DOCSLIB.ORG

Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Protein Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Protein Hong Qian, Katarina Le Blanc and Mikael Sigvardsson Linköping University Post Print N.B.: When citing this work, cite the original article. Original Publication: Hong Qian, Katarina Le Blanc and Mikael Sigvardsson, Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Protein, 2012, Journal of Biological Chemistry, (287), 31, 25795-25807. http://dx.doi.org/10.1074/jbc.M112.339622 Copyright: American Society for Biochemistry and Molecular Biology http://www.asbmb.org/ Postprint available at: Linköping University Electronic Press http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-80787 Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Hong Qian1,2*, Katarina Le Blanc2, Mikael Sigvardsson1 1Department of Clinical and Experimental Medicine, Linköping University, SE-58185 Linköping, Sweden. 2Center for Hematology and Regenerative Medicine, Department of Medicine, Karolinska University Hospital Huddinge, S-141 86, Stockholm, Sweden. Running title: Native mesenchymal stem cells do not express CD44 *To whom correspondence should be addressed: Hong Qian, HERM, Novum Floor 4, Karolinska University Hospital Huddinge, Hälsovagen 7, S-141 86, Stockholm, Sweden. E-mail: [email protected], Tel: +46-8-58583623, Fax: +46- 8-585 836 05. Key words: Mesenchymal stem cells, CD44, microarray, Bone Marrow, Flow cytometry. Background: Natural phenotype of mesenchymal stem cells (MSCs) has not been well- characterized. Results: MSCs from bone marrow naturally are CD44-, however, in vitro cultivation results in acquisition of CD44 expression on the cells. Conclusion: Native MSCs in bone marrow lack CD44 expression. Significance: Our findings highlight natural phenotype of MSCs and open new possibilities for prospective isolation of MSCs from bone marrow. 1 SUMMARY the information has been obtained from in vitro studies on culture-expanded cells, which Despite significant progress in our may not represent the phenotype of MSCs in understanding of mesenchymal stem cell vivo (2-5). Multi-color fluorescence activated (MSC) biology during the last years, much of cell sorting (FACS) have been fundamental for the information is based on experiments using definition and prospective isolation of in vitro culture-selected stromal progenitor different cell populations of the hematopoietic cells. Therefore, the natural cellular identity of system over the last 20 years. Recent MSCs remains poorly defined. Numerous development of FACS-based protocols for the studies have reported that CD44 expression is isolation and characterization of MSCs one of the characteristics of MSCs in both directly from BM opens the possibility to human and mice, however, we here have better identify and characterize non- prospectively isolated bone marrow stromal hematopoietic cell compartments in the BM. cell subsets from both human and mouse bone In mice, platelet derived growth factor marrow by flow cytometry and characterized receptor α (PDGFRα), stem cell antigen-1 them by gene expression analysis and function (SCA1), CD51 and Nestin are expressed on assays. Our data provide functional and freshly isolated BM stromal cell populations molecular evidence suggesting that primary enriched with MSCs (6-8). In human, several mesenchymal stem and progenitor cells of - surface proteins including Stro-1, CD271 and bone marrow reside in the CD44 cell fraction CD146 may be used as markers for in both mice and humans. The finding that - mesenchymal stem and progenitor cells (9-14). these CD44 cells acquire CD44 expression In addition, expression of markers such as after in vitro culture provides an explanation to CD105, CD90 and CD49A have been the previous misconceptions concerning CD44 diversely reported to be characteristic of expression on MSCs. In addition, the other MSCs (15). Among those, CD44 has been previous reported MSC markers including reported to be highly expressed on in vitro CD73, CD146, CD271, CD106/VCAM1 are expanded MSCs from both humans and mice also differentially expressed on those two cell (16-22). CD44 is an adhesion molecule types. Our microarray data revealed distinct - existing in different isoforms that interact with gene expression profile of the freshly CD44 multiple ligands such as hyaluronan, selectins, cells and the cultured MSCs generated from collagen and fibronectin (23). It is widely these cells. Thus, we conclude that bone expressed in multiple cell types including marrow MSCs physiologically lack expression hematopoietic cells, cancer stem cells (24). of CD44, highlighting the natural phenotype of MSCs and open new possibilities to In the present study, by using multi- prospectively isolate MSCs from the bone color FACS, microarray analysis and CFU-F marrow. assay, we have found that while freshly isolated MSCs from human and mouse BM express the surface markers previously INTRODUCTION reported to mark early mesenchymal Mesenchymal stem cells (MSCs) was progenitors, they lack expression of CD44. originally isolated from bone marrow (BM) by Further characterization of the cells revealed their capacity to generate colony-forming unit- that the CD44+ cells displayed little or no fibroblast (CFU-F) in vitro (1). Although there CFU-F activity whereas the CD44- cells has been significant progress in understanding contain almost all the clonogenic cells with of the biological features of MSCs, much of multilineage differentiation potentials. 2 However, in vitro culture of the CD44- MSCs excluded by propidium iodide (PI) staining. and progenitor cells resulted in their The cells were analyzed and sorted on conversion to a CD44 positive phenotype, FACSAria II Sorp (BD). providing an explanation to the previous observations suggesting CD44 as a marker for FACS isolation and analysis of mouse MSCs. MSCs. Furthermore, the cultured MSCs The BM mononuclear cells from femurs, tibias derived from the fresh CD44- stromal cells and iliac crest of FVB/N mice were isolated display distinct gene expression profiles of cell using a standard protocol which was tested in adhesion molecules and growth factors as well our laboratory without affecting cell surface as cytokines. These findings highlight the marker expression. The bones were first importance of in vivo/ex vivo analysis of crushed in PBS+10%FBS (PAA) in order to mesenchymal cells for identifying their obtain maximal cells in BM endosteal region physiological properties and suggest that prior to enzyme treatment. The marrow cells CD44 expression can be used as a negative were collected and the bone fragments were rather than a positive marker for prospective then treated with 0.1% Collagenase II (CLS II isolation of MSCs from BM. Worthin gton Biochemical) and 0.05% trypsin-EDTA for 45 min at 37°C. The tubes EXPERIMENTAL PROCEDURES were shaken every 10min during incubation. Subject: BM aspirates were obtained from The treatment was stopped by adding ice cold iliac crest of normal young adult volunteers FBS to reach a final concentration of 20% following informed consent according to the FBS, subsequently wash the bones by procedures approved by local ethics committee PBS+10% FBS. The cells were collected and at Karolinska Institute (Stockholm, Sweden). filtered via 70 µm cell strainer (BD). The bone Mouse bones were obtained from adult (3-4 and marrow cells were pooled and spun down month old) normal FVB/N mice. Animal at 300g for 10 min and then resuspended in procedures were performed with approval PBS+10% FBS. The stromal cells were first from the ethics committee at Linköping enriched by depleting hematopoietic cells University (Linköping, Sweden). using purified rat anti-mouse antibodies against CD45 and LIN (TER119, B220, CD4, FACS isolation and analysis of human BM CD8, GR1 and MAC1) and subsequently MSCs. Mononuclear cells from BM aspirates using sheep anti-rat Dynal beads (Invitrogen). of healthy adult volunteers were isolated by The endothelial cells and the residual Ficoll-Hypaque (Lymphoprep, Axis-Shield hematopoietic cells were visualized by CD31 PoC AS) density centrifugation. The CD45- - and goat-anti-rat tricolor antibody and/or CD235 cells were enriched by negative CD45 and TER119. The dead cells were selection using CD45 and CD235 microbeads excluded by PI staining. The CD44+ and and magnetic-activated cell sorting (MACS, CD44- stromal cells were gated or analyzed Miltenyi Biotec). The cells were then stained based on fluorescent minus one (FMO) with anti-human CD271 CD146, CD105, controls for CD44 expression on FACS aria II CD106, CD73, STRO-1, CD29, CD45 and Sorp (BD). For information about the Glycophorin A/CD235. Anti-human CD19 antibodies used in the study, see Supplemental was included in the staining in order to information. exclude possible contamination of B cells in the sorted stromal cells. For information about the antibodies used in the study, see CFU-F assay. The stromal cells (CD45-LIN- supplemental information. Dead cells were CD31-CD44+ and CD45-LIN- CD31-CD44-) 3 from normal mouse and human BM were Assays-on-Demand probes, see below list of sorted and plated into 96-well plates or 12- probes used for Q-PCR. well plates containing complete Mesencult medium in MesenCult® Proliferation Kit for Cell Cycle Analysis. The analysis was mouse (#05511) and human (#05411), performed as described(25). BM mononuclear respectively (Stem cell Technologies, cells from wild-type FVB/N mice were Vancouver, Canada) in hypoxic (1% O2) for initially stained with antibodies against CD45, 10-12 days (mouse) or 12-14 days (human). lineage cells and CD44. After incubation with The mouse cells were seeded at a density of the cell surface antibodies, the cells underwent 10, 40, 100 and 200 cells/well for the CD44- fixation with a Cytofix/Cytoperm kit (BD cells and 100, 200, 400, 1000 and 2000 Biosciences) and staining of PE-anti-KI67 and cells/well and the human cells were plated at DAPI. Analysis was performed on a FACS 2, 5, 10 cells/well for the CD44- cells and 10, ARIA II SORP (BD Biosciences). 50, 100 and 1000 cells/well for the CD44+ cells.
Load more

Recommended publications
  • Role of Cyclosporine in Gingival Hyperplasia: an in Vitro Study on Gingival Fibroblasts
    International Journal of Molecular Sciences Article Role of Cyclosporine in Gingival Hyperplasia: An In Vitro Study on Gingival Fibroblasts 1, , 2, 3 3 Dorina Lauritano * y , Annalisa Palmieri y, Alberta Lucchese , Dario Di Stasio , Giulia Moreo 1 and Francesco Carinci 4 1 Department of Medicine and Surgery, Centre of Neuroscience of Milan, University of Milano-Bicocca, 20126 Milan, Italy; [email protected] 2 Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, via Belmoro 8, 40126 Bologna, Italy; [email protected] 3 Multidisciplinary Department of Medical and Dental Specialties, University of Campania-Luigi Vanvitelli, 80138 Naples, Italy; [email protected] (A.L.); [email protected] (D.D.S.) 4 Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 44121 Ferrara, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-335-679-0163 These authors contributed equally to this work. y Received: 25 November 2019; Accepted: 13 January 2020; Published: 16 January 2020 Abstract: Background: Gingival hyperplasia could occur after the administration of cyclosporine A. Up to 90% of the patients submitted to immunosuppressant drugs have been reported to suffer from this side effect. The role of fibroblasts in gingival hyperplasia has been widely discussed by literature, showing contrasting results. In order to demonstrate the effect of cyclosporine A on the extracellular matrix component of fibroblasts, we investigated the gene expression profile of human fibroblasts after cyclosporine A administration. Materials and methods: Primary gingival fibroblasts were stimulated with 1000 ng/mL cyclosporine A solution for 16 h. Gene expression levels of 57 genes belonging to the “Extracellular Matrix and Adhesion Molecules” pathway were analyzed using real-time PCR in treated cells, compared to untreated cells used as control.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Epithelial-Specific Knockout of the Rac1 Gene Leads to Enamel Defects
    Eur J Oral Sci 2011; 119 (Suppl. 1): 168–176 Ó 2011 Eur J Oral Sci DOI: 10.1111/j.1600-0722.2011.00904.x European Journal of Printed in Singapore. All rights reserved Oral Sciences Zhan Huang1, Jieun Kim2, Rodrigo Epithelial-specific knockout of the Rac1 S. Lacruz1, Pablo Bringas Jr1, Michael Glogauer3, Timothy G. gene leads to enamel defects Bromage4, Vesa M. Kaartinen2, Malcolm L. Snead1 1The Center for Craniofacial Molecular Biology, Huang Z, Kim J, Lacruz RS, Bringas P Jr, Glogauer M, Bromage TG, Kaartinen VM, Herman Ostrow School of Dentistry, University of Southern California, Los Angeles, CA, USA; Snead ML. Epithelial-specific knockout of the Rac1 gene leads to enamel defects. 2 Eur J Oral Sci 2011; 119 (Suppl. 1): 168–176. Ó 2011 Eur J Oral Sci Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, MI, USA; 3Matrix The Ras-related C3 botulinum toxin substrate 1 (Rac1) gene encodes a 21-kDa GTP- Dynamics Group, Faculty of Dentistry, binding protein belonging to the RAS superfamily. RAS members play important University of Toronto, Toronto, Ontario, roles in controlling focal adhesion complex formation and cytoskeleton contraction, Canada; 4New York University College of activities with consequences for cell growth, adhesion, migration, and differentiation. Dentistry, New York, NY, USA To examine the role(s) played by RAC1 protein in cell–matrix interactions and enamel matrix biomineralization, we used the Cre/loxP binary recombination system to characterize the expression of enamel matrix proteins and enamel formation in Rac1 knockout mice (Rac1)/)). Mating between mice bearing the floxed Rac1 allele and mice bearing a cytokeratin 14-Cre transgene generated mice in which Rac1 was absent Zhan Huang, The Center for Craniofacial from epithelial organs.
    [Show full text]
  • Newly Developed Serine Protease Inhibitors Decrease Visceral Hypersensitivity in a Post-Inflammatory Rat Model for Irritable Bowel Syndrome
    This item is the archived peer-reviewed author-version of: Newly developed serine protease inhibitors decrease visceral hypersensitivity in a post-inflammatory rat model for irritable bowel syndrome Reference: Ceuleers Hannah, Hanning Nikita, Heirbaut Leen, Van Remoortel Samuel, Joossens Jurgen, van der Veken Pieter, Francque Sven, De Bruyn Michelle, Lambeir Anne-Marie, de Man Joris, ....- New ly developed serine protease inhibitors decrease visceral hypersensitivity in a post-inflammatory rat model for irritable bow el syndrome British journal of pharmacology - ISSN 0007-1188 - 175:17(2018), p. 3516-3533 Full text (Publisher's DOI): https://doi.org/10.1111/BPH.14396 To cite this reference: https://hdl.handle.net/10067/1530780151162165141 Institutional repository IRUA NEWLY DEVELOPED SERINE PROTEASE INHIBITORS DECREASE VISCERAL HYPERSENSITIVITY IN A POST-INFLAMMATORY RAT MODEL FOR IRRITABLE BOWEL SYNDROME. Running title: Serine proteases in visceral hypersensitivity Hannah Ceuleers, Nikita Hanning, Jelena Heirbaut, Samuel Van Remoortel, Michelle De bruyn, Jurgen Joossens, Pieter van der Veken, Anne-Marie Lambeir, Sven M Francque, Joris G De Man, Jean-Pierre Timmermans, Koen Augustyns, Ingrid De Meester, Benedicte Y De Winter Hannah Ceuleers, Nikita Hanning, Jelena Heirbaut, Sven Francque, Joris G De Man, Benedicte Y De Winter, Laboratory of Experimental Medicine and Pediatrics, Division of Gastroenterology, University of Antwerp, Antwerp, Belgium. Samuel Van Remoortel, Jean-Pierre Timmermans, Laboratory of Cell Biology and Histology, University of Antwerp, Antwerp, Belgium. Jurgen Joossens, Pieter van der Veken, Koen Augustyns, Laboratory of Medicinal Chemistry, University of Antwerp, Antwerp, Belgium. Sven Francque, Antwerp University Hospital, Antwerp, Belgium. Michelle De bruyn, Anne-Marie Lambeir, Ingrid De Meester, Laboratory of Medical Biochemistry, University of Antwerp, Antwerp, Belgium.
    [Show full text]
  • 2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition
    [Frontiers in Bioscience 13, 2335-2355, January 1, 2008] Roles of molecules involved in epithelial/mesenchymal transition during angiogenesis Giulio Ghersi Dipartimento di Biologia Cellulare e dello Sviluppo, Universita di Palermo, Italy TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Extracellular matrix 3.1. ECM and integrins 3.2. Basal lamina components 4. Cadherins. 4.1. Cadherins in angiogenesis 5. Integrins. 5.1. Integrins in angiogenesis 6. Focal adhesion molecules 7. Proteolytic enzymes 7.1. Proteolytic enzymes inhibitors 7.2. Proteolytic enzymes in angiogenesis 8. Perspective 9. Acknowledgements 10. References 1.ABSTRACT 2. INTRODUCTION Formation of vessels requires “epithelial- Growth of new blood vessels (angiogenesis) mesenchymal” transition of endothelial cells, with several plays a key role in several physiological processes, such modifications at the level of endothelial cell plasma as vascular remodeling during embryogenesis and membranes. These processes are associated with wound healing tissue repair in the adult; as well as redistribution of cell-cell and cell-substrate adhesion pathological processes, including rheumatoid arthritis, molecules, cross talk between external ECM and internal diabetic retinopathy, psoriasis, hemangiomas, and cytoskeleton through focal adhesion molecules and the cancer (1). Vessel formation entails the “epithelial- expression of several proteolytic enzymes, including matrix mesenchymal” transition of endothelial cells (ECs) “in metalloproteases and serine proteases. These enzymes with vivo”; a similar phenotypic exchange can be induced “in their degradative action on ECM components, generate vitro” by growing ECs to low cell density, or in “wound molecules acting as activators and/or inhibitors of healing” experiments or perturbing cell adhesion and angiogenesis. The purpose of this review is to provide an associated molecule functions.
    [Show full text]
  • Anti-ITGAE (GW21349)
    3050 Spruce Street, Saint Louis, MO 63103 USA Tel: (800) 521-8956 (314) 771-5765 Fax: (800) 325-5052 (314) 771-5757 email: [email protected] Product Information Anti-ITGAE antibody produced in chicken, affinity isolated antibody Catalog Number GW21349 Formerly listed as GenWay Catalog Number 15-288-21349, Integrin alpha-E Antibody. – Storage Temperature Store at 20 °C The product is a clear, colorless solution in phosphate buffered saline, pH 7.2, containing 0.02% sodium azide. Synonyms: Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide), Mucosal Species Reactivity: Human lymphocyte 1 antigen; HML-1 antigen; Integrin alpha-IEL; Tested Applications: WB CD103 antigen Recommended Dilutions: Recommended starting dilution Product Description for Western blot analysis is 1:500, for tissue or cell staining Integrin alpha-E/beta-7 is a receptor for E-cadherin. It 1:200. mediates adhesion of intra-epithelial T-lymphocytes to epithelial cell monolayers. Note: Optimal concentrations and conditions for each application should be determined by the user. NCBI Accession number: NP_002199.2 Swiss Prot Accession number: P38570 Precautions and Disclaimer This product is for R&D use only, not for drug, household, or Gene Information: Human .. ITGAE (3682) other uses. Due to the sodium azide content a material Immunogen: Recombinant protein Integrin, alpha E (anti- safety data sheet (MSDS) for this product has been sent to gen CD103, human mucosal lymphocyte antigen 1; alpha the attention of the safety officer of your institution. Please polypeptide) consult the Material Safety Data Sheet for information regarding hazards and safe handling practices. Immunogen Sequence: GI # 6007851, sequence 773 - 817 Storage/Stability For continuous use, store at 2–8 °C for up to one week.
    [Show full text]
  • Comparative Transcriptome Analysis of Embryo Invasion in the Mink Uterus
    Placenta 75 (2019) 16–22 Contents lists available at ScienceDirect Placenta journal homepage: www.elsevier.com/locate/placenta Comparative transcriptome analysis of embryo invasion in the mink uterus T ∗ Xinyan Caoa,b, , Chao Xua,b, Yufei Zhanga,b, Haijun Weia,b, Yong Liuc, Junguo Caoa,b, Weigang Zhaoa,b, Kun Baoa,b, Qiong Wua,b a Institute of Special Animal and Plant Sciences, Chinese Academy of Agricultural Sciences, Changchun, China b State Key Laboratory for Molecular Biology of Special Economic Animal and Plant Science, Chinese Academy of Agricultural Sciences, Changchun, China c Key Laboratory of Embryo Development and Reproductive Regulation of Anhui Province, College of Biological and Food Engineering, Fuyang Teachers College, Fuyang, China ABSTRACT Introduction: In mink, as many as 65% of embryos die during gestation. The causes and the mechanisms of embryonic mortality remain unclear. The purpose of our study was to examine global gene expression changes during embryo invasion in mink, and thereby to identify potential signaling pathways involved in implantation failure and early pregnancy loss. Methods: Illumina's next-generation sequencing technology (RNA-Seq) was used to analyze the differentially expressed genes (DEGs) in implantation (IMs) and inter- implantation sites (inter-IMs) of uterine tissue. Results: We identified a total of 606 DEGs, including 420 up- and 186 down-regulated genes in IMs compared to inter-IMs. Gene annotation analysis indicated multiple biological pathways to be significantly enriched for DEGs, including immune response, ECM complex, cytokine activity, chemokine activity andprotein binding. The KEGG pathway including cytokine-cytokine receptor interaction, Jak-STAT, TNF and the chemokine signaling pathway were the most enriched.
    [Show full text]
  • Supplemental Material Annexin A2-S100A10 Represents the Regulatory Component of Maxi-Cl Channel Dependent on Protein Tyrosine De
    Supplemental Material Annexin A2-S100A10 Represents the Regulatory Component of Maxi-Cl Channel Dependent on Protein Tyrosine Dephosphorylation and Intracellular Ca2+ Md. Rafiqul Islama Toshiaki Okadaa Petr G. Merzlyaka,b Abduqodir H. Toychieva,c Yuhko Ando-Akatsukad Ravshan Z. Sabirova,b Yasunobu Okadaa,e aDivision of Cell Signaling, National Institute for Physiological Sciences (NIPS), Okazaki, Japan, bInstitute of Biophysics and Biochemistry, National University of Uzbekistan, Tashkent, Uzbekistan, cDepartment of Biological Sciences, State University of New York College of Optometry, New York, NY, USA, dDepartment of Cell Physiology, Faculty of Pharmaceutical Sciences, Suzuka University of Medical Science, Suzuka, Japan, eDepartment of Physiology, Kyoto Prefectural University of Medicine, Kyoto, Japan Supplementary Material Supplementary Fig. 1. Maxi-Cl currents in C127 cells were unaffected by siRNA- mediated silencing of three annexin family member genes, Anxa1, Anxa3 and Anxa11. Effects of knockdown mediated by Anxa1-specific siRNA (A), Anxa3-specific siRNA (B) and Anxa11-specific siRNA (C). Top panels: The effects on expression of ANXA mRNAs in C127 cells treated with non-targeting siRNA (cnt) or Anxa1/3/11-specific siRNA (si) detected by RT-PCR using Gapdh as a control. M: molecular size markers (100-bp ladder). These data represent triplicate experiments. Upper-middle panels: Representative time courses of Maxi-Cl current activation recorded at +25 mV after patch excision from C127 cells transfected with Anxa1/3/11-specific siRNA. Lower-middle panels: Voltage- dependent inactivation pattern of Maxi-Cl currents elicited by applying single voltage step pulses from 0 to 25 and 50 mV. Bottom panels: Summary of the effects of non-targeting siRNA (Control) and Anxa1/3/11-specific siRNA on the mean Maxi-Cl currents recorded at +25 mV.
    [Show full text]
  • Supp Table 1.Pdf
    Upregulated genes in Hdac8 null cranial neural crest cells fold change Gene Symbol Gene Title 134.39 Stmn4 stathmin-like 4 46.05 Lhx1 LIM homeobox protein 1 31.45 Lect2 leukocyte cell-derived chemotaxin 2 31.09 Zfp108 zinc finger protein 108 27.74 0710007G10Rik RIKEN cDNA 0710007G10 gene 26.31 1700019O17Rik RIKEN cDNA 1700019O17 gene 25.72 Cyb561 Cytochrome b-561 25.35 Tsc22d1 TSC22 domain family, member 1 25.27 4921513I08Rik RIKEN cDNA 4921513I08 gene 24.58 Ofa oncofetal antigen 24.47 B230112I24Rik RIKEN cDNA B230112I24 gene 23.86 Uty ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 22.84 D8Ertd268e DNA segment, Chr 8, ERATO Doi 268, expressed 19.78 Dag1 Dystroglycan 1 19.74 Pkn1 protein kinase N1 18.64 Cts8 cathepsin 8 18.23 1500012D20Rik RIKEN cDNA 1500012D20 gene 18.09 Slc43a2 solute carrier family 43, member 2 17.17 Pcm1 Pericentriolar material 1 17.17 Prg2 proteoglycan 2, bone marrow 17.11 LOC671579 hypothetical protein LOC671579 17.11 Slco1a5 solute carrier organic anion transporter family, member 1a5 17.02 Fbxl7 F-box and leucine-rich repeat protein 7 17.02 Kcns2 K+ voltage-gated channel, subfamily S, 2 16.93 AW493845 Expressed sequence AW493845 16.12 1600014K23Rik RIKEN cDNA 1600014K23 gene 15.71 Cst8 cystatin 8 (cystatin-related epididymal spermatogenic) 15.68 4922502D21Rik RIKEN cDNA 4922502D21 gene 15.32 2810011L19Rik RIKEN cDNA 2810011L19 gene 15.08 Btbd9 BTB (POZ) domain containing 9 14.77 Hoxa11os homeo box A11, opposite strand transcript 14.74 Obp1a odorant binding protein Ia 14.72 ORF28 open reading
    [Show full text]
  • Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
    Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation
    [Show full text]