DOCSLIB.ORG

Effect of Nanoparticles on the Expression and Activity of Matrix Metalloproteinases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effect of Nanoparticles on the Expression and Activity of Matrix Metalloproteinases Nanotechnol Rev 2018; 7(6): 541–553 Review Magdalena Matysiak-Kucharek*, Magdalena Czajka, Krzysztof Sawicki, Marcin Kruszewski and Lucyna Kapka-Skrzypczak Effect of nanoparticles on the expression and activity of matrix metalloproteinases https://doi.org/10.1515/ntrev-2018-0110 Received September 14, 2018; accepted October 11, 2018; previously 1 Introduction published online November 15, 2018 Matrix metallopeptidases, commonly known as matrix Abstract: Matrix metallopeptidases, commonly known metalloproteinases (MMPs), are zinc-dependent proteo- as matrix metalloproteinases (MMPs), are a group of pro- lytic enzymes whose primary function is the degradation teolytic enzymes whose main function is the remodeling and remodeling of extracellular matrix (ECM) compo- of the extracellular matrix. Changes in the activity of nents. ECM is a complex, dynamic structure that condi- these enzymes are observed in many pathological states, tions the proper tissue architecture. MMPs by digesting including cancer metastases. An increasing body of evi- ECM proteins eliminate structural barriers and allow dence indicates that nanoparticles (NPs) can lead to the cell migration. Moreover, by hydrolyzing extracellularly deregulation of MMP expression and/or activity both in released proteins, MMPs can change the activity of many vitro and in vivo. In this work, we summarized the current signal peptides, such as growth factors, cytokines, and state of knowledge on the impact of NPs on MMPs. The chemokines. MMPs are involved in many physiological literature analysis showed that the impact of NPs on MMP processes, such as embryogenesis, reproduction cycle, or expression and/or activity is inconclusive. NPs exhibit wound healing; however, their increased activity is also both stimulating and inhibitory effects, which might be associated with a number of pathological conditions, such dependent on multiple factors, such as NP size and coat- as diabetes, cardiovascular diseases and neurodegenera- ing or a cellular model used in the research. tive and autoimmune disorders. A particular attention is paid to the role of MMPs in the metastasis and progression Keywords: enzymes; extracellular matrix; metalloprotein- of malignant tumors. Increased expression and/or activity ases; nanoparticles. of MMPs significantly correlate with the ability to metasta- size and greater invasiveness in almost all types of human *Corresponding author: Magdalena Matysiak-Kucharek, cancers and worse prognosis [1]. Thus, MMPs become a Department of Molecular Biology and Translational Research, potential target for therapy. Hydroxamate-based MMP Institute of Rural Health, Lublin, Jaczewskiego 2, Lublin 20-090, inhibitors, such as batimastat, ilomastat, and marimas- Poland, e-mail: [email protected] tat, which contain the CONHOH group binding zinc atom Magdalena Czajka and Krzysztof Sawicki: Department of Molecular Biology and Translational Research, Institute of Rural Health, at the active site of MMP enzyme, are the first synthetic Lublin, Jaczewskiego 2, Lublin 20-090, Poland inhibitors of MMPs allowed for testing on cancer patients. Marcin Kruszewski: Department of Molecular Biology and Currently, various other synthetic MMP inhibitors, which Translational Research, Institute of Rural Health, Lublin, differ in chemical structure, activity, and pharmacokinet- Jaczewskiego 2, Lublin 20-090, Poland; Centre for Radiobiology and ics, are on the market or in various phases of clinical trials Biological Dosimetry, Institute of Nuclear Chemistry and Technology, [2, 3]. Despite oncology, MMP inhibitors are used also in Dorodna 16, Warsaw 03-195, Poland; and Department of Medical Biology and Translational Research, Faculty of Medicine, University other areas of medicine, for example, in diseases related of Information Technology and Management, Sucharskiego 2, to the central nervous system [4]. Rzeszów 35-225, Poland Nanotechnology is a rapidly developing field of Lucyna Kapka-Skrzypczak: Department of Molecular Biology science, resulting in a variety of applications in industry and Translational Research, Institute of Rural Health, Lublin, and everyday life. In medicine, big hope is paid in the use Jaczewskiego 2, Lublin 20-090, Poland; and Department of Medical Biology and Translational Research, Faculty of Medicine, University of nanomaterials in the treatment of various diseases. of Information Technology and Management, Sucharskiego 2, Nanomaterials are foreseen to be used as drug and/or radi- Rzeszów 35-225, Poland onuclide carriers but also as agents for direct treatment, 542 M. Matysiak-Kucharek et al.: Effect of nanoparticles on the expression and activity of matrix metalloproteinases such as thermotherapy and phototherapy, or even nano- signal peptide, prodomain, and catalytic domain, which bots directly killing cancer cells [5]. In contrast, increasing is responsible for the proteolytic activity of the enzyme body of evidence suggests that nanoparticles (NPs) might and contains zinc and calcium ions as a structural or cata- be toxic for mammalian cells or might have other adverse lytic moiety. Only two MMPs have this simple structure: effects, such as the promotion of cancer development and MMP7 and MMP26. The others comprise the hemopexin- metastasis [6, 7]. like domain and other domains specific for individual In the last few years, the impact of a number of dif- MMPs. Therefore, MMPs show significant variability at ferent NPs on selected metalloproteinases has been the level of tertiary protein structure, which in turn affects reported. NPs can modulate the expression and/or activ- their properties. MMPs can be divided into five main sub- ity of MMPs in two ways: either stimulating or inhibiting groups according to their substrate activity and mecha- them. This study is an attempt to summarize the current nism of action: matrilysins, collagenases, stromelysins, state of knowledge on the effect of nanomaterials on the gelatinases, and membrane MMPs; however, some MMPs expression and activity of MMPs, a key factor in tumor do not fit into any of these groups and are classified as metastasis. “others” (Figure 1). Currently, 23 human MMPs are known, but their numbering starts from 1 and ends at 28 but does not include numbers 4, 5, 6, 18, and 22 due to the dupli- cation of names of the same MMP discovered by different 2 General characteristics of MMPs research groups at the same time [8, 9]. Matrilysins, also called endometalloproteinases, Although MMPs are multidomain enzymes, all identified have the ability to degrade fibronectin, fibrinogen, MMPs in humans share the same structure that include and collagen type IV. This group contains MMP7 and MMPs with minimal structural domain Matrylisins: MMP7, MMP26 MMPs with hemopexin domain Collagenases: MMP1, MMP8, MMP13; Stromelysins: MMP3, MMP10; Metaloelastases: MMP12; Enemielisines: MMP20; MMPs with fibronectin module Other MMPs: MMP19, MMP27 Gelatinases: MMP2, MMP9 MMPs with furin recognition motif Other MMPs: MMP11, MMP28 MMPs with vitronectin domain Other MMPs: MMP21 MMPs with cytoplasmic tail and transmembrane domain Membrane MMPs type I, transmembrane- anchored: MMP14, MMP15, MMP16, MMP24 MMPs with GPI anchor Membrane MMPs type I, GPI-anchored: MMP17, MMP25 MMPs with cysteine array and IgG like domain Membrane MMPs type II: MMP23 Signal Catalytic Hemopexin Furin Transmembrane GPI IgG-like peptide domain domain recognition motif domain anchor domain Fibronectin Cysteine Signal Prodomain Hinge Vitronectin domain Cytoplasmic tail module array anchor Figure 1: Domain structure of metalloproteinases (own elaboration). M. Matysiak-Kucharek et al.: Effect of nanoparticles on the expression and activity of matrix metalloproteinases 543 MMP26, characterized by the simplest protein struc- MMPs [8–12]. MMP gene expression at the transcription ture. Collagenases, which include MMP1, MMP8, and level is also effectively inhibited by transforming growth MMP13, degrade gelatin and practically all collagen factor-β. In addition, it has been shown that transcription subtypes. Their structure is characterized by the pres- factors, such as nuclear factor-κB light-chain enhancer of ence of hemopexin domain, bonded by a flexible linker activated B cells [13] and signal transducers and activators with the catalytic domain. MMP10 and MMP3 belong to of transcription 3 [14], can significantly affect MMP mRNA stromelysins and share substrate specificity, hydrolyzing expression. It also indicated that epigenetic mechanisms numerous components of the ECM. MMP3 exhibits higher play an important role in MMP regulation [15]. proteolytic efficiency and is necessary for the activation MMPs are secreted from cells in a latent form of of several MMP proenzymes. Sometimes, MMP11 is also zymogens. The presence of prodomain allows maintain- included to stromelysins due to the similar substrate ing MMPs in an inactive form. The activation of zymogen specificity. However, its structure does not correspond to can be achieved in several ways: (1) by removal of the the other enzymes of this group. The next MMP group are prodomain by another endoproteinase, (2) by allosteric gelatinases, which include MMP2 and MMP9. Structur- change of the prodomain conformation, or (3) by change ally, proteins belonging to this group contain the catalytic of the bond between the prodomain and zinc ions in the domain composed of three fibronectin type II modules, enzyme active center. It has been shown that substances which strengthens substrate binding. This structure
Load more

Recommended publications
  • Role of Cyclosporine in Gingival Hyperplasia: an in Vitro Study on Gingival Fibroblasts
    International Journal of Molecular Sciences Article Role of Cyclosporine in Gingival Hyperplasia: An In Vitro Study on Gingival Fibroblasts 1, , 2, 3 3 Dorina Lauritano * y , Annalisa Palmieri y, Alberta Lucchese , Dario Di Stasio , Giulia Moreo 1 and Francesco Carinci 4 1 Department of Medicine and Surgery, Centre of Neuroscience of Milan, University of Milano-Bicocca, 20126 Milan, Italy; [email protected] 2 Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, via Belmoro 8, 40126 Bologna, Italy; [email protected] 3 Multidisciplinary Department of Medical and Dental Specialties, University of Campania-Luigi Vanvitelli, 80138 Naples, Italy; [email protected] (A.L.); [email protected] (D.D.S.) 4 Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 44121 Ferrara, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-335-679-0163 These authors contributed equally to this work. y Received: 25 November 2019; Accepted: 13 January 2020; Published: 16 January 2020 Abstract: Background: Gingival hyperplasia could occur after the administration of cyclosporine A. Up to 90% of the patients submitted to immunosuppressant drugs have been reported to suffer from this side effect. The role of fibroblasts in gingival hyperplasia has been widely discussed by literature, showing contrasting results. In order to demonstrate the effect of cyclosporine A on the extracellular matrix component of fibroblasts, we investigated the gene expression profile of human fibroblasts after cyclosporine A administration. Materials and methods: Primary gingival fibroblasts were stimulated with 1000 ng/mL cyclosporine A solution for 16 h. Gene expression levels of 57 genes belonging to the “Extracellular Matrix and Adhesion Molecules” pathway were analyzed using real-time PCR in treated cells, compared to untreated cells used as control.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Inflammation-Mediated Skin Tumorigenesis Induced by Epidermal C-Fos
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Inflammation-mediated skin tumorigenesis induced by epidermal c-Fos Eva M. Briso,1 Juan Guinea-Viniegra,1 Latifa Bakiri,1 Zbigniew Rogon,2 Peter Petzelbauer,3 Roland Eils,2 Ronald Wolf,4 Mercedes Rinco´ n,5 Peter Angel,6 and Erwin F. Wagner1,7 1BBVA Foundation-Spanish National Cancer Research Center (CNIO) Cancer Cell Biology Program, CNIO, 28029 Madrid, Spain; 2Division of Theoretical Bioinformatics, German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; 3Skin and Endothelium Research Division (SERD), Department of Dermatology, Medical University of Vienna, A-1090 Vienna, Austria; 4Department of Dermatology and Allergology, Ludwig-Maximilian University, Munich, Germany; 5Division of Immunobiology, Department of Medicine, University of Vermont, 05405 Burlington, Vermont, USA; 6Division of Signal Transduction and Growth Control, DKFZ, DKFZ-Center for Molecular Biology of the University of Heidelberg (ZMBH) Alliance, 69120 Heidelberg, Germany Skin squamous cell carcinomas (SCCs) are the second most prevalent skin cancers. Chronic skin inflammation has been associated with the development of SCCs, but the contribution of skin inflammation to SCC development remains largely unknown. In this study, we demonstrate that inducible expression of c-fos in the epidermis of adult mice is sufficient to promote inflammation-mediated epidermal hyperplasia, leading to the development of preneoplastic lesions. Interestingly, c-Fos transcriptionally controls mmp10 and s100a7a15 expression in keratinocytes, subsequently leading to CD4 T-cell recruitment to the skin, thereby promoting epidermal hyperplasia that is likely induced by CD4 T-cell-derived IL-22. Combining inducible c-fos expression in the epidermis with a single dose of the carcinogen 7,12-dimethylbenz(a)anthracene (DMBA) leads to the development of highly invasive SCCs, which are prevented by using the anti-inflammatory drug sulindac.
    [Show full text]
  • Linc-DYNC2H1-4 Promotes EMT and CSC Phenotypes by Acting As a Sponge of Mir-145 in Pancreatic Cancer Cells
    Citation: Cell Death and Disease (2017) 8, e2924; doi:10.1038/cddis.2017.311 OPEN Official journal of the Cell Death Differentiation Association www.nature.com/cddis Linc-DYNC2H1-4 promotes EMT and CSC phenotypes by acting as a sponge of miR-145 in pancreatic cancer cells Yuran Gao1, Zhicheng Zhang2,3, Kai Li1,3, Liying Gong1, Qingzhu Yang1, Xuemei Huang1, Chengcheng Hong1, Mingfeng Ding*,2 and Huanjie Yang*,1 The acquisition of epithelial–mesenchymal transition (EMT) and/or existence of a sub-population of cancer stem-like cells (CSC) are associated with malignant behavior and chemoresistance. To identify which factor could promote EMT and CSC formation and uncover the mechanistic role of such factor is important for novel and targeted therapies. In the present study, we found that the long intergenic non-coding RNA linc-DYNC2H1-4 was upregulated in pancreatic cancer cell line BxPC-3-Gem with acquired gemcitabine resistance. Knockdown of linc-DYNC2H1-4 decreased the invasive behavior of BxPC-3-Gem cells while ectopic expression of linc-DYNC2H1-4 promoted the acquisition of EMT and stemness of the parental sensitive cells. Linc-DYNC2H1-4 upregulated ZEB1, the EMT key player, which led to upregulation and downregulation of its targets vimentin and E-cadherin respectively, as well as enhanced the expressions of CSC makers Lin28, Nanog, Sox2 and Oct4. Linc-DYNC2H1-4 is mainly located in the cytosol. Mechanically, it could sponge miR-145 that targets ZEB1, Lin28, Nanog, Sox2, Oct4 to restore these EMT and CSC-associated genes expressions. We proved that MMP3, the nearby gene of linc-DYNC2H1-4 in the sense strand, was also a target of miR-145.
    [Show full text]
  • Epithelial-Specific Knockout of the Rac1 Gene Leads to Enamel Defects
    Eur J Oral Sci 2011; 119 (Suppl. 1): 168–176 Ó 2011 Eur J Oral Sci DOI: 10.1111/j.1600-0722.2011.00904.x European Journal of Printed in Singapore. All rights reserved Oral Sciences Zhan Huang1, Jieun Kim2, Rodrigo Epithelial-specific knockout of the Rac1 S. Lacruz1, Pablo Bringas Jr1, Michael Glogauer3, Timothy G. gene leads to enamel defects Bromage4, Vesa M. Kaartinen2, Malcolm L. Snead1 1The Center for Craniofacial Molecular Biology, Huang Z, Kim J, Lacruz RS, Bringas P Jr, Glogauer M, Bromage TG, Kaartinen VM, Herman Ostrow School of Dentistry, University of Southern California, Los Angeles, CA, USA; Snead ML. Epithelial-specific knockout of the Rac1 gene leads to enamel defects. 2 Eur J Oral Sci 2011; 119 (Suppl. 1): 168–176. Ó 2011 Eur J Oral Sci Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, MI, USA; 3Matrix The Ras-related C3 botulinum toxin substrate 1 (Rac1) gene encodes a 21-kDa GTP- Dynamics Group, Faculty of Dentistry, binding protein belonging to the RAS superfamily. RAS members play important University of Toronto, Toronto, Ontario, roles in controlling focal adhesion complex formation and cytoskeleton contraction, Canada; 4New York University College of activities with consequences for cell growth, adhesion, migration, and differentiation. Dentistry, New York, NY, USA To examine the role(s) played by RAC1 protein in cell–matrix interactions and enamel matrix biomineralization, we used the Cre/loxP binary recombination system to characterize the expression of enamel matrix proteins and enamel formation in Rac1 knockout mice (Rac1)/)). Mating between mice bearing the floxed Rac1 allele and mice bearing a cytokeratin 14-Cre transgene generated mice in which Rac1 was absent Zhan Huang, The Center for Craniofacial from epithelial organs.
    [Show full text]
  • Discovery and Optimization of Selective Inhibitors of Meprin Α (Part II)
    pharmaceuticals Article Discovery and Optimization of Selective Inhibitors of Meprin α (Part II) Chao Wang 1,2, Juan Diez 3, Hajeung Park 1, Christoph Becker-Pauly 4 , Gregg B. Fields 5 , Timothy P. Spicer 1,6, Louis D. Scampavia 1,6, Dmitriy Minond 2,7 and Thomas D. Bannister 1,2,* 1 Department of Molecular Medicine, Scripps Research, Jupiter, FL 33458, USA; [email protected] (C.W.); [email protected] (H.P.); [email protected] (T.P.S.); [email protected] (L.D.S.) 2 Department of Chemistry, Scripps Research, Jupiter, FL 33458, USA; [email protected] 3 Rumbaugh-Goodwin Institute for Cancer Research, Nova Southeastern University, 3321 College Avenue, CCR r.605, Fort Lauderdale, FL 33314, USA; [email protected] 4 The Scripps Research Molecular Screening Center, Scripps Research, Jupiter, FL 33458, USA; [email protected] 5 Unit for Degradomics of the Protease Web, Institute of Biochemistry, University of Kiel, Rudolf-Höber-Str.1, 24118 Kiel, Germany; fi[email protected] 6 Department of Chemistry & Biochemistry and I-HEALTH, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458, USA 7 Dr. Kiran C. Patel College of Allopathic Medicine, Nova Southeastern University, 3301 College Avenue, Fort Lauderdale, FL 33314, USA * Correspondence: [email protected] Abstract: Meprin α is a zinc metalloproteinase (metzincin) that has been implicated in multiple diseases, including fibrosis and cancers. It has proven difficult to find small molecules that are capable Citation: Wang, C.; Diez, J.; Park, H.; of selectively inhibiting meprin α, or its close relative meprin β, over numerous other metzincins Becker-Pauly, C.; Fields, G.B.; Spicer, which, if inhibited, would elicit unwanted effects.
    [Show full text]
  • 2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition
    [Frontiers in Bioscience 13, 2335-2355, January 1, 2008] Roles of molecules involved in epithelial/mesenchymal transition during angiogenesis Giulio Ghersi Dipartimento di Biologia Cellulare e dello Sviluppo, Universita di Palermo, Italy TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Extracellular matrix 3.1. ECM and integrins 3.2. Basal lamina components 4. Cadherins. 4.1. Cadherins in angiogenesis 5. Integrins. 5.1. Integrins in angiogenesis 6. Focal adhesion molecules 7. Proteolytic enzymes 7.1. Proteolytic enzymes inhibitors 7.2. Proteolytic enzymes in angiogenesis 8. Perspective 9. Acknowledgements 10. References 1.ABSTRACT 2. INTRODUCTION Formation of vessels requires “epithelial- Growth of new blood vessels (angiogenesis) mesenchymal” transition of endothelial cells, with several plays a key role in several physiological processes, such modifications at the level of endothelial cell plasma as vascular remodeling during embryogenesis and membranes. These processes are associated with wound healing tissue repair in the adult; as well as redistribution of cell-cell and cell-substrate adhesion pathological processes, including rheumatoid arthritis, molecules, cross talk between external ECM and internal diabetic retinopathy, psoriasis, hemangiomas, and cytoskeleton through focal adhesion molecules and the cancer (1). Vessel formation entails the “epithelial- expression of several proteolytic enzymes, including matrix mesenchymal” transition of endothelial cells (ECs) “in metalloproteases and serine proteases. These enzymes with vivo”; a similar phenotypic exchange can be induced “in their degradative action on ECM components, generate vitro” by growing ECs to low cell density, or in “wound molecules acting as activators and/or inhibitors of healing” experiments or perturbing cell adhesion and angiogenesis. The purpose of this review is to provide an associated molecule functions.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Anti-MMP26 (GW21139)
    3050 Spruce Street, Saint Louis, MO 63103 USA Tel: (800) 521-8956 (314) 771-5765 Fax: (800) 325-5052 (314) 771-5757 email: [email protected] Product Information Anti-MMP26 antibody produced in chicken, affinity isolated antibody Catalog Number GW21139 Formerly listed as GenWay Catalog Number 15-288-21139, Matrix metalloproteinase-26 Antibody. – Storage Temperature Store at 20 °C The product is a clear, colorless solution in phosphate buffered saline, pH 7.2, containing 0.02% sodium azide. Synonyms: Matrix metalloproteinase 26 preproprotein, EC 3.4.24.-; MMP-26; Matrilysin-2; Endometase Species Reactivity: Human Product Description Tested Applications: WB May hydrolyze collagen type IV. fibronectin. fibrinogen. Recommended Dilutions: Recommended starting dilution beta-casein. type I gelatin and alpha-1 proteinase inhibitor. for Western blot analysis is 1:500, for tissue or cell staining Is also able to activates progelatinase B. Proteins of the 1:200. matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological Note: Optimal concentrations and conditions for each processes. such as embryonic development. reproduction. application should be determined by the user. and tissue remodeling. as well as in disease processes. such Precautions and Disclaimer as arthritis and metastasis. Most MMP's are secreted as This product is for R&D use only, not for drug, household, or inactive proproteins which are activated when cleaved by other uses. Due to the sodium azide content a material extracellular proteinases. The enzyme encoded by this gene safety data sheet (MSDS) for this product has been sent to degrades type IV collagen, fibronectin, fibrinogen, and the attention of the safety officer of your institution.
    [Show full text]
  • On and Polymorphisms in Q Fever
    Matrix metalloproteinase expression, produc3on and polymorphisms in Q fever Anne F.M. Jansen1,2, Teske Schoffelen1,2, Julien Textoris3, Jean Louis Mege3, Chantal P. Bleeker-Rovers1,2, Esther van de Vosse4, Hendrik Jan Roest5, Marcel van Deuren1,2 1. Department of Internal Medicine, Division of Experimental Medicine, Radboud university medical center, Nijmegen, The Netherlands 2. Radboud Expert Centre for Q fever, Radboud university medical center, Nijmegen, the Netherlands, 3. URMITE, CNRS UMR 7278, IRD 198, INSERM 1095 Aix-Marseille University, Marseille, France 4. Department of Infec3ous Diseases, Leiden University Medical Center, Leiden, The Netherlands 5. Department of Bacteriology and TSEs, Central Veterinary Instute, part of Wageningen UR, Lelystad, the Netherlands Background C. burnei induces MMP-1 and MMP-9 produc3on in PBMCs Chronic Q fever is a life threatening condi3on caused by the Gram-negave bacterium Coxiella burnei, manifes3ng as an infec3on of aneurysms, aor3c prosthesis or heart valves. Matrix metalloproteinases (MMPs) are proteoly3c enzymes that cleave extracellular matrix and are implicated in the pathology of aneurysms and endocardi3s. Currently, the contribu3on of MMPs to the pathogenesis of chronic Q fever is unknown. Methods We inves3gated the C. burnei specific gene expression of MMPs in PBMCs and protein produc3on by ELISA in chronic Q fever paents (n=6, n=10, respec3vely), cardiovascular paents with a history of Q fever (n=10) and healthy controls (n=4, n=10, respec3vely), in some experiments, the controls had vascular disease (n=10). Circulang MMP levels were assessed with Luminex technology and these groups were also genotyped for 20 SNPs in MMP and Tissue Inhibitor of MMP (TIMP) genes.
    [Show full text]
  • Gene Symbol Category ACAN ECM ADAM10 ECM Remodeling-Related ADAM11 ECM Remodeling-Related ADAM12 ECM Remodeling-Related ADAM15 E
    Supplementary Material (ESI) for Integrative Biology This journal is (c) The Royal Society of Chemistry 2010 Gene symbol Category ACAN ECM ADAM10 ECM remodeling-related ADAM11 ECM remodeling-related ADAM12 ECM remodeling-related ADAM15 ECM remodeling-related ADAM17 ECM remodeling-related ADAM18 ECM remodeling-related ADAM19 ECM remodeling-related ADAM2 ECM remodeling-related ADAM20 ECM remodeling-related ADAM21 ECM remodeling-related ADAM22 ECM remodeling-related ADAM23 ECM remodeling-related ADAM28 ECM remodeling-related ADAM29 ECM remodeling-related ADAM3 ECM remodeling-related ADAM30 ECM remodeling-related ADAM5 ECM remodeling-related ADAM7 ECM remodeling-related ADAM8 ECM remodeling-related ADAM9 ECM remodeling-related ADAMTS1 ECM remodeling-related ADAMTS10 ECM remodeling-related ADAMTS12 ECM remodeling-related ADAMTS13 ECM remodeling-related ADAMTS14 ECM remodeling-related ADAMTS15 ECM remodeling-related ADAMTS16 ECM remodeling-related ADAMTS17 ECM remodeling-related ADAMTS18 ECM remodeling-related ADAMTS19 ECM remodeling-related ADAMTS2 ECM remodeling-related ADAMTS20 ECM remodeling-related ADAMTS3 ECM remodeling-related ADAMTS4 ECM remodeling-related ADAMTS5 ECM remodeling-related ADAMTS6 ECM remodeling-related ADAMTS7 ECM remodeling-related ADAMTS8 ECM remodeling-related ADAMTS9 ECM remodeling-related ADAMTSL1 ECM remodeling-related ADAMTSL2 ECM remodeling-related ADAMTSL3 ECM remodeling-related ADAMTSL4 ECM remodeling-related ADAMTSL5 ECM remodeling-related AGRIN ECM ALCAM Cell-cell adhesion ANGPT1 Soluble factors and receptors
    [Show full text]
  • Polymorphisms of the Matrix Metalloproteinase Genes
    www.nature.com/scientificreports OPEN Polymorphisms of the matrix metalloproteinase genes are associated with essential hypertension in a Caucasian population of Central Russia Maria Moskalenko1, Irina Ponomarenko1, Evgeny Reshetnikov1*, Volodymyr Dvornyk2 & Mikhail Churnosov1 This study aimed to determine possible association of eight polymorphisms of seven MMP genes with essential hypertension (EH) in a Caucasian population of Central Russia. Eight SNPs of the MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, and MMP12 genes and their gene–gene (epistatic) interactions were analyzed for association with EH in a cohort of 939 patients and 466 controls using logistic regression and assuming additive, recessive, and dominant genetic models. The functional signifcance of the polymorphisms associated with EH and 114 variants linked to them (r2 ≥ 0.8) was analyzed in silico. Allele G of rs11568818 MMP7 was associated with EH according to all three genetic models (OR = 0.58–0.70, pperm = 0.01–0.03). The above eight SNPs were associated with the disorder within 12 most signifcant epistatic models (OR = 1.49–1.93, pperm < 0.02). Loci rs1320632 MMP8 and rs11568818 MMP7 contributed to the largest number of the models (12 and 10, respectively). The EH-associated loci and 114 SNPs linked to them had non-synonymous, regulatory, and eQTL signifcance for 15 genes, which contributed to the pathways related to metalloendopeptidase activity, collagen degradation, and extracellular matrix disassembly. In summary, eight studied SNPs of MMPs genes were associated with EH in the Caucasian population of Central Russia. Cardiovascular diseases are a global problem of modern healthcare and the second most common cause of total mortality1,2.
    [Show full text]