Mechanical loading-related changes in osteocyte sclerostin expression in mice are more closely associated with the subsequent osteogenic response than the peak strains engendered. Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA 23, 1225-1234, doi:10.1 007/s00198- 011-1656-4 (2012). 81 Papanicolaou, S. E., Phipps, R. J., Fyhrie, D. P. & Genetos, D. C. Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology 46, 389-399, doi:10.3233/BIR-2009-0550; 10.3233/BIR-2009-0550 (2009). 82 Spatz, J. M. et aL. Sclerostin antibody inhibits skeletal deterioration due to reduced mechanical loading. J Bone Miner Res 28, 865-874, doi:10.1002/jbmr.1807 (2013). 83 Spatz, J. M. et al. Serum sclerostin increases in healthy adult men during bed rest. The Journal of clinical endocrinology and metabolism 97, E1736- 1740, doi:10.1210/jc.2012-1579; 10.1210/jc.2012-1579 (2012). 84 Drake, M. T. et al. Effects of parathyroid hormone treatment on circulating sclerostin levels in postmenopausal women. J Clin Endocrinol Metab 95, 5056-5062, doi:jc.2010-0720 [pii] 10.1210/jc.2010-0720 (2010). 85 Keller, H. & Kneissel, M. SOST is a target gene for PTH in bone. Bone 37, 148-158, doi:S8756-3282(05)00117-1 [pii] 10.1016/j.bone.2005.03.018 (2005). 86 Capulli, M., Rufo, A., Teti, A. & Rucci, N. Global transcriptome analysis in mouse calvarial osteoblasts highlights sets of genes regulated by modeled microgravity and identifies a "mechanoresponsive osteoblast gene

25 signature". Journal of cellular biochemistry 107, 240-252, doi:10.1 002/jcb.22120; 10.1 002/jcb.22120 (2009). 87 Wagner, E. B. et al. Partial weight suspension: a novel murine model for investigating adaptation to reduced musculoskeletal loading. J AppI Physiol (1985) 109, 350-357, doi:10.1152/japplphysiol.00014.2009 (2010). 88 Ellman, R. et al. Partial reductions in mechanical loading yield proportional changes in bone density, bone architecture, and muscle mass. J Bone Miner Res 28, 875-885, doi: 10.1 002/jbmr. 1814 (2013).

26 Chapter 2

2 Osteocyte's role in skeletal biology

Bone is a dynamic metabolically active tissue with diverse functions. It provides the body's protection of vital organs and enables the lever arms for musculoskeletal movements. In addition, bone has well established endocrine roles, such as coordinating the body's calcium-phosphate mineral stores, growth factor storage, helping to maintain the body's acid-base balance, as well as providing the niche environment for critical functions of the immune system, hematopoiesis, and regulation of fat metabolism.

Classically, bone is known as a mechanically responsive tissue actively remodeling to align its underlying cortical structure along the axis of maximum stress (Wolff's Law)' 2 . However, the molecular mechanisms underlying bone's response to mechanical unloading are not completely understood and are a focus of this thesis work. Bone is comprised of both inorganic and organic matrix as well as cells derived from the mesoderm (osteoclasts, osteoblasts, and osteocytes) and endoderm (i.e., endothelial) germ layers. The matrix is primarily comprised of inorganic hydroxyapatite and organic proteins comprised of type I collagen, non-collagenous proteins (e.g. osteocalcin, osteopontin), and proteoglycans.

Osteoclasts, derived from the monocyte lineage, are multinucleated cells responsible for bone resorption secreting such enzymes as tartrate-resistant acid phosphatase (TRAP). Osteoblasts, derived from mesenchymal stem cells (MSCs), are bone-forming cells that produce the non-mineralized organic portions of bone, known as osteoid, which is subsequently mineralized. Osteoblasts are thought to have three known fates: 1) differentiation into bone lining cells, 2) differentiation into osteocytes, or 3) apoptosis. The molecular cues determining which fate an individual osteoblast takes are largely unknown.

27 Osteocytes are the most abundant cell type in bone (90-95% of all bone cells), outnumbering osteoblasts by approximately a 10:1 ratio and osteoclasts by a 100:1 ratio in adult bone. Osteocytes are post mitotic, terminally differentiated osteoblasts that, during the process of bone formation, assume a more differentiated morphology and become entrapped in individual lacuna within the matrix that they are actively synthesizing. The morphology of the osteoblast, a plump polygonal cell, changes dramatically as it becomes an osteocyte with reduced cytoplasm and numerous dendritic processes 3. The dendritic processes of osteocytes travel within a canaliculi network to allow for extensive connections between osteocytes, establishing an osteocytic network within bone. The osteocyte network connects osteocytes to each other, osteoblasts and osteoclasts resident on bone surfaces, and to the bone marrow microenvironment. Over the past two decades, our understanding of osteocytes has exponentially expanded and it is now appreciated these cells are key regulators of skeletal metabolism, mineral homeostasis, hematopoiesis, and bone's response to mechanical loading and unloading 4. The remainder of this chapter will review the diverse role of osteocytes in skeletal biology and Chapter 3I IAl p~roiden -n rev;InAAew f d~qisue- %induced and-% mL-grv b -- loss in the '., vvIuI tjlviI..I, cl IuVIqUVV '.JI UI0U0 -ii IUUt-,u aI iu IIdUVICIVILY UUI I I U II UlI context of osteocyte biology.

2.1 Life of an osteocyte

Osteocytes are evolutionary highly conserved and the organized structure of these cells within a mineralized matrix is present in bone specimens from Tyrannosaurus rex, dating back more than 80 million of years ago, clearly indicating an important role for these cells in skeletal metabolism. The life of an osteocyte is thought to be split into four stages: an early stage (young osteocyte) in which the cell is smaller in size, reside into the osteoid and do not express alkaline phosphatase, an actively mineralizing stage, a late stage (mature osteocyte) in which the larger cell re-express alkaline phosphatase and is deeply embedded in the mineralized bone8 , and if it occurs, apoptosis which is thought to be an initiation signal for bone remodeling by osteoclast resorption. The young

28 osteocyte within the osteoid, is characterized by its proximity to the endosteal or periosteal bone surfaces and biochemically by the expression of transcripts, such as El1/gp38/podoplain, matrix extracellular phosphoglycoprotein (MEPE), dentin-matrix protein-1 (DMP1), and phosphate-regulating gene with homologies to endopeptidases on the X chromosome (Phex), and the absence of expression of small-leucine rich proteoglycans (i.e. Keratin) produced by osteoblasts9 -. Mature osteocytes are characterized by their deeply embedded position in bone and biochemically by their expression of the gene SOST, which produces the protein sclerostin, or their expression of the fibroblast growth factor-23 (FGF-23), a protein involved in the body's regulation of phosphate1 '-.

2.2 Osteocyte orchestration of bone homeostasis

Osteocytes are thought to regulate both osteoblasts and osteoclast differentiation and function. For example, osteocytes are the major source in the adult of the

protein sclerostin 18-25 which inhibits bone formation, both in vitro and in vivo, by directly reducing proliferation and differentiation of osteoblasts via the canonical Wnt signaling pathway. Sclerostin is thought to act by binding the low-density

lipoprotein receptor 5 and 6 (LRP5 and 6) to inhibit Wnt-pcatenin-signaling 2631 Moreover, sclerostin appears central to the bone's response to mechanical loading and will be further discussed in Chapter 3 and throughout this thesis.

More recently, osteocytes have been shown to be central regulators of bone resorption through their interaction with osteoclasts. For example, the major factors which govern osteoclast differentiation from osteoclast progenitor cells are: 1) the cytokine receptor activator of NFkB ligand (RANKL), which is essential for osteoclast formation, function and survival; and 2) osteoprotegerin (OPG), a decoy receptor for RANKL that prevents its binding to osteoclast progenitors 32. Many different cell types, including bone marrow stromal cells, osteoblasts at various stages of differentiation, T- and B-lymphocytes, hypertrophic chondrocytes and synovial fibroblasts, express RANKL and were thought to contribute to osteoclastogenesis . However, recent paradigm-shifting work

29 reports that osteocyte-derived RANKL is a significant source of RANKL involved in osteoclast formation and remodeling in cancellous bone33 34 . In these studies, mice with osteocyte-specific deletion of RANKL developed normally, but had slightly increased bone mass with increasing age and dramatically reduced osteoclast numbers and serum CTX, a marker of bone resorption.

2.3 Osteocyte as bone's mechano-sensor

Owing to their evolutionary conservation, sheer number, dendritic processes, and the lacunar network, osteocytes have been investigated for more than fifty years

as the major cell type in bone responsible for sensing mechanical loads 35 . Numerous studies have established osteocytes role in both mechano-sensation and transduction 3 3-43 . However, the exact mechanisms and pathways responsible for load sensation, intracellular signal and extracellular transduction, remain active areas of research and will be discussed in Chapter 3.

2.4 Osteocyte orchestration of mineral homeostasis

Osteocytes are thought to be the main source of FGF-231 ' 4 44 , a key regulator, together with parathyroid hormone (PTH) of the body's phosphate

homeostasis 12. Secreted FGF-23 from osteocytes acts on the kidneys, where it decreases the expression of NPT2, a sodium-phosphate cotransporter in the proximal tubule decreasing the reabsorption of phosphate. Evidence for supporting this role of osteocytes comes from DMP1-null mice and patients with inactivating mutation of DMP1 who have autosomal dominant hypophosphatemic rickets with osteomalacia as a consequence of abnormally high levels of FGF-23 12,13,17,45-47. Conversely, mice lacking FGF-23 are hyperphosphatemic and are osteopenic.

30 2.5 Osteocyte orchestration of hematopoiesis

Recently emerging evidences points to the osteocyte networks' paracrine interactions with the bone marrow microenvironment niche where hematopoiesis occurs in the adult. Osteoblasts and osteocytes express several G-protein coupled receptors (GPCRs) and signaling trough these receptors has been shown to control the bone marrow niche7 . Evidence for this role of osteocytes comes from mice lacking Gsa in osteocytes displaying a profound myeloproliferative phenotype characterized by a dramatic increase in myeloid cells in bone marrow, spleen, and peripheral blood with granulocyte colony- stimulating factor secreted by osteocytes identified as the principal cytokine regulating granulopoiesis in these mice7 .

2.6 Osteocyte orchestration of immune function and fat metabolism

Recent evidence also suggests osteocytes play a significant role in the regulation of immune function and fat metabolism. For example, the targeted ablation of osteocytes utilizing a transgenic mouse with expression of diphtheria toxin receptor (DTR) under the promoter of DMP-1 resulted in impaired B-cell lymphopoiesis and marked reductions in double-positive CD4/CD8 T-cells in the thymus48 '49. Furthermore, SOST/sclerostin has been shown to have a role in the fate of B-cells, as recently reported5 . Cain et al. 5 showed SOST knockout mice, despite the high bone mass and increased number of osteoblasts, have no differences in the frequency or absolute number of hematopoietic stem cells (HSCs), common lymphoid progenitors, common myeloid/megakaryocyte erythroid progenitors, or granulocyte/monocyte progenitors, confirming the findings in mice over-expressing the constitutive PTH/PTHrP receptor in osteocytes 5. However, in these SOST null mice, B cells are significantly reduced in both their frequency and cell number in the bone marrow and the reduction was a consequence of increased apoptosis due to a reduction in Cxcl12 expression in stromal cells 50 .

31 Furthermore, Sato et al.4 using the targeted osteocyte ablation model also provide evidence that osteocytes are required in the maintenance of fat metabolism and cooperate with the hypothalamus in the regulation of fat in the liver. For example, osteocyte ablated mice lacked visible white adipose tissue (WAT) including subcutaneous, mesenteric, and retroperitoneal fat tissue and epididymal fat pad mass along with decreased serum leptin levels49 .

2.7 Summary

In summary, osteocytes have been shown to be critically essential for diverse roles in human physiology acting both to control bone homeostasis and as an endocrine cell7 ,12 ,13 ,15,48,49. Importantly, these emerging roles of osteocyte functions are still to be explored in the context of microgravity physiology and disuse bone loss, with the primary focus of this thesis on osteocytes' orchestration of the bone's response to mechanical unloading.

32 1 Chen, J. H., Liu, C., You, L. & Simmons, C. A. Boning up on Wolff's Law: mechanical regulation of the cells that make and maintain bone. Journal of Biomechanics 43, 108-118, doi:10.1016/j.jbiomech.2009.09.016; 10.1016/j.jbiomech.2009.09.016 (2010). 2 Wolff, J. Das Gesetz der Transformation der Knochen Kirschwald. (1892). 3 Guo, D. et al. Identification of osteocyte-selective proteins. Proteomics 10, 3688-3698, doi: 10.1 002/pmic.201000306 (2010). 4 Calvi, L. M. et al. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425, 841-846, doi:10.1038/nature02040 nature02040 [pii] (2003). 5 Divieti, P., Lanske, B., Kronenberg, H. M. & Bringhurst, F. R. Conditionally immortalized murine osteoblasts lacking the type 1 PTH/PTHrP receptor. J Bone Miner Res 13, 1835-1845, doi:10.1359/jbmr.1998.13.12.1835 (1998). 6 Divieti, P. P. PTH and osteocytes. J Musculoskelet Neuronal Interact 5, 328-330 (2005). 7 Fulzele, K. et al. Myelopoiesis is regulated by osteocytes through Gsalpha-dependent signaling. Blood 121, 930-939, doi:10.1182/blood- 2012-06-437160; 10.11 82/blood-2012-06-437160 (2013). 8 Nioi, P. et al. Transcriptional Profiling of Laser Capture Microdissected Subpopulations of the Osteoblast Lineage Provides Insight Into the Early Response to Sclerostin Antibody in Rats. Journal of bone and mineral research, doi:10.1002/jbmr.2482 [doil (2015). 9 lgwe, J. C., Gao, Q., Kizivat, T., Kao, W. W. & Kalajzic, I. Keratocan is expressed by osteoblasts and can modulate osteogenic differentiation. Connective tissue research 52, 401-407, doi:10.3109/03008207.2010.546536; 10.3109/03008207.2010.546536 (2011). 10 Paic, F. et al. Identification of differentially expressed genes between osteoblasts and osteocytes. Bone 45, 682-692, doi:S8756- 3282(09)01634-2 [pii] 10.1016/j.bone.2009.06.010 (2009). 11 Woo, S. M., Rosser, J., Dusevich, V., Kalajzic, I. & Bonewald, L. F. Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differentiation in vitro and accelerates bone formation in vivo. J Bone Miner Res 26, 2634-2646, doi:10.1002/jbmr.465 (2011). 12 Bergwitz, C. & Juppner, H. FGF23 and syndromes of abnormal renal phosphate handling. Adv Exp Med Biol 728, 41-64, doi:10.1007/978-1- 4614-0887-1_3. 13 Bergwitz, C. & Juppner, H. Regulation of phosphate homeostasis by PTH, vitamin D, and FGF23. Annu Rev Med 61, 91-104, doi:10.1 146/annurev.med.051308.111339. 14 Bonewald, L. F. & Wacker, M. J. FGF23 production by osteocytes. Pediatr Nephrol 28, 563-568, doi:10.1 007/s00467-012-2309-3.

33 15 Cheng, F. & Hulley, P. The osteocyte--a novel endocrine regulator of body phosphate homeostasis. Maturitas 67, 327-338, doi:S0378- 5122(10)00324-5 [pii] 10.1016/j.maturitas.2010.08.011 (2010). 16 Martin, A. et al. Bone proteins PHEX and DMP1 regulate fibroblastic growth factor Fgf23 expression in osteocytes through a common pathway involving FGF receptor (FGFR) signaling. FASEB J 25, 2551-2562, doi:fj.10-177816 [pii] 10.1096/fj.10-177816 (2011). 17 Ubaidus, S. et al. FGF23 is mainly synthesized by osteocytes in the regularly distributed osteocytic lacunar canalicular system established after physiological bone remodeling. J Electron Microsc (Tokyo) 58, 381- 392, doi:dfp032 [pii] 10.1 093/jmicro/dfp032 (2009). 18 Agholme, F., Isaksson, H., Li, X., Ke, H. Z. & Aspenberg, P. Anti-sclerostin antibody and mechanical loading appear to influence metaphyseal bone independently in rats. Acta orthopaedica 82, 628-632, doi:10.3109/17453674.2011.625539 (2011). 19 Leupin, 0. et al. Control of the SOST bone enhancer by PTH using MEF2 transcription factors. J Bone Miner Res 22, 1957-1967, doi:10.1 359/jbmr.070804 (2007). 20 Lin, C. et al. Sclerostin mediates bone response to mechanical unloading through antagonizing Wnt/beta-catenin signaling. J Bone Miner Res 24, 1651-1661, doi:10.1 359/jbmr.090411 (2009). 21 Paszty, C., Turner, C. H. & Robinson, M. K. Sclerostin: a gem from the genome leads to bone-building antibodies. J Bone Miner Res 25, 1897- 1904, doi:10.1002/jbmr.161 (2010). 22 Poole, K. E. et al. Sclerostin is a delayed secreted product of osteocytes that inhibits bone formation. FASEB J 19, 1842-1844, doi:05-4221fje [pii] 10.1096L/fJ.UO-2fjee (200). 23 van Bezooijen, R. L. et al. Sclerostin is an osteocyte-expressed negative regulator of bone formation, but not a classical BMP antagonist. J Exp Med 199, 805-814, doi:10.1084/jem.20031454 jem.20031454 [pii] (2004). 24 van Bezooijen, R. L., ten Dijke, P., Papapoulos, S. E. & Lowik, C. W. SOST/sclerostin, an osteocyte-derived negative regulator of bone formation. Cytokine Growth Factor Rev 16, 319-327, doi:S1359- 6101(05)00042-0 [pii] 10.1016/j.cytogfr.2005.02.005 (2005). 25 Winkler, D. G. et al. Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. EMBO J 22, 6267-6276, doi:10.1 093/emboj/cdg599 (2003). 26 Collette, N. M., Genetos, D. C., Murugesh, D., Harland, R. M. & Loots, G. G. Genetic evidence that SOST inhibits WNT signaling in the limb. Dev Biol 342, 169-179, doi:S0012-1606(10)00187-9 [pii] 10.1016/j.ydbio.2010.03.021 (2010). 27 O'Brien, C. A. et al. Control of bone mass and remodeling by PTH receptor signaling in osteocytes. PLoS One 3, e2942, doi:10.1371 /journal.pone.0002942 (2008).

34 28 Piters, E. et al. First missense mutation in the SOST gene causing sclerosteosis by loss of sclerostin function. Hum Mutat 31, E1526-1543, doi:10.1002/humu.21274 (2010). 29 Semenov, M., Tamai, K. & He, X. SOST is a ligand for LRP5/LRP6 and a Wnt signaling inhibitor. J Biol Chem 280, 26770-26775, doi:M504308200 [pii] 10.1074/jbc.M504308200 (2005). 30 Semenov, M. V. & He, X. LRP5 mutations linked to high bone mass diseases cause reduced LRP5 binding and inhibition by SOST. J Biol Chem 281, 38276-38284, doi:M609509200 [pii] 10.1074/jbc.M609509200 (2006). 31 Ayturk, U. M. et al. An RNA-seq protocol to identify mRNA expression changes in mouse diaphyseal bone: applications in mice with bone property altering Lrp5 mutations. J Bone Miner Res 28, 2081-2093, doi:10.1002/jbmr.1946 (2013). 32 Boyce, B. F. & Xing, L. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys 473, 139-146, doi:S0003- 9861(08)00159-8 [pii] 10.101 6/j.abb.2008.03.018 (2008). 33 Xiong, J. et al. Matrix-embedded cells control osteoclast formation. Nat Med 17, 1235-1241, doi:10.1038/nm.2448 (2011). 34 Nakashima, T. et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature medicine 17, 1231-1234, doi:10.1038/nm.2452; 10.1038/nm.2452 (2011). 35 Bonewald, L. F. Mechanosensation and Transduction in Osteocytes. Bonekey Osteovision 3, 7-15, doi:10. 1138/20060233 (2006). 36 Bonivtch, A. R., Bonewald, L. F. & Nicolella, D. P. Tissue strain amplification at the osteocyte lacuna: a microstructural finite element analysis. J Biomech 40, 2199-2206, doi:S0021-9290(06)00406-4 [pii] 10.1016/j.jbiomech.2006.10.040 (2007). 37 Cheng, B. et al. PGE(2) is essential for gap junction-mediated intercellular communication between osteocyte-like MLO-Y4 cells in response to mechanical strain. Endocrinology 142, 3464-3473 (2001). 38 Cherian, P. P. et al. Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for the release of prostaglandin. Mol Biol Cell 16, 3100-3106, doi:E04-10-0912 [pii] 10.1091/mbc.E04-10-0912 (2005). 39 Gluhak-Heinrich, J. et al. Mechanical loading stimulates dentin matrix protein 1 (DMP1) expression in osteocytes in vivo. J Bone Miner Res 18, 807-817, doi:10.1359/jbmr.2003.18.5.807 (2003). 40 Kitase, Y. et al. Mechanical induction of PGE2 in osteocytes blocks glucocorticoid-induced apoptosis through both the beta-catenin and PKA pathways. J Bone Miner Res 25, 2657-2668, doi:10.1002/jbmr.168 (2010). 41 Kogawa, M. et al. Sclerostin regulates release of bone mineral by osteocytes by induction of carbonic anhydrase 2. J Bone Miner Res 28, 2436-2448, doi: 10.1 002/jbmr.2003 (2013). 42 Nicolella, D. P., Moravits, D. E., Gale, A. M., Bonewald, L. F. & Lankford, J. Osteocyte lacunae tissue strain in cortical bone. J Biomech 39, 1735-

35 1743, doi:S0021-9290(05)00202-2 [pii] 10.1016/j.jbiomech.2005.04.032 (2006). 43 Robling, A. G., Bellido, T. & Turner, C. H. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J Musculoskelet Neuronal Interact 6, 354 (2006). 44 Dallas, S. L., Prideaux, M. & Bonewald, L. F. The Osteocyte: An Endocrine Cell and More. Endocr Rev, doi:er.2012-1026 [pii] 10.1210/er.2012-1026. 45 Feng, J. Q. et al. Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet 38, 1310- 1315, doi:ngl 905 [pii] 10.1 038/ng1 905 (2006). 46 Liu, S., Tang, W., Zhou, J., Vierthaler, L. & Quarles, L. D. Distinct roles for intrinsic osteocyte abnormalities and systemic factors in regulation of FGF23 and bone mineralization in Hyp mice. Am J Physiol Endocrinol Metab 293, E1636-1644, doi:00396.2007 [pii] 10.1 152/ajpendo.00396.2007 (2007). 47 Rhee, Y. et al. Parathyroid hormone receptor signaling in osteocytes increases the expression of fibroblast growth factor-23 in vitro and in vivo. Bone 49, 636-643, doi:S8756-3282(11)01066-0 [pii] 10.1016/j.bone.2011.06.025 (2011). 48 Asada, N. et al. Matrix-embedded osteocytes regulate mobilization of hematopoietic stem/progenitor cells. 49 Sato, M. et al. Osteocytes regulate primary lymphoid organs and fat metabolism. 50 Cain, C. J. et al. Absence of sclerostin adversely affects B-cell survival. J Bone Miner Res 27, 1451-1461, doi:10.1 002/jbmr.1608 (2012). 01 Bel :id o, T. e t a 1. ChIIn 10f 11 parthrid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis. Endocrinology 146, 4577-4583, doi:en.2005-0239 [pii] 10.1210/en.2005-0239 (2005).

36 Chapter 3

3 Osteocytes: microgravity and disuse induce bone loss 3.1 Skeletal health in long duration spaceflight

Bone loss in spacefaring humans has been noted since the early days of the Gemini program. For the most part, despite rigorous exercise protocols, bone loss in weight bearing bones (-0.5-1.6% per month) has been nearly 10-fold higher than the rate seen in postmenopausal women. Further, femoral strength predictions by finite element analysis of QCT data declined 2.6% per month in astronauts who spent 4 to 6 months on the International Space Station (ISS) 1 using the interim resistance exercise device (IRED) used on early ISS increment missions. The estimated increased fracture risk that accompanies this bone loss may be substantial, as a 20% decrease in femoral neck bone mineral density (BMD) during a year of spaceflight would correspond to 30 years of age-related bone loss in a postmenopausal woman, equating to an unacceptable potential

20-40% increase in fracture risk 2.

Notably, two recent studies reported effective mitigation of spaceflight-induced bone loss. In the first study, bisphosphonate treatment inhibited bone loss due to spaceflight'. Despite this apparent success, bisphosphonate treatment may not be an adequate solution as several of the study subjects dropped out of the study due to drug-related side effects. Moreover there remain concerns about use of bisphosphonates in young astronauts due to the long-term retention of bisphosphonates in the skeleton and concerns about the negative effects of prolonged suppression of bone turnover 4. Furthermore, no pharmaceutical therapies exist that mimics the effects of gravity on osteocytes as current therapies modulate osteoblast (e.g. PTH) and osteoclast (bisphosphonates, anti- RANKL antibodies) functions.

37 A second study reported that in five astronauts, use of the advanced resistive exercise device (ARED) coupled with adequate energy and nutritional intake was successful in maintaining bone mineral density (BMD) in some astronauts, as assessed by dual-energy x-ray absorptiometry (DXA) 5 .

Despite these promising reports, it is clear that issues related to skeletal health in long duration spaceflight are not solved. First, in the ARED exercise and nutrition study, urinary measures of bone resorption markers remained 2 -3 fold higher than baseline, indicative of negative skeletal effects, such as microarchitectural deterioration, that were likely not captured by the BMD measurements5 . Second, large inter-subject differences in rates of bone loss remain unexplained, and of concern, as one of the astronauts who exercised with the ARED still lost BMD at a rate of 1.5% per month6 . Third, exploration missions of long duration will likely require exercise equipment of minimal mass and size, which may not be able to achieve loading magnitudes optimal for musculoskeletal health, and alternative countermeasures in the case of exercise hardware failure 7. Finally, while most physiological systems reach an adaptive plateau during exposure to spaceflight, bone loss shows no clear signs of slowing, and bone mass exhibits a slow and inconsistent recovery upon return to 1-g6 ,8 . Thus, there is strong rationale for further investigations to better understand the mechanisms regulating the skeletal response to spaceflight and mechanical unloading for mitigating bone loss in disuse and microgravity.

3.2 Osteocyte orchestration of mechanotransduction

Osteocytes have been recognized for over 30 years as the mechanosensor of bone9-13 . Osteocytes location, deep within the mineralized matrix, and their structural organization of a cellular network, make them ideal to sense mechanical stimuli and to coordinate the action of the other cell types in bone. This complex communication network between osteocytes, osteoblasts, and osteoclasts is thought to guarantee the health and function of the skeleton.

38 Krempein et al. 14 first demonstrated the effects of reduced mechanical loading on osteocyte morphology. Rats were immobilized by spinal cord severing, plaster cast, or nerve dissection. Three weeks of immobilization caused a significant decrease in the percentage of small metabolically inactive osteocytes (spinal cord severing, -20%, plaster cast, -15.4%) and a corresponding increase in the percentage of mature enlarged osteocytes (spinal cord severing, +12.6%, plaster cast, +14.6%). Recent murine hind limb tail suspension experiments showed increased osteocyte apoptosis in both trabecular and cortical bone 5 . It has also been postulated that osteocyte cell death is an initiator signal for osteoclast remodeling activity or that loaded osteocytes release an osteoclast-inhibiting factor16-18

While evidence from both animals and humans indicates that bone loss due to microgravity results from reduced osteoblastic bone formation, increased osteoclast-mediated bone resorption, as well as osteocyte-mediated osteolysis 19-22, the relative contribution of each process and the molecular mechanisms by which osteocytes influence these processes in response to mechanical unloading are poorly understood. Yet, progress has been made towards identifying some of the osteocyte-specific mechanisms that contribute to mechanotransduction in bone, including: i) regulation of bone formation via the Wnt/P-catenin signaling pathway, ii) regulation of osteoclast activity via the RANKL pathway, and iii) regulation of osteocyte osteolysis.

3.3 Osteocyte orchestration of osteoblasts in mechanical unloading

Mature osteocytes are one of the only cells that express, postnatally, the protein sclerostin, a product of the gene SOST2 3 32 . Mutations in the SOST' 34 exons or a distal conserved regulatory region 35 are causative of human high bone mass disorders, sclerosteosis and van Buchem disease, respectfully 36 . Consistent with the negative effect of sclerostin on bone mass, transgenic mice over expressing SOST show low bone mass 37 whereas SOST-null animals have high bone

39 mass36 . Specifically, murine studies demonstrated that increased skeletal loading dramatically reduces SOST/Sclerostin levels, whereas SOST/Sclerostin levels were up-regulated by unloading 38. Furthermore, mice constitutively lacking sclerostin have increased bone mass, but are subsequently resistant to disuse- induced bone loss 39. In addition, mice lacking an evolutionary conserved region (ECR5) that is known to control the expression of SOST/Sclerostin also have a high bone mass phenotype 0 .

In addition, in a cross-sectional study in postmenopausal women with recent immobilization due to stroke, serum sclerostin levels were 3-fold higher than those in age matched postmenopausal women41 .

Furthermore, it has been reported that osteocytes are also the major source of insulin-like growth factor IGF-1. For example, deletion of IGF-1 in osteocytes impairs skeletal growth, reduces the periosteal circumference, and inhibits bone's response to mechanical forces 42 4 3. When osteocyte IGF-1 conditional knockout mice were subjected to mechanical loading, there was a significant reduction in bone formation indicating that osteocyte derived IGF-1 is also an important determinant of bone's response to mechanical loading 43.

3.4 Osteocyte orchestration of osteoclasts in mechanical unloading

Osteocytes are a major source of the osteoclast differentiation cytokine NFkB ligand (RANKL), which is essential for osteoclast formation, function and survival; and 2) osteoprotegerin (OPG), a decoy receptor for RANKL that prevents its binding to osteoclast progenitors44 . Importantly, mice lacking RANKL in osteocytes, have increased bone mass and are resistant to bone loss after tail suspension4 5' 46. However, these studies used the DMP1 promoter, which is also expressed in a subset of osteoblasts. Thus, additional studies with alternative osteocyte promoters driving the loss of RANKL is required to validate the role of osteocyte derived RANKL to the bone's response to mechanical unloading.

40 3.5 Osteocyte depleted mice are resistant to disuse-induced bone loss

A mouse model in which osteocytes are selectively ablated upon diphtheria toxin administration demonstrated not only that osteocytes are key regulators of skeletal homeostasis, as these mice have severe osteopenia, but also that without osteocytes bone is resistant to unloading induced bone loss4

3.6 Osteocyte osteolysis in disuse-induced bone loss

Microgravity-induced bone loss in humans has been historically thought of as increased bone resorption via osteoclast activity and, in some studies, a decrease in osteoblast function6 . However, recent evidence shows that osteocytes can directly resorb their perilacunar/canalicular matrix through a process termed 'osteocytic osteolysis' 48*.

To our knowledge, the only spaceflight study of osteocyte biology comes from a Russian Bion-1 1 biosatellite launched in 1996 carrying two Macaca mullatta monkeys for a 14-day mission. Examination of iliac crest biopsies of the flight animals showed mature osteocytes had increased specific volume of the Golgi complex and increased osteolytic activity49. Evidence for osteocytic osteolysis as a contributor to microgravity-induced bone loss is supported by iliac crest biopsies of the Macaca mullatta monkeys (Bion 11, 1996) that showed mature osteocytes had increased osteolytic activity49. Additional evidence of osteocytic osteolysis (e.g., increased lacunar area and perimeter) following microgravity exposure was recently reported in adult mice exposed to 15 days of microgravity on STS-131 20 . However, the mechanisms that drive the increase in osteocytic osteolysis in microgravity and disuse-induced bone loss are still largely unknown. Importantly, a recent ground-based in vitro study reported that sclerostin promotes the release of osteocytic perilacunar bone mineral by inducing osteocyte expression of carbonic anhydrase 2 (Car2), cathepsin K (Ctsk), and tartrate-resistant acid phosphatase (Acp5)25 .

41 3.7 Ground based models of microgravity and disuse bone loss

Given the financial expense and limited nature of spaceflight experiments, several models of ground (earth) based in-vivo and in-vitro mechanical unloading models have been developed. Several of these model systems are utilized in this thesis and are reviewed, herein.

3.7.1 In-vivo (rodent) ground based models of mechanical unloading

Various models of disuse-induced bone and muscle loss have been developed, including, but not limited to cast immobilization 14, spinal cord injury 50, muscle paralysis (e.g. Botulinum toxin) 51, and the tail suspension hind limb unloading model52-54. The tail suspension hind limb unloading model, developed by National Aeronautics and Space Administration (NASA), is unique in its ability to mimic the cephalad-fluid shift that occurs in microgravity while avoiding weight bearing by the hindquarters5 2-5 4. More recently, to investigate the physiological effects and response to partial unloading environments, Wagner et al.55 developed a rodent model that allows for chronic exposure to various IPx/Pv rf nrtial weight- bearing. For this thesis, we employed the hind limb unloading (Chapter 7) and partial weight bearing model (Chapter 8) to study the musculoskeletal effects of sclerostin inhibition in rodents.

3.7.2 In-vitro models of mechanical unloading

Rotating wall vessels (RWVs) and three-dimensional clinostats, also called random positioning machines (RPMs), are two systems commonly used to simulate microgravity5-58. The RPM consists of two frames that rotate independently and randomly about orthogonal axes resulting in a gravity vector 56 8 that is in constant motion and can approach a residual force as low as 10-5 g -5 force. NASA developed the RWV bioreactor as a model for the low-shear, low- turbulence conditions of microgravity cell culture. Cells, tissues, or scaffolds are rotated synchronously in the bioreactor vessel such that the fluid dynamic effect

42 on them mimics a particle allowed to free fall with the time-averaged gravitational vector on individual cells modeled as 10-3 g force56 . At the commencement of this thesis, neither the RPM or RWV models had been used to study isolated osteocytes in simulated microgravity. The RWV bioreactors have been broadly published as models of simulated microgravity for a wide variety of cell types 59-

65. Of particular note, is the recently performed study by Martinez, et al. that show the NASA bioreactors reproduce key findings of actual spaceflight microgravity conditions in immunologic cells5 6. For this thesis, we have chosen to utilize the RWV bioreactors to study the effects of simulated microgravity in osteocytes (Chapter 5).

43 1 Leblanc, A. et al. Bisphosphonates as a supplement to exercise to protect bone during long-duration spaceflight. Osteoporos Int 24, 2105-2114, doi:10.1 007/sOO1 98-012-2243-z (2013). 2 Looker, A. C. et al. Updated data on proximal femur bone mineral levels of US adults. Osteoporos Int 8, 468-489 (1998). 3 Sibonga, J. D. Spaceflight-induced bone loss: is there an osteoporosis risk? Curr Osteoporos Rep 11, 92-98, doi:10.1007/s11914-013-0136-5 (2013). 4 Khosla, S. et al. Benefits and risks of bisphosphonate therapy for osteoporosis. J Clin Endocrinol Metab 97, 2272-2282, doi:jc.2012-1027 [pii] 10.1210/jc.2012-1027 (2012). 5 Smith, S. M. et al. Benefits for bone from resistance exercise and nutrition in long-duration spaceflight: Evidence from biochemistry and densitometry. J Bone Miner Res 27, 1896-1906, doi:10.1002/jbmr.1647 (2012). 6 Orwoll, E. S. et al. Skeletal health in long-duration astronauts: nature, assessment, and management recommendations from the NASA Bone Summit. J Bone Miner Res 28, 1243-1255, doi:10.1002/jbmr.1948 (2013). 7 Davis, S. A. & Davis, B. L. Exercise equipment used in microgravity: challenges and opportunities. Curr Sports Med Rep 11, 142-147, doi:10.1249/JSR.ObOl3e3182578fc3 00149619-201205000-00010 [pii] (2012). 8 Sibonga, J. D. et al. Recovery of spaceflight-induced bone loss: bone mineral density after long-duration missions as fitted with an exponential function. Bone 41, 973-978, doi:S8756-3282(07)00624-2 [pii] 10.1016/j.bone.2007.08.022 (2007). 9) BnUIaVVdIU, L. F. Osteocyte messages from a byCell IVdetlab 0, 410-411, doi:S1550-4131(07)00135-0 [pii] 10.1016/j.cmet.2007.05.008 (2007). 10 Bonewald, L. F. Osteocytes as dynamic multifunctional cells. Ann N Y Acad Sci 1116, 281-290, doi:annals.1402.018 [pii] 10.1 196/annals.1402.018 (2007). 11 Bonewald, L. F. Mechanosensation and Transduction in Osteocytes. Bonekey Osteovision 3, 7-15, doi:10. 1138/20060233 (2006). 12 Bonewald, L. F. Summary--Osteocytes and mechanotransduction. J Musculoskelet Neuronal Interact 5, 333-334 (2005). 13 Bonewald, L. F. & Johnson, M. L. Osteocytes, mechanosensing and Wnt signaling. Bone 42, 606-615, doi:S8756-3282(08)00008-2 [pii] 10.1016/j.bone.2007.12.224 (2008). 14 Krempien, B., Manegold, C., Ritz, E. & Bommer, J. The influence of immobilization on osteocyte morphology: osteocyte differential count and electron microscopical studies. Virchows Arch A Pathol Anat Histol 370, 55-68 (1976). 15 Aguirre, J. I. et al. Osteocyte apoptosis is induced by weightlessness in mice and precedes osteoclast recruitment and bone loss. J Bone Miner Res 21, 605-615, doi: 10.1 359/jbmr.060107 (2006).

44 16 Palumbo, C., Ferretti, M., Ardizzoni, A., Zaffe, D. & Marotti, G. Osteocyte- osteoclast morphological relationships and the putative role of osteocytes in bone remodeling. J Musculoskelet Neuronal Interact 1, 327-332 (2001). 17 Bakker, A., Klein-Nulend, J. & Burger, E. Shear stress inhibits while disuse promotes osteocyte apoptosis. Biochem Biophys Res Commun 320, 1163-1168, doi:10.1016/j.bbrc.2004.06.056 S0006291X04013415 [pii] (2004). 18 Heino, T. J., Hentunen, T. A. & Vaananen, H. K. Osteocytes inhibit osteoclastic bone resorption through transforming growth factor-beta: enhancement by estrogen. J Cell Biochem 85, 185-197, doi:10.1002/jcb.10109 [pii] (2002). 19 Tavella, S. et al. Bone turnover in wild type and pleiotrophin-transgenic mice housed for three months in the International Space Station (ISS). PLoS One 7, e33179, doi:10.1371/journal.pone.0033179 (2012). 20 Blaber, E. A. et al. Microgravity induces pelvic bone loss through osteoclastic activity, osteocytic osteolysis, and osteoblastic cell cycle inhibition by CDKN1a/p21. PloS one 8, e61372, doi:10.1371/journal.pone.0061 372 [doi] (2013). 21 Jee, W. S. S., Wronski, T. J., Morey, E. R. & Kimmel, D. B. Effects of spaceflight on trabecular bone in rats. American Journal of Physiology 244, R310-R344 (1983). 22 Bouxsein, M. L. et al. Sclerostin Antibody Treatment Improves Bone Mass, Microarchitecture and Mechanical Properties in Mice Exposed to Microgravity: Results from the STS-135 Shuttle Mission. J Bone Mineral Res 27 (Suppl 1). (2012). 23 Galli, C., Passeri, G. & Macaluso, G. M. Osteocytes and WNT: the mechanical control of bone formation. J Dent Res 89, 331-343, doi:0022034510363963 [pii] 10.1177/0022034510363963 (2010). 24 Kim, C. A. et al. A known SOST gene mutation causes sclerosteosis in a familial and an isolated case from Brazilian origin. Genet Test 12, 475- 479, doi: 10.1 089/gte.2008.0036 (2008). 25 Kogawa, M. et al. Sclerostin regulates release of bone mineral by osteocytes by induction of carbonic anhydrase 2. J Bone Miner Res 28, 2436-2448, doi: 10.1 002/jbmr.2003 (2013). 26 Leupin, 0. et al. Control of the SOST bone enhancer by PTH using MEF2 transcription factors. J Bone Miner Res 22, 1957-1967, doi:10.1 359/jbmr.070804 (2007). 27 Nguyen, J., Tang, S. Y., Nguyen, D. & Alliston, T. Load regulates bone formation and Sclerostin expression through a TGFbeta-dependent mechanism. PloS one 8, e53813, doi:10.1371/journal.pone.0053813; 10.1371/journal.pone.0053813 (2013). 28 Papanicolaou, S. E., Phipps, R. J., Fyhrie, D. P. & Genetos, D. C. Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology 46, 389-399, doi:10.3233/BIR-2009-0550; 10.3233/BIR-2009-0550 (2009).

45 29 Powell, W. F., Jr. et al. Targeted ablation of the PTH/PTHrP receptor in osteocytes impairs bone structure and homeostatic calcemic responses. J Endocrinol 209, 21-32, doi:JOE-10-0308 [pii] 10.1530/JOE-10-0308 (2011). 30 Robling, A. G. et al. Mechanical stimulation of bone in vivo reduces osteocyte expression of Sost/sclerostin. J Biol Chem 283, 5866-5875, doi:M705092200 [pii] 10.1074/jbc.M705092200 (2008). 31 Semenov, M., Tamai, K. & He, X. SOST is a ligand for LRP5/LRP6 and a Wnt signaling inhibitor. J Biol Chem 280, 26770-26775, doi:M504308200 [pii] 10.1074/jbc.M504308200 (2005). 32 Semenov, M. V. & He, X. LRP5 mutations linked to high bone mass diseases cause reduced LRP5 binding and inhibition by SOST. J Biol Chem 281, 38276-38284, doi:M609509200 [pii] 10.1074/jbc.M609509200 (2006). 33 Balemans, W., Cleiren, E., Siebers, U., Horst, J. & Van Hul, W. A generalized skeletal hyperostosis in two siblings caused by a novel mutation in the SOST gene. Bone 36, 943-947, doi:S8756- 3282(05)00058-X [pii] 10.101 6/j.bone.2005.02.019 (2005). 34 Balemans, W. et al. Increased bone density in sclerosteosis is due to the deficiency of a novel secreted protein (SOST). Hum Mol Genet 10, 537- 543 (2001). 35 Balemans, W. et al. Identification of a 52 kb deletion downstream of the SOST gene in patients with van Buchem disease. J Med Genet 39, 91-97 (2002). 36 Paszty, C., Turner, C. H. & Robinson, M. K. Sclerostin: a gem from the genome leads to bone-building antibodies. J Bone Miner Res 25, 1897- Iv'.t, u I. IU. I1 U.2/jumr.I U1I l1 u I(U2). 37 Bellido, T. et al. Chronic elevation of parathyroid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis. Endocrinology 146, 4577-4583, doi:en.2005-0239 [pii] 10.1210/en.2005-0239 (2005). 38 Robling, A. G., Bellido, T. & Turner, C. H. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J Musculoskelet Neuronal Interact 6, 354 (2006). 39 Lin, C. et al. Sclerostin Mediates Bone Response to Mechanical Unloading via Antagonizing Wnt/beta-Catenin Signaling. J Bone Miner Res 24, 1651- 1661 (2009). 40 Collette, N. M. et al. Targeted deletion of Sost distal enhancer increases bone formation and bone mass. Proceedings of the National Academy of Sciences of the United States of America 109, 14092-14097, doi:10.1073/pnas.1207188109 (2012). 41 Gaudio, A. et al. Increased sclerostin serum levels associated with bone formation and resorption markers in patients with immobilization-induced bone loss. J Clin Endocrinol Metab 95, 2248-2253, doi:jc.2010-0067 [pii] 10.1210/jc.2010-0067 (2010).

46 42 lqbal, J. & Zaidi, M. Molecular regulation of mechanotransduction. Biochem Biophys Res Commun 328, 751-755 (2005). 43 Sheng, M. H., Zhou, X. D., Bonewald, L. F., Baylink, D. J. & Lau, K. H. Disruption of the insulin-like growth factor-1 gene in osteocytes impairs developmental bone growth in mice. Bone 52, 133-144, doi:S8756- 3282(12)01289-6 [pii] 10.1016/j.bone.201 2.09.027. 44 Boyce, B. F. & Xing, L. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys 473, 139-146, doi:S0003- 9861(08)00159-8 [pii] 10.1016/j.abb.2008.03.018 (2008). 45 Xiong, J. et al. Matrix-embedded cells control osteoclast formation. Nat Med 17, 1235-1241, doi:nm.2448 [pii] 10.1038/nm.2448. 46 Nakashima, T. et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature medicine 17, 1231-1234, doi:10.1038/nm.2452; 10.1038/nm.2452 (2011). 47 Tatsumi, S. et al. Targeted ablation of osteocytes induces osteoporosis with defective mechanotransduction. Cell Metab 5, 464-475, doi:S1550- 4131(07)00128-3 [pii] 10.101 6/j.cmet.2007.05.001 (2007). 48 Qing, H. et al. Demonstration of osteocytic perilacunar/canalicular remodeling in mice during lactation. J Bone Miner Res 27, 1018-1029, doi:10.1002/jbmr.1567 (2012). 49 Rodionova, N. V., Oganov, V. S. & Zolotova, N. V. Ultrastructural changes in osteocytes in microgravity conditions. Adv Space Res 30, 765-770 (2002). 50 Beggs, L. A. et al. Sclerostin Inhibition Prevents Spinal Cord Injury- Induced Cancellous Bone Loss. J Bone Miner Res 30, 681-689, doi:10.1002/jbmr.2396 (2015). 51 Ellman, R. et al. Combined effects of botulinum toxin injection and hind limb unloading on bone and muscle. Calcif Tissue Int 94, 327-337, doi:10.1 007/s00223-013-9814-7 (2014). 52 Morey-Holton, E., Globus, R. K., Kaplansky, A. & Durnova, G. The hindlimb unloading rat model: literature overview, technique update and comparison with space flight data. Adv Space Biol Med 10, 7-40 (2005). 53 Morey-Holton, E. R. & Globus, R. K. Hindlimb unloading rodent model: technical aspects. J Appi Physiol 92, 1367-1377 (2002). 54 Morey-Holton, E. R. & Globus, R. K. Hindlimb unloading of growing rats: a model for predicting skeletal changes during space flight. Bone 22, 83S- 88S (1998). 55 Wagner, E. B. et al. Partial weight suspension: a novel murine model for investigating adaptation to reduced musculoskeletal loading. J Appi Physiol (1985) 109, 350-357, doi:10.11 52/japplphysiol.00014.2009 (2010). 56 Martinez, E. M., Yoshida, M. C., Candelario, T. L. & Hughes-Fulford, M. Spaceflight and simulated microgravity cause a significant reduction of key gene expression in early T-cell activation. doi:D - NLM: PMC4360066 [Available on 03/15/16] OTO - NOTNLM.

47 57 Hoson, T., Kamisaka S Fau - Masuda, Y., Masuda Y Fau - Yamashita, M., Yamashita M Fau - Buchen, B. & Buchen, B. Evaluation of the three- dimensional clinostat as a simulator of weightlessness. 58 R, H. Desktop RPM. New Small Size Microgravity Simulator for the Bioscience Laboratory. Fokker Space, 1-5 (2000). 59 Sambandam, Y. et al. Microgravity control of autophagy modulates osteoclastogenesis. 60 Cazzaniga, A., Castiglioni, S. & Maier, J. A. Conditioned media from microvascular endothelial cells cultured in simulated microgravity inhibit osteoblast activity. Biomed Res Int 2014, 857934, doi:10. 1155/2014/857934 (2014). 61 Sambandam, Y. et al. Microarray profile of gene expression during osteoclast differentiation in modelled microgravity. 62 Capulli, M., Rufo A Fau - Teti, A., Teti A Fau - Rucci, N. & Rucci, N. Global transcriptome analysis in mouse calvarial osteoblasts highlights sets of genes regulated by modeled microgravity and identifies a "mechanoresponsive osteoblast gene signature". 63 Saxena, R., Pan G Fau - McDonald, J. M. & McDonald, J. M. Osteoblast and osteoclast differentiation in modeled microgravity. 64 Rucci, N., Rufo A Fau - Alamanou, M., Alamanou M Fau - Teti, A. & Teti, A. Modeled microgravity stimulates osteoclastogenesis and bone resorption by increasing osteoblast RANKL/OPG ratio. 65 Vincent, L., Avancena P Fau - Cheng, J., Cheng J Fau - Rafii, S., Rafii S Fau - Rabbany, S. Y. & Rabbany, S. Y. Simulated microgravity impairs leukemic cell survival through altering VEGFR-2NEGF-A signaling pathway.

48 Chapter 4

4 Development and characterization of a novel osteocytic cell line (Ocy454)

This thesis chapter, in part, previously published as the manuscript: Spatz, et al., The Wnt-inhibitor Sclerostin is Up-regulated by Mechanical Unloading in Osteocytes in-vitro, JBC, 2015.

49 4.1 Rationale

Currently available osteocytic cell lines' 2 express low level of key osteocytic proteins (e.g. Sclerostin, FGF23) and require high cell density with extended time in culture under differentiation conditions to become osteocyte-like. To investigate osteocyte responses to unloading, we have isolated and characterized a novel osteocytic cell line (Ocy454), reported herein, which faithfully recapitulates the in vivo response of osteocytes to mechanical stimuli (Chapter 5). Ocy454 cells show rapid, high-level expression of SOST/sclerostin that is responsive to hormonal (PTH), cytokine (PGE 2), and mechanical stimuli. Furthermore, Gsa knockdown in Ocy454 led to significant increases in SOST expression matching known osteocyte in-vivo regulation3 demonstrating the broad utility of this new osteocytic cell line for studying SOST/sclerostin regulation, as we have recently reported4 . Ocy454 also showed an enhanced osteocytic phenotype when cultured on a three dimensional (3D) biomaterial, by increasing FGF23 expression upon PTH stimulation highlighting the importance of optimizing in-vitro culture conditions for studying certain aspects of osteocyte biology.

4.2 Introduction

Studies of osteocyte biology have been hampered by their inaccessibility and by the lack of techniques to generate cell lines that faithfully characterize this cell population5 . Selective cell lines, HOB-01-C1, MLO-Y4, and IDG-SW3 exhibit osteocytic characteristics' 2 , but require differentiation factors and extended time in culture. While, primary cell cultures can be differentiated to express a mature osteocytic phenotype, these cultures have limited passage capability. The lack of mature osteocytic cell models and the limited passage ability of primary cells highlight the need for additional osteocyte cellular models.

50 4.3 Materials and methods

4.3.1 Osteocytic cell line

Mice expressing the green fluorescent protein (GFP) under the control of the 8Kb of Dentin Matrix-Protein 1 (8KbDMP1-GFP) (kindly provided by Dr. Ivo Kalajzic, University of Connecticut Health Center)5 were mated with mice carrying a ubiquitously expressed SV4OAg (Immortomouse Charles River) and osteocytes were isolated from the long bones of 4-week old double transgenic mice. Long bones were cut at the epiphysis, flushed with medium (aMEM) (Gibco, Grand Island, NY) supplemented with 0.1% of bovine serum albumin, 25mM HEPES (pH 7.4) and containing 1 mg/ml collagenase Type 1:11 (ratio 1:3) (Worthington, Lakewood, NJ) subjected to 4 sequential collagenase digestions, one EDTA digestion, a final sixth collagenase digestion, and minced bone fragments placed in collagen coated 100 mm tissue discs. Cells were allowed to reach confluence at 33 'C and then grown for an additional 10-12 days at 37 'C prior to FACS sorting for DMP1-GFP expression. Bulk-sorted GFP-positive cells were maintained on collagen coated flasks grown in aMEM supplemented with 10% FBS (Gibco, Grand Island, NY) and 1% antibiotic-antimycotic (Gibco). Subsequently, two criteria were selected for further identification of a mature osteocytic cell line: 1) sorted GFP-positive were required to have high levels of production of known osteocytic genes (SOST, DMP1) at early time point of 14 days at the semi-permissive temperature, 37 'C, in the absence of differentiation, and 2) respond to the known effects of PTH stimulation by suppression of SOST and increased expression of RANKL. This method provided a heterogeneous population of DMP1-GFP positive cells that more faithful resemble osteocytes in vivo, which are known to be a mix of cells with various degrees of SOST and DMP1 expression depending on their age/maturation. We performed our experiments in this heterogeneous population. In an effort to establish a more homogeneous osteocytic population, we also performed FACS on Ocy454 to isolate single cell subclones. Ocy454 and several single cell clones4 , have the same osteocyte marker expression and response to stimuli.

51 For two-dimensional cell culture, cells (Ocy454, IDG-SW3', and primary long bone osteoblasts isolated from 4-week old SV40TAg mice) were plated at 10 5 cells/ml, allowed to reach confluence at the permissive temperature (33 OC) for 3 days. Subsequently, cells were either differentiated at the permissive temperature or switched to the semi-permissive temperature (37 'C) for the indicated time points. MLO-Y4 cells were plated at 10 5 cells/ml and RNA extracted at 4 days. For primary osteocytes, cells were isolated from 4-week old DMP1-GFP long bones. In brief, long bones were flushed of bone marrow with PBS, subjected to sequential collagenase digestions, minced, and bone chips placed in tissue culture plates. Subsequently, at the two-week time point FACS was performed. GFP- and GFP+ positive populations were directly collected into RNA extraction buffer (Qiagen).

The routine culturing conditions to maintain the Ocy454 osteocytic phenotype was twice weekly sub-passages (1:5) for up to 4 months from a frozen stock. For 3D cell culture, 1.6 x 105 Ocy454 cells were plated on 200 pm polystyrene Alvetex (Reinnervate) well insert scaffolds. Scaffolds were collagen coated per manufacture protocols for indicated experiments. All other chemicals were from Sigma-Aldrich (St. Louis, MO) or Fisher Scientific.

4.3.2 Quantitative real time pcr

Total RNA was isolated (RNAEasy, Qiagen, Valencia, CA) per manufacturer's recommendations and RNA quantified (NanoDrop, Thermo Scientific, Rockford, IL). cDNA synthesis was preformed (Qiagen, Valencia, CA or Clontech, Mountain View, CA ) on 0.5-1 pg total RNA, followed by SYBR qPCR (StepOnePlus, Life Technologies, Grand Island, NY). Primer sequences are available upon request. Beta-actin (ACTB) was used for normalization of gene expression and ACT computed within each sample to the housekeeping reference and AACT across experimental conditions. Experiments were run in triplicates, unless otherwise indicated.

52 4.3.3 Western blot

Whole cell lysates (MPER, Thermo Scientific, Rockford, IL) from 2D-cell culture conditions were prepared according to the manufacturer's recommendations. Protein concentrations were quantified (Bio-Rad Protein Assay, Bio-Rad, Hercules, CA), 10 pg was separated on a 4-20% Tris-Glycine denaturing gel (Life Technologies, Grand Island, NY), and transferred to a PVDF membrane using the Trans-blot Turbo (Bio-Rad) system per manufacturer's recommendations. The membrane was blocked with 3% BSA and 5% non-fat milk in Tris buffered saline containing 0.05% Tween-20 (TBST) for 1 hour and then incubated with goat polyclonal mouse sclerostin antibody (1:200, R&D Systems, Minneapolis, MN) overnight at 4C [30]. After washing, secondary antibody (1:5000) was incubated for 1 hour at room temperature and then developed using enhanced chemiluminescence (Thermo Scientific, Rockford, IL) [30]. For Gsa immunoblotting, similar procedures were followed using an anti-Gsa antibody (Millipore, catalogue number 06-237).

4.3.4 Sclerostin immunohistochemistry

Three-dimensional scaffolds were washed once with phosphate-buffered saline (Life Technologies), frozen embedded (OCT, Tissue Tek), and 10 pM sections cut onto standard microscope slides. In brief, proteinase K was used for antigen retrieval for 15 minutes, followed by a quench in 3% H 202/Methanol for 10 minutes, washed in H 2 0 and rinsed in 1X TBS. Next, biotinylated anti-sclerostin antibody (R&D Systems, BAF1589) diluted 1:50 in TNB was incubated for 1 hour, washed three times with 1X TNT, SA-HRP diluted 1:100 in TNB was then added to slides and incubated for 30 minutes, washed three times with 1X TNT, and incubated with DAB HRP substrate (Vector Labs) for 5 minutes, and cover- slipped.

53 4.3.5 Sclerostin elisa

Four ml of cell culture supernatants from slow-turning rotating wall bioreactor experiments at indicated time points were spun at 850 rpm for four minutes and volume reduced to 250 ml with a 10kDa centrifugal filter unit (Millipore, Billerica, MA) per manufacturer recommendations. Supernatants were assayed for sclerostin using a commercially available assay (ALPCO, Salem, NH) per manufacture recommendations. For additional sclerostin ELISA experiments, an antibody matched pair ELISA assay was used4'6 . In brief, for the matched pair sclerostin ELISA, conditioned medium (36-48 hours) was harvested from Ocy454 cells as indicated in the figure legends and stored at -80 C until further use. High binding 96 well plates (Fisher, 21-377-203) were coated with Scl-Ab VI capture antibody (3 pg/ml) in PBS for one hour at room temperature. Plates were washed (PBS plus 0.5% Tween-20) and blocked with wash buffer supplemented with 1% BSA and 1 % normal goat serum for one hour at room temperature. Samples (60 pl/well) were then added along with a standard curve of murine recombinant Sclerostin (ALPCO) and plates were incubated overnight at 4C. Plates were washed three times, incubated with HRP-coupled ScI-Ab VII detection antibody (0.5 pg/ml) for one hour at room temperature. After washing, signal detection was performed using Ultra TMB-ELISA (Pierce, 34028), stopped by 2N sulfuric acid, and read at 450 nm. Prior to harvesting supernatant, cell number per well was determined using PrestoBlue assay (Life Technology) according to the manufacturer's instructions.

For shRNA experiments, shRNA (Broad Institute, Cambridge, MA) lentiviral particles in puromycin resistant vector, targeted against luciferase (control, shLuciferase) or shGsa were used to infect cells plated one day prior at 0.5 x 10 5 cells/ml. Subsequently, infected cells were puromycin selected (2 pg/mL) at the permissive temperature (33 'C) for seven days, and subsequently allowed to differentiate for 14-16 days at the semi-permissive temperature. Table 4-1 provides the shRNA target sequences.

54 Table 4-1: shRNA Target Sequence shRNA Target Sequence LacZ CCAACGTGACCTATCCCATTA Luciferase AGAATCGTCGTATGCAGTGAA GNAS E3 CGCAGATAAGAAACGCAGCAA GNAS B2 GCCAAGTACTTCATTCGGGAT GNAS G2 TCGGGATGAGTTTCTGAGAAT GNAS G9 CCTGCATGTTAATGGGTTTAA GNAS C2 CCTGAAGAATCTGTGCCATTT

4.4 Results

4.4.1 Osteocytic cell line basal and hormonal characterization

Our method for osteocyte cell line development coupled fluorescent sorting for an osteocytic marker (DMP1) with functional hormonal screening to accurately ensure the cell line possessed the key functional responses of mature osteocytes in vivo. Out of several preparations one population of sorted DMP-GFP-SV40TAg (Ocy454) cells was selected for further characterization on the basis of its high expression of SOST at early time points at the semi-permissive temperature. Ocy454 osteocytic cells displayed a dendritic morphology (Figure 4-1A) similar to other osteocytic cell lines' 2 and at two weeks at the semi-permissive temperature (37'C) expressed the DMP1 -GFP transgene (Figure 4-1 B, C).

55 C 33C 37 C

12d

Figure 4-1: (A) Representative dendritic morphology of osteocytic cell line (Ocy454), (B) DMP1-GFP expression at 3-days for permissive temperature (33'C), (C) DMP1-GFP expression time course at 5d and 12d for both permissive (33'C) and semi-permissive temperature (37'C).

After two weeks at 370C, Ocy454 cells expressed significantly higher levels of SOST and DMP1 compared to long bone primary osteocytes as well as the only other available osteocytic cell lines, MLO-Y4 and IDG-SW3 (Figure 4-2A,B). Upon further study, we also observed Ocy454 differentiated upon contact inhibition at the permissive temperature (Figure 4-1C, 2B). However, Ocy454 differentiated at a slower pace at the permissive temperature. For example, at the one-week time point there was lower levels of SOST at the permissive temperature compared to the semi-permissive temperature (Figure 4-2B). In addition, Ocy454 expressed levels of SOST that were significantly higher than those expressed by long bone osteoblasts (Figure 4-2B) as early as one week at 37C in the absence of differentiation factors. Sclerostin was detected in the cell culture supernatant at day 11 and continued to increase with time in culture (Figure 4-2B). Furthermore, after two weeks at the semi-permissive temperature

56 (37C) Ocy454 cells expressed high levels of other characteristic osteocytic genes such as DMP1 (Figure 4-2B). In contrast, these cells had low levels of expression of genes characteristic of immature osteocytes and late osteoblasts, such as keratocan (Kera) (Figure 4-2B) 7,8 . After one week in culture at 370C, Ocy454 cells expressed levels of DMP1 (Figure 4-2B) that were significantly higher than those expressed by long bone osteoblasts (LB-OBs). In addition, RANKL was highly expressed at the permissive temperature and then expression dropped to levels comparable to wild-type osteoblasts and IDG-SW3 cell line with differentiation at the semi-permissive temperature (Figure 4-21B). Interestingly the expression of FGF23 in Ocy454 followed a biphasic pattern of expression with significantly more mRNA at one week in semi-permissive culture than at later time points (Figure 4-2B).

57 A SOST DMP1 RANKL 400- 800 M Ocy454 C3 MLO-Y4 60 Con.7 300- 200- 400- 0.5- 100- 200- z 0- L 0.0- B SOST Sclerostin DMP1

100- * 3 -5 * -I Ocy454-33C 5 i 250 80- Ocy454-37C 1 *** *# LB-OBs 5I *# ' 60- IDG-SW3 LB: GFP- I 40- Ocy: GFP+

M1 1520

20-

FGF23 RANKL 10 KERA 15- 15- 4- NDNDN

IIo- 10- 10-

5- 5- II

NV

0 0 C CP

Figure 4-2: (A) Ocy454 at 2 weeks (37'C), black bars, express characteristic osteocytic markers vs. MLO-Y4 in the absence of differentiation media, (D) Ocy454 at I weeks and 2 weeks (37 'C), black bars, express characteristic osteocytic markers SOST, Sclerostin, DMP1, FGF23, RANKL, and lack Kera expression in the absence of differentiation media compared to long bone osteoblasts, IDG-SW3 (2 weeks), long bone DMPI-GFP- and long bone DMP1-GFP+ osteocytes. * p<0.001 1wk, 2wk at semi-permissive growth temperature (37'C) vs. permissive growth temperature (33'C, 3 days), ** p<0.001 1wk, 2wk at semi- permissive temperature vs. permissive growth temperature at indicated time points, # p<0.001 Ocy454 vs. long bone osteoblasts (LB-OB), W p<0.001 Ocy454 vs. long bone DMP1-GFP+ osteocytes at indicated time points. ND: Not detected. Error bars represent one SD.

58 We next assessed Ocy454 cell responsiveness to known osteocyte regulators. Short-term (4 hour) treatment with human (h)PTH(1-34), forskolin (FSK), or (16 hour) prostaglandin E2 (PGE 2) induced a statistically significant down-regulation of SOST (Figure 4-3A, p < 0.001 for all), and sclerostin both in whole cell lysate and condition media (Figure 4-3B, C). These results are consistent with the known inhibitory effects of these agents on SOST expression. In contrast, a

PGE 2 inhibitor, indomethacin caused an increase in SOST (Figure 4-3B) showing Ocy454 cells have an intact hormonal axis that increases SOST expression.

In addition, hPTH(1-34) dose- and time-response experiments showed Ocy454 to be sensitive to down regulation of SOST in as short as 2 hours (1OOnM, Figure 4-3D) and a 50% suppression at doses as low as 0.1 nM hPTH(1 -34) (Figure 4-

3D). Similarly, hPTH(1-34) (4-hr), FSK, and PGE 2 caused concurrent increases in RANKL mRNA (Figure 4-3E). hPTH(1-34) suppressed Mef2C mRNA (Figure 4-3F), consistent with previous reports [44,45] and DMP1 mRNA (Figure 4-3G). There was no regulation of FGF23 mRNA by 4-hour PTH treatment in Ocy454 at 1-week or 2-weeks in two-dimensional non-collagen and collagen coated 6-well plate culture conditions (data not shown).

59 A B SOST Sclerostin Sclerostin

S 1.5- VEH M VEH m VEH PTH T PTH 300- Indometh 1 uM FSK I0 Indometh 10 uM PGE2 3 m PTH 10 nM i 200- 100-d

0.0 14d 16d C I 2 3 4 5 Sclerostin GAPDH D PTH: SOST Timecourse PTH-4HR Dose Response 2.0- 1.5-

z~*1.5- z .0- Eo E * * ~if 0 - g'*0.5- 1 0.5-

* * 0.I V

* E F G RANKL Mef2C DMPI 20 m 2.0- m VEH m VEH m VEH U* PTH m PTH m PTH 1.5- FSK 40 PGE2 T 1.0 1.0- E .j 15 0.54K -r 0.5-

Z* 0.0- O.Oj

Figure 4-3: Ocy454 (A) decreases SOST with 4-hour (h)PTH(1-34) (100 nM), Forskolin (10 nM) and 16-hour (PGE 2, 5 nM) treatment to known negative regulators at 2 weeks at semi-permissive temperature, (B) 16-hour hPTH(1-34) (100 nM) decreases secreted sclerostin as measured by ELISA (ALPCO) and 48-hr indomethacin treatment (1 IM and 10 pM) increases secreted sclerostin by ELISA (Amgen), (C) 4-hour hPTH(1-34) (100 nM) treatment of Ocy454 at 2-weeks suppresses total cell lysate sclerostin: Lane 1-2: VEH, Lane 3-4: hPTH(1-34), Lane 5: Sclerostin standard (APLCO), (D) hPTH(1-34) time course and dose response for SOST suppression, (E) increases RANKL with 4- hour treatment to hPTH(1-34), forskolin, and 16-hour PGE 2 at 2 weeks, (F) 4hr hPTH(1- 34) treatment suppresses Mef2C, (G) and DMP1. * p<0.001 for all SOST time course and hormone/cytokine treatment vs. VEH. Error bars represent one SD.

60

* We and others have previously reported that mice lacking 39 Gsa have increased levels of SOST/Sclerostin. To confirm these in-vivo results in Ocy454 cells, we used shRNA to knock-down Gsa in Ocy454, as was done previously for HDAC5 4. The range of sclerostin secretion (normalized to cell number) was determined in each experiment using 10 separate control lentiviruses expressing shRNAs against non-expressed genes (LacZ, luciferase, GFP, RFP). Dotted lines indicate two standard deviations above the mean value of sclerostin secretion (normalized to cell number) in the presence of the control hairpins. As shown in Figure 4-4A, two out of five hairpins tested to achieve LV-mediated shRNA knockdown of GNAS (but not related heterotrimeric G proteins GNAQ or GNA1 1) consistently increased sclerostin secretion (individual hairpins labeled next to corresponding data points). The individual hairpins that reduced GNAS mRNA levels accordingly increased SOST expression (Figure 4-4B), thereby confirming the expected knockdown/phenotype relationship for this known SOST regulator. GNAS hairpins "G2" and "G9" both effectively reduced Gsa protein levels (Figure 4-4C), and hairpin G2 was selected for further study. Sclerostin secretion in control (shLuciferase) and GNAS G2 shRNA-expressing cells was determined over time. As shown in Figure 4-4D, GNAS shRNA causes an increase in sclerostin secretion at all-time points, with the most dramatic results at early times after switching cells from 330C to 37C. Finally, GNAS shRNA cells were tested for PTH responsiveness. Figure 4-4E shows that GNAS shRNA increases basal SOST expression (after 14 days at 37TC); furthermore, while control cells respond to PTH at this time point with suppression of SOST levels, this is not the case when Gsa levels are reduced. Taken together, these data confirm a cell-intrinsic role for Gsa in osteocytes, and further support the use of Ocy454 cells for studying SOST gene regulation.

61 A B

400. 8 G2 E300G9

W0 4- 3091 200 - G9

m10B2 A A V -- 2 B2 6e* A -E-40C2 ~ E3 ...... M..C2...A.A ...... Nv -20 0 20 40 60 80 % GNAS knockdown C D shLacZ 10000- shGNAS

shRNA 8000( 6000 IBGs, ( 4000 .2 200 m mn IBTubulin

E SOST X10- mVEHE 8. PTH

E. 4

0z

shLuciferase shGNAS C2 shGNAS G2 Figure 4-4: (A) Ocy454 cells were infected with control shRNA-expressing lentiviruses (shGFP, shLuciferase, shRFP, shLacZ) and 5 separate hairpins targeting the indicated gene. Each data point represents sclerostin/cell number values obtained for an individual hairpin. Dotted lines indicate values two standard deviations above and below those of the controls. For GNAS, individual hairpins are labeled on the data plot. (B) Ocy454 cells were infected with shGFP and the indicated GNAS shRNA lentiviruses and then switched to 37'C. 14 days later, RNA was isolated and RT-qPCR performed for beta actin, GNAS, and SOST. (C) As in (B), except lysates were generated for immunoblotting. (D) As in (B), except conditioned medium was collected at the indicated times for sclerostin ELISA. (E) As in (B), expect cells were treated with vehicle or hPTH(1 -34) (50 nM) for 4 hours followed by RT-qPCR for SOST and beta actin. *, p<0.01 hPTH(1-34) vs VEH. ** p < 0.001 shGNAS G2 vs. shLuciferase and shGNAS C2. *** p <0.001 shGNAS vs. shLacZ for all time points.

62 4.4.2 Three-dimensional culture enhances osteocytic phenotype

To evaluate the effects of a three-dimensional culture environment on the expression of osteocyte-specific genes and to provide a scaffold for cell attachment in the rotating wall bioreactor system used to simulate microgravity, Ocy454 cells were seeded onto scaffolds and cultured for an additional 7 to 14 days. Consistent with our two-dimensional culture results, we observed also a significant down regulation of SOST (Figure 4-5A), increases in RANKL (Figure 4-5B), and decreases in DMP1 (Figure 4-4D) in three-dimensional cultures (p < 0.001 for all) upon PTH treatment. Previous reports have demonstrated that TGFp1 increases SOST/sclerostin levels during mechanical loading [47,48]. In contrast to prior reports, treatment of Ocy454 cells with TGFP1 (10 ng/ml, 24 hours) resulted in a down regulation of SOST (Figure 4-4A), increases in RANKL (Figure 4-5B), and a known TGFP1 responsive gene Serpinel was increased 2.3 0.1 fold (p< 0.007). Interestingly, in contrast to two-dimensional cultures, culture in three dimensions with 4-hr PTH treatment resulted in a five-fold (p < 0.001) increase in FGF23 expression (Figure 4-5C). In a direct comparison between three-dimensional and two-dimensional culture at an early time point (3 days at 370C), Ocy454 had significantly higher amounts of SOST and RANKL in the three-dimensional culture conditions (Figure 4-5G) than in the two- dimensional setting. Furthermore, Ocy454 displayed dendritic morphology in three-dimensional culture conditions (Figure 4-5E) and we observed decreases in sclerostin protein expression with hPTH(1-34) treatment in three-dimensional culture (Figure 4-5F).

63 A A~B E SOST RANKL 1.5- 15- t VEH U I PTH _r 10- TGFP z E Of 0.5- 5- 0 z * 0.0- 0- C D F FGF23 DMPI

6- * 1.5- Sclerostin

zc 4- 1.0-

AN E 2- 0.5- Z~i VEH PTH 4HR 0- -r - 0.0-

G SOST RANKL DMP1 100- 15- 1.5- f2D s0- mScaffold C *t -I- N 10- t 60- .10 z 40- E 8(U 5- 0.5- I 20-

0- MI. 0- - 0.0- 3d 3d 3d

Figure 4-5: Ocy454 on 3D scaffold (collagen coated, A-D for hPTH(1-34) experiments). (A) 4-hour hPTH(1-34) (100 nM) and 24-hour TGFp 1 (10 ng/ml) treatment at 12-14 days decreases SOST, (B) increases RANKL, 4-hPTH(1-34) (C) increases FGF23, (D) decreases DMPI expression, (E) representative H&E stain of Ocy454 cell within the 3D scaffold. (F) 4- hour hPTH(1-34) (100 nM) treatment decreases sclerostin expression of Ocy454 on 3D scaffold. (G) Ocy454 gene expression for SOST, DMP1, and RANKL on three-dimensional scaffolds vs. two-dimensional culture at semi-permissive growth temperature for 3-days (37*C). * p<0.001 for hPTH(1-34) or * p< 0.007 TGFp 1 vs. VEH. Error bars represent one SD.

64 4.5 Conclusion

We have successfully generated a novel osteocytic cell line Ocy454 that recapitulates known in-vivo osteocytic functions without the requirement for long term high-density cultures and in the absence of differentiation media conditions. Thus, for the first time, we have established osteocytes cell lines that can be routinely cultured in short time periods with high-level expression of SOST/Sclerostin that is responsive to hormonal (PTH), cytokine stimuli, and matches the known response to SOST/Sclerostin of several in-vivo knockout animal models.

65 1 Woo, S. M., Rosser, J., Dusevich, V., Kalajzic, I. & Bonewald, L. F. Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differentiation in vitro and accelerates bone formation in vivo. J Bone Miner Res 26, 2634-2646, doi:10.1002/jbmr.465 (2011). 2 Bonewald, L. F. Establishment and characterization of an osteocyte-like cell line, MLO-Y4. J Bone Miner Metab 17, 61-65 (1999). 3 Fulzele, K. et al. Myelopoiesis is regulated by osteocytes through Gsalpha-dependent signaling. Blood 121, 930-939, doi:10.1182/blood- 2012-06-437160; 10.11 82/blood-2012-06-437160 (2013). 4 Wein, M. N. et al. HDAC5 controls MEF2C-driven sclerostin expression in osteocytes. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, doi:10.1002/jbmr.2381 [doi] (2014). 5 Kalajzic, I. et al. Dentin matrix protein 1 expression during osteoblastic differentiation, generation of an osteocyte GFP-transgene. Bone 35, 74- 82, doi:10.1016/j.bone.2004.03.006 S8756328204001097 [pii] (2004). 6 Yu, L. et al. Sclerostin expression is induced by BMPs in human Saos-2 osteosarcoma cells but not via direct effects on the sclerostin gene promoter or ECR5 element. Bone 49, 1131-1140, doi:10.1016/j.bone.2011.08.016; 10.1016/j.bone.2011.08.016 (2011). 7 Igwe, J. C., Gao, Q., Kizivat, T., Kao, W. W. & Kalajzic, I. Keratocan is expressed by osteoblasts and can modulate osteogenic differentiation. Connective tissue research 52, 401-407, doi:10.3109/03008207.2010.546536; 10.3109/03008207.2010.546536 (2011). 8 Paic, F. et al. Identification of differentially expressed genes between osteoblasts and osteocytes. Bone 45, 682-692, doi:b875b- 3282(09)01634-2 [pii] 10.1016/j.bone.2009.06.010 (2009). 9 Wu, J. Y. et a/. Gsalpha enhances commitment of mesenchymal progenitors to the osteoblast lineage but restrains osteoblast differentiation in mice. The Journal of clinical investigation 121, 3492- 3504, doi:10.1 172/JC146406; 10.1172/JC146406 (2011).

66 Chapter 5

5 Osteocytes as bone's gravity sensor: cell autonomous increases in sclerostin in mechanical unloading

This thesis chapter, in part, previously published as the manuscript: Spatz, et al., The Wnt-inhibitor Sclerostin is Up-regulated by Mechanical Unloading in Osteocytes in-vitro, JBC, 2015.

67 5.1 Rationale

In bed rest and immobilization, an increase in circulating sclerostin (Chapter 9) is associated with a decrease in parathyroid hormone (PTH)' 2 . The increase in SOST/sclerostin could be ascribed to direct osteocyte responses to changes in mechanical cues or due to endocrine regulators, such as PTH. To investigate whether SOST/sclerostin up-regulation in mechanical unloading is an endogenous, osteocyte intrinsic response (e.g. Wolff's Law) or a hormonal response to decreased PTH levels, to maintain nominal blood calcium levels, we have subjected osteocytes to the simulated microgravity environment of the NASA/Synthecon Rotating Wall Vessel (RWV) bioreactor system.

5.2 Introduction

The precise mechanisms whereby osteocytes respond to and convert mechanical stimuli to biochemical signals remain elusive because of a lack of appropriate in vitro models (Chapter 4). At the molecular level, osteocytes are thought to regulate the bone's response to mechanical loading by at least two key molecules, sclerostin and receptor activator of nuclear factor kappa-B ligand

3 4 (Rank) , . Mature osteocytes are one of the few cells that postnatally produce sclerostin, encoded by the SOST gene. Sclerostin inhibits bone formation, both in vitro and in vivo, by directly reducing proliferation and differentiation of osteoblasts via the canonical Wnt signaling pathway. Sclerostin is thought to act by binding the low-density lipoprotein receptor 5 and 6 (LRP5 and 6) to inhibit Wnt-pcatenin-signaling5-7. Moreover, sclerostin appears central to the bone's response to mechanical loading. SOST/sclerostin expression increases with mechanical unloading 2,8 9 and decreases with loading 0 . Furthermore, serum sclerostin is significantly increased during prolonged, 90 day, bed rest in healthy volunteers (Chapter 9), in obese patients undergoing weight loss", and acutely in postmenopausal stroke patients. In addition to the effects of sclerostin, it was recently shown that soluble Rankl also secreted by osteocytes3' 4 contributes to the control of bone remodeling. However, Rankl has also been found to be

68 expressed in a variety of other cell types including osteoblasts, bone lining cells, keratinocytes, T and B lymphocytes, mammary epithelial cells, and undefined cell types within the brain13 . Thus, it is currently unknown whether osteocytes can increase Rankl in a cell autonomous manner, potentially serving as an initiator of the cascade of bone resorption seen in mechanical unloading and microgravity.

Regardless of the initiation mechanisms, the hallmark of immobilization and microgravity in humans is an increase in bone resorption1 14 , resulting in subsequent transient hypercalcemia with persistently increased urinary and fecal calcium loss'. The endocrine counter regulatory mechanisms to maintain normal serum calcium are a reduction in serum parathyroid hormone (PTH) and consequently lower 1,25 -dihydroxyvitamin D concentrations'. However, PTH is also a known potent regulator of SOST/sclerostin in osteocytes, both in humans and in animal models15 17 , raising the possibility that the increase in SOST/Sclerostin during unloading or bed rest might be a consequence of decreased serum PTH rather than direct mechanical sensing by osteocytes. Indeed, there is an inverse correlation between PTH and sclerostin in male hypoparathyroid subjects and PTH infusion in healthy men induces a decline in circulating sclerostin17 . Both in vivo and in vitro, PTH decreases sclerostin expression via activation of the PTH receptor expressed on osteocytes1 5 and mice lacking the PTH receptor specifically in osteocytes have elevated expression of sclerostin 9 . Thus, in-vivo studies cannot determine whether

20 suppression of PTH, or other changes in cytokines, such as PGE 2 , are driving the increases in serum sclerostin following unloading. More broadly, there is no evidence to assess whether the increase in SOST/sclerostin is a direct osteocyte response to mechanical unloading as postulated by the mechanostat theory postulated by Harold Frost21 .

The primary hypothesis and objective of this study was to determine whether mechanical unloading is sensed in an osteocyte endogenous manner and investigate the cellular mechanism(s) osteocytes employ to regulate

69 SOST/sclerostin. We hypothesized that simulated unloading (microgravity), as achieved in the NASA rotating wall bioreactors would increase SOST/sclerostin in a cell autonomous fashion and that this increase would be suppressible by negative regulators (PTH, PGE 2) of SOST/sclerostin. As reported herein, osteocytic cells are indeed capable of responding to reduced mechanical forces with a time-dependent increases in SOST/sclerostin expression. In addition, the gene expression profile in simulated microgravity (e.g. SOST, Osteocalcin, Phex, MEPE) is distinct from that seen with mechanical loading, as achieved by fluid shear stress. Moreover, the increase in SOST/sclerostin expression is suppressed by PTH and PGE 2, suggesting upstream mechanistic overlap between mechanical sensing and G-protein-coupled receptor signaling and the potential to use targeted therapies in these signaling pathways as treatments for disuse induced bone loss.

5.3 Materials and methods

5.3.1 Simulated microgravity

Ocy454 cells were plated on three-dimensional scaffolds as described (Chapter 4) and allowed to grow at the permissive temperature (33 'C) for three days. Subsequently, scaffolds were moved to the semi-permissive temperature (37 OC) for an additional culturing time before being loaded into the NASA/Synthecon RWV bioreactors. Scaffolds were cut into 3 mm discs using disposable biopsy punches (Integra Miltex, Plainsboro, NJ) and placed into non-rotating (static) or rotating (simulated microgravity) 110 ml slow-turning-lateral-vessels (STLV; Synthecon, Houston, TX) for three days. For the rotating vessels, rotation speed was set to 18.6 rpm for the first 24 hours and increased to 20.9 rpm to maintain solid body rotation kinetics throughout the experiment22.

70 5.3.2 Two dimensional laminar fluid shear stress

Ocy454 cells were plated on glass microscope culture slides (Flexcell International Corp., NC) at 2 x 10 5 cells/ml and allowed to grow at the permissive temperature (33 OC) for three days. Subsequently, slides were moved to the semi-permissive temperature (37 OC) for an additional culturing time (11-14 days). Media was changed to static slide or slides were loaded into the laminar fluid flow shear stress device (Flexcell Streamer, Flexcell International Corp, NC) connected to an electronically controlled peristaltic pump with pulse dampers integrated into the flow circuit to allow for continuous unidirectional shear stress. Cells were exposed to 0.5 or 2 dynes/cm 2 for a period of either 2 hours or 3- days23 -25 .

5.3.3 Three dimensional laminar fluid shear stress

Alvetex scaffolds were seeded with 1.6 million cells and allowed to grow at the permissive temperature (33 'C) for 2 days prior to transferring to (37 OC) for differentiation. Cells were differentiated for 14 days prior to transferring to the Reinnervate Perfusion Plate. The perfusion plates were attached to a Masterflex Peristaltic Pump (#7520-57) with a Masterflex Standard Pump Head (#7014-20) and exposed to either 0.5 or 2 dynes/cm 2 for a period of either 1-day or 3-days.

5.3.4 Statistical Analysis

All values are reported as the mean SD, unless otherwise noted. Group mean differences were evaluated with Student t-test and considered significant at p <0.05.

71 5.4 Results

5.4.1 Fluid shear stress regulation of Ocy454 in two-dimensional culture

Ocy454 were subjected to continuous unidirectional fluid shear stress in two- dimensional culture conditions. Consistent with previous reports using UMR

106.01 osteoblast-like cells 23, short-term (2 hour) fluid shear stress, significantly suppressed SOST mRNA levels at low and high shear stresses (Figure 5-1). Whereas Rankl was reduced at low shear stress (0.5 - 2 dyne/cm 2), and Rankl and DMP1 were increased at higher shear stress (8 dyne/cm 2 ), as shown in Figure 5-1. These results demonstrate that Ocy454 cells are exquisitely responsive to mechanical forces with an intact SOST, DMP1 and RANKL regulation to overloading stimuli. Our results also suggest differential regulation of SOST and DMP1 to fluid shear stress, but not to simulated microgravity; whereas the response to hPTH(1-34) is same (Figure 5-2).

A B C SOST DMPI RANKL 2. 1 2.0 mStatic 8 0.5 dynes/cm 2 -W C= Static < 146 2 dynes/cm 2 I . 4.Static 8 dynes/cm 2 ' . ,; 2 0.

H R.2 R 0.02H

Figure 5-1: Short-term (2 hour) fluid shear stress in two-dimensional-culture reduces (A) SOST, (B) increased DMP1 at high shear stress (8 dyne/ cm2), (C) reduces RANKL at low- shear stress (0.5 - 2 dyne/cm2) and increases RANKL at high shear stress (8 dyne/cm2). * p<0.001, ** p< 0.05 static vs. fluid shear stress. Error bars represent one SD.

5.4.2 Simulated microgravity increases SOST/sclerostin and Rankl

We utilized the NASA-developed rotating wall bioreactor system to mimic microgravity to assess whether osteocytes can directly sense mechanical

72 unloading and regulate the expression of sclerostin and Rankl, known be involved in the bone's response to unloading. Indeed, under simulated microgravity conditions (3 days), there was a statistically significant increase of 3.5 1.9 fold (p < 0.001) in SOST expression compared to static controls (Figure 5-2A). Secreted sclerostin, as assessed by ELISA, was also increased as early as 1 day by 1.4 0.1, by 2.7 0.4 at 2-days, and by 4.7 0.1 at 3-days (p< 0.001 for all) (Figure 5-2B). There were no significant changes in other osteoblastic genes (osteocalcin, alkaline phosphatase, osterix mRNA) between the loaded and unloaded bioreactors demonstrating that the increase in SOST/sclerostin expression was not a consequence of an altered cell state as we observed in our prolonged two-dimensional fluid shear stress experiments. In an effort to identify upstream regulator of SOST/Sclerostin expression, we assessed changes in reported and potential regulators of SOST in the Mef2 pathway (Mef2A-D), PGE 2 pathway (mPTGES-1, 15-HGPD, EP2 , EP 4 ), SIRT1, Osterix, PTHrP, PTH receptor, and periostin. We observed no changes in mRNA levels for any of these known regulators of SOST (Table 5-1) following simulated microgravity.

73 A B SOST Sclerostin 6- 150 m Static m Static C Simulated uG 100 # '" Simulated uG 0 z.1 I 412 Lu2- S 20f* z NDND i ..~. VEH PTH PGE2 nImI i

C DMP1 RANKL OPG RANKL/OPG 4- 1.5- 4- 4- m Static * ** "" Simulated uG CU 3- 3- 3- 1.0- , Vp z 2- 2- 2X a9 E 0.5- *111- 1-

0- 0ma 0.0-1 0- Phex MEPE gp38 Osteocalcin 2.0- 2.5- 1.5, 1.5- ** 2.0- ,I o 1.5- 1. 1.0- <0 1.5- 1.0- 1.0- 0.5- 0.5- - 0.5- 0.5- 0z 0.0- 0.0- UT 0. 0.0- Figure 5-2: 3-day simulated microgravity (white bars) increases (A) SOST compared to static controls (black bars). 4-hour hPTH(1-34) (50 nM) and 16-hour PGE 2 (5 nM) decrease SOST in both simulated microgravity and static controls. (B) Sclerostin increases as early as 1-day exposure to simulated microgravity and remains elevated through 3-days, overnight (16- hour) hPTH(1-34) (50 nM) treatment on days 2-3 suppresses secreted sclerostin as measured by ELISA (APLCO). 3-day simulated microgravity increases (C) DMP1, Rankl, Rankl/OPG ratio, gp38, and MEPE, decreases OPG, has no effect on Phex or Osteocalcin # p<0.001, ** p<0.05 for simulated microgravity vs. static controls, * p< 0.001 for all hormone/cytokine treatments vs. VEH. ND: Not detected. Error bars represent one SD.

74 Consistent with previous reports of osteoblasts increasing Rankl expression in simulated microgravity conditions [49], we observed increased Rankl mRNA (Figure 5-2C) and a concurrent modest reduction in OPG mRNA (Figure 5-2C) resulting in a statistically significant increase in the Rankl/Opg ratio in unloaded vs. static conditions (Figure 5-2C). We also detected a modest increase mRNA encoding DMP1, MEPE, and gp38 with no change in Phex or osteocalcin mRNA under simulated microgravity conditions (Figure 5-2C). Thus, we report these regulatory changes to osteocytic genes as a signature of osteocytes exposed to simulated microgravity.

Table 5-1: Evaluated Regulators of SOST/Sclerostin in Simulated Microgravity

ECR5 Enhancers Mef2A, C, D, Mef2B (not expressed) SOST Promoter Transcription Factors TFGB1 Osterix Runx2 SIRT1 Pax6 Periostin MyoD: Not expressed in Ocy454 Gsa PGE2 Pathway EP2, EP4 Cox-2 mPTGES-1 15-HGPD Cell Membrane Receptors PTH1R, PTHrP: Not expressed in Ocy454 P2XR1 -7

5.4.3 GPCR responsiveness: SOST/Sclerostin in simulated microgravity

To determine whether activation of PTH receptors (or other G-protein coupled receptors) could still suppress SOST/Sclerostin in microgravity, we tested the effects of PTH and PGE 2 treatment in simulated microgravity. PTH (Figure 5-2A) suppressed SOST and sclerostin levels of expression (Figure 5-2B) to the same

75 extent in static and unloaded conditions (p < 0.001). Similarly, PGE 2 caused the same magnitude of suppression of SOST expression in both static and simulated microgravity. These results demonstrate that, while the increase in SOST expression is not dependent on reductions in GPCR expression (PTHR, EP2/4) or Gsc. activity (Table 5-1), modulating GPCR signaling can still regulate SOST/Sclerostin expression in the setting of microgravity or unloading, such as disuse-induced bone loss.

5.4.4 Long Term fluid shear stress regulation of Ocy454

One limitation of the NASA rotating wall bioreactor system is the possible generation of minimal fluid shear stress demonstrated to be on the order of 0.5-2

dynes/cm 2 22,26 . To investigate whether the changes in gene expression observed in the NASA bioreactor were indeed due to simulated microgravity and not minimal shear stress, we subjected Ocy454 cells to long-term exposure (24 hour or 72 hour) to low laminar fluid shear stresses (0.5 - 2 dyne/cm 2) in three- dimensional (Alvetex) culture conditions. At 2-dyne/cm 2 we observed a significant reduction in SOST mRNA and no change in DMP1 mRNA at 24-hr (Figure 5-3). AL U.5 Uyne/ucr2 we observed significant suppression of S ST mRNA, a significant increase in DMP1 mRNA, decreases in Opg, MEPE, gp38 (24 hour), and osteocalcin mRNAs with no effect on Rankl or Phex mRNAs (Figure 5-3). Similar results for 2-dyne/cM2 were observed at 72-hr (Figure 5-3), with the exception of a lack of regulation of DMP1 mRNA. These data clearly indicated that the up-regulation of SOST/sclerostin present in the NASA rotating wall bioreactor system was indeed due to simulated microgravity and not minimal shear stress.

76 OPG SOST DMPI RANKL 2.0- 3 15- 15- Statc 2 0.5 dynes/cm 2 0 C,- 1.5- 2 dynes/cm 2- 10- 10.* 1z 1.0 E0 E ;5. 5- * 5- 5 0.5 * o z

0 * -*- 0-A4 0 0.0 ld 3d Id 3d Id 3d Id 3d

Phex MEPE gp38 Osteocalcin 3- 4- 5- 3-

4- 3- 2 * 2- C. 3- 22- E 2-

0- * 0 0- 0 ld 3d Id 3d Id 3d Id 3d

Figure 5-3: Fluid shear stress of Ocy454 in three-dimensional culture at 1-day and 3-day 2 fluid at low shear stress of 0.5 dyne/cm2 and 2 dyne/cm (A) reduces SOST, (B) increases DMP1, (C) decreases OPG, (D) Phex, (E) MEPE, (F) increases gp38, (G) and decreases osteocalcin at the shear stresses and time points. * p<0.001, ** p<0.05 static vs. fluid shear stress. Error bars represent one SD.

In addition, as shown in Figure 5-4, we subjected Ocy454 to 2D long-term low fluid flow. These low flow conditions induced changes in the differentiation state of Ocy454, as illustrated by significantly elevated levels of expression of SOST, DMP1, Rankl, Opg (24 hours), Phex, MEPE, and gp38 with a reduction of osteocalcin expression (Figure 5-4).

77 Overall, these two-dimensional and three-dimensional long-term mechanical over-loading results demonstrated that our simulated microgravity experiments reflect a unique osteocyte cellular response to mechanical under-loading stimuli.

SOST DMPI OPG 30- 150- 4- Static 0.5 dynes/cm 2 3d .2 20- 100. Static 2 .2U 2 dynes/cm 2- E .r0 z10 E'U 10 50- azE 0* 0- 0 3d 3d 3d

Phex MEPE RANKL

25- 15-

.2 20-

Ce 4 15- 3- 0 2: .- 10- 2- p- I I E tS 5- z 0- 04U 3d I 3d 3d Osteocalcin gp38

3 4

= 22 <0

E .$ .z E 1.

0 1L 3d 3d

Figure 5-4: Long-term (3-day) fluid shear stress in two-dimensional-culture increases SOST, DMP1, RANKL, OPG (24 hour), Phex, MEPE, gp38, and decreases osteocalcin at the indicated shear stresses and time points. * p<0.001, ** p<0.05 static vs. fluid shear stress. Error bars represent one SD. 78 5.5 Discussion

The primary objective of this study was to determine whether increases in SOST/sclerostin and Ranki seen in the context of disuse induced bone loss are an intrinsic osteocytic response to mechanical unloading. While it has been established that osteocytes are key players in the bone's response to mechanical stimuli 10,2 3,24 ,2 7,2 8, it is still unclear whether their response to unloading is a direct response to reduction in load, as theorized by Wolf's Law, or a consequence of changes in systemic endocrine or paracrine factors. Furthermore, the biochemical response of the osteocytic network to overloading 10 ,23 ,24 does not in it of itself provide evidence for a direct response to unloading stimuli. Here we present new data showing that osteocytes elicit an intrinsic response to mechanical loading which is independent of the known external hormonal influence of PTH and other factors.

Prior studies in rodents have reported increases in SOST/sclerostin in bone tissue9'10 and in circulating sclerostin9 during unloading. In addition, increased circulating serum sclerostin levels with a concurrent reduction of PTH levels have been reported in the context of disuse-induced bone loss in rodents 29 [55] and humans (Chapter 9). However, as PTH is a strong negative regulator of SOST/sclerostin, these in-vivo studies cannot address the question of whether osteocytes can directly sense mechanical unloading or respond to hormonal changes.

Importantly, our results suggest that the increase in bone resorption in mechanical unloading and microgravity with associated transient hypercalcemia and reduced parathyroid hormone levels is not the driving force for increases in SOST/sclerostin and Rankl expression. Thus, for the first time, we have observed isolated osteocytes sensing mechanical unloading and responding with increases in SOST/sclerostin and the Rankl/Opg ratio.

79 The transcriptional regulators of SOST/Sclerostin in mechanical unloading are currently unknown. However, Mef2 transcription factors have been shown in several contexts to bind a distal enhancer (ECR5) in the SOST locus resulting in the increased expression of SOST/sclerostin 30,31. However, we observed no transcriptional changes in the potential regulators of SOST in the Mef2 pathway

(Mef 2A, C, D) (Table 5-1). Furthermore, since PGE 2 is a known negative regulator of SOST/Sclerostin in a Mef2 independent mechanism 32 and reductions in PGE 2 production genes (Cox-2) have been observed in osteoblasts exposed 33 to microgravity , we assessed changes in the PGE 2 production or degradation pathways (mPTGES-1, 15-HGPD) and receptor expression (EP2, EP4), as shown Table 5-1. Notably, no changes in mRNA of transcripts responsible for

PGE2 production, PGE 2 degradation, or PGE 2 receptors were observed between static and unloaded cultures implying that the increases of SOST/sclerostin in mechanical unloading are presumably not arising from changes in the PGE 2 pathway. Several transcription factors have also been reported to suppress the SOST promoter (like SIRT1, Osterix) 34'35 or act at the distal enhancer (ECR5)

30 (like TGFp 1 .3) . However, in the context of mechanical unloading we observed no change in the SIRT1 Osterix, nr T(FR1 3 mRNA (Table 5-1). It has also been proposed the periostin (Postn) matricellular protein suppresses SOST in a Mef2C-dependent mechanism that is regulated by PTH 36 . However, in Ocy454 we observed no correlation between sclerostin, PTH, and Postn mRNA or protein expression in two-dimensional cultures or in the context of mechanical unloading (data not shown). Thus, future studies, investigating the novel transcriptional or post-transcriptional regulation of SOST/sclerostin in the context of mechanical unloading and microgravity are warranted.

G-protein coupled hormonal (PTH) and cytokine regulators (PGE 2) were capable of suppressing the increases of SOST/Sclerostin seen in mechanical unloading. Thus, while our results show osteocytes can directly sense mechanical unloading, they also suggest the overall level of sclerostin in-vivo appears as an integral response of the osteocyte network to mechanical loading, hormonal, and

80 cytokine cues. Of particular note, we have shown mice lacking PTHR in osteocytes lose bone in the hind limb unloading model consistent with our in-vitro findings that GPCR signaling may play a minimal role in disuse induced bone loss. One study has recently reported that SOST regulation in mechanical unloading in rodents could be site-specific with modest (-1.5%) down regulation in cancellous metaphyseal and cortical bone while up regulation was seen in diaphyseal cortical 37 regions. Our results are consistent with these findings as our cell lines were isolated from the diaphysis of long bones. However, as the majority of osteocytes in the load-bearing skeleton are located in the diaphysis of long bones and circulating levels of sclerostin are elevated in the setting of disuse-induced bone loss, the clinical significance of the heterogeneity nature of the osteocytic network remains to be further explored. Furthermore, while the NASA rotating wall bioreactor provides a solid-body rotation with a minimal fluid shear stress in the range of 0.5 - 2 dynes/cm 2 22,26, no currently existing in-vitro ground-based model of microgravity can fully eliminate the low level of shear stress inherent in our model.

However, short mechanical loading10 38 and fluid shear stress2 3 are known to cause decreased, not increased, levels of SOST/sclerostin and Rankl as we have observed (Figure 5-2). To further investigate this confounding variable of minimal fluid shear stress in the NASA bioreactor, we subjected Ocy454 cells in two-dimensional and three-dimensional culture conditions to low unidirectional fluid shear stress. Importantly, neither two-dimensional nor three-dimensional fluid shear stress matched the pattern of osteocytic gene expression seen in simulated microgravity. In addition, cells on the surfaces of the scaffolds are likely exposed to shear stresses higher in range than cells within the scaffold. However, the same seeding technique was used in all scaffold experiments so non uniformity in cell distribution could in it of itself not account for the significant down-regulation of SOST in three-dimensional fluid flow (Figure 5-3) compared to the increased in SOST (Figure 5-2) we observed in the simulated microgravity experiments. Finally, additional variables such as nutrient availability could also

81 be playing confounding factors to our observed results. However, the simulated microgravity experiments utilized a 110-ml bioreactor. Daily changes of 10% volume of media were also performed to facilitate elimination of bubbles. Thus, these culture conditions for both static and microgravity conditions are nutrient rich. Our interpretation notwithstanding, we acknowledge such confounding variables specific to osteocytic cell cultures in simulated microgravity will need to be addressed in future experiments under conditions of true-microgravity (Chapter 6).

5.6 Conclusion

In conclusion, isolated osteocytes can directly sense a mechanical unloading stimulus resulting in the increases in expression of both inhibitors of bone formation, SOST/sclerostin, and stimulators of bone resorption, notably Rankl and the Rankl/Opg ratio. Future therapies, aimed at modulating the osteocyte's gravity-sensing pathways could lead to improved therapies for a range of bone disorders.

82 1 Smith, S. M. et al. Space flight calcium: implications for astronaut health, spacecraft operations, and Earth. Nutrients 4, 2047-2068, doi:10.3390/nu4122047; 10.3390/nu4122047 (2012). 2 Spatz, J. M. et al. Serum sclerostin increases in healthy adult men during bed rest. The Journal of clinical endocrinology and metabolism 97, E1736- 1740, doi:10.1210/jc.2012-1579; 10.1210/jc.2012-1579 (2012). 3 Nakashima, T. et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature medicine 17, 1231-1234, doi:10.1038/nm.2452; 10.1038/nm.2452 (2011). 4 Xiong, J. et al. Matrix-embedded cells control osteoclast formation. Nature medicine 17, 1235-1241, doi: 10.1 038/nm.2448; 10.1 038/nm.2448 (2011). 5 Collette, N. M., Genetos, D. C., Murugesh, D., Harland, R. M. & Loots, G. G. Genetic evidence that SOST inhibits WNT signaling in the limb. Dev Biol 342, 169-179, doi:S0012-1606(10)00187-9 [pii] 10.1016/j.ydbio.2010.03.021 (2010). 6 Semenov, M., Tamai, K. & He, X. SOST is a ligand for LRP5/LRP6 and a Wnt signaling inhibitor. J Biol Chem 280, 26770-26775, doi:M504308200 [pii] 10.1074/jbc.M504308200 (2005). 7 Semenov, M. V. & He, X. LRP5 mutations linked to high bone mass diseases cause reduced LRP5 binding and inhibition by SOST. J Biol Chem 281, 38276-38284, doi:M609509200 [pii] 10.1074/jbc.M609509200 (2006). 8 Lin, C. et al. Sclerostin Mediates Bone Response to Mechanical Unloading via Antagonizing Wnt/beta-Catenin Signaling. J Bone Miner Res 24, 1651- 1661 (2009). 9 Spatz, J. M. et al. Sclerostin antibody inhibits skeletal deterioration due to reduced mechanical loading. J Bone Miner Res 28, 865-874, doi:10.1002/jbmr.1807 (2013). 10 Robling, A. G., Bellido, T. & Turner, C. H. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J Musculoskelet Neuronal Interact 6, 354 (2006). 11 Armamento-Villareal, R. et al. Weight loss in obese older adults increases serum sclerostin and impairs hip geometry but both are prevented by exercise training. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 27, 1215- 1221, doi:10.1002/jbmr.1560; 10.1002/jbmr.1560 (2012). 12 Gaudio, A. et al. Increased sclerostin serum levels associated with bone formation and resorption markers in patients with immobilization-induced bone loss. J Clin Endocrinol Metab 95, 2248-2253, doi:jc.2010-0067 [pii] 10.1210/jc.2010-0067 (2010). 13 Bishop, K. A., Coy, H. M., Nerenz, R. D., Meyer, M. B. & Pike, J. W. Mouse Rankl expression is regulated in T cells by c-Fos through a cluster of distal regulatory enhancers designated the T cell control region. The Journal of biological chemistry 286, 20880-20891, doi:10.1074/jbc.M111.231548; 10.1074/jbc.M111.231548 (2011).

83 14 Massagli, T. L. & Cardenas, D. D. Immobilization hypercalcemia treatment with pamidronate disodium after spinal cord injury. Archives of Physical Medicine and Rehabilitation 80, 998-1000 (1999). 15 Bellido, T. Downregulation of SOST/sclerostin by PTH: a novel mechanism of hormonal control of bone formation mediated by osteocytes. J Musculoskelet Neuronal Interact 6, 358-359 (2006). 16 Bellido, T. et al. Chronic elevation of parathyroid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis. Endocrinology 146, 4577-4583, doi:en.2005-0239 [pii] 10.1210/en.2005-0239 (2005). 17 Yu, E. W., Kumbhani, R., Siwila-Sackman, E. & Leder, B. Z. Acute Decline in Serum Sclerostin in Response to PTH Infusion in Healthy Men. J Clin Endocrinol Metab, doi:jc.2011-1534 [pii] 10.121 0/jc.2011-1534 (2011). 18 Costa, A. G. et a/. Circulating sclerostin in disorders of parathyroid gland function. The Journal of clinical endocrinology and metabolism 96, 3804- 3810, doi:10.1210/jc.2011-0566 (2011). 19 Powell, W. F., Jr. et al. Targeted ablation of the PTH/PTHrP receptor in osteocytes impairs bone structure and homeostatic calcemic responses. J Endocrinol 209, 21-32, doi:JOE-10-0308 [pii] 10.1530/JOE-10-0308 (2011). 20 Galea, G. L. et al. Sost down-regulation by mechanical strain in human osteoblastic cells involves PGE2 signaling via EP4. FEBS Lett 585, 2450- 2454, doi:S0014-5793(11)00483-2 [pii] 10.1016/j.febslet.2011.06.019 (2011). 21 Hughes, J. M. & Petit, M. A. Biological underpinnings of Frost's mechanostat thresholds: the important role of osteocytes. J Musculoskelet Neuronal Ifnteract 1 ),Z 128-135 (201). 22 Hammond, T. G. & Hammond, J. M. Optimized suspension culture: the rotating-wall vessel. American journal of physiology.Renal physiology 281, F12-25 (2001). 23 Papanicolaou, S. E., Phipps, R. J., Fyhrie, D. P. & Genetos, D. C. Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology 46, 389-399, doi:10.3233/BIR-2009-0550; 10.3233/BIR-2009-0550 (2009). 24 Li, J., Rose, E., Frances, D., Sun, Y. & You, L. Effect of oscillating fluid flow stimulation on osteocyte mRNA expression. Journal of Biomechanics 45, 247-251, doi:10.1016/j.jbiomech.2011.10.037; 10.1016/j.jbiomech.2011.10.037 (2012). 25 Santos, A., Bakker, A. D., Zandieh-Doulabi, B., Semeins, C. M. & Klein- Nulend, J. Pulsating fluid flow modulates gene expression of proteins involved in Wnt signaling pathways in osteocytes. J Orthop Res 27, 1280- 1287, doi: 10.1 002/jor.20888 (2009). 26 Song, K. et al. Numerical simulation of fluid field and in vitro three- dimensional fabrication of tissue-engineered bones in a rotating bioreactor and in vivo implantation for repairing segmental bone defects. Cell stress

84 & chaperones 18, 193-201, doi:1 0.1 007/s12192-012-0370-2; 10.1007/s12192-012-0370-2 (2013). 27 Cheng, B. et al. PGE(2) is essential for gap junction-mediated intercellular communication between osteocyte-like MLO-Y4 cells in response to mechanical strain. Endocrinology 142, 3464-3473 (2001). 28 Zhang, K. et al. El 1/gp38 selective expression in osteocytes: regulation by mechanical strain and role in dendrite elongation. Mol Cell Biol 26, 4539-4552, doi:26/12/4539 [pii] 10.11 28/MCB.02120-05 (2006). 29 Ito, T. et al. Changes in serum concentrations of calcium and its regulating hormones during tail suspension in rats. Environmental medicine : annual report of the Research Institute of Environmental Medicine, Nagoya University 40, 43-46 (1996). 30 Loots, G. G. et al. TGF-beta regulates sclerostin expression via the ECR5 enhancer. Bone 50, 663-669, doi:10.1016/j.bone.2011.11.016; 10.1016/j.bone.2011.11.016 (2012). 31 Yu, L. et al. Sclerostin expression is induced by BMPs in human Saos-2 osteosarcoma cells but not via direct effects on the sclerostin gene promoter or ECR5 element. Bone 49, 1131-1140, doi:10.1016/j.bone.2011.08.016; 10.1016/j.bone.2011.08.016 (2011). 32 Genetos, D. C., Yellowley, C. E. & Loots, G. G. Prostaglandin E2 signals through PTGER2 to regulate sclerostin expression. PloS one 6, e17772, doi:10.1371/journal.pone.001 7772; 10.1371/journal.pone.0017772 (2011). 33 Hughes-Fulford, M. Changes in gene expression and signal transduction in microgravity. Journal of gravitational physiology : a journal of the International Society for Gravitational Physiology 8, P1-4 (2001 ). 34 Cohen-Kfir, E. et al. Sirt1 is a regulator of bone mass and a repressor of Sost encoding for sclerostin, a bone formation inhibitor. Endocrinology 152, 4514-4524, doi:10.1210/en.2011-1128; 10.1210/en.2011-1128 (2011). 35 Yang, F., Tang, W., So, S., de Crombrugghe, B. & Zhang, C. Sclerostin is a direct target of osteoblast-specific transcription factor osterix. Biochemical and biophysical research communications 400, 684-688, doi:10.1016/j.bbrc.2010.08.128; 10.1016/j.bbrc.2010.08.128 (2010). 36 Bonnet, N. et al. The matricellular protein periostin is required for sost inhibition and the anabolic response to mechanical loading and physical activity. J Biol Chem 284, 35939-35950, doi:M109.060335 [pii] 10.1 074/jbc.M1 09.060335 (2009). 37 Macias, B. R., Aspenberg, P. & Agholme, F. Paradoxical Sost gene expression response to mechanical unloading in metaphyseal bone. Bone 53, 515-519, doi:10.1016/j.bone.2013.01.018; 10.1016/j.bone.2013.01.018 (2013). 38 Tu, X. et al. Sost downregulation and local Wnt signaling are required for the osteogenic response to mechanical loading. Bone 50, 209-217, doi:10.1016/j.bone.2011.10.025 (2012).

85 86 Chapter 6

6 Preparation for an osteocyte cell line experiment to the International Space Station

This thesis chapter, in part, previously published as the manuscript: Pajevic, Spatz, et al., Osteocyte biology and space flight, Current Biotechnology 2013 2013; 2(3): 179-183.

87 6.1 Rationale

The NASA rotating wall bioreactor operates on the principle of subjecting cells to continuous rotating fluid environment that randomizes the gravity vector over one revolution 2 . However as an analog model of microgravity, it has a significant limitation of also exposing cells to fluid shear stress'. To determine the molecular mechanisms, in-vitro, of osteocytes exposed to true microgravity, we integrated Ocy454 into flight proven cell culture hardware (Osteo-4) onboard the International Space Station. This chapter describes the validation of osteocytes (Ocy454) into the Osteo-4 payload in preparation for an ISS mission.

6.2 Key Findings

The osteocytic cell line (Ocy454) grown in spaceflight bioreactors (Osteo-4) maintained cell functions, such as responsiveness of SOST and Rankl (Figure 6- 6) to the treatment of human parathyroid hPTH(1-34) (100 nM) hormone. This demonstrated osteocytes can be grown in the conditions necessary for an ISS experiment. Simulated launch random vibrations had minimal statistically significant effects on known mechanically responsive genes, SOST and DMP1 (Figure 6-7), highlighting the importance of accounting for the confounding effects of the launch in the overall experimental design. Experiments were also conducted to demonstrate that post experiment, bioreactor cooling at 8 'C for up to 24 hours had no significant effect on RNA recovery and gene expression (Figure 6-8). These RNA recovery experiments highlighted the importance of ensuring astronaut resources were allocated to collect science within 24 hours of bioreactor fixation.

During the ISS Osteo-4 mission, launched April 14 th 2015, media samples were collected at 6 hours and 24 hours post-launch to examine the effects of launch vibrations. In addition, these samples serve to provide early time points in microgravity to examine secreted proteins and cytokines of osteocytes. Two bioreactors were fixed in RNA preservation buffer (RNAProtect cell reagent,

88 Qiagen) and one was fixed for histology and protein recovery (1% paraformaldehyde) at 2-, 4-, and 6- days post launch to study both early and late responses of osteocytes to microgravity.

6.3 Flight Hardware for Microgravity Bone Biology Studies

At present, few long-term cell culture payloads have flown successfully in space, and limited capability exists on the International Space Station (ISS) for mammalian cell culture experiments. One of the payloads developed and used successfully for several previous missions to study bone cell cultures in microgravity is the Osteo (Figure 6-1, ISS-configuration) payload. The Osteo system was originally developed for the Canadian Space Agency (CSA) as a cell culture rack operated by astronauts for Space Shuttle missions. It flew on several missions, including STS-95 and STS-107 (no data was collected from STS-107). During the Columbia investigation and "return to flight" timeframe, Osteo was upgraded by CALM Technologies, Kingston, Canada, to a fully automated payload, renamed eOSTEO (also referred to as Osteo-3). A Russian FOTON biosatellite in 2007 flew with two eOSTEO systems aboard; one for CSA experiments and one for European Space Agency (ESA) experiments. Investigations for Canadian scientists included effects of parathyroid hormone (PTH)-related peptide (PTHrP) on osteoblasts, the CD200 ligand pathway in osteoblasts and osteoclasts, and the cytoskeleton of bone cells in microgravity. European investigators looked at fibrogenesis of osteoblasts, osteoclast differentiation, and the effects of microgravity on the cross-influence of osteoclasts and osteoblasts 3 Upgrades to eOSTEO were begun in 2012, to further improve the scientific yield, and allow the hardware to be flown on ISS. This upgraded hardware was renamed Osteo-4, and the system included automated hardware specifically designed for bone cell cultures. Osteo-4 is currently the system of choice for culturing bone and bone-derived cells in microgravity with significant flight heritage.

89 Another fully automated payload recently used to investigate the effect of microgravity on bone marrow derived mesenchymal stem cells (BMSC), is a bioreactor from Kayser-Italia 3. The spaceflight bioreactor is comprised of five cylindrical plunger compartments in which cells are cultured on porous ceramic disks (Skelite) and maintained in a culture chamber 3. The latest NASA payload for cell culture is the Cell Bio Tech Demo (CBTD), a precursor to new hardware currently developed by the agency and scheduled for delivery to the ISS in middle of this decade.

Osteo payloads operate as a close system that, in contrast to a standard in vitro culture conditions, is not exposed to a controlled carbon dioxide (C02) concentration (i.e., 5% CO2 for routine culturing of Ocy454). This closed system does not allow for free exchange of oxygen and C02, requiring either the use of specialized culture medium or the addition of buffers to maintain the pH of the cell cultures within the physiological range. For Osteo-4, we chose to supplement our media with 25 mM HEPES and perform daily media changes to maintain pH and nutrient availability to the osteocytic cell line (Ocy454). Under these conditions, Ocy454 were successfully qrown in the Osteo-4 hardware for up to 14 days in pre-mission ground-based testing experiments.

6.4 Osteo-4 upgrades for ISS compatibility

The Osteo-4 hardware modifications were upgrades to the Osteo-3, to meet requirements of flying the hardware on the International Space Station. ISS interface requirements were met through the use of a modified standard ISS locker, which allows installation and operation of the payload in specialized payload racks, called "expedite the processing of Experiments for Space Station (EXPRESS) racks". In addition to the interface upgrades, science related activities were facilitated through the on-orbit removal of bioreactors at experimental time points to allow astronauts to store the fixed bioreactors in cold

(-95 0C) stowage. Design modifications to the existing Osteo-3 flight trays and bioreactors were avoided to minimize cost and risk by reusing hardware that had

90 previously and successfully completed cell culture experiments in microgravity. Historically, the Osteo systems have flown in a stacked configuration, comprised of four trays with a base unit containing communication avionics. In these prior Osteo configurations, the adjacent top tray provided the function of a lid and there was no provision for on-orbit removal of bioreactors. As the ISS Osteo-4 configuration allows for the removal of individual trays and bioreactors at scientifically relevant time points, the Osteo-3 stacking approach to the structural layout of the payload was no longer suitable for the Osteo-4 mission.

Thus, the Osteo-4 approach (Figure 6-1), consists of three removable trays (Figure 6-2, 6-3) that are integrated into an EXPRESS locker (Figure 6-3). The locker system provides a common power, data, communications, and thermal interface (avionics air for within tray cooling to 8-to-16 0C) for the trays, and a means of securing the trays for launch and storage. This approach required that each tray provide qualified levels of containment to meet NASA on-orbit safety standards. In order to achieve this, clear polycarbonate tray lids were added to each tray (Figure 6-3). In addition, quick disconnects on each bioreactor (Figure 6-5) and access panels were included in the lid design to allow on-orbit recovery of the bioreactors by the astronauts for subsequent cold stowage of the bioreactor after each of the desired experimental time points.

Figure 6-1:Osteo-4 ISS payload within EXPRESS rack locker (gray)

91 Waste Media Sample Chamber

Waste Bag Valve Actuators

Syringes

Bioreactor

Bioreactor Cooling Tray Electronics

Valve Actuators

Figure 6-2: 3D Solid Model of Single Osteo-4 Tray (Interior)

Figure 6-3: Tray Removal from Express Rack (top) Osteo-4 tray with lid (bottom, left), and Osteo-4 lid showing access ports for bioreactor removal (bottom, right)

92 6.4.1 Osteo-4 Fluid Pathway

The Osteo-4 fluid pathway (Figure 6-4) is used as the first level of containment and contains all the fluid reagents (syringes) and cell cultures (bioreactors) for the science.

6OmL Syringes Main Waste Bag

Sample I MEDIA Waste Bags

-n Cannula/Septum 14 MEDIA 0 Disconnect

MEDIA ) -11E

MEDIA I 0

One-way Disconnec Valves P--nt Cell Cuture Bioreactor Modules Automated Valves

Figure 6-4: Osteo-4 Fluid Pathway Configuration Diagram

93 Figure 6-5: Osteo-4 bioreactor with 2 ml sample bag (top), Ocy454 on Alvetex Scaffolds integrated into Osteo-4 assembly (bottom, left), Osteo-4 bioreactor integrated into fluid pathway (bottom, right)

In operation, the Osteo-4 tray performs fluid delivery in the closed fluid pathway by opening one of four valves (3 Bioreactor, 1 flush, Figure 6-4) allowing fluids from one of the four syringe- based fluid reservoirs to be delivered to the selected bioreactor or flush line. When a bioreactor fluid sample is desired, one of 3 sample waste valves is opened during a feed to collect a small 2 mL sample. As this is a flow-through system, waste fluid is collected in the main waste bag.

6.5 Material and Methods

6.5.1 Cell Culture

The Ocy454 cell line was cultured at permissive growth temperature (33 0C) maintained on rat type I collagen coated flasks grown in Minimum Essential Media Alpha Media aMEM supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY) and 1% Antibiotic-Antimycotic (Gibco, Grand Island, NY).

94 Upon confluence, Ocy454 were plated at 1.6 million cells on Alvetex (Reinnervate, UK) 6-well insert scaffolds and grown for 3 days at 33 'C, media changed, and grown for 3 days to 2 weeks at 37 0C prior to integrating five alvetex scaffolds (9 mm) into Osteo-4 bioreactors. Media for Osteo-4 experiments was additionally supplemented with 25 mM Hepes buffer to maintain physiological pH in the non-CO 2 closed environment bioreactors for up to 48 hours. To preserve RNA for later analysis, selected Osteo-4 bioreactors were fixed with an RNA stabilization buffer (RNAprotect Cell Reagent, Qiagen). To preserve bioreactors for histology and protein analysis, selected Osteo-4 bioreactors were fixed with 1% paraformaldehyde in phosphate buffered saline, pH 7.4.

6.5.1 Quantitative Real Time PCR

Two 9 mm scaffolds were pooled and total RNA was isolated (RNAEasy, Qiagen, Valencia, CA) per manufacture's recommendations followed by RNA quantification (NanoDrop, Thermo Scientific, Rockford, IL). cDNA synthesis was performed on 500 to 1000 ng total RNA, followed by SYBR qPCR (StepOnePlus, Life Technologies, Grand Island, NY).

6.6 Results

6.6.1 Osteo-4 spaceflight bioreactors

We performed experiments in Osteo-4 bioreactors (Figure 6-4, 6-5) to test the scaffold insert holder biocompatibility and the no-CO 2 environment of the Osteo-4 spaceflight-qualified bioreactors. To this end several commercially available no-

CO 2 media (Life Technologies) were tested. However, the phosphate buffers used in commercially available no-CO 2 media adversely effected basal gene expression of Ocy454 (data not shown). aMEM supplemented with 10% fetal bovine serum (FBS) and 25 mM Hepes was chosen because it preserved the osteocytic gene expression pattern and maintained the pH of the medium within physiological range for a minimum of 48 hours between media changes. In some experiments, at the end of the culture period bioreactors were fed with medium

95 containing vehicle or 1OOnM human PTH(1-34) and the experiment was terminated 4 hours later with the injection of fixatives to preserve samples for RNA isolation (RNAProtect cell reagent, Qiagen) or histology (1% paraformaldehyde) as performed during the ISS flight mission. As shown in Figure 6-6, Ocy454 cells maintained their PTH responsiveness and readily suppressed SOST by 60% and increased RANKL by 35% upon hormonal treatment. These results match the in-vivo and in-vitro response of osteocytes (see Chapter 3-5) and reflect the cells maintain their osteocytic phenotype in the Osteo-4 bioreactors.

Sclerostin mRNA RANKL 4 80 VEH * ePTH 3- 60

Ir '0 2 40 E .4 :E1.20 0z* 0 0 2wk 2wk

Figure 6-6: Ocy454 responsiveness to PTH. Ocy454 were seeded into 9mm Alvetex scaffolds and cultured for 3 days at 33C. Cells were then loaded into single loop bioreactor and cultured for 14 days. Medium was changed manually every other day. Cells were treated with PTH for 4 hour prior to RNA isolation and gene analysis. Data normalized by beta actin. * p<0.05.

To assess sclerostin expression in these Ocy454 within the Osteo-4 bioreactors, we performed immunohistochemistry (IHC) for sclerostin in Ocy454 cells grown for 7 days in an Osteo-4 bioreactor and treated with PTH or vehicle for 4 hours at the end of the culturing period. Sclerostin was readily detected in Ocy454 cells (Figure 6-7A), and as expected, its expression was significantly suppressed by PTH treatment, as revealed by reduced immunostaining, (Figure 6-7B). Tunel staining (Figure 6-7C,D) of the same scaffolds revealed minimal cell death under these conditions demonstrating high cell viability in the Osteo-4 bioreactor configuration.

96 ......

V, il J

C D

Figure 6-7: Sclerostin and Tunel staining in Ocy454 cells. Ocy454 cells were seeded into 9 mm scaffold and cultured for 3-4 days at 33 C before being switched to non-permissive temperature (37C) for an additional 14 days. Scaffold were then loaded into a Osteo-4 bioreactor and cultured for 7 days with a daily medium change. At the end of the 7 days experiments , bioreactor was treated with PTH of vehicle for 4 additional hr. Scaffold were fixed and processed for IHC and Tunel assay. Sclerostin IHC in vehicle (A) and hPTH (1-34), 100 nM (B)

Importantly, these result demonstrate Ocy454 have intact osteocytic signaling pathways in the Osteo-4 bioreactors and will enable us to test the response of OCY454 to microgravity stimuli during the ISS mission.

6.6.2 Osteocytic response to random launch vibration

As osteocytes are sensitive to mechanical loading, we performed experiments in Osteo-4 to investigate the effects of launch vibrations on Ocy454. In brief, Ocy454 were grown for 1-week prior to integration into the Osteo-4 bioreactors and two identical payloads. Next, one Osteo-4 payload was subjected to single axis random launch vehicle (SpaceX Falcon 9, Dragon Capsule) vibrations on a shaker table (Draper Laboratories, Cambridge, MA) for a duration of 180 seconds. The other Osteo-4 payload served as the non-vibrated control. Subsequently, RNA was isolated at 2- and 24-hours following the random vibration test completion. The number of bioreactors at each time point was: two static and one random vibration bioreactor at 2-hour time point, and one static and three bioreactors at 24-hour time point.

97 DMP1 Osteocalcin Sclerostin mRNA 2.0 1.& 3- M Static .111 1m Random Vibration 1.0- 2 .0, z " 01.0- E . ill. 0.& 1 0 z 0.i 0.0 2 HR 24 HR 24 HR 2HR 24HR Figure 6-8: Ocy454 gene expression changes following single axis random vibration test of the Osteo-4 payload simulating SpaceX Falcon 9 Dragon launch For two known mechanically responsive genes (DMP1 and SOST), non- statistically significant changes were observed at both time points, except for a small statistically significant up-regulation of SOST and down-regulation of osteocalcin at the 24-hour time point (Figure 6-8). However, as SOST is known be down regulated with mechanical loading and fluid shear stress (Chapter 5), these findings given the limited number of biological and technical replicates, should be interpreted accordingly. To help account for this potential effect of launch loading as a confounding variable for the Osteo-4 ISS flight experiment, 2-ml of medium was collected from both ground and flight bioreactors at 6- and 24- hours post launch.

6.6.3 Preservation of Osteo-4 bioreactors in space flight environment

Given the unique crew constraints of conducting a cell culture experiment on the ISS, coupled with our ability to provide temporary within-tray cooling of bioreactors to 8-to-12 0C (pending crew recovery of bioreactors for long term stowage at -95 DC), we sought to investigate the effects of the key osteocyte genes under these thermal conditions. Importantly, we discovered SOST, a key osteocytic gene under investigation for the Osteo-4 mission, was significantly down regulated after extended cooling (48 hours) when Ocy454 was grown under normal growth conditions, integrated into Osteo-4 bioreactors (Figure 6-9), and fixed with a buffer (RNAProtect cell reagent, Qiagen) to preserve RNA for

98 subsequent isolation and analysis upon sample returned to earth. This data highlighted the importance of astronauts moving Osteo-4 bioreactors to deep cold stowage (-95 0C) post fixation with the RNA preservation buffer (RNAProtect cell reagent, Qiagen) within 24-hours, to obtain optimum science return. This data set, related to the performance of RNA cell protection buffers to minimize changes in gene expression if science is recovered within 24-hours is widely applicable to other science investigations conducting ISS cell culture experiments.

A B SOST Sclerostin mRNA 2.0 1.- M 24HR 24HR 48HR 48HR 01. 0 01.0

E 0.5 0 0 Z * 0.0 0. 8C 16C 12C

Figure 6-9: (A) Ocy454 SOST regulation on three-dimensional scaffolds (Alvetex) grown

under normal growth conditions for 4-days (37 *C, 5% CO 2 ), fixed with Cell Protect RNA preservation buffer, and RNA recovered at indicated time points. (B) Ocy454 SOST regulation on three-dimensional scaffolds (Alvetex) grown under normal growth

conditions for 4-days (37 "C, 5% CO 2), integrated into Osteo-4 bioreactors for 4-days, fixed with Cell Protect RNA preservation buffer, and RNA recovered at indicated time points.

99 6.7 Conclusions

We have shown Ocy454 grew well within Osteo-4 bioreactors with no significant cell apoptosis. In addition, Ocy454 maintained osteocytic responses in the Osteo-4 spaceflight qualified bioreactors by reducing SOST and increasing Rankl upon PTH treatment, showing that important osteocytic biological pathways remain intact in the spaceflight qualified bioreactors and flight conditions. In addition, we demonstrated the importance of astronauts recovering Osteo-4 science for long term cold-stowage within 24-hours of bioreactor fixation. Lastly, the Osteo-4 hardware successfully completed all technical and science operations for the ISS mission and bioreactors have been returned to earth for processing and downstream analysis.

1 Gutierrez, R. A. & Crumpler, E. T. Potential effect of geometry on wall shear stress distribution across scaffold surfaces. 2 Martinez, E. M., Yoshida, M. C., Candelario, T. L. & Hughes-Fulford, M. Spaceflight and simulated microgravity cause a significant reduction of key gene expression in early T-cell activation. doi:D - NLM: PMC4360066 [Available on 03/15/16] OTO - NOTNLM. 3 Pajevic, P. D., Spatz, J. M., Garr, J., Adamson, C. & Misener, L. Osteocyte biology and space flight.

100 Chapter 7

7 Sclerostin antibody inhibits skeletal deterioration due to reduced mechanical loading

This thesis chapter, in part, previously published as the manuscript: Spatz, et al., Sclerostin antibody inhibits skeletal deterioration due to reduced mechanical loading, J Bone Miner Res. 2013 Apr;28(4):865-74. doi: 10.1002/jbmr.1807.

101 7.1 Introduction and Rationale

Despite intensive exercise countermeasures, muscle and bone loss remain among the top medical challenges to extended space missions. While recent advances in exercise countermeasures (Advanced Resistive Exercise Device, ARED) demonstrated on the International Space Station have reduced both muscle and bone loss for extended missions in microgravity, bone loss at weight bearing skeletal sites is still -0.5% per month and highly variable between individuals'. In addition, serum markers of bone resorption and urinary calcium were significantly elevated in astronauts using the intensive exercise regimes provided by the ARED1. Thus, significant bone turnover and bone loss is occurring in long duration astronauts and remains an area of concern for deep- spaceflight human missions.

7.2 Pharmacologic prevention of bone loss

Having been shown to reduce fracture risk in large-scale randomized clinical trials, several drugs are currently approved for prevention of bone loss and treatment of osteoporosis. Broadly, there are two classes of clinically approved therapies: 1) anti-resorptive, including the bisphosphonates, calcitonin, selective estrogen receptor modulators (SERMs), estrogen, and the newest biologic anti- Rankl antibodies; and 2) anabolic, including teriparatide (PTH (1-34)).

Among the anti-resorptive therapies, the oral bisphosphonates are the most widely used. Whereas they potently inhibit bone resorption, and therefore afford protection from bone loss associated with disuse, they are retained in bone for years, raising some concerns about their use in younger individuals, such as the astronaut population. Moreover, due to the coupling of bone resorption and bone formation, bisphosphonates also suppress bone formation. Whereas bisphosphonates are highly efficacious for reducing vertebral, hip and non- vertebral fracture risk in postmenopausal women, a number of rare, but serious side effects may be associated with bisphosphonate use, including gastro-

102 intestinal disorders, osteonecrosis of the jaw, atypical femoral shaft fractures, delayed fracture healing, and bone pain. These concerns notwithstanding, a study recently completed tested the effect of the oral bisphosphonate alendronate plus exercise in preventing the declines in bone mass and strength and elevated levels of urinary calcium and bone resorption in astronauts during 5.5 months of spaceflight2. The combination of the ARED and bisphosphonate use attenuated the declines in altered bone physiology during spaceflight including, bone mineral density of the spine, hip, and pelvis assessed by dual- energy x-ray absorptiometry (DXA), compartmental losses in trabecular and cortical bone mass in the hip assessed by quantitative computed tomography, elevated levels of bone resorption markers, and urinary excretion of calcium 2 . However, several individual astronauts were unable to participate or complete the study due to the aforementioned side effects, particularly gastro-intestinal concerns during pre-flight phase-in dosing of the oral bisphosphonate.

Taken together, these observations reduce enthusiasm for use of bisphosphonates in astronauts, and provide rationale for developing new targeted biologic therapies to inhibit spaceflight induced bone loss.

7.3 Key findings

We tested the ability of a murine sclerostin antibody (SclAbll) to prevent bone loss in adult mice subjected to hind limb unloading (HLU) via tail suspension for 21 days. Mice (n = 11-17/group) were assigned to control (CON, normal weight bearing) or HLU and injected with either SclAblI (subcutaneously, 25 mg/kg) or vehicle (VEH) twice weekly. SclAbll completely inhibited the bone deterioration due to disuse, and induced bone formation such that bone properties in HLU- SclAbll were at or above values of CON-VEH mice. For example, hind limb bone mineral density (BMD) decreased -9.2% 1.0% in HLU-VEH, whereas it increased 4.2% 0.7%, 13.1% 1.0%, and 30.6% 3.0% in CON-VEH, HLU- SclAbll, and CON-SclAbll, respectively (p<0.0001). Trabecular bone volume, assessed by micro-computed tomography (pCT) imaging of the distal femur, was

103 lower in HLU-VEH versus CON-VEH (p < 0.05), and was 2- to 3-fold higher in SclAblI groups versus VEH (p < 0.001). Midshaft femoral strength, assessed by three-point bending, and distal femoral strength, assessed by micro-finite element analysis (pFEA), were significantly higher in SclAblI versus VEH-groups in both loading conditions. Serum sclerostin was higher in HLU-VEH (134 5pg/mL) compared to CON-VEH (116 6pg/mL, p'<0.05). Serum osteocalcin was decreased by hind limb suspension and increased by SclAblI treatment. Interestingly, the anabolic effects of sclerostin inhibition on some bone outcomes appeared to be enhanced by normal mechanical loading. Altogether, these results confirm the ability of SclAbil to abrogate disuse-induced bone loss and demonstrate that sclerostin antibody treatment increases bone mass by increasing bone formation in both normally loaded and under loaded environments.

7.4 Background

Pharmacologic inhibition of sclerostin induces bone formation in normal and ovariectomized animals that are fully weight-bearing3-7 and also following unilateral limb immobilization in rats". In addition, there is only a short-term (7 days) study that has examined sclerostin antibody treatment in the well- characterized hind limb unloading (HLU) model 9. However, because of the limited duration of unloading, this study did not demonstrate bone microarchitectural changes due to HLU, nor report effects on bone mechanical properties of unloading or sclerostin antibody treatment. Further, there are conflicting reports in the literature as to whether the optimal anabolic effect of sclerostin antibody treatment requires normal mechanical loading 38, ,9. Finally, although there is evidence that SOST is increased by mechanical unloading 0'", there is limited data on serum levels of sclerostin following reduced mechanical loading in animal models.

Thus, in this study we sought to demonstrate the anabolic effects of pharmacologic inhibition of sclerostin in the HLU model. We hypothesized that

104 sclerostin antibody treatment would not only inhibit bone loss and the deterioration of mechanical properties associated with disuse-induced bone loss, but would also induce bone formation. We also determined whether the skeletal effects of sclerostin antibody treatment depend on mechanical loading by comparing the response to pharmacologic inhibition in normally loaded animals to those exposed to HLU, and by comparing the responses in the forelimbs and hind limbs of HLU mice. Finally, we determined whether serum sclerostin increased following HLU to elucidate whether in addition to SOST, the sclerostin protein is mechanically regulated by disuse.

7.5 Material and methods

7.5.1 Overview of study design

Female adult mice (C57BI/6J, 12 weeks of age; Jackson Laboratory, Bar Harbor, ME, USA) were subjected to either HLU via tail suspension , or normal loading (CON) and injected twice weekly with sclerostin antibody (SclAbll, 25 mg/kg, subcutaneously; Amgen, Thousand Oaks, CA, USA) or vehicle (VEH) for the 21-day experiment. Thus, mice were assigned to one of four groups: HLU- VEH (n = 13), HLU-SclAbll (n = 11), CON-VEH (n = 17), or CON-SclAbll (n = 11). Animals were assigned to groups by total body bone mineral density (BMD) and body mass in a manner to minimize differences between groups at baseline. All mice were weighed daily for the first 5 days and biweekly thereafter, with adjustments made to ensure the hind limb paws could not touch the ground. The average weight-bearing on the forelimbs of HLU groups was 43% 1.4% of total body mass. Mice were maintained on a 12/12 hour light/dark cycle and had ad libitum access to standard laboratory rodent chow and water. Control animals were singly housed to mimic the increased stress environment of singly housed

HLU animals. Mice were euthanized by CO 2 inhalation at the end of the experiment. All animal procedures were approved by and performed in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) at the Beth Israel Deaconess Medical Center.

105 7.5.2 Bone mineral density and body composition

In vivo assessment of total body (exclusive of the head region), hind limb, and forelimb BMD (g/cm 2) was performed at baseline and end of the study using peripheral dual-energy X-ray absorptiometry (pDXA PiXImusIl; GE Lunar Corp., Madison, WI, USA), as described 4 .

7.5.3 Specimen harvesting and preparation

Femurs, tibias, and humeri were harvested and cleaned of soft tissue. The right femurs and humeri and were prepared for imaging and biomechanical testing by wrapping in saline-soaked gauze and freezing at -20*C. The left femur was prepared for histology in 10% neutral buffered formalin at 40C for 48 to 72 hours, and then transferred to 70% ethanol at 4*C. Wet weight of the gastrocnemius and soleus muscles were obtained at the end of the study, and normalized to body weight.

7.5.4 Bone turnover markers

Mice were fasted for 2 hours before blood was collected at the time of euthanasia. Serum was used to measure sclerostin (in VEH-treated mice only) and bone turnover markers. Osteocalcin and sclerostin (in VEH-treated mice only) were assessed using the species-specific single-plex Luminex assays (Millipore, Billerica, MA, USA). Serum concentrations of amino-terminal propeptide of type I procollagen (P1 NP), tartrate-resistant acid phosphatase 5b (TRACP5b), and type I collagen C-telopeptide (sCTX) were measured by using mouse ELISA kits (IDS, Fountain Hills, AZ, USA). All assays were run according to the manufacturers' protocols.

7.5.5 Histology and quantitative histomorphometry

Qualitative histologic analysis and quantitative static and dynamic histomorphometry were performed as described15 . To examine bone formation

106 rates, calcein (15 mg/kg) was injected intraperitoneally at 8 days and alizarin red or demeclocycline 2 days prior to euthanasia. Histomorphometric measurements were performed on the secondary spongiosa of the distal femoral metaphysis using an OsteoMeasure morphometry system (Osteometrics, Atlanta, GA, USA). For dynamic histomorphometry, mineralizing surface per bone surface (MS/BS, %) and mineral apposition rate (MAR, pm/d) were measured in unstained sections under ultraviolet light, and used to calculate bone formation rate with a surface referent (BFR, pm 3/pm 2/d). Eroded surface per bone surface (ES/BS, %), number of osteoblasts, osteoclasts per bone surface, number of osteocytes per bone area (identified as filled lacunae), and number of adipocytes per marrow area were also measured, as described15. Terminology and units follow the recommendations of the Histomorphometry Nomenclature Committee of the American Society for Bone and Mineral Research 6 .

7.5.6 Mechanical testing

Femurs were mechanically tested at a constant displacement rate of 0.03 mm/s to failure in three-point bending (Bose ElectroForce 3200 with 150 N load cell; Bose Corporation, Eden Prairie, MN, USA). Fresh-frozen femurs were thawed to room temperature then centered longitudinally, with the anterior surface on the two lower support points spaced 10 mm apart17 . Force-displacement data were acquired at 30 Hz and used to determine maximum force (N) and stiffness (N/mm). Assessment of bone morphology and microarchitecture was performed with high-resolution micro-computed tomography (pCT40; Scanco Medical, Bruttisellen, Switzerland). In brief, the distal femoral and humeral metaphysis were scanned using 70 KvP, 50 mAs, and 12-pm isotropic voxel size. The femoral metaphysis region began 240 pm distal to the growth plate and extended 1.8 mm distally. Similarly, the humeri region began 240 pm distal to the growth plate and extended 1.2 mm distally. Cancellous bone was separated from cortical bone with a semi-automated contouring program. For the cancellous bone region we assessed bone volume fraction (BV/TV, %), trabecular thickness (Tb.Th, mm), trabecular separation (Tb.Sp, mm), trabecular number (Tb.N, 1/mm),

107 connectivity density (ConnD, 1/mm 3), and structure model index (SMI). Transverse CT slices were also acquired at the femoral midshaft to assess total cross-sectional area, cortical bone area, and medullary area (TA, BA, and MA, respectively, all mm 2); bone area fraction (Ct.BA/TA, %), cortical thickness (Ct.Th, mm), porosity (Ct.Po, %) and minimum (Imin, mm 4 ), maximum (Imax, mm ), and polar (pMOI, mm ) moments of inertia. Cortical bone was analyzed from the metaphysis (surrounding the trabecular volume of interest) and from a 0.6-mm-long mid-diaphyseal region. Bone was segmented from soft tissue using the same threshold, 247 mg HA/cm 3 for trabecular and 672 mg HA/cm 3 for cortical bone. Scanning and analyses adhered to published guidelines 8

To assess the effect of unloading and sclerostin antibody treatment on mechanical properties of metaphyseal bone, pCT-derived data was used to perform linear micro-finite element analysis (pFEA) of the distal femur using the manufacturer's software (Scanco Medical AG, Bassersdorf, Switzerland), which implements a voxel-based pFEA method 19. The pFE model of the metaphyseal region, including both cortical and trabecular bone, was subjected to applied uniaxial compression, with an elastic modulus of 10 GPa and Poisson's ratio of 0.3 for each element. Outcomes included axial stiffness (N/mm) as well as the percentage of load carried by the cortical and trabecular compartments.

7.5.7 Statistical analysis

All data were checked for normality, and standard descriptive statistics computed. Treatment effects were evaluated using analysis of variance (ANOVA) or repeated measures ANOVA for all continuous variables. We used two-factor ANOVA to determine whether the effect of sclerostin antibody treatment depended on the loading condition. Main ANOVA effects and post hoc testing were considered significant at p < 0.05, whereas the interaction between treatment and loading was considered significant at p < 0.1. Data are reported as mean sem, unless noted.

108 7.6 Results

7.6.1 Body mass

Body mass increased slightly in the CON-VEH and CON-SclAbil groups and declined transiently in the HLU groups in the first 3 days by -8% to -9% but then stabilized at -5% below baseline for remainder of study (p < 0.05 versus baseline). As a result, the HLU-SclAbll and HLU-VEH weighed less than their respective CON groups at the end of the study (-9.1% and -11.5%, respectively, p < 0.05).

7.6.2 Muscle mass

Soleus wet weight was 51% and 38% lower than CON in HLU-SclAbll and HLU- VEH, respectively (p < 0.0001, Figure 7-1A). Gastrocnemius wet weight was 27% and 19% lower than CON in HLU-SclAbll and HLU-VEH, respectively (p < 0.0001, Figure 7-1 B). There were no differences in muscle mass between VEH- treated and SclAblI-treated groups in either loading condition.

- A Soleus B Gastrocnemius

. t *VEH 6- 0.3 l SclAbIl

4- 0.2 3

2 $.0

0 ~ 0 A CON HLU CON HLU

Figure 7-1: Effects of unloading and sclerostin antibody treatment on normalized wet weight of (A) soleus and (B) gastrocnemius muscles. t p < 0.01 for CON versus HLU within treatment group. Error bars represent 1 SEM. 7.6.3 Bone mineral density

BMD increased slightly in CON-VEH at all sites, whereas HLU caused significant bone loss at the hind limb and total body, but not the forelimb (Figure 7-2). Treatment with sclerostin antibody not only prevented the bone loss due to HLU,

109 but also led to marked increases in BMD in CON and HLU groups, both versus baseline and versus VEH-treated groups. For example, hind limb BMD declined

-9.3% + 1.1% in HLU-VEH, whereas it increased 4.3% 0.7%, 13.2% 1.0%, and 30.6% 3.0% versus baseline in CON-VEH, HLU-SclAbll, and CON-SclAblIl, respectively (p < 0.001 for all). The pattern was similar for total body BMD (Figure 7-2A). Forelimb BMD was unchanged in HLU-VEH (-1.1% 2.6%) and tended to increase in CON-VEH (4.1% 3.0%, p = 0.2 versus baseline). Forelimb BMD increased in SclAbll-treated HLU (15.1% 2.9%, p < 0.001 versus baseline) and CON groups (28.6% 2.4%, p < 0.001, Figure 2C); and these increases were significantly greater than the BMD changes in VEH-treated animals (p < 0.0001 for both).

A B C Forelimb 35- Total Body Hindlimb EVEH 30 [ SclAbIl S25- E20- 15 - 10

00-

6Z -10 - -15 CON HLU CON HLU CON HLU

Figure 7-2: Effect of unloading and sclerostin antibody treatment on (A) total body BMD, (B) hind limb BMD, and (C) forelimb BMD. *Significantly different from baseline (p < 0.001). Horizontal bars denote significant differences (p < 0.01) between VEH and SclAblI within loading groups; tp < 0.05 for CON versus HLU within a treatment group. Error bars represent 1 SEM. (One CON-ScIAblI and three CON-VEH and animals were excluded from forelimb BMD measurements due to poor positioning on either baseline or follow-up scan.

7.6.4 Bone microarchitecture

Consistent with hind limb BMD measurements, HLU resulted in significant bone deterioration, particularly in the trabecular compartment (Figure 7-3, Table 7-1). Compared to CON-VEH, HLU-VEH mice had lower Tb.BV/TV, Tb.N, and Tb.Th in the distal femur. Cortical bone was also negatively affected by unloading, because HLU-VEH had lower cortical bone area, cortical bone area fraction,

110 cortical thickness, and polar moment inertia than fully loaded animals at both the distal femoral and mid-diaphyseal sites (Table 7-1). In addition, HLU-VEH had higher cortical porosity than CON-VEH at the distal femoral cortex. At the humerus, trabecular bone parameters were unaffected by HLU; however, cortical bone area, bone area fraction, thickness, and polar moment of inertia were slightly lower in HLU-VEH versus CON-VEH (Table 7-2).

111 Table 7-1: Effect of HLU and SclAbil-Il treatment on femoral trabecular and cortical bone microarchitecture, assessed by pCT (mean SEM).

Controls HLU ANOVA Results Site Vehicle SciAbll Vehicle SciAbll Pload Ptreatment Pinteraction Distal Trabecular BV/TV (%) 10.3 0.4b 32.0 1.5ab 8.0 0.3 21.7 1.2 a <0.0001 <0.0001 <0.0001 Tb.N (mm-1) 3.86 0.04b 4.32 0.05a, b 3.72 0.05 4.05 0.05a 0.0006 <0.0001 0.1 Tb.Th (mm) 0.054 0.001 b 0.097 0.002a, b 0.048 0.001 0.075 0.003a <0.0001 <0.0001 <0.0001 Tb.Sp (mm) 0.252 0.003b 0.198 0.003ab 0.261 0.003 0.217 0.005a 0.008 <0.0001 0.2 ConnD (mm- 3) 74 3b 107 3a 55 108 3a 0.3 <0.0001 0.06 SMI 2.99 0.06 1.4 0.12ab 3.05 0.05 1.98 0.08a 0.01 <0.0001 0.002 Distal Cortical Tt.CSA (mm 2) 2.49 0.03 2.68 0.05ab 2.48 0.05 2.54 0.05 0.3 0.008 0.9 Ct.BA (mm 2) 0.71 0.01 b 0.96 0.01 a,b 0.57 0.01 0.80 0.02a <0.0001 <0.0001 0.7 Ct.BA/TA (%) 28.5 0.4b 35.5 0.7a b 22.8 0.4 31.5 0.2a <0.0001 <0.0001 0.06 Ct.Por (%) 5.9 0.2b 5.3 0.2 7.9 0.4 5.3 0.4 a 0.0006 <0.0001 0.003 Ct.Th (mm) 0.12 0.002b 0.15 0.002ab 0.10 0.001 0.13 0.001a <0.0001 <0.0001 0.08 4 pMOI (mm ) 0.50 0.01 b 0.71 0.02a,b 0.39 0.01 0.57 0.02a <0.0001 <0.0001 0.3 Midshaft Cortical Tt.CSA (mm 2) 1.56 0.018 1.69 0.024ab 1.54 0.030 1.58 0.026 0.03 0.001 0.05 Ct.BA (mm 2) 0.66 0.010b 0.86 0.015ab 0.55 0.010 0.70 0.012a <0.0001 <0.0001 0.02 Ct.MA (mm 2) 0.90 0.014b 0.83 0.013a 0.99 0.023 0.88 0.016a 0.0004 <0.0001 0.2 Ct.BA/TA (%) 42.1 0.5b 50.8 0.4a,b 35.8 0.5 44.2 0.3a <0.0001 <0.0001 0.04 Ct.Th (mm) 0.16 0.002b 0.21 0.003ab 0.13 0.002 0.17 0.002a <0.0001 <0.0001 0.03 TMD (mgHAlccm) 1148 5 1161 8 1135 4 1147 7 0.09 0.1 0.7 4 pMOI (mm ) 0.28 0.01 b 0.37 0.01ab 0.24 0.01 0.29 0.01 a <0.0001 <0.0001 0.04 a: p<0.05 SclAbll vs. VEH within loading condition; b: p<0.05 CON vs. HLU within treatment condition

112 Table 7-2: Effect of HLU and sclerostin antibody treatment on bone microarchitecture at the humerus (mean SEM)

Controls HLU ANOVA Results Site Vehicle SciAbli Vehicle SciAbll Pload Ptreatment Pinteraction Proximal Trabecular BV/TV (%) 9.2 0.4 23.0 1.3ab 8.5 0.4 18.0 1.0 a 0.004 0.0001 0.01 Tb.N (mm-1) 3.85 0.07 4.55 0.1Oa 3.99 0.07 4.30 0.112 0.7 <0.0001 0.03 Tb.Th (mm) 0.049 0.001 0.076 0.001a, b 0.047 0.001 0.066 0.001a <0.0001 <0.0001 0.008 Tb.Sp (mm) 0.26 0.005 0.20 0.006a 0.25 0.005 0.22 0.007a 1 <0.0001 0.04 ConnD (mm- 3) 41 4 87 4a 37 5 83 7a 0.5 <0.0001 1 SMI 2.8 0.05 2.0 0. 1ab 3.0 0.06 2.2 0.08a 0.009 <0.0001 0.2

Midshaft Cortical Tt.CSA (mm 2) 0.73 0.01 0.80 0.01 a,b 0.71 0.01 0.75 0.01a 0.03 0.0001 0.2 Ct.BA (mm 2) 0.41 0.006b 0.54 0.005ab 0.37 0.009 0.48 0.007a <0.0001 <0.0001 0.2 Ct.MA(mm 2) 0.32 0.006b 0.26 0.006a 0.35 0.006 0.27 0.006a 0.009 <0.0001 0.3 Ct.BA/TA (%) 56.3 0.3b 67.7 0.5ab 51.5 0.5 64.0 0.3a <0.0001 <0.0001 0.2 Ct.Por (%) 0.24 0.02 0.20 0.02 0.21 0.005 0.20 0.01 0.3 0.1 0.6 Ct.Th (mm) 0.16 0.001b 0.21 0.002ab 0.14 0.002 0.19 0.001a <0.0001 <0.0001 0.2 TMD (mgHA/ccm) 1174 6 1167 6 1153 9 1171 8 0.18 0.6 0.1 pMOl (mm 4) 0.072 0.002b 0.093 0.002ab 0.065 0.003 0.081 0.003a 0.0008 <0.0001 0.3 a: p < 0.05 SclAbll vs VEH within loading condition; b: p<0.05 HLU vs CON within treatment condition Abbreviations: bone volume fraction (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), connectivity density (ConnD), structure model index (SMI), total cross-sectional area (Tt.CSA), cortical bone area (Ct.BA), medullary area (Ct.MA), cortical bone area fraction (Ct.BA/TA), cortical porosity (Ct.Por), cortical thickness (Ct.Th), polar moment of inertia (pMOl), tissue mineral density (TMD)

113 A B

35-

*VEH 30- 30 SclAbII

25-

20

to 15

10-

51

0- CON HLU

Figure 7-3: Effect of unloading and sclerostin antibody treatment at the distal femur. (A) Trabecular BV/TV (%); (B) 3D rendering of pCT image from representative animals from each group. Horizontal bars designate significant differences between VEH and SclAblI within loading group (p < 0.001); tp < 0.01 for CON versus HLU within a treatment group; and #significantly greater effect of SclAblI in CON versus HLU. Error bars represent 1 SEM.

Treatment with SclAbli improved bone properties in normally loaded animals and fully inhibited disuse-induced bone loss, improving cortical and trabecular bone parameters to levels at or above the fully-loaded VEH-treated group. Specifically, SclAbll-treated animals, both loaded and unloaded, had significantly higher Tb.BV/TV, Tb.Th, and Tb.N, along with lower Tb.Sp, better connectivity density, and more plate-like architecture (SMI) than VEH-treated animals at both the femur and humerus (Tables 7-1 and 7-2).

Treatment with SclAblI also improved cortical bone properties in both loaded and unloaded animals, increasing cortical bone area, thickness, and bone area fraction at both the femur and humerus, and prevented the increase in cortical

114 porosity seen in the HLU group. SclAbli treatment led to lower midshaft medullary area in both HLU and CON, consistent with endocortical bone apposition. Mid-femoral cross-sectional area was increased in CON-SclAbll, but not HLU-SclAbll, suggesting that normal loading may augment SclAbll treatment's ability to induce periosteal bone apposition. Consistent with this, SclAbli treatment led to increased mid-diaphyseal cross-sectional area in the humeri of both the loaded and unloaded animals (Table 7-2). The positive effect of SclAblI treatment was significantly greater in loaded than unloaded animals for femur Tb.BV/ TV, Tb.Th, and SMI, and midshaft cortical bone area (Figure 7-3, Table 7-1, Pinteraction < 0.001), and for Tb.BV/TV and Tb.Th in the proximal humerus.

7.6.5 Mid-femoral biomechanics and pFEA of the distal femur metaphysis

Femoral bending stiffness and maximum load were 19% lower in HLU-VEH compared to CON-VEH (p < 0.05, Figure 7-4). Mice treated with SclAbll had better mechanical properties compared to VEH-treated groups in both loading conditions, with maximum load and bending stiffness 40% to 50% higher than VEH (Figure 7-4).

A B Maximum Force Bending Stiffness

20 90 -- t VEH 80 ElScIAbII

15 70 f 60 550E 60--

Z40 30- 5 - 20- 10- 0 0 CON HLU CON HLU Figure 7-4: Effect of unloading and sclerostin treatment on femoral strength as assessed by three-point bending, (A) maximum force, and (B) bending stiffness. Horizontal bars designate significant differences between VEH and ScIAblI within loading group (p < 0.01); tp < 0.01 CON versus HLU within a treatment group.

115 pFEA showed that compressive stiffness of the combined cortical and trabecular regions were 18% lower in HLU-VEH than CON-VEH (p < 0.05) and 50% higher in SclAbli versus VEH-treated mice in both loading conditions (Figure 5A). Interestingly these changes in stiffness were nearly twofold greater than the respective changes in bone volume (-10% for HLU-VEH and +25% for SclAbll- treated animals), suggesting that changes in bone mass underestimate changes in mechanical properties.

A C

pFEA - Distal Femur Stiffness CON-VEH HLU-VEH * VEH 10A

CON H-LU E B6- CON-SciAbIl HLU-SclAbI szFEA - Distal Femur Cortex ~ 2 100 EScAbI 98-

CON HLU 0.0 10.0 Von Mises Stress (MPa)

Figure 7-5: Effect of unloading and scierostin antibody treatment on bone strength, as assessed by micro-finite element analysis (pFEA) of the distal femur: (A) stiffness, (B) % cortical load, (C) representative pFEA Von Mises Stress color map images. Horizontal bars designate significant differences between VEH and ScIAblI within loading group (p < 0.05); fp < 0.01 for CON versus HLU within a treatment group; #significantly greater effect of ScIAblI in CON versus HLU (p < 0.02); Error bars represent 1 SEM.

HLU did not change the distribution of load sharing between the trabecular and cortical compartments. In contrast, the proportion of load carried by trabecular and cortical bone compartments were increased and decreased, respectively, in ScIAbil-treated mice compared to VEH groups, consistent with a shift toward more uniform load sharing following ScIAbl treatment in both loading conditions (Figure 5). Notably, differences in pFEA-estimated stiffness (-18% in HLU-VEH

116 versus CON-VEH, and +50% in SclAbll-treated mice) were larger than the differences in total bone volume (-10% in HLU-VEH versus CON-VEH, and +25% in SclAblI-treated mice), suggesting that changes in bone mass alone underestimate the effects of unloading and sclerostin antibody treatment on bone biomechanical properties.

7.6.6 Serum sclerostin and bone turnover markers

HLU-VEH mice had higher serum sclerostin (134 5 versus 116 6 pg/mL, p < 0.05), lower osteocalcin, and lower CTX1 than CON-VEH, but similar TRACP5b (Figure 6). Compared to VEH-treated mice, those treated with SclAbll had higher osteocalcin and lower TRACP5b (in HLU only), but had similar CTX1 levels (Figure 6).

A C 40- EVE E 1: t 20 - ScIAbII 2 100 15-

0 I.. C 10HLU 40 20- EH S5- 20 0 H 0- CON-VEH HLU-VE CON HLU B D 60- 250- t E E .0 1- *VEH El T ScIAbli 50- EIScAbI 0 200-

0 -E 40- 150- t 0 0

0 100- 0 Q20 6 50- 10

0- CON HLU CON HL.

Figure 7-6: Effect of unloading and sclerostin antibody treatment on serum sclerostin and markers of bone turnover. (A) Sclerostin (vehicle groups only); (B) Osteocalcin; (C) TRACP5b, and (D) CTXI. Horizontal bars designate significant differences between VEH and ScIAblI within loading group (p < 0.05). tp < 0.01 CON versus HLU within a treatment group. Error bars represent 1 SEM.

117 7.6.7 Histomorphometry

Static and dynamic histomorphometry results are summarized in Table 7-3. Due to technical issues with fluorescent label incorporation in some animals, sample sizes in some groups were limited to 3 animals for dynamic outcomes. In VEH- treated animals, HLU led to reduced MAR and greater marrow adiposity. SclAblI treatment led to significantly higher bone formation indices (MAR, MS/BS, and BFR/BS) compared to VEH-treated mice in both loading conditions, but had no effect on marrow adiposity.

Table 7-3: Effect of unloading and SclAblI treatment on static and dynamic quantitative histomorphometry of the distal femur (mean SEM).

Controls (CON) Hind limb Unloaded (HLU) Vehicle SciAbli Vehicle SclAbll

Static indicest N.Ob/BS (#/mm 2) 24 4 23 2 26 4 32 2 N.Oc/BS(#/mm 2) 3.9 1.1 4.4 1.0 6.5 1.3 5.1 1.3 N.Ot/BA (#/mm 2) 740 44 591 34 653 93 647 38 N.Ad/MA(#/mm 2) 16 4P 17 4b 34 7 35 6 Ad.Diam (pm) 44 2.5c 36 1.1b 51 4.0 50.5 2.4 OS/BS(%) 24.0 2 25.7 2 25.2 5 33.7 2 ES/BS (%) 6.3 1.5 6.3 0.7 8.7 1.9 10.1 2.4 Dynamic indicesti MS/BS (%) 13.6 3.3 24.9 2.2a 11.6 5.5 21.1 5.0a MAR (pm/day) 1.2 0.2b 1.6 0.2a 0.5 0.2 2.0 1.1a BFR/BS (pm 3/pm 2/d) 0.2 0.1 0.4 0.1a 0.09 0.1 0.9 0.6a

a p< 0.05 SclAblI vs VEH treatment within the CON or HLU groups; b p<0.05 HLU vs CON within the SclAbll and VEH treatment groups. C p=0.08 HLU vs CON within VEH-treated group t Sample size for static indices: n=6 / group t Sample size for dynamic indices: CON-VEH=6, CON-SclAbll=5, HLU-VEH=3, HLU-SclAbll=3.

Abbreviations: osteoblast number per bone surface (N.Ob/BS), osteoclast number per bone surface (N.Oc/BS), osteocyte number per bone area (N.Ot/BA), adipocyte number per marrow area (N.Ad/MA), adipocyte diameter (Ad.Diam), osteoid surface per bone surface (OS/BS), eroded surface per bone surface (ES/BS), mineralizing surface (MS/BS), mineral apposition rate (MAR), bone formation rate per bone surface (BFR/BS).

118 7.7 Discussion

The primary objective of this study was to determine the musculoskeletal effects of pharmacologic inhibition of sclerostin in mice exposed to hind limb unloading. We hypothesized that sclerostin antibody treatment would prevent bone loss and the deterioration of mechanical properties associated with disuse by promoting bone formation. Treatment with sclerostin antibody led to skeletal anabolic activity in the setting of unloading, as evidenced by increases in BMD, trabecular and cortical microarchitecture, and femoral strength values in the HLU-SclAblI group that were at or above values in the CON-VEH group. Furthermore, treatment with sclerostin antibody resulted in an increase in serum bone formation markers and histologic evidence of enhanced trabecular bone formation. These observations of skeletal anabolic activity following treatment with sclerostin antibody in disuse are consistent with other studies of sclerostin antibody treatment during immobilization in rodents 20 21 . Further, the increases in total body and hind limb BMD observed in our normally loaded control animals induced by sclerostin antibody treatment were similar to prior observations in normally loaded animals4 8 22 . In addition, serum bone turnover markers and dynamic histomorphometry outcomes were consistent with sclerostin antibody treatment increasing bone mass in rodents mainly by enhancing bone formation 8,9

Sclerostin antibody treatment had inconsistent effects on indices of bone resorption, with decreased serum TRACP5b levels, but no differences in serum CTX. Serum was collected only at a single time point (e.g., end of study) and thus the serum measures cannot reflect the changes over the entire experiment in osteoclast number versus their net activity that are theoretically reflected in the TRACP5b and CTX measures, respectively. Other studies in rodents have also reported declines in TRACP5b following sclerostin antibody treatment9.

The current study also explored whether the skeletal effects of sclerostin antibody treatment are sensitive to mechanical loading by examining effects in

119 hindlimb-unloaded versus fully-loaded controls, and effects in the unloaded hind limb versus loaded forelimb. In the femur, the skeletal response to sclerostin inhibition tended to be enhanced in the normally loaded mice compared to those exposed to hind limb suspension, with significantly greater response in trabecular bone volume and microarchitecture, cortical bone area and thickness, and distal femur pFEA-estimated stiffness, as well as a trend for greater gain in leg BMD (p = 0.20 for load-treatment interaction). Furthermore, femoral midshaft cross- sectional area was greater than VEH-treated mice only in the fully loaded SclAbll-treated animals, suggesting that periosteal apposition induced by sclerostin inhibition requires mechanical loading. At the humerus, whereas the effects of sclerostin antibody on BMD and cortical bone morphology were similar in HLU and fully-loaded groups, the increases in trabecular bone volume, number, and thickness were greater in CON than HLU. Although speculative, the finding that the response to sclerostin inhibition is altered in the "loaded" humerus of the HLU group suggests that systemic effects of HLU (i.e., stress) that are unrelated to mechanical loading influence the response to sclerostin inhibition. In a study of rats exposed to unilateral hind limb immobilization via bandages, Tian and colleagues8 also found that the trabecular bone response to sclerostin inhibition tended to be enhanced in the loaded versus unloaded limbs, whereas responses in cortical bone were similar in both groups. In contrast, in rats injected unilaterally with botulinum toxin A (botox) to induce hind limb paralysis, the response to sclerostin inhibition was similar in the loaded and unloaded proximal tibia primary spongiosa .

Although far from conclusive, taken together these observations suggest that the anabolic effects of sclerostin inhibition are enhanced with normal mechanical loading. As proposed by Tian and colleagues8 , the relative excess of sclerostin in unloaded bone could reduce the anabolic effects of sclerostin inhibition relative to those seen in fully loaded bone. Alternatively, although sclerostin appears to be a central mediator of the bone's response to mechanical loading 3, it may not be the only mechanism by which the osteocytic network responds to mechanical

120 unloading. For example, another mechanism by which osteocytes may orchestrate a response to altered mechanical loading is suggested by the observation that osteocytes are a major source of the osteoclastogenic cytokine receptor activator of NFkB ligand (RANKL)24, and further, that mice lacking RANKL in osteocytes are protected from bone loss induced by hind limb unloading 25 . Thus, sclerostin-independent effects, notably RANKL-mediated effects or, for example, the detrimental effects of increased marrow adiposity on osteoblasts, could also be responsible for a differential response to sclerostin antibody treatment in unloaded versus loaded bone. Clearly, further studies are needed to further investigate the interaction between mechanical loading and the anabolic effects of sclerostin antibody treatment.

Hind limb unloading in rodents and bed rest studies in humans have reported an increase in marrow adiposity 2 ,27. Interestingly, sclerostin antibody treatment did not prevent the increased marrow adiposity with HLU and had no effect on marrow adiposity in normally loaded animals. Canonical Wnt signaling inhibits adipogenesis and promotes survival of committed preadipocytes28-30 . Patients with activating mutations in low-density lipoprotein receptor-related protein 5 (LRP5) leading to increased Wnt signaling are associated with increased trabecular bone volume and reduced bone marrow fat in iliac crest biopsies, as well as increased osteogenesis and reduced adipogenesis of mesenchymal stem cells3 1 . However, specific Wnt targets and the role of noncanonical Wnt signaling in adipogenesis remain incompletely understood32 . Because sclerostin binds to the LRP4/5/6 receptor to inhibit Wnt signaling, our observation that sclerostin antibody treatment had no influence on bone marrow adiposity suggests that other mechanisms besides sclerostin-mediated Wnt signaling must be involved in the increased marrow adiposity seen with unloading.

Several limitations of this study merit mention. We studied only female mice at one time point, with a single-dosing regimen for sclerostin inhibition. Thus it is not clear whether the anabolic effects of sclerostin antibody would continue with

121 longer treatment, or whether a higher dose or more frequent dosing would promote even greater anabolic effects in the skeleton or eliminate the load- treatment interactions we observed.

These limitations notwithstanding, this study provides novel information about the ability of sclerostin antibody to induce bone formation in the situation of reduced mechanical loading. We showed that changes in bone volume underestimate both the loss of bone strength with disuse and the gain of bone strength with sclerostin inhibition, and we also explored the question whether mechanical loading influences the anabolic actions of sclerostin inhibition by comparing the skeletal responses of HLU and CON mice at both the forelimbs and hind limbs.

7.8 Conclusion

In summary, treatment with sclerostin antibody induces an anabolic skeletal response in an established rodent model of disuse-induced bone loss, such that unloaded animals treated with sclerostin antibody had BMD, microarchitecture, and mechanical strength values at or above the normally loaded control mice. These results provide strong rationale for testing the ability of sclerostin antibody treatment to improve skeletal fragility in patients with spinal cord injuries, stroke, muscular dystrophy, cerebral palsy, and other diseases and conditions associated with short-term or chronic disuse.

122 1 Smith, S. M. et al. Benefits for bone from resistance exercise and nutrition in long-duration spaceflight: Evidence from biochemistry and densitometry. J Bone Miner Res 27, 1896-1906, doi:10.1002/jbmr.1647 (2012). 2 Leblanc, A. et al. Bisphosphonates as a supplement to exercise to protect bone during long-duration spaceflight. 3 Agholme, F., Isaksson, H., Li, X., Ke, H. Z. & Aspenberg, P. Anti-sclerostin antibody and mechanical loading appear to influence metaphyseal bone independently in rats. Acta orthopaedica 82, 628-632, doi:10.3109/17453674.2011.625539 (2011). 4 Li, X. et al. Sclerostin antibody treatment increases bone formation, bone mass, and bone strength in a rat model of postmenopausal osteoporosis. J Bone Miner Res 24, 578-588, doi:10.1359/jbmr.081206 (2009). 5 Li, X. et al. Inhibition of sclerostin by monoclonal antibody increases bone formation, bone mass, and bone strength in aged male rats. J Bone Miner Res 25, 2647-2656, doi: 10.1 002/jbmr. 182 (2010). 6 Ominsky, M. S. et al. Two doses of sclerostin antibody in cynomolgus monkeys increases bone formation, bone mineral density, and bone strength. J Bone Miner Res 25, 948-959, doi: 10.1 002/jbmr. 14 (2010). 7 Padhi, D. et al. Multiple doses of sclerostin antibody romosozumab in healthy men and postmenopausal women with low bone mass: A randomized, double-blind, placebo-controlled study. Journal of clinical pharmacology, doi: 10.1 002/jcph.239; 10.1 002/jcph.239 (2013). 8 Tian, X., Jee, W. S., Li, X., Paszty, C. & Ke, H. Z. Sclerostin antibody increases bone mass by stimulating bone formation and inhibiting bone resorption in a hindlimb-immobilization rat model. Bone 48, 197-201, doi:10.1016/j.bone.2010.09.009 (2011). 9 Shahnazari, M. et al. Early Response of Bone Marrow Osteoprogenitors to Skeletal Unloading and Sclerostin Antibody. Calcified tissue international, doi:10.1 007/s00223-012-9610-9 (2012). 10 Robling, A. G., Bellido, T. & Turner, C. H. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J Musculoskelet Neuronal Interact 6, 354 (2006). 11 Macias, B. R. et al. Simulated resistance training, but not alendronate, increases cortical bone formation and suppresses sclerostin during disuse. Journal of applied physiology (Bethesda, Md.: 1985) 112, 918-925, doi:10.1152/japplphysiol.00978.2011 (2012). 12 Morey-Holton, E. R. & Globus, R. K. Hindlimb unloading rodent model: technical aspects. J AppI Physiol 92, 1367-1377 (2002). 13 Morey-Holton, E. R. & Globus, R. K. Hindlimb unloading of growing rats: a model for predicting skeletal changes during space flight. Bone 22, 83S- 88S (1998). 14 Ellman, R. et al. Partial reductions in mechanical loading yield proportional changes in bone density, bone architecture, and muscle mass. J Bone Miner Res 28, 875-885, doi: 10.1 002/jbmr. 1814 (2013).

123 15 Devlin, M. J. et al. Caloric restriction leads to high marrow adiposity and low bone mass in growing mice. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 25, 2078-2088, doi:10.1002/jbmr.82 (2010). 16 Parfitt, A. M. Bone histomorphometry: standardization of nomenclature, symbols and units (summary of proposed system). Bone 9, 67-69 (1988). 17 Brodt, M. D., Ellis, C. B. & Silva, M. J. Growing C57BI/6 mice increase whole bone mechanical properties by increasing geometric and material properties. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 14, 2159-2166, doi:10.1 359/jbmr.1999.14.12.2159 (1999). 18 Bouxsein, M. L. et al. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J Bone Miner Res 25, 1468- 1486, doi:10.1002/jbmr.141 (2010). 19 Van Rietbergen, B., Huiskes, R., Eckstein, F. & Ruegsegger, P. Trabecular bone tissue strains in the healthy and osteoporotic human femur. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 18, 1781-1788, doi: 10.1 359/jbmr.2003.18.10.1781(2003). 20 Moustafa, A. et al. Mechanical loading-related changes in osteocyte sclerostin expression in mice are more closely associated with the subsequent osteogenic response than the peak strains engendered. Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA 23, 1225-1234, doi:10.1 007/sOO1 98- 011-1656-4 (2012). 21 Lin, C. et al. Sclerostin mediates bone response to mechanical unloading through antagonizing Wnt/beta-catenin signaling. J Bone Miner Res 24, 1651-1661, doi:10.1359/jbmr.090411 (2009). 22 Robling, A. G. Sclerostin Antibody Protects the Skeleton from Disuse- induced Bone Loss. ASBMR Annual Meeting (2010). 23 Tu, X. et al. Sost downregulation and local Wnt signaling are required for the osteogenic response to mechanical loading. Bone 50, 209-217, doi:10.1016/j.bone.2011.10.025 (2012). 24 Nakashima, T. et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature medicine 17, 1231-1234, doi: 10.1 038/nm.2452; 10.1 038/nm.2452 (2011). 25 Xiong, J. et al. Matrix-embedded cells control osteoclast formation. Nature medicine 17, 1235-1241, doi:10.1038/nm.2448; 10.1038/nm.2448 (2011). 26 Ahdjoudj, S., Lasmoles, F., Holy, X., Zerath, E. & Marie, P. J. Transforming growth factor beta2 inhibits adipocyte differentiation induced by skeletal unloading in rat bone marrow stroma. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 17, 668-677, doi:10.1 359/jbmr.2002.17.4.668 (2002). 27 Trudel, G. et al. Bone marrow fat accumulation after 60 days of bed rest persisted 1 year after activities were resumed along with hemopoietic

124 stimulation: the Women International Space Simulation for Exploration study. Journal of applied physiology (Bethesda, Md.: 1985) 107, 540-548, doi:10.1152/japplphysiol.91530.2008; 10.1152/japplphysiol.91530.2008 (2009). 28 Takada, I., Kouzmenko, A. P. & Kato, S. Wnt and PPARgamma signaling in osteoblastogenesis and adipogenesis. Nature reviews. Rheumatology 5, 442-447, doi:10.1038/nrrheum.2009.137 (2009). 29 Park, J. R., Jung, J. W., Lee, Y. S. & Kang, K. S. The roles of Wnt antagonists Dkk1 and sFRP4 during adipogenesis of human adipose tissue-derived mesenchymal stem cells. Cell proliferation 41, 859-874, doi: 10.1111/j. 1365-2184.2008.00565.x (2008). 30 Ross, S. E. et al. Inhibition of adipogenesis by Wnt signaling. Science (New York, N.Y.) 289, 950-953 (2000). 31 Qiu, W. et al. Patients with high bone mass phenotype exhibit enhanced osteoblast differentiation and inhibition of adipogenesis of human mesenchymal stem cells. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 22, 1720-1731, doi:10.1359/jbmr.070721 (2007). 32 Cristancho, A. G. & Lazar, M. A. Forming functional fat: a growing understanding of adipocyte differentiation. Nature reviews.Molecular cell biology 12, 722-734, doi:10.1 038/nrm3198; 10.1 038/nrm3198 (2011).

125 126 Chapter 8

8 Sclerostin antibody inhibits skeletal deterioration in mice exposed to partial weight-bearing in mice

8.1 Rationale

The biological mechanism of osteocytes' mechanosensing remains elusive, particularly in the spectrum of clinically relevant reduced, but not full reduction in weight-bearing activities. Furthermore, future long duration spaceflights to terrestrial destinations, such as the Moon and Mars, will have astronauts spending considerable amounts of time in partial gravity environments. Currently, both the U.S. and Russian bioastronautics medical community consider the unknown risks of partial weigh bearing effects on the human body a top medical concern.

As we have shown, mice can be protected in the setting of full unloading with the sclerostin antibody treatment, but several bone parameters had an enhanced anabolic effects with SclAbli in normal mechanical loading (Chapter 7). To further investigate the response to sclerostin inhibition in the presence of partial mechanical unloading, we tested the ability of sclerostin antibody to inhibit skeletal deterioration during exposure to prolonged (21 -day) partial weight- bearing at 20%, 40%, and 70% of normal loading. We hypothesized that sclerostin antibody treatment would prevent bone loss across the spectrum of partial unloading and we would observe a load dependent effect of sclerostin antibody treatment. Consistent with our findings in hind limb unloading, we observed sclerostin antibody led to anabolic activity across the spectrum of partial unloading. In this chapter, we also compare the musculoskeletal responses of full loading to partial weight-bearing environments, and assessed whether the efficacy of anti-sclerostin antibody depends on the loading condition.

127 8.2 Key findings

While all partial weight-bearing groups had bone parameters well above the CON-VEH group, we observed a modest load dependent effect in our sclerostin antibody partial weight-bearing groups. At the dose used in our studies, these results suggest even small amounts of loading (i.e., PWB20, PWB40) provide enough mechanical loading stimuli to provide optimum benefit of sclerostin antibody inhibition.

8.3 Introduction

The profound effects of mechanical unloading on muscle atrophy and skeletal fragility are well established. However, there has been little investigation into the physiological effects of partial reduction of weight-bearing. To address this gap in knowledge, our group previously developed the partial weight-bearing (PWB) model' 2 that enables long-term exposure of mice to partial loading while maintaining quadrupedal locomotion. We have used this model to show that bone and muscle loss is linearly proportional to the reduction of mechanical loads 2 . In addition, we previously reported that in mice subjected to mechanical disuse via high limb unloading (HLU), treatment with sclerostin antibody not only inhibits bone loss, but leads to improved bone mass via increased bone formation (Chapter 7)3. Notably, for a few bone outcomes, we observed greater anabolic effects of sclerostin inhibition in the normally loaded mice (Chapter 7)3.

To further investigate the skeletal responses to sclerostin inhibition in a mechanical unloading environment, we tested the ability of sclerostin antibody to inhibit skeletal deterioration during exposure to partial weight-bearing at 20%, 40%, and 70% of normal loading. We hypothesize that treatment with sclerostin antibody would improve bone mass, microarchitecture and strength in all loading conditions, but that there would be a greater skeletal response in the normally loaded mice than in unloaded mice.

128 8.4 Material and methods

8.4.1 Overview of study design

We tested the ability of sclerostin antibody (SclAbIl) to prevent bone loss in adult female mice (C57BI/6J, 11 wks. of age) subjected to mechanical unloading for 21 days. Mice were assigned to one of four loading groups (n=8 to 17 / group): partial weight-bearing at 20% (PWB20), 40% (PWB40), 70% (PWB70) of normal weight-bearing, or control (CON, normal weight-bearing). Animals were assigned to groups by total body bone mineral density (BMD) and body mass in a manner to minimize differences between groups at baseline. Mice in each group were injected with either SclAbIl at 25 mg/kg or vehicle (VEH) twice weekly. All mice had access to standard rodent chow and water ad libitum. The protocol was approved by the Institutional Animal Care and Use Committee at Beth Israel Deaconess Medical Center.

8.4.2 Partial weight-bearing (PWB) model

For partial weight-bearing, we followed the methods described previously by Ellman et al.2 . In brief, two to three days prior to unloading, mice assigned to PWB groups were placed in the PWB jacket and singly housed in standard vivarium cages for acclimation. On day 0, mice were placed in a two-point full suspension rig, as described previously2 3 . A clasp on the jacket and a tail wrap were connected by a chain and spaced by a hollow metal rod to distribute loading. This apparatus was then joined to a spring and hung from a wheel with linear freedom along a rail across the top of a cage. Adjustments to actual weight-bearing, or effective mass, were made by threading the spring through its support thereby changing the length of spring engaged by the harness, and providing differential vertical force to support mouse's body weight. Effective mass was measured daily by quiet standing on a scale and the spring tension adjusted to maintain the desired amount of unloading.

129 8.4.3 Bone mineral density and muscle mass

In vivo assessment of total body (exclusive of the head region) and leg (femur and tibia exclusive of femoral neck and foot) bone mineral density (BMD, g/cm 2) was performed at baseline and end of the study using peripheral dual-energy X- ray absorptiometry (pDXA, PIXImusll, GE Lunar Corp.), as previously described2 . Muscle atrophy was assessed by wet weight of the soleus and gastrocnemius muscles at necropsy. Muscle mass was normalized to animal body weight.

8.4.4 Specimen harvesting and preparation

At the end of the study, mice were euthanized via C02 overdose. Femurs were harvested and cleaned of soft tissue. The right femur was prepared for imaging and biomechanical testing by wrapping in saline-soaked gauze and freezing at - 200C.

8.4.5 Serum markers of bone metabolism

Mice were fasted for 2 hours before blood was collected at the time of euthanasia and used to measure serum sclerostin (in vehicle treated mice only) and bone turnover markers. Osteocalcin was assessed using the species-specific single- plex Luminex assays (Millipore, Billerica, MA). Serum concentrations of TRACP5b, and type I collagen C-telopeptide (sCTX) were measured by using mouse ELISA kits (IDS, Fountain Hills, AZ). All assays were run according to the manufacturers' protocols.

8.4.6 Bone microarchitecture

Assessment of bone microarchitecture was performed with microcomputed tomography (pCT40, Scanco Medical, BrOttisellen, Switzerland) 2-4 . In brief, the distal femoral metaphysis were scanned using 70 KvP, 50 mAs, and 12-pm isotropic voxel size. The femoral metaphysis region began 240 pm distal to the growth plate and extended 1.8 mm distally. Cancellous bone was separated from

130 cortical bone with a semi-automated contouring program. For the cancellous bone region we assessed bone volume fraction (Tb.BV/TV, %), trabecular thickness (Tb.Th, mm), trabecular separation (Tb.Sp, mm), trabecular number (Tb.N, 1/mm), connectivity density (ConnD 1/mm 3), and structure model index (SMI). Transverse CT slices were also acquired at the femoral midshaft to assess total cross-sectional area, cortical bone area and medullary area (Tt.Ar, Ct.Ar and Me.Ar, mm 2 ); bone area fraction (Ct.BA/Tt.TA, %), cortical thickness (Ct.Th, mm), and polar (pMOI, mm 4 ) moment of inertia. Bone was segmented from soft tissue using the same threshold for all groups: 247 mg HA/cm 3 for trabecular and 672 mg HA/cm 3 for cortical bone. MicroCT scanning and analyses adhered to published guidelines4.

8.4.7 Mechanical testing

Femurs were mechanically tested at a constant displacement rate of 0.03 mm/sec to failure in three-point bending (Bose ElectroForce 3200 with a 150 N load cell, Bose Corporation, Eden Prairie, MN). Fresh-frozen femurs were thawed to room temperature then centered longitudinally, with anterior surface on the two lower support points spaced 10 mm apart2 3 . Force-displacement data were acquired at 30 Hz and used to determine maximum force (N) and stiffness (N/mm).

8.4.8 Statistical analysis

All data were checked for normality, and standard descriptive statistics computed. Overall treatment and loading effects were evaluated using analysis of variance (ANOVA) for all continuous variables. Fisher exact post-hoc testing were considered significant at p<0.05. Data are reported as mean SEM, unless noted.

131 8.5 Results

8.5.1 Body mass and muscle mass

PWB20-VEH, PWB40-VEH, PWB40-VEH, and PWB70-Sclabll groups had lower body mass (<5% declines) through the first two weeks of unloading and recovered to baseline at end of study. PWB70 and CON groups had minimal changes with unloading and both gained (<5% body mass) at the end of the study. Soleus wet weight (normalized to body weight) was 20%, 17%, and 6% lower in PWB20-VEH, PWB40-VEH, and PWB70-VEH, respectively, than CON- VEH (p<0.05) consistent with our prior observations in the PWB model that muscle loss is proportional to the degree of unloading 2. Gastrocnemius wet weight (normalized to body weight) was 12%, 11 %, and 6% lower in than lower in PW1B20-VEH, PWB40-VEH, and PWB70-VEH, respectively, than CON-VEH (p<0.05). There were no differences in muscle mass between VEH and SclAblI treated mice at any unloading level, demonstrating that the activity of sclerostin antibody is specific to bone (data not shown).

8.5.2 Bone mineral density

Partial weight-bearing caused significant bone loss, whereas sclerostin antibody treatment increased total body and leg BMD in all groups (Figure 8-1). Specifically, leg BMD declined -9.8 0.7%, -7.0 in 0.7%, and -4.9% 1.1% in PWB20-VEH, PWB40-VEH, and PWB70-VEH, respectively, whereas it increased 3.9 0.4% in CON-VEH (p<0.0001 vs baseline for all, and p<0.001 for all PWB groups vs CON). Leg BMD increased by 14 to 18% in all PWB groups treated with SclAblI (p<0.001 vs VEH for all). In comparison, leg BMD increased 30 3% in CON-SclAblI (p<0.001 vs VEH-treated animals). The effect of SclAblI treatment on BMD did not vary with the level of PWB and there was no difference between the response of any PWB group and fully-loaded controls to SclAbll (p = 0.22). The pattern was similar for total body BMD (Figure 8-1).

132 A B Hindlimb Total Body 40- 40- M VEH 30- 30- M SciAbli * * * n 20- 20- .u~n.,0 2 10- 10- .... flil C.) C 0- 0-

-10- -10-

-20-J PWB20 PWB40 PWB70 CON -20" PWB20 PWB40 PWB70 CON

Figure 8-1: Effect of partial weight-bearing and sclerostin antibody treatment on (A) hind limb BMD, (B) total body BMD. Changes in leg BMD were significantly different from baseline in all groups (p<0.001). * p < 0.05 for VEH vs SclAbIl within loading group; ** p<0.01 for CON-VEH vs all other VEH-treated groups. Error bars represent one SEM.

8.5.3 Bone volume and microarchitecture

Consistent with in vivo BMD measurements, partial weight-bearing led to significant bone deterioration, particularly in the trabecular compartment (Table 8-1). Treatment with SclAblI led to increased Tb.BV/TV, regardless of loading condition, such that trabecular bone volume of SclAbll-treated groups was 2.5 to 3-fold higher than that of VEH animals. SclAbll treated animals, both normally loaded and partially unloaded, had significantly higher trabecular bone volume (Figure 8-2A), thickness and number, along with lower trabecular separation and

A B * VEH M VEH * SciAbil C3 SciAbilI 40 40- 0

30

20

00 10- I- 0.

0 20 40 70 100 +, % Loaded

Figure 8-2: Effect of partial weight-bearing and sclerostin antibody treatment on (A) trabecular bone volume at the distal femur and (B) linear regression (solid line) shown with 95% confidence bands (dashed lines) across the loading groups for trabecular bone volume at the distal femur. * p<0.0001 for VEH vs. ScIAblI within a loading group, ** p<0.0001 for CON-VEH vs all other VEH-treated groups. Error bars represent one (A) SEM.

133 more plate-like architecture than vehicle-treated animals (Table 8-1). The improvement in trabecular microarchitecture with sclerostin antibody treatment was dose dependent with loading across the PWB groups (Figure 8-2B, r2 0.76, p = 0.1).

Cortical bone was also negatively affected by partial unloading, as PWB mice had lower cortical bone area, cortical bone area fraction, cortical thickness, and polar moment inertia than CON animals at the mid-femoral diaphysis (Table 8-1). Treatment with SclAblI led to improved cortical bone properties in all groups, such that cortical properties in unloaded animals were equal to or better than the normally loaded, vehicle-treated group.

134 Table 8-1: : Effect of PWB and SciAbII treatment on femoral trabecular and cortical bone microarchitecture, assessed by tCT (mean SEM . PWB20 PWB40 PWB70 Fully Loaded

Vehicle SclAbli Vehicle SclAbll Vehicle SclAbll Vehicle SclAbIl Site N=10 N =9 N 14 N = 8 N 10 N 8 N = 17 N = 11 Distal Femur Trabecular BV/TV (%) 7.3 0.5b 22.2 0.8ab 8.8 0.3 24.7 +1 .0 ab 9.6 0.6 24.8 0.4 a,b 10.3 0.4 32.0 1.5a Tb.N (mm-1) 3.59 0 .1b 3.95 0.05a,b 3.79 0.06b 4.08 + 0.06ab 3.78 0.1b 4.1 0.03ab 3.85 0.04 4.3 0.05a Tb.Th (mm) 0.048 0.001b 0.077 0.001a b 0.049 0.001 b 0.082 + 0.001ab 0.049 0.001b 0.078 + 0.001ab 0.054 0.001 0.097 0.002a 06 Tb.Sp (mm) 0.27 0.006b 0.22 0.004a,b 0.26 0.004 (p=0 ) 0.21 + 0.005a,b 0.26 0.007b 0.21 0.002ab 0.25 0.003 0.20 0.003a ConnD(mm- 3) 46 7b 104 5a 56 4 106 4a 71 8 113 1 69 3 107 3 SMI 3.2 0.1b 2.0 0.06a,b 3.0 0.02 1.9 0.07ab 2.9 0.05 1.8 0.03ab 3.0 0.06 1.4 0.12a Femur Midshaft Cortical Tt.CSA (mm 2) 1.54 0.02 1.62 0.01 b 1.50 0.03 1.58 0.03b 1.59 0.01 1.62 0.01 b 1.56 0.02 1.69 0.02a Ct.BA (mm 2) 0.54 0.01b 0.73 0.01ab 0.56 0.09b 0.75+ 0.01ab 0.57 0.01b 0.73 0.01 ab 0.66 0.01 0.86 0.02a Ct.MA (mm 2) 1.0 0.02b 0.89 0.01ab 0.95 0.02b 0.84 0.02a 1.0 0.01b 0.89 + 0.01ab 0.9 0.01 0.83 0.01a Ct.BA/TA (%) 35.0 0.4b 45.1 0.5ab 36.8 0.5b 47.1 0.3a,b 35.8 0.6b 45.0 0.2ab 42.7 0.5 50.8 0.4a TMD (mgHA/ccm) 1101 7b 1116 3b 1133 8b 1167 5a 1105 9b 1113 lb 1148 5 1175 3 pMOl (mm 4) 0.23 0.01b 0.31 0.01ab 0.23 0.01b 0.31 0.01 a,b 0.25 0.01b 0.31 0.01 ab 0.27 0.007 0.37 0.012 a: p<0.05 SclAbll vs. VEH within loading condition; : p<0.05 CON vs. PWB within treatment condition. Abbreviations: bone volume fraction (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), connectivity density (ConnD), structure model index (SMI), total cross-sectional area (Tt.CSA), cortical bone area (Ct.BA), medullary area (Ct.MA), cortical bone area fraction (Ct.BA/TA), cortical thickness (Ct.Th), polar moment of inertia (pMOI), tissue mineral density (TMD).

135 8.5.4 Femoral strength

VEH-treated PWB groups had on average 23% lower maximum force and 18% lower bending stiffness compared to normally loaded VEH-treated animals (Figure 8- 3). Mice treated with SclAbll had improved mechanical properties compared to VEH- treated groups in all loading conditions. Specifically, maximum bending force was 50% higher, bending stiffness was 40% higher, and work to failure was 30-50% higher (Figure 8-3C) in SclAbll treated mice than VEH in all-loading conditions. Estimated bending modulus (data not shown) and post-yield displacement (Figure 8- 3D) did not vary with unloading or sclerostin-antibody treatment.

A B 20- 100 M VEH z * * 3 SciAbIl

10- *

22 *

C DO

2 E E2 E 20 z E

00

Figure 8-3: Effect of partial weight-bearing and sclerostin antibody treatment on femoral strength as assessed by three-point bending, (A) maximum force and (B) bending stiffness, (C) work to failure, (D) post-yield displacement. * p<0.05 for VEH vs. SclAbll within a loading group, ** p<0.05 for CON-VEH vs all other VEH-treated groups. Error bars represent one SEM.

136 8.5.5 Bone turnover markers

Compared to normally loaded controls, PWB led to reduced sCTX, unchanged levels of TRACP5b, and decreased osteocalcin (Figure 8-4). Independent of loading, mice treated with SclAbll had increased bone formation, as evidenced by approximately 70% higher osteocalcin levels compared to VEH controls. SclAbll treated mice also exhibited unchanged or decreased bone resorption, with variable effects on sCTX and generally lower TRACP5b compared to VEH-treated groups. A B C

601 20- 300E

SclAbil T 1 C3 0-Il10-

Figure 8-4: Effect of unloading and sclerostin antibody treatment on serum markers of bone turnover: A) CTX1; B) TRACP5b; and C) Osteocalcin,. * p < 0.05 SclAbli vs VEH control within a loading condition. ** p<0.01 for CON-VEH vs all other VEH-treated groups. Error bars represent one SEM.

8.6 Discussion

The primary objective of this study was to determine the skeletal effects of pharmacologic inhibition of sclerostin in mice exposed to different levels of unloading via the partial weight-bearing model. We hypothesized that sclerostin antibody treatment would improve bone mass, microarchitecture and strength across the spectrum of partial unloading and that the anabolic effects of sclerostin antibody would vary with the degree of unloading. Consistent with our previous finding that sclerostin antibody improves bone outcomes in the hind limb unloading model3, we found here that sclerostin antibody significantly increased trabecular and cortical bone mass and improved bone microarchitecture and strength across a range of partial unloading. Although improvements in trabecular bone following sclerostin antibody treatment were greater with higher levels of weight-bearing, it should be noted that the current results, along with our prior study in hind limb unloaded mice

137 indicate a robust response to sclerostin antibody treatment, even in the absence of normal loading. Moreover, femoral bending strength and cortical bone responses to sclerostin antibody treatment did not vary with unloading condition. However, our finding that trabecular, but not cortical, bone improvements following sclerostin antibody treatment were enhanced with greater levels of partial weight-bearing should be considered in the context of the relatively high, and frequent dosing regimen (25 mg/kg, twice weekly) that was used in this study. Previous rodent studies have shown that both 5 and 25 mg/kg doses of sclerostin antibody produce similar increases in bone mass and strength at the femur5'6 , suggesting that maximal responses are already seen at the lower dose. Thus, future studies could further explore if lower doses of sclerostin antibody (< 5 mg/kg) and/or less frequent dosing regimens would enhance evaluation of possible load-dependent skeletal responses to sclerostin antibody. Ultimately, studies investigating sclerostin antibody in clinical situations of reduced mechanical loading, such as bed rest or spinal cord injury (SCI), will be needed to investigate the clinical utility of sclerostin antibody for preventing disuse-induced bone loss. For example, a recently completed rodent complete SCI model showed sclerostin antibody inhibition, at the same dosing reqimen we used, resulted only in maintenance of trabecular bone comparable to sham operated controls and no effect on cortical bone microarchitecture . In contrast, our partial weight-bearing results showed all partial weight groups to had both trabecular and cortical bone equal to or greater than those of CON, VEH- treated mice suggesting a synergistic response to SclAblI and partial loading.

Serum indices of bone turnover measured at the end of the study showed that partial weight-bearing was associated with a reduction in bone formation and resorption. In rodent models of disuse, bone formation markers have been previously reported as being suppressed8 . However bone resorption markers have a more complicated time-course, showing transient increases that preceded suppression of bone formation markers in rodents 8 . It may be useful to assess bone turnover indices at an earlier time point measurement to capture the initial changes in bone metabolism following unloading and sclerostin inhibition. Similar to prior studies 4' 59' , serum

138 markers of bone turnover indicated that treatment with sclerostin antibody increased bone formation and decreased or maintained bone resorption across all partial weight-bearing groups.

This study was limited only studying female mice at one time point, with a single dosing regimen for sclerostin inhibition. Furthermore, we did not conduct dynamic histomorphometry studies, which would further aid in defining the skeletal response to partial weight-bearing coupled with sclerostin antibody treatment. Nonetheless, this study provides novel information about the ability of sclerostin antibody to induce bone formation in the situation of reduced, but not full mechanical unloading. Consistent with our prior work demonstrating a robust skeletal response to sclerostin antibody in the hind limb unloading model 3 , here we showed that while even small amounts of loading (i.e., 20% of normal weight-bearing) enable the skeleton to achieve a profound improvement in bone structure in response to sclerostin inhibition, greater weight-bearing may lead to even greater benefits, particularly in the trabecular compartment. This observation suggests that patients with limited mobility and/or weight-bearing would have marked benefits from treatment with sclerostin antibody, even if their responses were attenuated relative to persons with normal skeletal loading.

8.7 Conclusion

Treatment with sclerostin antibody induces an anabolic skeletal response in a rodent model of partial weight-bearing, such that partially unloaded animals treated with sclerostin antibody had bone mineral density, microarchitecture, and mechanical strength values at or above the normally loaded control mice. These results provide strong rationale for testing the ability of sclerostin antibody treatment, in conjunction with even limited weight-bearing exercise, to improve skeletal fragility in patients with spinal cord injuries, stroke, muscular dystrophy, cerebral palsy, and other diseases and conditions associated with short-term or chronic musculoskeletal disuse.

139 1 Wagner, E. B. et al. Partial weight suspension: a novel murine model for investigating adaptation to reduced musculoskeletal loading. J Appl Physiol (1985) 109, 350-357, doi: 10.11 52/japplphysiol.0001 4.2009 (2010). 2 Ellman, R. et al. Partial reductions in mechanical loading yield proportional changes in bone density, bone architecture, and muscle mass. J Bone Miner Res 28, 875-885, doi:10.1 002/jbmr.1814 (2013). 3 Spatz, J. M. et al. Sclerostin antibody inhibits skeletal deterioration due to reduced mechanical loading. J Bone Miner Res 28, 865-874, doi:10.1002/jbmr.1807 (2013). 4 Bouxsein, M. L. et al. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J Bone Miner Res 25, 1468- 1486, doi:10.1002/jbmr.141 (2010). 5 Ominsky, M. S. et al. Two doses of sclerostin antibody in cynomolgus monkeys increases bone formation, bone mineral density, and bone strength. J Bone Miner Res 25, 948-959, doi:10.1002/jbmr.14 (2010). 6 Tian, X., Jee, W. S., Li, X., Paszty, C. & Ke, H. Z. Sclerostin antibody increases bone mass by stimulating bone formation and inhibiting bone resorption in a hindlimb-immobilization rat model. Bone 48, 197-201, doi:10.1016/j.bone.2010.09.009 (2011). 7 Beggs, L. A. et al. Sclerostin Inhibition Prevents Spinal Cord Injury-Induced Cancellous Bone Loss. J Bone Miner Res 30, 681-689, doi:10.1002/jbmr.2396 (2015). 8 Kurokouchi, K. et al. Changes in the markers of bone metabolism following skeletal unloading. Environmental medicine : annual report of the Research Institute of Environmental Medicine, Nagoya University 39, 21-24 (1995). 9 Li, X. et al. Inhibition of sclerostin by monoclonal antibody increases bone IIrm~atIUIn, bUIne masd, d bI tent in aged male ra ts. J Bone tviiner Res 25, 2647-2656, doi:10.1 002/jbmr. 182 (2010).

140 Chapter 9

9 Serum sclerostin increases in healthy adult men in bed rest

This thesis chapter, in part, previously published as the manuscript: Spatz, et al., Serum sclerostin increases in healthy adult men in bed rest, J Clinical Endocrinology Metab. 2012 Sep;97(9):E1736-40. doi: 10.1210/jc.2012-1579. Epub 2012 Jul 5.

141 9.1 Rationale

Animal models and human studies suggest that osteocytes regulate the skeleton's response to mechanical unloading in part by an increase in sclerostin. However, few studies have reported changes in serum sclerostin in humans exposed to reduced mechanical loading. We determined changes in serum sclerostin and bone turnover markers in healthy adult men undergoing controlled bed rest.

9.2 Introduction

Reduced mechanical loading of the skeleton is invariably associated with muscle atrophy and bone loss. Bone loss is observed clinically after prolonged bed rest, immobilization, stroke, and spinal cord injury- 6 . In addition, microgravity causes profound muscle atrophy and bone loss in astronauts 7. However, the precise mechanisms underlying disuse-induced and microgravity bone loss in humans are incompletely understood. Previous bed rest studies have reported that bone loss at weight-bearing skeletal sites is accompanied by decreased serum PTH, along with increased urinary calcium excretion and bone resorption markers with the mechanisms underlying these changes unknown.

Osteocytes play a key mechanosensing role, modulating bone modeling and remodeling by orchestrating the activity of osteoblasts and osteoclasts8 . Consistent with the negative effect of sclerostin on bone formation, transgenic mice overexpressing SOST are osteopenic9 , whereas SOST-null animals have high bone mass 0 , similar to the human conditions of van Buchem disease and sclerosteosis. Importantly, the SOST/sclerostin pathway has been implicated in the response of bone to mechanical loading in murine models because increased skeletal loading reduces SOST expression, whereas decreased mechanical loading increases it". Furthermore, SOST-null animals are resistant to disuse- induced bone loss 0 . An alternate mechanism by which osteocytes respond to altered mechanical loading is suggested by the observation that osteocytes are a

142 major source of the osteoclastogenic cytokine RANKL8 , and further, that mice lacking RANKL in osteocytes are protected from bone loss induced by hind limb unloading.

Despite evidence of several molecular mechanisms by which osteocytes may regulate the response to mechanical loading in animal models, little is known about how osteocytes orchestrate skeletal adaptation to mechanical unloading in humans. In a cross-sectional study, older women who had suffered a stroke 10 months beforehand had 3-fold higher serum sclerostin levels than age matched, fully ambulating controls (4), consistent with the notion that sclerostin levels increase in response to mechanical unloading. Yet, men with unloading due to chronic spinal cord injury (mean SD, 22.4 + 11.2 yr.) have lower sclerostin levels than ambulating control subjects6 . To address a gap in the literature with regard to the acute response to unloading, we evaluated the longitudinal changes in serum sclerostin levels in healthy men that participated in a 90-d, controlled bed rest study, with the hypothesis that acute unloading would lead to an increase in serum sclerostin.

9.3 Subjects and materials

9.3.1 Subjects

Seven healthy men were recruited by the National Aeronautics and Space Administration (NASA) Johnson Space Center (JSC) to participate in a 90-d bed rest experiment. Eligibility included physically fit men between the ages of 25 and 55 yr. who were not taking prescribed medication that would interfere with physiological measurements. Mean ( SD) age of the participants was 31 3 yr. (range, 28-36 yr.). Mean ( SD) height, weight, and body mass index of subjects were 183 6 cm, 88 12 kg, and 26 2.8 kg/m2, respectively. Mean dietary calcium and vitamin D intake were fixed at 1674 251 mg/d and 384 72 IU/d, respectively. Subjects were continuously monitored via remote controlled cameras and remained in 60 head down tilt for 90 d with controlled nutrition,

143 water intake, day-night cycles, ambient room temperature, and in-bed hygiene. Daily vital sign measurements were collected. Additional details regarding the University of Texas Medical Branch (UTMB)-NASA bed rest protocol can be found in prior publications1 -3 ,5 . The institutional review boards of both NASA JSC and UTMB approved the study protocol, and all subjects gave written informed consent.

9.3.2 Serum sclerostin and bone turnover markers

Serum (fasting, 0630 h collection) and urine samples were collected at two pre- bed rest time points (10 and 3 d before bed rest) and at bed rest d 28 (BR-28), bed rest d 60 (BR-60), and bed rest d 90 (BR-90). For all serum and urine markers, the results from the two pre-bed rest measurements were averaged to provide a baseline (BL) value for each subject. In addition, urinary collections were normalized to a 24-h time period at each time point. Serum sclerostin levels were assayed in duplicate using an ELISA kit (ALPCO/Biomedica, Salem, NH). All sclerostin samples were assayed with a single assay. The intra-assay variability as reported by the manufacturer is 5%. We also measured markers of bone metabolism, including serum PTH, 25 (OH) vitamin D, and 1,25 (OH) 2 vitamin D; serum markers of bone formation (bone-specific alkaline phosphatase (BSAP) and osteocalcin); serum markers of osteoclast activity, soluble RANKL, osteoprotegerin (OPG); urinary calcium and phosphorus excretion; and urinary markers of bone resorption, N-terminal telopeptide (NTX), deoxypridinoline (DPD), pyridinium crosslinks (PYD)], using previously reported methods 2 .

9.3.3 Bone mineral density

Areal BMD (grams per square centimeter) was measured by dual-energy x-ray absorptiometry (DXA Hologic Discovery; Hologic Inc., Bedford, MA). BMD of the whole body, lumbar spine, averaged left and right hips, heel, and forearm was assessed at BL and repeated at BR-60 and 5 d after the end of the bed rest period (BR + 5). One subject was lost to follow-up at BR + 5. BMD

144 measurements for each subject reported are the mean of triplicate scans.

9.3.4 Statistical analysis

All data are summarized by mean SD unless otherwise specified. All data were analyzed with repeated-measures ANOVA. Analyses were performed with SAS 9.2 (SAS Institute Inc., Cary, NC) using the proc mixed procedure with an autoregressive covariance structure. Given the small sample size, a two-sided a of 0.10 for the overall ANOVA model was accepted as significant to proceed to pre-specified pairwise comparisons of specific time points vs. BL (BL vs. BR-28, BR-60, and BR-90), for which two-sided of a = 0.05 was considered significant.

9.4 Results

9.4.1 Serum sclerostin and PTH

Serum sclerostin increased after bed rest in all subjects (Fig. 9-1A). Specifically, serum sclerostin levels increased above BL at BR-28 (+29 20%; p = 0.003) and appeared to plateau in most subjects at BR-60 (+42 31%; p < 0.001). Sclerostin levels remained mildly elevated at BR-90, although this result did not reach statistical significance (+22 21%; p = 0.07). In contrast, serum PTH levels declined at BR-28 (-17 16%; p = 0.02) and BR-60 (-24 14%; p = 0.03), remained reduced at BR-90 (-21 21%; p = 0.14), but did not reach statistical significance.

145 A B ,o- Sclerostin M BR-60 -0-. PT H 7r 2 3 BR-90 02 O 0. -2

CHC:I

_20 T

BL BR-28 BR-60 BR-90 , *4* .

Figure 9-1: A, Effect of bed rest on serum sclerostin and PTH. B, BMD (mean SD). * p < 0.05; **, p < 0.005; ***, p < 0.0001, indicating significant change from BL.

9.4.2 Bone mineral density

Subjects had normal BMD because BL Z-scores at the distal radius, lumbar spine, total hip, and femoral neck were 0.2 0.7, -0.6 1.0, 0.2 1.0, and 0.0 1.3, respectively. BMD declined significantly at BR-60 and BR+5 at all weight- bearing skeletal sites, including the lumbar spine, hip, femoral neck, and calcaneus (Fig. 9-1 B; p < 0.05 for all). There was no change in forearm BMD.

9.4.3 Serum and urinary markers of bone turnover

As summarized in Table 9-1, urinary levels of bone resorption markers (NTX, DPD, PYD) increased significantly compared with BL at all-time points. Urinary calcium excretion was also significantly increased throughout the study, whereas urinary phosphorus levels were elevated at BR-28 and BR-60 (p < 0.005 for both), with a return to BL at BR-90. Serum bone formation markers (serum BSAP, osteocalcin), serum RANKL, OPG, and the RANKL/OPG ratio did not change. 25 (OH) vitamin D was above BL at all-time points (p < 0.005), whereas

1,25 (OH) 2 vitamin D was significantly lower than BL at BR-28 (-13%; p < 0.05) and tended also to be lower at BR-60 (p = 0.06) and BR-90 (p = 0.07).

146 Table 9-1: Serum and urinary measurements of bone turnover makers, urinary calcium and phosphorous at baseline (BL), BR-28, BR-60, and BR-90 (mean SD).

BL BR-28 BR-60 BR-90 Serum Sclerostin (pmol/l) 35.4 7 45.3 9.4** 48.8 4.8** 42.1 4.7 PTH (pg/ml) 31.5 12 25.5 10.5* 24 10.9* 25.6 13.6 25 (OH) Vitamin D (ng/ml) 13 3 17 3** 19 2*** 18 3***

1,25 (OH) 2 Vitamin D (pg/ml) 38 5 34 7* 34 9 33 7 BSAP (U/L) 27 6 29 5 30 5 32 3 Osteocalcin (ng/ml) 13 3 13 2 14 3 13 4 Soluble RANKL (pmol/1) 0.3 0.2 0.3 0.3 0.3 0.2 0.3 0.3 OPG (pmol/1) 2.5 0.9 2.4 1 2.2 1 2.2 1 RANKL/OPG (pmol/I) 0.12 0.12 0.13 0.11 0.14 0.13 0.18 0.18 24-Hour Pooled Urine NTX (nmol) 482 127 795 182*** 735 153** 796 165*

DPD (nmol) 67 16 108 22*** 112 25*** 116 26*** PYD (nmol) 221 63 367 119 ** 380 145** 409 171** Calcium (mmol/day) 5.9 1.3 7.9 0.6*** 7.4 1.1* 7.5 1.2* Phosphorus (mg/day) 849 117 1039 200 ** 1074 160** 946 136

*p < 0.05, ** p < 0.005, *** p<0.0001 compared to BL. Assay manufacturers were: sclerostin, soluble RANKL, and OPG-ALPCO/Biomedica, Salem, NH; PTH-Scantibodies, Santee, CA; 25 (OH) vitamin D and 1,25 (OH)2 vitamin D-DiaSorin, Stillwater, MN; BSAP, DPD, and PYD- Quidel, San Diego, CA; osteocalcin-Biomedical Technologies, Stoughton, MA; NTX and phosphorus-Alere North American, Waltham, MA; and calcium-Atomic Absorption, Perkins Elmer Flame; PerkinElmer Inc., Waltham, MA.

9.5 Discussion

We found that in healthy men exposed to bed rest, serum sclerostin levels increased significantly by as early as 1 month and remained elevated for another month. Consistent with prior bed rest studies 3, serum PTH declined, urinary calcium and bone resorption markers increased, and BMD decreased at weight- bearing sites. There were no detectable changes in serum markers of bone formation.

Our observation of increased serum sclerostin after bed rest is consistent with previous reports of elevated sclerostin levels in animal and human models of disuse4 11 . A prior cross-sectional study reported that 10 months after suffering a

147 stroke, postmenopausal women (mean age = 80 yr.) had 3-fold higher serum sclerostin levels than age-matched healthy controls 4. In comparison, in the current longitudinal study (subject mean age = 36), the maximum increase in serum sclerostin levels was +42% vs. BL at BR-60. Several differences between these two studies may have contributed to the different magnitudes of sclerostin increases after disuse, including: 1) we assessed the longitudinal response to acute mechanical unloading, whereas the study of stroke patients was a cross- sectional study of long-term disuse; 2) we enrolled healthy young men, whereas the stroke study examined elderly postmenopausal women; and 3) we studied strictly controlled bed rest, whereas activity levels of the stroke patients were more variable. Our data also differ from a previous cross-sectional study in middle-aged men with chronic spinal cord injury, in whom sclerostin levels were lower than normally ambulating age-matched controls (6). However, the increase in serum sclerostin that we observed supports a conceptual model where serum sclerostin rises acutely and then is suppressed in the chronic bone wasting phase. Clearly, additional human studies are needed to better define the time course of changes in serum sclerostin in response to disuse, to address whether there is a neuroloqical component to its regulation, and to test the efficacy of sclerostin antibody treatment in the setting of acute-onset, disuse-induced bone loss.

Decreased levels of serum PTH accompanied the increases in serum sclerostin after bed rest, presumably driven by a transient increase of serum calcium levels by bone resorption and a measured increase in urinary calcium. In animal models, PTH decreases sclerostin expression via activation of the PTH receptor expressed on osteocytes13 . Furthermore, there is an inverse correlation between PTH and sclerostin in male hypothyroid subjects1 4, and PTH infusion in healthy men induces a decline in serum sclerostin levels 15. However, in these studies, we cannot determine whether the reduction in PTH levels is driving the observed increase in sclerostin or whether sclerostin increases in disuse due to non-PTH- mediated mechanisms. To answer this question, future bed rest studies could

148 employ more frequent measures of serum calcium, sclerostin, and PTH to more precisely define the time course of changes in each. Also, blocking the increase in serum calcium, perhaps by administration of an antiresorptive agent, might prevent the decrease in serum PTH and allow one to determine whether the increased sclerostin in bed rest is independent of serum PTH. Finally, we have conducted in-vitro unloading experiments in isolated osteocytes (Chapter 5) to determine if osteocytes inherently can sense simulated microgravity in the absence of PTH to give rise to an increase in SOST and Sclerostin to directly de- couple the confounding effects of PTH and mechanical unloading in in-vivo experiments.

9.6 Conclusion

In conclusion, serum sclerostin levels increased significantly in healthy young men exposed to 90 d of head down tilt bed rest16 . Bed rest was also associated with a decrease in serum PTH, an increase in bone resorption markers, and a decrease in BMD at weight-bearing sites. These are the first data to show the acute, longitudinal changes in serum sclerostin in response to bed rest. Given the key role that sclerostin plays in mediating bone metabolism and formation, additional studies exploring the regulation of sclerostin in disuse are warranted, particularly given the emergence of anti-sclerostin pharmacological therapies.

149 1 Zwart, S. R. et al. Effects of 21 days of bed rest, with or without artificial gravity, on nutritional status of humans. J Appi Physiol 107, 54-62, doi:91136.2008 [pii] 10.11 52/japplphysiol.91136.2008 (2009). 2 Zwart, S. R. et al. Nutritional status assessment before, during, and after long-duration head-down bed rest. Aviat Space Environ Med 80, Al 5-22 (2009). 3 Inniss, A. M., Rice, B. L. & Smith, S. M. Dietary support of long-duration head-down bed rest. Aviat Space Environ Med 80, A9-14 (2009). 4 Gaudio, A. et al. Increased sclerostin serum levels associated with bone formation and resorption markers in patients with immobilization-induced bone loss. J Clin Endocrinol Metab 95, 2248-2253, doi:jc.2010-0067 [pii] 10.1210/jc.2010-0067 (2010). 5 Spector, E. R., Smith, S. M. & Sibonga, J. D. Skeletal effects of long- duration head-down bed rest. Aviat Space Environ Med 80, A23-28 (2009). 6 Morse, L. R. et al. Association between sclerostin and bone density in chronic spinal cord injury. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 27, 352-359, doi:10.1 002/jbmr.546 (2012). 7 LeBlanc, A. D., Spector, E. R., Evans, H. J. & Sibonga, J. D. Skeletal responses to space flight and the bed rest analog: a review. J Musculoskelet Neuronal Interact 7, 33-47 (2007). 8 Nakashima, T. et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nature medicine 17, 1231-1234, doi:10.1038/nm.2452; 10.1038/nm.2452 (2011). 9 Winkler, D. G. et al. Osteocyte control of bone formation via sclerostin, a M~ ~~ 11 A-AA ~0 I ^^ ^r 17 ^- novel BMP aIantagonist. IVIU J , 0207-f27, doi:10.1 093/emboj/cdg599 (2003). 10 Lin, C. et a. Sclerostin Mediates Bone Response to Mechanical Unloading via Antagonizing Wnt/beta-Catenin Signaling. J Bone Miner Res 24, 1651- 1661 (2009). 11 Robling, A. G., Bellido, T. & Turner, C. H. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J Musculoskelet Neuronal Interact 6, 354 (2006). 12 Xiong, J. et al. Matrix-embedded cells control osteoclast formation. Nat Med 17, 1235-1241, doi:10.1038/nm.2448 (2011). 13 O'Brien, C. A. et al. Control of bone mass and remodeling by PTH receptor signaling in osteocytes. PLoS One 3, e2942, doi: 10.1371/journal.pone.0002942 (2008). 14 Costa, A. G. et al. Circulating sclerostin in disorders of parathyroid gland function. The Journal of clinical endocrinology and metabolism 96, 3804- 3810, doi:10.1210/jc.2011-0566 (2011). 15 Yu, E. W., Kumbhani, R., Siwila-Sackman, E. & Leder, B. Z. Acute Decline in Serum Sclerostin in Response to PTH Infusion in Healthy Men. J Clin Endocrinol Metab, doi:jc.2011-1534 [pii] 10.121 0/jc.2011-1534 (2011).

150 16 Spatz, J. M. et al. Serum sclerostin increases in healthy adult men during bed rest. The Journal of clinical endocrinology and metabolism 97, El 736- 1740, doi:10.1210/jc.2012-1579; 10.1210/jc.2012-1579 (2012).

151 152 Chapter 10

10 Summary and conclusions 10.1 Summary of hypotheses

As outlined in section 1.2, these investigations were designed to explore four primary hypotheses.

Hypothesis 1: Conditionallyimmortalized osteocytic cell lines, derived from long bones, can be established that express markers of mature osteocytes and follow the hormonal responses of in-vivo osteocytes.

As described in Chapter 4, a novel osteocytic cell line (Ocy454) was developed and validated as a new in-vitro tool to study osteocyte biology. The significant advancement for the field of bone biology is that Ocy454 can be cultured without differentiation factors and that Ocy454 exhibits robust expression of markers of mature osteocytes within two-weeks.

Hypothesis 2: Osteocytic cells directly sense mechanical unloading to increase SOST and sclerostin in simulated microgravity.

We showed that exposure of an osteocytic cell line (Ocy454) to simulated microgravity results in increased expression of both inhibitors of bone formation (e.g., SOST/sclerostin), and stimulators of bone resorption, notably RANKL and the RANKL/OPG ratio. In addition, the response to a mechanical loading stimulus, achieved by subjecting Ocy454 to fluid shear stress, does not in itself account for the observed gene regulation seen in simulated microgravity.

Hypothesis 3: Pharmacologic inhibition of sclerostin prevents bone loss and induces bone formation in adult mice subjected to hind limb unloading, and partial weight bearing.

153 This hypothesis was confirmed by showing that adult mice exposed to both full unloading (Chapter 7) and partial weight bearing (Chapter 9) and treated with sclerostin antibody had BMD, microarchitecture, and mechanical strength values at or above the normally loaded control mice. Moreover, in the hind limb unloading study we confirmed that inhibition increased bone formation by quantitative histomorphometry. Interestingly, we observed that although robust in all conditions, the skeletal response to sclerostin antibody tended to be better in normally-loaded compared to unloaded mice suggesting that limited weight- bearing exercise may improve the skeletal response to sclerostin inhibition in patients with spinal cord injuries, stroke, muscular dystrophy, cerebral palsy, and other diseases and conditions associated with short-term or chronic musculoskeletal disuse.

Hypothesis 4: The osteocyte secreted protein sclerostin, is elevated in healthy adult men subjected to 90 days of controlledbed rest.

The hypothesis that sclerostin may play an important role in the human response to disuse-induced bone loss is supported by our observation that serum sclerostin levels increased significantly in healthy young men exposed to 90 days of head down tilt bed rest.

10.2 Future work

The development of a novel osteocyte cell line (Ocy454) that is easy-to-use and re-capitalizes key aspects of in-vivo osteocytes provide a useful tool for studies of bone biology and endocrine research community. Already, collaborators have utilized the latest advances in biotechnology, such as Crispr/Cas9 and shRNA, in Ocy454 to modify the genome of osteocytes, knockdown, knockout, or overexpress genes of interest thereby facilitating diverse studies of the roles of osteocytes that would have otherwise been difficult prior to the invention of the Ocy454 cell line. Furthermore, the Ocy454 cell line is heterogeneous cell line representative of different stages of osteocyte maturation enabling future

154 researchers to single cell clone Ocy454 to meet particular experimental needs as the understanding of osteocyte biology evolves.

With the successful completion of the ISS OSTEO-4 mission, the Ocy454 cell line was the first osteocyte culture to be flown in microgravity. Future work will compare whole genome expression changes observed in the ISS flight study to those occurring in the ground-based simulated microgravity models. The long term goal is identify novel targets of the osteocyte proteome that are regulated by mechanical unloading to determine how osteocytes integrate the mechanical unloading stimuli in hopes of providing additional therapeutic targets for disuse- and microgravity-induced bone loss and other conditions of skeletal fragility, most notably osteoporosis.

Sclerostin antibody remains a promising anabolic therapy for a wide variety of bone disorders. While we have clearly demonstrated its potential in pre-clinical models of disuse- and microgravity-induced bone loss, there remains an important next step and need to demonstrate its effectiveness in well-controlled human studies of disuse-induced bone loss (e.g. bed rest) and, eventually, in long duration spaceflight experiments.

10.3 Conclusions

In summary, we have shown both with in-vitro and in-vivo experiments that osteocytes play an important role in bone's remarkable adaption to mechanical unloading. Most notably, the development of a novel, easy to use, mature osteocytic cell line is a particularly unique contribution of this thesis. In addition, the confirmation of elevated serum sclerostin levels in human bed rest studies and the protection of sclerostin antibody treatment in disuse-induced bone loss highlight emerging opportunities to modulate osteocytes and their secretome to cure a multitude of human bone diseases.

155