Combined Biosynthetic and Synthetic Production of Valuable Molecules: A Hybrid Approach to Vitamin E and Novel Ambroxan Derivatives

Bertrand T. Adanve

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences

COLUMBIA UNIVERSITY

2015 © 2015 Bertrand T. Adanve All Rights Reserved ABSTRACT

Combined Biosynthetic and Synthetic Production of Valuable Molecules: A Hybrid Approach to Vitamin E and Novel Ambroxan Derivatives

Bertrand T. Adanve

Chapter 1. Introduction

Synthetic chemistry has played a pivotal role in the evolution of modern life.

More recently, the emerging field of synthetic biology holds the promise to bring about a paradigm shift with designer microbes to renewably synthesize complex molecules in a fraction of the time and cost. Still, given nature’s virtuosity at stitching a staggering palette of carbon frameworks with ease and synthetic chemistry’s superior parsing powers to access a greater number of unnatural end products, a hybrid approach that leverages the respective strengths of the two fields could prove advantageous for the efficient production of valuable natural molecules and their analogs.

To demonstrate this approach, from biosynthetic Z,E-farnesol, we produced a library of novel analogs of the commercially important amber fragrance Ambrox®, including the first synthetic patchouli scent. Likewise, we produced the valuable tocotrienols from yeast-produced geranylgeraniol in a single step, the first such process of its kind. The novel acid catalyst system that allowed for this unique regioselective cyclization holds promise as an asymmetric proton transfer tool and could open the door to facile asymmetric synthesis of vitamin E and other molecules.

Chapter 2. Z,E-Farnesol Biosynthesis

To produce the scarce and costly Z,E-farnesol biosynthetically, we over- expressed the four reported Z,E-FPPS (from acid-fast bacteria M. tuberculosis, T. fusca, C. glutamicum, and C. efficiens) into E. coli and the two with the best reported kinetics

(those from M. tuberculosis and T. fusca) into yeast. Though our engineered yeast strains did not produce any detectable Z,E-farnesol, they surprisingly produced high titers of

E,E-farnesol. In E. coli, the Z,E-FPPS from M. tuberculosis led to the best production titers of Z,E-farnesol (8.0 mg/L in flasks and 2.9 mg/L at bench scale), allowing us to produce and isolate 50 mg of the material.

Chapter 3. Novel Ambroxan Analogs from Biosynthetic Farnesol

In a first demonstration of the hybrid approach where the biosynthesized intermediate is not part of the target molecule’s biosynthetic pathway, microbe-produced

Z,E-farnesol was homologated and subsequently cyclized with the halonium donors

BDSB and IDSI to yield halo-benzohydrofurans, the 3 carbon halogenated versions of the commercially relevant 9-epi-Ambrox®. From this halogenated intermediate, the known compound was derived along with a library of novel analogs with improved organoleptic properties, among which the first synthetic patchouli scent.

Chapter 4. Geranylgeraniol Biosynthesis

We engineered yeast with a set of fusion enzyme constructs, including a first of its kind triple fusion enzyme construct, which led to geranylgeraniol (GGOH) production with no squalene side product despite no repression of squalene synthase (ERG9). With this triple fusion-engineered strain, we produced 27 mg of isolated GGOH in a very rudimentary, homemade fermenter. Chapter 5. Tocotrienols in Single Step from Biosynthetic Geranylgeraniol

In a second demonstration of the hybrid biosynthetic synthetic approach, we coupled the yeast-derived geranylgeraniol with trimethylhydroquinone to produce the potent vitamin E α-tocotrienol in a single step C–C coupling with concomitant regioselective cycloetherification of the most proximal vinyl, which constitutes the shortest synthesis of the tocotrienol. Likewise, we synthesized the three other members of the tocotrienol family.

Chapter 6. Novel Chiral Acid for asymmetric proton transfer: Adanve acids applied

to Chiral vitamin E synthesis

We developed a new class of chiral Bronsted acids (Adanve acids), materials that are highly tunable, easy to synthesize, and easy to handle as well as recover. In a preliminary exploration of the ability of these chiral acids to induce asymmetric proton transfer, we investigated their usage to impart asymmetric formation of chromans, namely the important vitamin E family. Our early findings suggest that a host of factors play a role in the ability of this novel acid catalyst system to induce asymmetric chroman formation. CONTENTS Chapter 1. Introduction

1.1 The Eminence of Synthetic Chemistry and Its Limitations ...... 2

1.2 The Emergence of Synthetic Biology and Its Limitations ...... 4

1.3 The Hybrid Biosynthetic and Synthetic Approach...... 7

1.4 The Hybrid Approach Applied to 9-epi-Ambrox® and tocotrienols ...... 11

1.5 Conclusion...... 13

1.6 References ...... 15

Chapter 2. Z,E-Farnesol Biosynthesis

2.1 Introduction ...... 18

2.2 Z,E-Farnesylpyrophosphate synthases (Z,E-FPPS)...... 22

2.3 Z,E-farnesol in E. coli...... 22

2.4 Z,E-farnesol in yeast...... 25

2.5 High-ATCC200589/tHMG1: A Yeast Background Strain For Terpenoid Production ...... 27

2.6 Bench Scale Production Optimizations Without Appropriate Fermenter ...... 29

2.7 Titer Yield Calculation...... 29

2.8 Conclusion...... 30

2.9 References ...... 31

2.10 Experimental Section ...... 32

Chapter 3. Novel 9-epi-Ambrox® Analogs from Biosynthetic Z,E-farnesol

3.1 Introduction to Ambrox®...... 59

3.2 Farnesol Homologation ...... 61

i 3.3 Cyclization to Halo-hydrobenzofurans ...... 63

3.4 Derivatization ...... 64

3.5 Discovery of Novel Structure and Ambergris-type Scent...... 64

3.6 Inspiration for a Synthetic Patchouli Scent ...... 65

3.7 Conclusion...... 66

3.8 References ...... 68

3.9 Experimental Section ...... 69

Chapter 4. Geranylgeraniol Biosynthesis

4.1 Introduction ...... 116

4.2 Double Enzyme Fusion Exploration ...... 118

4.3 Triple Enzyme Fusion Advent ...... 119

4.4 Fusion Constructs in Opposite Backgrounds ...... 121

4.5 Enzyme Order in the Fusion Constructs...... 121

4.6 Bench Scale Production Optimizations Without Appropriate Fermenter ...... 122

4.7 Titer Yield Calculation...... 122

4.8 Conclusion...... 123

4.9 References ...... 124

4.10 Experimental Section ...... 125

Chapter 5. Tocotrienols in a Single Step from Biosynthetic Geranylgeraniol

5.1 Introduction ...... 138

5.2 Designing the Catalyst System...... 141

5.3 Choosing the Catalyst: Improving the In(III)-Promoted Synthesis of Tocopherol: from Phytyl Acetate to Phytyl Trifluoroacetate...... 142

ii 5.4 Synthesis of Polyprenyl-chromans, including α-Tocotrienol...... 143

5.5 Accessing the Rest of the Tocotrienol Family: Effect of Deactivating Protection Groups...... 146

5.6 Next Generation Approach: Type II Adanve Acids...... 147

5.7 Conclusion...... 150

5.8 References ...... 151

5.9 Experimental Section ...... 152

Chapter 6. Novel Chiral Acid for Asymmetric Proton Transfer: Adanve Acids Applied to Chiral Vitamin E Synthesis

6.1 Introduction ...... 215

6.2 Cyclization Conditions: Effects of Solvent, Substrate Concentration, Catalyst Loading, and Temperature on Product Yield and Enantioselectivity ...... 221

6.3 Substrate Modifications: 1-OH Protecting Group Effects ...... 225

6.4 Substrate Modification: “Sticky” Side Chain Effects ...... 227

6.5 Additional Chiral Acids Synthesized and Explored...... 230

6.6 Conclusion...... 231

6.7 References ...... 232

6.8 Experimental Section ...... 234

iii ACKNOWLEDGMENTS

I thank the following people and groups for their support during my Ph.D work at Columbia. I could never fully describe in this short space how invaluable you have been during this time.

Virginia Cornish and Scott Snyder for welcoming me in your labs, for all your support, mentorship and patience; and most of all, for letting me try new science.

The Cornish group for providing a welcoming and helpful environment conducive to doing great science. In particular, I would like to mention Caroline Patenode (collaborator on the biosynthetic farnesol project), Yao Zong Ng (collaborator on the biosynthetic farnesol and geranylgeraniol projects), Millicent Olawale, Andrew Anzalone, Zhixing Chen, Erik Aznauryan and Pedro Baldera-Aguayo.

The Snyder group for your help and for letting me lift all those chemicals during my first few years.

The Acidophil, LLC team for your collaboration on a range of projects. In particular Philip Goelet; I learned a lot about the business side of science from our interactions.

Professor Dalibor Sames, Professor Harris Wang, and Dr. George Ellestad for your gracious acceptance to serve on my committee and discussions about chemistry and synthetic biology.

Dr. John Decatur, Dr. Brandon Fowler, Dr. Yasuhiro Itagaki, and Professor Luis Avila for providing support with spectroscopic analysis and being great company in general. Prof. James Leighton for generously providing access to his lab’s chiral HPLC.

Alix, Carlos, Jay, Dani, Socky, Robert, Chris, and Bill. You enable the science that we do.

The great people at St. Mary’s College of Maryland. Particularly, Richard Edgard and Wes Jordan (for recognizing my potential and going to all lengths to make sure I could attend). Professors Andrew Koch and Charles Adler (for your mentorship and research opportunities).

All my friends, especially Mari-Ann Larsen Volay and Alexandra Lebrecht.

My family for your belief in me and for bearing my decade-long absence with pride.

iv To all those who dare mount the steed of their dreams

v 1

CHAPTER 1

Introduction 2

1.1 The Eminence of Synthetic Chemistry and Its Limitations

Over the course of the past two centuries, synthetic chemistry has played a profound role in the development of society, impacting nearly every component of modern life. Its power to create molecules has grown tremendously, and there remain at present few known organic molecules that synthetic chemistry has not conquered through its immense sophistication and ingenuity. Even incredibly complex natural products like

Taxol (1) and Brevetoxin were synthetically assembled in the mid-1990s.1-3

The potential of synthetic chemistry was first ushered in by Friedrich Wohler in

1828 when he synthesized urea (2).4 1903 then saw the first commercial total synthesis with Gustaf Komppa’s industrial production of camphor (3). This achievement crystallized the notion that chemical synthesis, with its convenience and scale in producing complex molecules from the assembly and manipulation of simpler building blocks, could supplant natural source extraction for the production of much needed molecules.

This paradigm shift was welcomed, for direct extraction from natural sources was often fraught with challenges such as short supply, difficulty in isolating reasonable amounts of material as well as costs associated with purification and product shipment from one end of the world where the natural source is found to the other end where the product is consumed. For instance, Carothers’ synthesis of nylon at Dupont in 19305 offered a convenient alternative to natural rubber, which was hitherto produced through the collection of latex sap from rubber trees in tropical zones. The triumph of synthetic chemistry became even more pronounced in the second half of the last century, which saw an explosion in the sophistication with which organic molecules were synthetically 3

assembled beginning with Woodward’s syntheses of many complex natural products including quinine (4), strychnine, cortisone, reserpine, chlorophyll, and vitamin B12.6,7

Expanding this Woodwardian era with their seminal achievements,6-8 chemists like

Corey, Barton, Stork, Eschenmoser, and Nicolaou further augmented our understanding of the fundamental principles governing chemical structures and reactivities, consolidating the awesome power of synthetic chemistry to make any molecule, from therapeutics to polymers, through a vast arsenal of chemical reactions, synthetic strategies, and analytical tools. The impact and influence of synthetic chemistry has yet to wane. To the contrary, it remains vibrant and dynamic with many young chemists’ foray into the field armed with novel synthetic tools, new ideas for functionalization chemistries, and a deeper knowledge of biosynthetic tactics.

OMe O N O H2N NH2 OH O N H 2: Urea 3: Camphor 4: Quinine 5: Ambrox® 1828 1903 1944 1950

AcO O OH HO Ph O

O BzHN O OH H O HOBzO AcO 6: R,R,R-Tocopherol (most common vitamin E) 1: Taxol 1963 1994

Figure 1: Examples of natural products produced by synthetic chemistry

Furthermore, the advantages of synthetic chemistry go beyond simply providing a more favorable alternative to compounds found in nature. Organic chemistry also allows 4

improvements to natural products by enabling access to analogs with better pharmacokinetics and toxicity profiles, a crucial benefit since natural products are not always optimized for human biochemistry. Synthetic chemistry can also bring about completely novel compounds with unique, advantageous properties that do not occur in nature, as was the case with Kevlar and Teflon, materials from Dupont that continue to find wide applications in many areas of human life.

Nevertheless, despite synthetic chemistry’s untold merits and vast potential to continue its impact on the future, some limitations remain. First, synthesis can be time- consuming, often constituting the rate-limiting step in nearly all biomedical investigations. Second, it typically relies on petrochemical-based precursors and highly expensive reagents and catalysts. Third, even when a key molecule of interest has been identified, if it is of even a moderate degree of complexity it is unlikely that it can be made efficiently on scale, let alone in environmentally benign ways. As an example of the state of the art, a recent effort by process chemists at Novartis showed that more than

50 g of the bioactive natural product discodermolide could be synthesized in 39 overall steps in an industrial environment, but only through a Herculean effort involving 43 chemists, 17 large-scale chromatographies and 20 months of overall time.9-12

1.2 The Emergence of Synthetic Biology and Its Limitations

Given these limitations of synthetic chemistry, and in particular the value of complex natural products for the development of novel medicines, unique materials, cosmetics, perfumes, and sundry other applications, synthetic biology appears well poised to be a natural and significant complement to synthetic chemistry. Just as synthetic 5

chemistry provided a favorable alternative to the extraction of organic molecules from their natural source at great cost in the 19th and 20th centuries, synthetic biology holds the promise to bring about another paradigm shift, a more renewable one, in how organic compounds are produced for mass consumption.

Until recently, biology was an observation-analysis only science, much like chemistry before the advent of synthetic methods. But a deeper understanding of the

“stimulus-DNA-RNA-Peptide” relationship, more sophisticated molecular biology tools for genome manipulation, advances in the elucidation and construction of metabolic pathways spurred by the appreciation that natural products were biosynthesized according to the rules of organic chemistry, and breakthroughs in the various -omics technologies have conferred a synthetic echelon to the biology field.

Increasingly, innovations in this branch of biology, synthetic biology, hint to a future where microbes are reprogrammed as adaptive diagnostic and remedial tools that seek and destroy pathogens inside the body. In this future, not only are microbes engineered with logic gates effectively turning them into living computers, but they are also, owing to their ease of culture and exponential reproduction rates, foundries inside of which valuable organic molecules—fuels, therapeutics, polymers—are produced in a cheap, convenient, and renewable fashion. One could point out that the use of microbes as living foundries for the synthesis of important molecules began in 1928 when

Alexander Fleming discovered that Penicillium rubens produced an anti-bacterial

(penicillin) when grown under certain conditions. But it was not until synthetic and molecular biology methods were engaged to evolve better strains of the fungi that enough penicillin could be produced to satisfy demand. 6

OH H

HO OH H OH H

7: 1,3-Propanediol 8: Amorphadiene 9: Taxadiene 10: Sclareol 2003 2006 2010 2012

Figure 2. Examples of natural products produced by synthetic biology

Getting a microbe to efficiently produce a compound that it does not already produce natively demands the expertise of metabolic engineering, a field that was essentially born in the 1990’s.13 It does not suffice to simply introduce the genes of a xenobiotic pathway into the microbial host—lest toxic intermediates accumulate and kill the cell, negatively interfering with target production. Instead, one must take a more intricate, global, and synergistic approach where all genes on the metabolic pathway are controlled with respect to one another to maintain flux balance so that sufficient titers of the target molecule can be produced without disrupting endogenous homeostasis. Other crucial considerations include the types of carbon source fed to the organisms, growth conditions, protein modifications, and techniques for product detection and isolation.

Some of these concepts are already being put to practice. For instance, 1,3-propanediol

(7) was successfully produced in titers reaching 3.5 g/L/h;14 amorphadiene (8) was produced in yields of over 40 g/L,15,16 taxadiene (9) at 1.08 g/L,17 sclareol (10) at 1.5 g/L,18 and many others including polyketides such as the promising anti-cancer epothilone19 and biofuels like butanol.20 This rapid progress in the metabolic engineering field points to an imminent biosynthetic century. 7

Still, significant challenges remain to tap the field’s full potential, with two of the most notable issues being that key enzymes in the biosynthetic pathways of target molecules are often missing and engineering redox partners-requiring P450 enzymes for the oxygenation steps is arduous.21,22 In fact, to date no report of the functional expression of more than one P450 enzyme exists, and even successful single P450 expressions often come at the price of significantly lower titer yields.17,23 This latter challenge is perhaps the most significant considering that the majority of bioactive natural products are decorated with an assortment of functionally critical oxygen-based groups.

Furthermore, it is imperative to appreciate that the goal is not always to make the same molecule as nature given that synthetically derived analogs often exhibit superior properties to the natural compound. For instance, with the penicillins, it was ultimately

(+)-6-Aminopenicillinic acid (11), the core of the molecule, which was biosynthesized and then synthetically modified into novel antibiotics (12) with greater efficacies against gram-negative bacteria and beta-lactamase producing organisms.24 This model sheds deep light on valuable solutions for 21st century science.

1.3 The Hybrid Biosynthetic and Synthetic Approach

With the current limitations of the two fields in mind and the appreciation that synthetic chemistry enhances synthetic biology, for my Ph.D thesis, I aimed to leverage the respective strengths of synthetic biology and synthetic chemistry in a combined

“jigsaw” strategy to produce complex natural and unnatural organic molecules in an efficient and sustainable manner (Figure 3). 8

Biosynthesis Chemical synthesis

X X X X Y

Y Y

Engineered Target Metabolic Target Molecules & Analogs Microbe Intermediate (from related or unrelated biosynthetic pathway)

Figure 3. Schematic representation of the hybrid approach

For molecules necessitating several oxygenations, the hybrid approach seeks to biosynthesize an advanced intermediate with one or two chemical handles that are strategically positioned to aid in the functionalization of additional positions by way of synthetic chemistry, thus enabling rapid generation of the target natural product and a manifold of analogs.

Biosynthesis Chemical synthesis H H H N R N H Yeast 2 S S N O N O O CO2H CO2H 11: (+)-6-Aminopenicillinic acid 12: penicillin analogs

AcO O AcO O OH OH 10 9 O Ph O Plant cells 7 13 HO 1 5 BzHN O SCoA 2 OH H HO H O O BzO AcO HOBzO AcO 13: Baccatin III 1: Taxol

H H O Recombinant yeast O H H H HO O

O O 14: Artemisinic Acid 15: Artemisinin

Figure 4. Notable previous iterations of the combined approach 9

Previously, others have demonstrated similar combined semi-biosynthetic approach to produce several key molecules such as penicillin, taxol, artemisin, Δ7-

Dafacronic acid, and polyketide derivatives.23-27 In each case, fermentation in biological hosts is used to produce an advanced intermediate and subsequent organic transformations are implemented to yield the final product. Figure 4 depicts the reported semisyntheses of penicillins, taxol, and artemisinin.

In contrast to this general strategy, we aimed to leverage nature’s approach for building varied, versatile carbon frameworks and mesh it with synthetic chemistry’s parsing and combinatorial abilities to access a greater number of natural and unnatural end products (Figure 3). Importantly, this approach does not necessitate that these compounds occur as natural biosynthetic intermediates in the pathway towards the target molecule. By contrast, in this strategy, optimization of biosynthetic production of relatively few molecules can result in the efficient semi-biosynthetic production of many.

Moreover, this hybrid approach calls for the examination of any material up for production to discern an intermediate step where it is optimal for either synthetic biology or synthetic chemistry to be involved, a strategy which requires synthetic biology as well as synthetic chemistry expertise. Lastly, this approach may sometime require the invention of novel chemistry (as is the case with our single step synthesis of tocotrienols described later in this thesis).

Figure 5 demonstrates how the hybrid approach could be applied to Taxol (1), the valuable but scarce anticancer agent. To begin, yeast would be engineered to produce

Taxadien-5,10-diol (16) in high titers. Subsequently, this intermediate would be isolated and its 5-hydroxyl enlisted to install the oxetane ring with concomitant generation of the 10

4-hydroxyl. C13 would be readily oxidized as it is allylic to give compound 17.

Subsequently, the 4-hydroxyl would be recruited to direct the oxidation at C2, and the 10- hydroxyl that of C9 by way of an α-hydroxy ketone to yield compound 18. At this stage,

Biosynthesis Chemical synthesis AcO O OH O Ph O

Ph N O H OH H Microbe O HOBzO AcO 1: Taxol HO AcO O AcO O OH OH 10 O Ph O 7 HO 5 N O H H OH H OH H HO O HO O 16 BzO AcO BzO AcO 13 20: Taxotere

HO AcO OH AcO OH

9 O Ph O HO 13 HO 1 N O 4 2 H H H OH H O O O HO BzO AcO BzO AcO 17 18 19

Figure 5. Possible taxoid therapeutics production by the hybrid approach

given that SAR studies have indicated that the 7-hydroxyl and 1-hydroxyl are not required for activity, and that a hydroxyl instead of a ketone at C9 improve anti-cancer activity, a modified beta-lactam tail could be affixed to 18 to produce less oxygenated, unnatural taxoid analogs such as 19 that could have better activity than Taxol (1).

Alternatively, 18 could be taken to Baccatin III (13) after oxidation of C1 and C7, after which, upon affixing of the appropriate beta-lactam tail, we arrive at Taxol (1) and

Taxotere® (20).

While it would have been rewarding to apply the hybrid approach to a complex molecule such as Taxol, we believed that 9-epi-Ambrox® and vitamin E, two molecules 11

with great commercial and therapeutic value, were better fits for a first proof-of-principle demonstration.

1.4 The Hybrid Biosynthetic and Synthetic Approach Applied to 9-epi-Ambrox®

and tocotrienols

In a first demonstration of the hybrid approach where the intermediate produced is not found on the target molecule’s biosynthetic pathway, and the target molecule itself is not a natural product, we engineered S. cerevisiae and E. coli to produce 2-Z,6-E-farnesol

(Z,E-FOH, 21). Then, using chemical synthesis, we converted this versatile precursor to the valuable tricyclic labdane ether fragrance 9-epi-Ambrox® (22) and a library of novel analogs with improved ambergris-type organoleptic properties, including, to our knowledge, the first synthetic patchouli scent.

Biosynthesis Chemical synthesis O O O O O

X H H X X X

O O O OH O O O H H HO H 22 Engineered Microbe 21: Z,E-Farnesol X = Br, I (--)-9-epi-Ambrox & novel analogs

Figure 6. Demonstrated hybrid approach to 9-epi-Ambrox® and analogs

In a second demonstration of the hybrid approach, we engineered S. cerevisiae to produce the diterpene geranylgeraniol (GGOH, 23), which we subsequently coupled with trimethylhydroquinone to produce the potent vitamin E tocotrienols (24) in a single step

C-C coupling with concomitant regioselective cycloetherification of the most proximal 12

vinyl group in what constitutes the shortest synthesis of α-tocotrienol to date (Figure 7A).

Likewise, we synthesized three other members of the tocotrienol family. In the latter case, the necessary use of a meta-directing group to prevent over-alkylation of the additional open arene positions led to a great proportion of the obtained product being the uncyclized 3-geranylgeranyl-hydroquinone acetates. We selectively cyclized these products to tocotrienols with a Bronsted acid version of the original acid catalyst system at room (Figure 7B).

Finally, we explored the ability of the novel acid catalyst system that allowed for the single step tocotrienol synthesis to effect asymmetric proton transfer as applied to chiral vitamin E synthesis (Figure 7C).

13

Biosynthesis Chemical synthesis R1 Adanve Acid HO A Type I OH Single step R2 O Triple Fusion- 23: E,E,E-Geranylgeraniol 24: Tocotrienols Engineered Yeast R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ)

R1 R B 1 R3O R3O

R2 OH R2 O

Adanve Acid R Type II 1 R1 R O C 3 R3O

R OH Y 2 R2 O Y

Y = CO2H , , H2C H2C Trolox® Tocopherols Tocotrienols

In(OTf)3 HO Br HO Br N N z O n z N N S O H HO z = H, F Cl n = 1 - 3 Adanve Acid CF3 Adanve Acid Type I Type II

Figure 7. (A) Demonstrated hybrid approach to tocotrienols (B) Mild regioselective cyclization

with type II Adanve acids (C) Asymmetric proton transfer

1.5 Conclusion

Synthetic chemistry has played a pivotal role in the evolution of modern life by providing a reliable alternative to the extraction of important molecules from natural sources, offering novel synthetic materials with advantageous properties such as life- saving therapeutics. More recently, buoyed by levels of control endowed by our 14

improved understanding of biological systems and our enhanced ability to engineer living organisms, the emerging field of synthetic biology holds the promise to bring about another paradigm shift with designer microbes to renewably synthesize complex molecules in a fraction of the time and cost. Still, given nature’s virtuosity at stitching a staggering palette of carbon frameworks with ease and synthetic chemistry’s superior parsing and combinatorial powers to access a greater number of unnatural end products, a hybrid approach that leverages the respective strengths of the two fields could prove advantageous for the efficient production of valuable natural molecules and their analogs.

To demonstrate this approach, I will describe in this thesis how, from biosynthetic

Z,E-farnesol, a library of novel analogs of the commercially important amber fragrance

Ambrox® were produced. Likewise, the valuable tocotrienols were generated from yeast- produced geranylgeraniol in a single step, the first such process of its kind. The novel acid catalyst system that allowed for this unique regioselective cyclization holds promise as an asymmetric proton transfer tool for other applications, opening the door for facile asymmetric chromans and important chiral molecules.

15

1.6 References

(1) Holton, R. A.; Somoza, C.; Kim, H. B.; Liang, F.; Biediger, R. J.; Boatman, P. D.; Shindo, M.; Smith, C. C.; Kim, S. J. Am. Chem. Soc. 1994, 116, 1597. (2) Holton, R. A.; Kim, H. B.; Somoza, C.; Liang, F.; Biediger, R. J.; Boatman, P. D.; Shindo, M.; Smith, C. C.; Kim, S. J. Am. Chem. Soc. 1994, 116, 1599. (3) Nicolaou, K. C.; Yang, Z.; Shi, G.-q.; Gunzner, J. L.; Agrios, K. A.; Gartner, P. Nature 1998, 392, 264. (4) Wohler, F. Ann. Phys. Chem. 1828, 12, 253. (5) Carothers, W. H.; USPO, Ed.; Du Pont: USA, 1938; Vol. US2130523. (6) Nicolaou, K. C.; Sorensen, E. J. Classics in Total Synthesis; VCH: Weinheim, 1996. (7) Nicolaou, K. C.; Snyder, S. A. Classics in Total Synthesis II; Wiley-VCH: Weinheim, 2003. (8) Nicolaou, K. C.; Chen, J. S. Classics in Total Synthesis III; Wiley-VCH: Weinheim, 2011. (9) Mickel, S. J.; Sedelmeier, G. H.; Niederer, D.; Daeffler, R.; Osmani, A.; Schreiner, K.; Seeger-Weibel, M.; Bérod, B.; Schaer, K.; Gamboni, R.; Chen, S.; Chen, W.; Jagoe, C. T.; Kinder, F. R.; Loo, M.; Prasad, K.; Repič, O.; Shieh, W.- C.; Wang, R.-M.; Waykole, L.; Xu, D. D.; Xue, S. Org. Proc. Res. Dev. 2003, 8, 92. (10) Mickel, S. J.; Sedelmeier, G. H.; Niederer, D.; Schuerch, F.; Grimler, D.; Koch, G.; Daeffler, R.; Osmani, A.; Hirni, A.; Schaer, K.; Gamboni, R.; Bach, A.; Chaudhary, A.; Chen, S.; Chen, W.; Hu, B.; Jagoe, C. T.; Kim, H.-Y.; Kinder, F. R.; Liu, Y.; Lu, Y.; McKenna, J.; Prashad, M.; Ramsey, T. M.; Repič, O.; Rogers, L.; Shieh, W.-C.; Wang, R.-M.; Waykole, L. Org. Proc. Res. Dev. 2003, 8, 101. (11) Mickel, S. J.; Sedelmeier, G. H.; Niederer, D.; Schuerch, F.; Koch, G.; Kuesters, E.; Daeffler, R.; Osmani, A.; Seeger-Weibel, M.; Schmid, E.; Hirni, A.; Schaer, K.; Gamboni, R.; Bach, A.; Chen, S.; Chen, W.; Geng, P.; Jagoe, C. T.; Kinder, F. R.; Lee, G. T.; McKenna, J.; Ramsey, T. M.; Repič, O.; Rogers, L.; Shieh, W.-C.; Wang, R.-M.; Waykole, L. Org. Proc. Res. Dev. 2003, 8, 107. (12) Mickel, S. J.; Sedelmeier, G. H.; Niederer, D.; Schuerch, F.; Seger, M.; Schreiner, K.; Daeffler, R.; Osmani, A.; Bixel, D.; Loiseleur, O.; Cercus, J.; Stettler, H.; Schaer, K.; Gamboni, R.; Bach, A.; Chen, G.-P.; Chen, W.; Geng, P.; Lee, G. T.; Loeser, E.; McKenna, J.; Kinder, F. R.; Konigsberger, K.; Prasad, K.; Ramsey, T. M.; Reel, N.; Repič, O.; Rogers, L.; Shieh, W.-C.; Wang, R.-M.; Waykole, L.; Xue, S.; Florence, G.; Paterson, I. Org. Proc. Res. Dev. 2003, 8, 113. (13) Woolston, B. M.; Edgar, S.; Stephanopoulos, G. Annu. Rev. Chem. Biomol. Eng. 2013, 4, 259. (14) Nakamura, C. E.; Whited, G. M. Curr. Opin. Biotechnol. 2003, 14, 454. (15) Ro, D.-K.; Paradise, E. M.; Ouellet, M.; Fisher, K. J.; Newman, K. L.; Ndungu, J. M.; Ho, K. A.; Eachus, R. A.; Ham, T. S.; Kirby, J.; Chang, M. C. Y.; Withers, S. T.; Shiba, Y.; Sarpong, R.; Keasling, J. D. Nature 2006, 440, 940. (16) Westfall, P. J.; Pitera, D. J.; Lenihan, J. R.; Eng, D.; Woolard, F. X.; Regentin, R.; Horning, T.; Tsuruta, H.; Melis, D. J.; Owens, A.; Fickes, S.; Diola, D.; 16

Benjamin, K. R.; Keasling, J. D.; Leavell, M. D.; McPhee, D. J.; Renninger, N. S.; Newman, J. D.; Paddon, C. J. Proc. Nat. Acad. Sci. 2012, 109, E111. (17) Ajikumar, P. K.; Xiao, W. H.; Tyo, K. E.; Wang, Y.; Simeon, F.; Leonard, E.; Mucha, O.; Phon, T. H.; Pfeifer, B.; Stephanopoulos, G. Science 2010, 330, 70. (18) Schalk, M.; Pastore, L.; Mirata, M. A.; Khim, S.; Schouwey, M.; Deguerry, F.; Pineda, V.; Rocci, L.; Daviet, L. J. Am. Chem. Soc. 2012, 134, 18900. (19) Tang, L.; Shah, S.; Chung, L.; Carney, J.; Katz, L.; Khosla, C.; Julien, B. Science 2000, 287, 640. (20) Steen, E. J.; Chan, R.; Prasad, N.; Myers, S.; Petzold, C. J.; Redding, A.; Ouellet, M.; Keasling, J. D. Microbial Cell Factories 2008, 7, 36. (21) Chang, M. C.; Keasling, J. D. Nat. Chem. Biol. 2006, 2, 674. (22) Leonard, E.; Yan, Y.; Koffas, M. A. Metabolic engineering 2006, 8, 172. (23) Ro, D. K.; Paradise, E. M.; Ouellet, M.; Fisher, K. J.; Newman, K. L.; Ndungu, J. M.; Ho, K. A.; Eachus, R. A.; Ham, T. S.; Kirby, J.; Chang, M. C.; Withers, S. T.; Shiba, Y.; Sarpong, R.; Keasling, J. D. Nature 2006, 440, 940. (24) Tan, J. S.; File, T. M., Jr. The Medical clinics of North America 1995, 79, 679. (25) Croteau, R.; Ketchum, R. E.; Long, R. M.; Kaspera, R.; Wildung, M. R. Phytochemistry reviews : proceedings of the Phytochemical Society of Europe 2006, 5, 75. (26) Kinzurik, M. I.; Hristov, L. V.; Matsuda, S. P. T.; Ball, Z. T. Org. Lett. 2014, 16, 2188. (27) Kirschning, A.; Hahn, F. Angew. Chem. Int. Ed. 2012, 51, 4012.

17

CHAPTER 2

Z,E-Farnesol Biosynthesis 18

2.1 Introduction

Plant secondary metabolites constitute a vast and diverse group of molecules that have been evolved for millions of years to fulfill a range of purposes including defense, signaling, growth, and reproduction. Astoundingly, these metabolites are all derived from a common precursor, acetyl CoA—one could go even further back through glucose to carbon dioxide and water—showcasing nature’s virtuosity for stitching together monomers to yield a wide array of molecular structures. Figure 1 illustrates this natural complexity.

Peptides Polyketides

Fatty Acids Polyphenols OH HO O O O Glycolysis O + OH Alkaloids OP (>12,000) HO OH SCoA OH O OH Pyruvic Acid Monoterpene D-Glucose Glyceraldehyde-3-P Acetyl-CoA Indole Alkaloids MEP MVA (> 4,000) IDI Terpenes OPP OPP (> 55,000) DMAPP IPP

Figure 1. Nature’s synthetic pathway to diverse architectures from a single starting point.

For hundred of years, key classes of these secondary metabolites have found crucial human applications. Given their large biodiversity, desirable properties, and extensively studied biosynthesis and chemical reactivity, terpenes lend themselves fittingly to the hybrid approach described in the preceding chapter.

With over 55,000 members, terpenes constitute the largest and most diverse family of secondary metabolites, finding use in numerous human applications including therapeutics, fragrances, and polymers. All terpenes come from a universal 5-carbon 19

building block, isoprene, which can be derived from the prokaryotic methylerythritol phosphate (MEP) pathway or from the eukaryotic mevalonate (MVA) pathway.1-3

Isoprene is then stitched together in a head to tail synthesis as dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP) to yield a linear isoprenoid. This linear molecule can be hydrolyzed to yield prenyl alcohols, or it can be cyclized by different cyclases into a vast palette of carbocyclic frameworks that in turn can undergo rearrangements and functionalization, largely at the hand of P450 enzymes, to yield a staggering diversity of terpenoid molecules. Sesquiterpenes (15 carbon terpenes) are the most diverse class in the terpene family, comprising over 10,000 members. Many key therapeutics such as artemisinin (1), fuels such as farnesane (2), and fragrances such as selinene (3) are sesquiterpenes.

H O OAc HO OH OH HO Geraniol H H Fragrance OPP Menthol Prostratin H Fragrance OH Anti-HIV OPP Analgesic IPP AcO O DMAPP OH Ph O

BzHN O Cholesterol HO H Good and bad OH H O Taxol HOBzO AcO O O Antitumor P P O O OH n O- O- Linear terpene pyrophosphate Beta carotene Pigment, Vitamin A precursor H O H O O H O H

1: Artemisinin 2: Farnesane 3: α-Selinene Antimalerial Diesel fuel Fragrance

Figure 2. Staggering diversity of terpenoids from a universal 5-carbon unit.

20

In our hybrid approach to 9-epi-Ambrox® (5), we aimed to employ Z,E-farnesol

(4, Z,E-FOH), the 2-cis,6-trans isomer of the common sesquiterpene progenitor farnesol as our starting material. Given the cost and difficulty in obtaining Z,E-FOH ($1,000 per mg from commercial sources, seven synthetic steps from geraniol),4,5 we aimed to engineer S. cerevisiae (yeast) and E. coli for cheap and renewable production of this starting material.

Biosynthesis Chemical synthesis O O O

X H H X

O O OH O Y

H H HO H 5 Engineered 4: Z,E-FOH (--)-9-epi-Ambrox & novel analogs X = Br, I Microbe Y = O, CH2

Figure 3. Hybrid approach to 9-epi-Ambrox® from Z,E-FOH

EtO OEt 1. KOtBu P O O O O O 2. (OEt)2POCl 1. PBr3 1. Separ. OH OEt OEt 2. Ethylaceto- 3. HCl 2. MeLi, EtO O acetate MeMgCl NaH, nBuLi 6: Geraniol 7 8 9

1. PBr 3 O O LAH 2. NaOEt, O 3. NaOH, Δ

1. (Ph)3PCH3Br, O O H2O/ O nBuLi P(Ph)3 P(Ph)3 CH2O Hexanes 2. sBuLi OH Li O Li 10: geranyl- 11 12 4: Z,E-FOH acetone

Figure 4. Chemical approaches to Z,E-FOH

21

Terpenoid production in heterologous hosts is typically achieved by first enhancing the pool of IPP and DMAPP by overexpressing the MEP or MVA pathways.6-8

With the MVA pathway in yeast, overexpression of the rate-limiting hydroxymethyl-Co-

A reductase (HMG1) often combined with repression of ERG9 (squalene synthase, which diverts FPP and GGPP to ergosterol synthesis) is often sufficient to achieve this goal.9

Then, overexpression of the appropriate isoprenoid diphosphate synthases and cyclases allows for the condensation of the 5-carbon monomers and their cyclization to reach the desired structure. However, the ERG9 repression or mutation approach requires supplemention of the fermentation media with ergosterol, an essential component of yeast cell membranes.

In our case, in addition to overexpression of the MEP pathway (E. coli) and

HMG1 enzyme (yeast), we required a Z,E-FPPS that would catalyze the formation of

Z,E-farnesylpyrophosphate, which in turn would be hydrolyzed by endogenous phosphatases such as DPP1 to yield our desired Z,E-FOH (4).

Figure 5. Strain design for Z,E-FOH production in engineered microbes. A) MEP in E. coli. B) MVA in S. cerevisiae. 22

2.2. Z,E-farnesylpyrophosphate synthases (Z,E-FPPS)

Naturally, most organisms, including yeast and E. coli, possess native farnesylpyrophosphate synthases (FPPS) that catalyzes the formation of the trans,trans- farnesyl isomer. With the exception of the long-chain (C40–C200) isoprenoid synthases that catalyze the formation of Z isoprenoids,10,11 few Z-FPP synthases have been identified. To date, only four Z,E-FPPS have been cloned, all from acid fast bacteria (M. tuberculosis, T. fusca, C. glutamicum, and C. efficiens).12,13

To achieve production of the target Z,E-FOH in our host strains, we imported all four known Z,E-FPPS into E. coli strains and the two Z,E-FPPS with the best reported kinetics13 (those from M. tuberculosis and T. fusca) into yeast. The heterologously expressed Z,E-FPPS relies on the endogenous 5-carbon terpene precursors IPP and

DMAPP as building blocks for assembly of Z,E-FOH. While E,E-farnesyl pyrophosphate

(E,E-FPP) is a substrate for several downstream processes in yeast as well as E. coli, we anticipated that Z,E-farnesyl pyrophosphate (Z,E-FPP) would not be diverted into downstream biosynthetic processes due to the altered geometry about the double bond.

2.3 Z,E-farnesol in E. coli

In E. coli over-expressing a subset of the B. subtillis MEP pathway, the Z,E-FPPS from M. tuberculosis (Rv1086) led to the best Z,E-FOH production (8.0 mg/L in flasks and 2.9 mg/L at bench scale production). In flasks, the Rv1086-engineered strain also produced E,E-FOH at 2.1 mg/L. Interestingly, the level of E,E-FOH production (0.037 mg/L) was much lower at bench scale comparatively to the decrease in Z,E-FOH titers, suggesting that the large scale conditions were more conducive to greater ratios of Z,E-

FOH product. 23

Of the other Z,E-FPPS-engineered strains, only uppS1 (C. glutamicum) led to

Z,E-FOH production (0.77 mg/L) and some E,E-FOH (0.10 mg/L). Ce1055 (C. efficiens) produced only E,E-FOH (0.76 mg/L) while Tfu0456 (T. fusca) also produced only E,E-

FOH but at 0.054 mg/L (Figure 6).

Figure 6. Z,E-FOH production titers (mg/L) in Z,E-FPPS-engineered E. coli.

Figure 7. Z,E-FOH production titers (mg/L) in Z,E-FPPS-engineered E. coli. *Data from

Acidophil 24

While we were not too surprised that the Ce1055 and uppS1-engineered strains did not produce much Z,E-FOH given their less favorable kinetics, we were puzzled that the Tfu0456-engineered strain did not produce any Z,E-FOH in our hand not only

13 because of its more favorable Kcat/Km, but also because our collaborators at Acidophil,

LLC (who constructed the E. coli strains for us) reported that the Tfu0456-engeneered strain had the second highest production of Z,E-FOH to the Rv1086-engineered strain

(Figure 7). That our fermentation of the same Tfu0456-engeneered strain leading to no

Z,E-FOH could be explained by the differences in colonies tested (see Section 2.5 of this

Chapter) or other fermentation condition differences, as we encountered all of these challenges in our fermentation of the Rv1086-engeneered strain. Solubility and folding issues could also play a role. These latter factors, i.e. differing kinetics, solubility and folding, could also explain why the differing Z,E-FOH production levels between the four Z,E-FPPS-engineered strains, suggesting that Rv1086 may have the best properties for expression in E. coli.

As such, we selected the E. coli strain engineered with Rv1086 for bench scale production. We found that a combination of 10–20% decane content by volume and a water bath to maintain constant 29.5 ºC temperature were helpful for Z,E-FOH production at this scale in our rudimentary fermentor (vide infra). Unlike previous hypotheses that the decane overlay helps prevent the loss of volatile farnesol,14 we believe that given farnesol’s high boiling point (284 ºC) a more likely explanation for the positive effect of decane on farnesol prodution is that it helps extract the farnesol product out of the cell, which prevents the deleterious effects that overproduction of prenyl 25

alcohols has on the organism.15 Surfactants in general were found to have the same effect and enhanced prenyl alcohol production in microbes when added to the fermentation media.15 As such, we evaluated isopropyl myristate as a possible additive, but the more volatile decane made it more suitable for product processing.

During the course of our fermentations, an independent report16 was published where E. coli was engineered with Rv1086 (Z,E-FPPS from M. tuberculosis) to produce

Z,E-FOH. In this report, they achieved production by fusing Rv1086 to ispA (native E,E-

FPPS), hypothesizing that the GPP (geranylpyrophosphate) produced by the native ispA was engaged by Rv1086. We found that this fusion was not necessary, and that the Z,E-

FPPS on its own could drive Z,E-FPP production in E. coli as evidenced by Z,E-FOH production.

As described in the next section, we did engage the fusion strategy in yeast, albeit one different from the reported ispA–Rv1086.

2.4 Z,E-farnesol in yeast

To achieve Z,E-FOH production in yeast, we chose to focus our efforts on Z,E-

FPPS from M. tuberculosis (Rv1086) and T. fusca (Tfu0456) given that they were reported to have the two highest Kcat/Km out of the four known Z,E-FPPS. For the background strain, we chose ATCC200589, which has been reported to produce E,E-

FOH in titers of 2.2 mg/L when engineered with a truncated version of HMG1 (tHMG1) lacking the regulatory domain (Δ1192–1266).17 Our hypothesis was that Z,E-FPPS in a background strain with a large pool of IPP and DMAPP would be beneficial to Z,E-FOH production. 26

However, when we over-expressed Z,E-FPPS Rv1086 and Tfu0456 in the

ATCC200589/tHMG1 background, we detected no production of Z,E-FOH in either resulting strains (Figure 8) but saw squalene (~2.5 mg/L) and E,E-FOH (<0.3 mg/L) production. Additionally, we introduced double fusion constructs of Rv1086 and Tfu0456 with DPP1, hoping to take advantage of the enhanced substrate channeling effect (see

Chapter 4 for a more in-depth discussion of fusion strategies) that we have seen in other cases. We found that none of these double fusion engineered strains produced our desired

Z,E-FOH, but that the combination ATCC200589/tHMG1/DPP1-Tfu0456 surprisingly led to high levels of E,E-FOH production (20.3 mg/L, Figure 8) with ten-fold lower squalene (Figure 8) than the background ATCC200589/tHMG1. This outcome could be due to the over-expressed DPP1 in the fusion construct hydrolyzing E,E-FPP to produce

E,E-FOH, thus reducing the available pool of E,E-FPP for ERG9 to produce squalene.

Figure 8. Z,E-FPPS-engineered yeast produced E,E-FOH (mg/L)

In our fermentations of ATCC200589/tHMG1/DPP1-Tfu0456, we observed a significant side product peak at retention time of ~9.90 min that possessed a similar mass spectra and retention time (~9.90 min) to a side product peak in our synthetic Z,E-FOH 27

standard (see Figure S5 in the experimental section). Although this unidentified side product peak was also present at lower levels in the background strain

ATCC200589/tHMG1, the fact that we observed the same peak in our initial E. coli-

Rv1086 fermentations without decane and its disappearance when we employed a 20% decane by volume additive suggest that it could be a degradation product of FOH, with

Z,E-FOH being more prone to this degradation given its lower stability. Unfortunately, we could not test whether increased decane levels in the ATCC200589/tHMG1/DPP1-

Tfu0456 fermentation would lead to detectable Z,E-FOH given that the strain’s growth was severely impaired when more than 5% decane was added. Alternative surfactants that are more compatible to yeast growth but also conducive to rapid GC-MS quantification could be helpful in the future to solve this problem (isopropyl myristate is compatible with yeast survival but not GC quantification in our hands). It is also possible, given that we only tested one codon-optimized version of our constructs, that different codon optimizations of the Z,E-FPPS could lead to Z,E-FOH production in yeast.

2.5 High-ATCC200589/tHMG1: A Yeast Background Strain For Terpenoid

Production

When we over-expressed tHMG1 under the strong, constitutive promoter TEF1 in

ATCC200589, the result was increased production of E,E-FOH, geranylgeraniol

(GGOH), and squalene as compared to the starting strain which only produced E,E-FOH to barely detectable levels (Figure 8). Out of 6 independent colonies of

ATCC200589/tHMG1 screened, 2 produced a 10-fold higher titers of E,E-FOH, GGOH, 28

and squalene (high-ATCC200589/tHMG1) compared to the other 4 (low-

ATCC200589/tHMG1).

Extracted Yield (mg/L) Side peak 10 EE-FOH NOH 1 GGOH Squalene

Log scale 0.1

0.01 (4) (2) (4) (3) (4) (3) ATCC200589 (3) ATCC200589 (EA-14) (3) ZE2-T3) (3) Tfu0456-DPP1 Low ATCC200589/ Low High ATCC200589/ High Rv1086-DPP1 (AN- tHMG1 (AN-ZE1-T7) tHMG1 (AN-ZE1-T7) DPP1-Rv1086 (EA-3) Rv1086 (AN-ZE5-T2) DPP1-Tfu0456 (CP51) Tfu0456 (AN-ZE5-T1) ATCC200589/tHMG1/ ATCC200589/tHMG1/ ATCC200589/tHMG1/ ATCC200589/tHMG1/ ATCC200589/tHMG1/ ATCC200589/tHMG1/

Figure 9. Prenyl alcohol production in ATCC200589-derived strains. **Data is plotted on a log scale. In brackets at the end is the number of independent replicates. Error bars represent one standard deviation.

These results (Figure 9) suggest that colonies obtained from the same transformation can exhibit large differences in production, possibly due to imbalances in pathway flux as a result of differences in plasmid copy numbers and/or mutations. As such, when engineering cells for heterologous production, it may be beneficial (even necessary) to screen a large number of colonies for the desired phenotype.

The E,E-FOH production titer for the high-ATCC200589/tHMG1 strain was 17.4 mg/L, which is twice the level of production previously reported in the same background strain over-expressing with a different tHMG1 construct and expression plasmid.17 The high-ATCC200589/tHMG1 also produces GGOH at 2.9 mg/L. Thus, high- 29

ATCC200589/tHMG1 may represent a good background strain for the heterologous production of other terpenoids with the expression of specific terpene cyclases and synthases.

2.6 Bench Scale Production Optimizations Without Appropriate Fermenter

Interestingly, the Z,E-FOH titer yields of our Rv1086-engineered E. coli decreased by an order of magnitude when going from production in flask to bench scale production in 6-liter jars when typically an increase by several orders of magnitude have been reported by others with scaled up fermentation.18,19

Our lower yields are likely due to our less than ideal fermentation conditions. For example, we used compressed air instead of oxygen, we had no pH control, or any of the other trappings found on modern fermentors. It is likely that our strains would fare much better in better fermentation conditions with more favorable aeration, pH, mixing, nutrients, and evaporation control.

2.7 Titer Yield Calculation

We calculated our production titer yields based on mg/L of growth media and not on mg/L of the organic extract. Moreover, we did not adjust our titer yields to account for the efficiency of the extraction process. It is known that a significant portion of prenyl alcohols remain bound within the cell membrane even with the addition of a surfactant to the fermentation culture.15 In light of this fact, our actual production titer yields could in fact be higher even in our less than ideal fermentation conditions.

30

2.8 Conclusion

In summary, we expressed the four reported Z,E-FPPS (from acid-fast bacteria M. tuberculosis, T. fusca, C. glutamicum, and C. efficiens) into E. coli and the two with the best reported kinetics (those from M. tuberculosis and T. fusca) into yeast for biosynthetic production of Z,E-FOH. Though our engineered yeast strains did not produce any detectable Z,E-FOH, they surprisingly led to high titers of E,E-FOH. In E. coli, Rv1086 led to the best production titers of Z,E-FOH, allowing us to produce and isolate 50 mg of the biosynthetic material.

While our immediate goal is to employ Z,E-FOH in the synthetic production of 9- epi-Ambrox, our successful heterologous expression of Z,E-FPP holds promise for parallel biosynthetic production of Z-type terpenenoids.

**I would like to note that the following people contributed to the work in this chapter: Caroline Patenode: E. coli–Z,E-FPPS fermentation (including bench scale set-up). Yao Zong Ng: Yeast–Z,E-FPPS strain construction and fermentation. Acidophil, LLC: E. coli–Z,E-FPPS strain construction and initial fermentation. Erik Aznauryan and Pedro Baldera-Aguayo helped with S. cerevisiae cloning and early fermentation trials. 31

2.9 References

(1) Breitmaier, E. Terpenes; Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006. (2) Woolston, B. M.; Edgar, S.; Stephanopoulos, G. Annu. Rev. Chem. Biomol. Eng. 2013, 4, 259. (3) Vranová, E.; Coman, D.; Gruissem, W. Annu. Rev. Plant Biol. 2013, 64, 665. (4) Brown, R. C. D.; Bataille, C. J.; Hughes, R. M.; Kenney, A.; Luker, T. J. The J. Org. Chem. 2002, 67, 8079. (5) Yu, J. S.; Kleckley, T. S.; Wiemer, D. F. Org. Lett. 2005, 7, 4803. (6) Ro, D.-K.; Paradise, E. M.; Ouellet, M.; Fisher, K. J.; Newman, K. L.; Ndungu, J. M.; Ho, K. A.; Eachus, R. A.; Ham, T. S.; Kirby, J.; Chang, M. C. Y.; Withers, S. T.; Shiba, Y.; Sarpong, R.; Keasling, J. D. Nature 2006, 440, 940. (7) Chang, M. C.; Keasling, J. D. Nat. Chem. Biol. 2006, 2, 674. (8) Paddon, C. J.; Keasling, J. D. Nat Rev Micro 2014, 12, 355. (9) Asadollahi, M. A.; Maury, J.; Møller, K.; Nielsen, K. F.; Schalk, M.; Clark, A.; Nielsen, J. Biotechnol. Bioeng. 2008, 99, 666. (10) Brandish, T. D. H. B. P. E. FEMS Microbiol. Lett. 1994, 119, 255 (11) Koyama, T. A. M. N. H. K. T. J. Biosci. Bioeng. 2009, 107, 620 (12) Schulbach, M. C.; Brennan, P. J.; Crick, D. C. J. Biological Chem. 2000, 275, 22876. (13) Ambo, T.; Noike, M.; Kurokawa, H.; Koyama, T. Biochem. Biophys. Res. Comm. 2008, 375, 536. 14) Wang, C.; Yoon, S.-H.; Shah, A. A.; Chung, Y.-R.; Kim, J.-Y.; Choi, E.-S.; Keasling, J. D.; Kim, S.-W. Biotechnol. Bioeng. 2010, 107, 421. (15) Muramatsu, M.; Ohto, C.; Obata, S.; Sakuradani, E.; Shimizu, S. J. Biosci. Bioeng. 2008, 106, 263. (16) Wang, C.; Zhou, J.; Jang, H.-J.; Yoon, S.-H.; Kim, J.-Y.; Lee, S.-G.; Choi, E.-S.; Kim, S.-W. Metabolic Eng. 2013, 18, 53. (17) Ohto, C.; Muramatsu, M.; Obata, S.; Sakuradani, E.; Shimizu, S. Appl. Microbiol. Biotechnol. 2009, 82, 837. (18) Westfall, P. J.; Pitera, D. J.; Lenihan, J. R.; Eng, D.; Woolard, F. X.; Regentin, R.; Horning, T.; Tsuruta, H.; Melis, D. J.; Owens, A.; Fickes, S.; Diola, D.; Benjamin, K. R.; Keasling, J. D.; Leavell, M. D.; McPhee, D. J.; Renninger, N. S.; Newman, J. D.; Paddon, C. J. Proc. Nat. Acad. Sci. 2012, 109, E111. (19) Tokuhiro, K.; Muramatsu, M.; Ohto, C.; Kawaguchi, T.; Obata, S.; Muramoto, N.; Hirai, M.; Takahashi, H.; Kondo, A.; Sakuradani, E.; Shimizu, S. Appl. Environmental Microbiol. 2009, 75, 5536. (20) Dagert, M.; Ehrlich, S. D. Gene 1979, 6, 23. (21) Lerner, C. G.; Inouye, M. Nucleic Acids Res. 1990, 18, 4631. (22) Zhao, Y.; Yang, J.; Qin, B.; Li, Y.; Sun, Y.; Su, S.; Xian, M. Appl. Microbiol. Biotechnol. 2011, 90, 1915. (23) Sikorski, R. S.; Hieter, P. Genetics 1989, 122, 19. 32

2.10 Experimental Section Culture media E. coli LB media was made from Miller powdered mix (broth:10285, plates:10283), TB media was made from BD-Difco powdered mix (243820). 99% glycerol (G5516), D-(+)-glucose (G7021), ampicillin sodium salt (A0166) and spectinomycin dihydrochloride pentahydrate (S40014) were purchased from Sigma-Aldrich.

S. cerevisiae

YPD media (1L): 10g BD Bacto Yeast Extract (212750), 20g Bacto Peptone (211677), dH2O to 950mL, autoclave; when cooled to 50ºC add 50mL 40% glucose. For yeast SC selective media, see Table S4 and S5.

Strain construction E. coli

20 E. coli BL21 (DE3) cells were made competent using CaCl2 and transformed with plasmid pA8 (carrying an IPTG-inducible subset of the B. subtillis MEP pathway) and with one of four plasmids carrying various Z,E farnesol pyrophosphate synthases (Z,E-FPPases) under an IPTG- inducible promoter. The four Z,E-FPPases were derived from various species of bacteria and codon-optimized for expression in E. coli: M. tuberculosis/RV1086 (pFPP2), T. fusca/Tfu0456 (pFPP3), C. efficiens/CE1055 (pFPP4) and C. glutamicum/uppS1 (pFPP5). E. coli transformants were selected on LB plates containing 50mg/L spectinomycin (for pA8) and 100mg/L ampicillin (for pFPPs).

S. cerevisiae The yeast (Saccharomyces cerevisiae) strain ATCC200589 was obtained from the American Type Culture Collection, Rookville. The other strains used in this study (see Table S1) were constructed by transforming various plasmids (see Table S2) into the background strain ATCC200589. Yeast transformation was performed by electroporation at 1500V. The transformants were cultivated on SC agar plates or liquid media lacking specific amino acids to select for the auxotrophic markers on the plasmids.

Plasmid construction E. coli 33

Four Z,E-FPPases previously identified in four species of bacteria (M. tuberculosis:RV1086, T. fusca:Tfu0456, C. efficiens:CE1055, and C. glutamicum:uppS1)13 were codon-optimized for expression in E. coli and synthesized commercially by DNA 2.0 Inc. Each of the four Z,E- FPPases was amplified by PCR (see Table S3) to add NcoI and XhoI restriction sites on the 5’ and 3’ ends respectively. The resulting amplicons and pTrc2B vector were digested with NcoI and XhoI, and the construct inserted via InFusion cloning (Clontech), to create the four IPTG- inducible Z,E-FPPase expression plasmids pFPP2, pFPP3, pFPP4 and pFPP5. The cloning mix was transformed into electrocompetent E. coli TG1 cells and selected on LB/ampicillin agar plates. This cloning was performed by our collaborator Acidophil LLC. Plasmid pA8 containing the B. subtilis MEP pathway was also constructed by Acidophil. It consists of a pCL1920 backbone21 with a replication origin from pSC1010 and carrying a spectinomycin resistance cassette. It contains the B. subtilis MEP genes dxs, dxr, ispD, ispF, ispG, ispH and idi, which were codon-optimized for E. coli expression. The genes were cloned under the IPTG-inducible pLac promoter. B. subtilis genes were chosen due to the higher flux through the MEP pathway in B. subtilis compared to E. coli.22

S. cerevisiae The general strategy adopted for the construction of yeast expression plasmids (see Table S2) was: (1) PCR of the individual parts (see Table S3 for primers), (2) overlap/fusion PCR (external primers AN409 and AN412 for all plasmids except pAN127) to create a transcriptional unit (TU) composed of the promoter, ORF and terminator, (3) Gibson assembly to insert the TU into the cut plasmid backbone, and (4) transformation of the Gibson mixture into E. coli TG1 cells for selection on LB/ampicillin plates and amplification prior to transforming into S. cerevisiae. pAN96 was constructed by Gibson assembly of the vector pRS41623 digested with SacI and KpnI, PCR products of the promoter and terminator, as well as synthetic double-stranded gene fragments (gblock-1 and gblock-2, Integrated DNA Technologies) coding for yeast codon- optimized Tfu0456 containing an N-terminal His6-tag and TEV cleavage site. pAN99 was constructed via the same strategy but using gblock-3 and gblock-4 coding for yeast codon- optimized Rv1086 containing an N-terminal His6-tag and TEV cleavage site. pAN193 and pAN194 were constructed by Gibson assembly of the vector pRS426 digested with SacI and KpnI and the PCR amplified transcriptional units from pAN96 and pAN99 respectively (primers AN409 and AN412) (see Table S3). The plasmids pAN137 and pCP51 containing the enzyme fusions were constructed by Gibson assembly of SacI and KpnI-digested pRS426 with a fusion PCR product containing the promoter, N-terminal His6-tag and TEV cleavage site, DPP1, GGGS linker, Rv1086 or Tfu0456 and terminator amplified from pAN99/pAN96 respectively. For these two plasmids, the N-terminal His6-tag and TEV cleavage site were created by primer extension (primers AN466 and AN467) followed by a second round of PCR with the primers AN468 and AN469. The plasmids pAN138 and pAN141 were constructed by Gibson assembly of SacI and KpnI–digested pRS426 with a 34

fusion PCR product containing the promoter, Z,E-FPPases amplified from pAN96/pAN99 respectively, GGGS linker, DPP1 and terminator.

Small scale production trials E. coli E. coli farnesol production was performed in sterilized, baffled, 125mL Erlenmeyer flasks (Corning 4444-125) with culture caps (KimKap 73665-25) in an incubator shaker (New Brunswick, Innova 43R). On Day 1, a single colony was inoculated into a 14mL Falcon culture tube containing 3mL LB with 100mg/L ampicillin and 50mg/L spectinomycin. The culture was shaken at 37°C and 230 rpm for 15 hours. On Day 2, 0.5mL of the saturated overnight culture was added to 50mL of LB with 1% glycerol, 100mg/L ampicillin and 50mg/L spectinomycin. The flasks were grown at 30°C and 230 rpm until they reached an optical density (OD600) of approximately 1.5 (4-6 hrs) as determined by a 1:10 dilution of the culture in LB media. OD600 measurements were carried out in a SpectraMaxPlus 384 spectrophotometer using 1.5mL cuvettes (VWR, 97000-586). At this point, IPTG was added (0.2mM) to induce expression of the MEP pathway components and Z,E-FPPase. An overlay of 4.5mL of decane (95%, Sigma 30570) was added at the time of induction. The culture was harvested on Day 3 after 24 hours post-induction.

S. cerevisiae Yeast prenyl alcohol production was performed in sterilized, 50mL Erlenmeyer flasks (VWR) in an incubator shaker (New Brunswick, Innova 43R) at 30ºC and 230 rpm for a total of 7 days. On Day 1, 0.3 mL of saturated, overnight culture grown in appropriate selective media was added to 2.7mL of SC or YPD media. On Day 2, 3mL of YPD and 150µL of decane (to a final concentration of 2.5%) were added. On Day 3, 4mL of YPD and 100µL of decane were added. Cultures were harvested after incubation for 7 days.

Bench scale production Bench scale E. coli–based production was performed in a Bellco 6L Low Profile Vertical Sidearm Bioreactor vessel. Filtered air was supplied via a sidearm sparger, and vented via two exit ports equipped with moisture traps (see Fig.S6). The 6L vessel was placed in a water bath to maintain the temperature at 29.5°C. Mixing of the broth was achieved by the sparged air. There was no control of dissolved oxygen, pH, nutrient availability or culture volume. Bench scale production was attempted only with the FPP2/A8 E. coli strain. On Day 1, a single colony was inoculated into a 14mL Falcon culture tube containing 3mL LB with 100mg/L ampicillin and 50mg/L spectinomycin, and grown at 37°C and 230 rpm for 8 hours. The 3mL culture was then used to inoculate 25mL of the same media and incubated for 15 35

hours at 37°C and 230 rpm. On Day 2, the 25mL overnight culture was added to 2.5L of TB broth and 1% glycerol (autoclaved at 250°F for 45 minutes on Day 1) in a 6L vessel, along with 400µl of Sigma Antifoam-400, 100mg/L ampicillin and 50mg/L spectinomycin. The culture was grown until it reached an OD600 of approximately 0.3 (4-6 hours), at which time 0.2mM IPTG was added to induce expression of the Z,E-FPPase RV1086 and MEP pathway components. 375mL of decane was added to the 6L vessel at the time of induction to form an overlay. Pulses of glycerol (25mL, 1% of final vol) were added at 8 and 16 hours post-inoculation. At 24 hours post-inoculation, 1L of TB media containing the aforementioned concentrations of IPTG and antibiotics was added to replace media lost from the 6L vessel. A further 250mL of decane was also added at this time to replenish the overlay. The content of the 6L vessel was collected and extracted with ethyl acetate at 48 hours post-induction.

Prenyl alcohol extraction E. coli Small scale flask fermentations were transferred into a 50mL falcon tube. The inside of the flask was rinsed with 5mL of ethyl acetate (99.5%, Sigma 437549), and combined with the fermented broth. 1mL of brine was added to aid separation. The tube was vortexed vigorously for 4x30 seconds. The tube was then centrifuged at 3200 rpm for 10 minutes and the top organic layer was filtered and transferred to a glass GC-MS vial for analysis. Bench scale fermentations were transferred into a 2L separation funnel in batches of 1L. 500mL of ethyl acetate and 20mL of brine were added to each batch in the funnel, and the contents shaken vigorously. Separation was allowed to occur and the aqueous layer was removed and re- extracted once more as above. The organic layer was transferred into centrifuge tubes and spun at 4000 rpm for 10 minutes to break the emulsion. The organic layers were concentrated under reduced pressure and the residue dissolved in hexane (99%, Sigma 32293) for GC-MS analysis. 50 mg of Z,E-FOH was isolated from these concentrates following drying (MgSO4) and purification on silica gel.

S. cerevisiae

1mL of the final culture broth was removed for pH and OD600 measurements. The remainder of the culture (~8.4mL) was transferred into a 15mL falcon tube containing 1mL of brine. 2mL of hexane was used to rinse the flask and added to the falcon tube. The tube was shaken vigorously and then placed horizontally in an incubator shaker (230 rpm) for 1 hour to mix. The mixture was centrifuged at 3200 rpm for 10 min and the top hexane layer was filtered and transferred into a glass GC-MS vial for analysis.

Analysis of prenyl alcohols 36

Z,E-FOH, E,E-FOH, nerolidol, GGOH and squalene were analyzed using a ThermoFinnigan PolarisQ GC-MS (Agilent J&W column, #CP8907, VF-1ms 15m X 0.25mm x 0.25µm). GC-MS runs were carried out with the following method: MS: ion source 225ºC, EI/NICI, mass range 50-600. GC: helium gas, 1.2 ml/min, inlet temperature 225ºC, initial column temperature 50ºC, hold 2.5 minutes, raise at 17ºC/min to 285ºC, hold 3.5 minutes.

E. coli For quantitative analysis of E. coli fermentations, cis-nerolidol (96%, Sigma 72180) was used as an internal standard. A standard concentration curve was created by graphing the ratio of the TIC area of the E,E-farnesol (96%, Sigma 277541) peak to the TIC area of the 25mg/L cis-nerolidol peak for a range of E,E-farnesol concentrations (Fig.S7). To determine the concentration of Z,E- FOH in the biosynthesis extracts, each sample was dosed to achieve a final concentration of 25mg/L cis-nerolidol. The equation of the linear regression of the standard curve was used to calculate the concentration of Z,E-FOH.16 All production values were back calculated and reported as mg/L of culture media. Specifically, the total amount of extracted Z,E-FOH was calculated by multiplying the determined concentration by the volume of the extract. This was then divided by the total volume of culture to determine production yield in mg/L of media.

S. cerevisiae For quantitative analysis of prenyl alcohols, undecanol was used as an internal standard. The ratio of the selected ion peak area (67 mass fragment) of 25mg/L undecanol to that of 25 mg/L of authentic standards was used as a standard ratio. The amount of prenyl alcohol in a sample was determined by comparison of this ratio to the ratio in a sample spiked with 25mg/L undecanol. 37

Figure S1. Z,E-FOH and E,E-FOH production in E. coli Graph showing the yield of Z,E-FOH and E,E-FOH from engineered E. coli strains containing one of four Z,E-FPPases. Bars represent an average of four trials with standard error shown. 38

A

A (i) A (ii) A (iii)

Figure S2. GC-MS traces of E. coli fermentations (A) Gas chromatographs of extract from FPP2 (M. tuberculosis FPPase) flask fermentation in decane (top) and synthetic Z,E-FOH standard in decane (below). Corresponding mass spectra below. Peak (i) denotes the Z,E-FOH product of the FPP2 strain. Peak (iii) denotes the synthesized Z,E-FOH, and peak (ii) denotes a potential degradation product of Z,E-FOH. RT of Z,E-FOH is ~12.12 min. RT of the Z,E-FOH side peak is ~12.05 min. These runs were performed with a different GC column compared to all other traces in this report, hence the different retention times. 39

B Figure S2. GC-MS traces of E. coli fermentations (B) Gas chromatographs of extract from FPP2 bench-scale production in hexane (top) and the synthetic Z,E-farnesol standard (below) in hexane. Corresponding mass spectra below. Peak (i) denotes the added cis-nerolidol standard. Peak (ii) denotes the biosynthesized Z,E-FOH. Peak (iv) denotes the synthesized Z,E-FOH, and peak (iii) denotes the side peak as in (A). RT of cis-nerolidol in hexane is ~8.87 min. RT of standard Z,E-FOH in hexane is ~9.98 min. RT of Z,E-FOH side peak in hexane is ~9.90 min.

B (i) B (ii)

B (iii) B (iv)

40

C Figure S2. GC-MS traces of E. coli fermentations (C) Gas chromatographs of extracts from E. coli strains containing the other Z,E- FPPases: 1) FPP5 (C. glutamicum); 2) FPP4 (C. efficiens); 3) FPP3 (T. fusca); 4) Mix of farnesol isomers (Sigma, W247804) in decane; 5) Synthesized Z,E-FOH standard in decane. Corresponding mass spectra below. Peaks (i), (iv), and (vi) denote the added cis-nerolidol. Peaks (ii) and (vii) denote biosynthesized Z,E-FOH. Peaks (iii), (v) and (viii) denote EE-FOH. RT of cis- nerolidol in decane is ~8.76 min. RT of standard Z,E-FOH in decane (peaks (ix) and (xi)) is ~9.81 min. RT of standard EE-FOH in decane (peak (x)) is ~ 9.95 min.

C (i) C (ii) C (iii)

41

C (iv) C (v) C (vi)

C (vii) C (viii) C (ix)

C (x) C (xi)

42

Figure S3. NMR of biosynthetic Z,E-FOH from E. coli

43

Extracted Yield (mg/L) Side peak 10 EE-FOH NOH

1 GGOH Squalene 0.1

0.01Log Scale (4) (2) (4) (4) (3) (3) (3) ZE2-T3) (3) ATCC200589 (3) ATCC200589 Low ATCC200589/ Low High ATCC200589/ High tHMG1 (AN-ZE1-T7) tHMG1 (AN-ZE1-T7) Rv1086-DPP1 (AN- Rv1086 (AN-ZE5-T2) DPP1-Rv1086 (EA-3) ATCC200589/tHMG1/ ATCC200589/tHMG1/ ATCC200589/tHMG1/ ATCC200589/tHMG1/ Tfu0456 (AN-ZE5-T1) ATCC200589/tHMG1/ ATCC200589/tHMG1/ DPP1-Tfu0456 (CP51) Tfu0456-DPP1 (EA-14)

Figure S4. Prenyl alcohol production in S. cerevisiae Small scale production trials of engineered yeast strains showing the yields of various prenyl alcohols (side peak, E,E-FOH, NOH, GGOH and squalene). Data is plotted on a log scale. In brackets at the end is the number of independent replicates. Error bars represent one standard deviation. 44

B (i) (ii)

(iii) (iv) 45

(v) (vi)

(vii)

46

Figure S5. GC-MS traces of S. cerevisiae fermentations (A) GC chromatographs of: 1. Extract from small scale fermentation trial of CP-51. 2. Extract from small scale fermentation trial of ATCC200589/tHMG1 (AN-ZE1-T7). 3. Synthetic Z,E- FOH standard. 4. Authentic E,E-FOH standard (96%, Sigma 277541). The undecanol internal standard is present in each trace at retention time (RT) ~ 7.68 min. RT of the unidentified side peak is ~ 9.90 min. RT of Z,E-FOH is ~ 9.99 min. RT of E,E-FOH is ~10.12 min. (B) Mass spectra of labeled peaks in the GC chromatographs.

47

Figure S6. Schematic of bench-scale production vessel 48

Farnesol Standard Curve 600 y = 78.829x - 53.682 500 R² = 0.98829 400

300

200

100 farnesol concentration (mg/L) - 0 EE 0 1 2 3 4 5 6 7 Ratio of area of EE-farnesol peak to nerolidol peak

Figure S7. E,E-FOH calibration curve for quantification of Z,E-FOH 49

Table S1. E. coli and yeast strains used in this study

Name Genotype/Plasmids-insert Source FPP2/A8 DH5(DE3)/pA8/pFPP2 This study FPP3/A8 DH5(DE3)/pA8/pFPP3 This study FPP4/A8 DH5(DE3)/pA8/pFPP4 This study FPP5/A8 DH5(DE3)/pA8/pFPP5 This study ATCC200589 MATalpha can1 leu2 trp1 ura3 aro7 ATCC AN-ZE1-T7 ATCC200589/pAN127-tHMG1 This study AN-ZE5-T1 ATCC200589/pAN127-tHMG1/pAN193-Tfu0456 This study AN-ZE5-T2 ATCC200589/pAN127-tHMG1/pAN194-Rv1086 This study CP-51 ATCC200589/pAN127-tHMG1/pCP51-DPP1-Tfu0456 This study EA-3 ATCC200589/pAN127-tHMG1/pAN137-DPP1-Rv1086 This study EA-14 ATCC200589/pAN127-tHMG1/pAN138-Tfu0456-DPP1 This study AN-ZE2-T3 ATCC200589/pAN127-tHMG1/pAN141-Rv1086-DPP1 This study 50

Table S2. Plasmids used in this study

Transcriptional Unit Name Origin Marker Details (Promoter-ORF-Terminator) pSC101, pLac-(dxs, dxr, ispD,ispF, idi, E. coli codon-optimized MEP pA8 SpecR E coli ispH) –T1 components from B. subtilis pBR322, E. coli codon-optimized Z,E- pFPP2 AmpR pTrc-RV1086-rrnBt E coli FPPase from M. tuberculosis pBR322, E. coli codon-optimized Z,E- pFPP3 AmpR pTrc-Tfu0456-rrnBt E coli FPPase from T. fusca pBR322, E. coli codon-optimized Z,E- pFPP4 AmpR pTrc-CE1055-rrnBt E coli FPPase from C. efficiens pBR322, E. coli codon-optimized Z,E- pFPP5 AmpR pTrc-uppS1-rrnBt E coli FPPase from C. glutamicum pAN127 2µ, yeast TRP1 TEF1p-tHMG1-ACT1p Truncated tHMG CEN, pAN96 yeast URA3 PGK1p-Tfu0456-ADH1t Codon optimized Tfu0456 CEN, pAN99 yeast URA3 PGK1p-Rv1086-ADH1t Codon optimized Rv1086 pAN193 2µ, yeast URA3 PGK1p-Tfu0456-ADH1t Codon optimized Tfu0456 pAN194 2µ, yeast URA3 PGK1p-Rv1086-ADH1t Codon optimized Rv1086 pAN137 2µ, yeast URA3 PGK1p-DPP1-Rv1086-ADH1t Fusion of DPP1-Rv1086 pAN138 2µ, yeast URA3 PGK1p-Tfu0456-DPP1-ADH1t Fusion of Tfu0456-DPP1 pAN141 2µ, yeast URA3 PGK1p-Rv1086-DPP1-ADH1t Fusion of Rv1086-DPP1 pCP51 2µ, yeast URA3 PGK1p-DPP1-Tfu0456-ADH1t Fusion of DPP1-Tfu0456 51

Table S3. Primers and dsDNA gene fragments (gblocks) used in this study

Name Plasmid Template Sequence (5’ – 3’) CACTAAAGGGAACAAAAGCTGGAGCTATAGCTTCAAA AN569 pAN127 TEF1p-F ATGTTTCTACTCC GTTTTCACCAATTGGTCCATAAACTTAGATTAGATTGC AN387 pAN127 TEF1p-R TATGCT TAGCAATCTAATCTAAGTTTATGGACCAATTGGTGAA AN388 pAN127 tHMG1-F AACTGAAG TACGCGCACAAAAGCAGAGATTAGGATTTAATGCAGG AN401 pAN127 tHMG1-R TGACGG AN402 pAN127 ACT1t-F TCACCTGCATTAAATCCTAATCTCTGCTTTTGTGCGCG GACTCACTATAGGGCGAATTGGGTACACACTATGATA AN568 pAN127 ACT1t-R TATAAATATAATAGTTTTTCG All CCTCACTAAAGGGAACAAAAGCTGGAGCTCGAAGTAC AN409 except PGK1p-F CTTCAAAGAATGGGGTC pAN127 ATGATGATGGTGCATTTGTTTTATATTTGTTGTAAAAA AN413 pAN96 PGK1p-R GTAGATAATTAC ACAAATATAAAACAAATGCACCATCATCATCACCACG GTAAACCAATTCCTAATCCTTTGTTAGGTTTGGACTCC ACTGAAAACTTATATTTCCAAGGTATTGACCCATTCAC CATGGGTTTACTTAGAATTCCCTTGTACAGATTGTACG AAAGAAGACTAGAACGTGCCTTGTCCAACGCGCCCAA GCCAAGACACGTTGGTGTTATTTTGGACGGTAACAGA gblock-1 pAN96 Tfu0456-1 AGATGGGCTCGTTTGTCCGGTTTGTCTTCACCAAAGGA AGGTCATAGAGCTGGTGCCGAGAAGATCTTCGAACTG TTGGATTGGTGTGACGAAGTTGGTGTCCAAGTCGTCA CTTTGTGGTTACTTTCTACAGATAACTTGGCTCGTCCA CCAGAAGAATTGGAACCATTGTTCGAAATTATTGAAA ATACCGTTAGAAGATTGTGTAATGAAGGTAGAAGAGT TAACCCAATGGGT AATGAAGGTAGAAGAGTTAACCCAATGGGTGCTTTAG ATTTGTTACCAGCTTCTACGGCTCAAGTCATGAAGGA AGCTGGTACCACTACCGAAAGAAACCCAGGTTTATTG GTCAACGTCGCTGTCGGTTACGGTGGTAGAAGAGAAA TCGCTGATGCTGTTAGATCTTTGTTGTTGGAGGAAGCT GCTAAGGGTACTACCTTGGAAGAATTGGCGGAAAGAT gblock-2 pAN96 Tfu0456-2 TGGACTTAGACGATATTGCTAAGCATTTGTACACTAG AGGTCAACCAGACCCAGACTTGTTGATTAGAACCTCT GGTGAACAAAGATTGTCTGGTTTCTTGTTGTGGCAATC TGCTCACTCTGAATTCTACTTCTGTGAAGTTTTCTGGC CAGCCTTCCGTAAGATTGATTTCTTGAGAGCTTTGAGA TCTTATAGCGTCAGACAAAGACGTTTTGGTTGTTAAGC GAATTTCTTATGA 52

CGTTTTGGTTGTTAAGCGAATTTCTTATGATTTATGAT AN414 pAN96 ADH1t-F TTTTAT All TACGACTCACTATAGGGCGAATTGGGTACCGAGCGAC AN412 except ADH1t-R CTCATGCTATACC pAN127 GTGATGATGATGCATTTGTTTTATATTTGTTGTAAAAA AN410 pAN99 PGK1p-R GTAGATAATTAC ACAAATATAAAACAAATGCATCATCATCACCACCATG GTAAACCAATTCCAAACCCATTGTTGGGTTTGGACTCT ACCGAAAACTTGTACTTCCAAGGTATCGACCCATTCA CCATGGAGATTATTCCTCCAAGATTGAAAGAACCATT GTACAGATTGTATGAATTGAGATTGAGACAAGGTTTG GCTGCTTCCAAGTCTGACTTACCAAGACATATAGCTGT gblock-3 pAN99 Rv1086-1 TTTGTGTGATGGTAACAGACGTTGGGCTAGATCTGCC GGTTACGACGATGTCTCTTACGGTTACAGAATGGGTG CTGCTAAGATTGCCGAAATGTTAAGATGGTGTCATGA AGCTGGTATCGAATTGGCTACCGTCTATTTGTTATCTA CTGAAAATTTGCAAAGAGATCCAGATGAACTTGCGGC CTTGATTGAAATCATCACTGACGTTGTCGAAGAAATTT GTGCCCCAGCTAATCACTGGAGCGTT ATTTGTGCCCCAGCTAATCACTGGAGCGTTAGAACCG TCGGTGACTTAGGTTTGATTGGTGAAGAACCAGCTAG AAGGTTGAGAGGTGCTGTTGAATCCACTCCAGAAGTT GCCTCTTTCCACGTTAATGTGGCGGTGGGTTACGGTGG TAGGAGAGAAATTGTCGATGCCGTTAGAGCTTTATTG TCCAAGGAATTAGCTAACGGTGCTACTGCCGAAGAAT gblock-4 pAN99 Rv1086-2 TGGTCGATGCTGTTACTGTTGAAGGTATTTCTGAAAAC TTGTACACTTCCGGTCAACCAGACCCAGACTTGGTTAT AAGAACCTCCGGTGAACAAAGATTGTCTGGTTTCTTG TTATGGCAATCTGCTTATTCTGAAATGTGGTTCACTGA AGCTCATTGGCCAGCTTTCAGACACGTCGATTTCTTGA GAGCCTTGAGAGATTATTCGGCTCGTCATAGATCTTAC GGTCGATAAGCGAATTTCTTATGA TCTTACGGTCGATAAGCGAATTTCTTATGATTTATGAT AN411 pAN99 ADH1t-F TTTTAT pAN137/ GGTGGTGATGATGATGCATTTGTTTTATATTTGTTGTA AN465 PGK1p-R pCP51 AAAAGTAGATAATTAC pAN137/ HIS -TEV- CATCATCATCACCACCATGGTAAACCAATTCCAAACC AN466 6 pCP51 F1 CATTGTTGGGTTTGGACTCTACC pAN137/ HIS -TEV- GTGAATGGGTCGATACCTTGGAAGTACAAGTTTTCGG AN467 6 pCP51 R1 TAGAGTCCAAACCCAACAATGGG pAN137/ HIS -TEV- CAACAAATATAAAACAAATGCATCATCATCACCACCA AN468 6 pCP51 F2 TGGTAAAC pAN137/ HIS -TEV- ATAAACGAAACTCTGTTCATGGTGAATGGGTCGATAC AN469 6 pCP51 R2 CTTGGAAG pAN137/ AAGGTATCGACCCATTCACCATGAACAGAGTTTCGTT AN470 DPP1-F pCP51 TATTAAAACG 53

TAATCTCCATAGAACCACCACCCATACCTTCATCGGA AN471 pAN137 DPP1-R CAAAGGATG AGGTATGGGTGGTGGTTCTATGGAGATTATTCCTCCA AN472 pAN137 Rv1086-F AGATTGAA CATAAGAAATTCGCTTATCGACCGTAAGATCTATGAC AN473 pAN137 Rv1086-R G CTTACGGTCGATAAGCGAATTTCTTATGATTTATGATT AN474 pAN137 ADH1t-F TTTAT GTGATGATGATGGTGCATTTGTTTTATATTTGTTGTAA AN480 pAN138 PGK1p-R AAAGTAGATAATTAC CAACAAATATAAAACAAATGCACCATCATCATCACCA AN481 pAN138 Tfu0456-F CG CTGTTCATAGAACCACCACCACAACCAAAACGTCTTT AN482 pAN138 Tfu0456-R GTCTGAC TTGGTTGTGGTGGTGGTTCTATGAACAGAGTTTCGTTT AN483 pAN138 DPP1-F ATTAAAACG pAN138/ AAATCATAAATCATAAGAAATTCGCTTACATACCTTC AN431 DPP1-R pAN141 ATCGGACAAAGG pAN138/ TCCTTTGTCCGATGAAGGTATGTAAGCGAATTTCTTAT AN432 ADH1t pAN141 GATTTATGATTTTTAT GTGGTGATGATGATGCATTTGTTTTATATTTGTTGTAA AN475 pAN141 PGK1p-R AAAGTAGATAATTAC CAACAAATATAAAACAAATGCATCATCATCACCACCA AN452 pAN141 Rv1086-F TGG CTGTTCATAGAACCACCACCTCGACCGTAAGATCTAT AN476 pAN141 Rv1086-R GACGAG CTTACGGTCGAGGTGGTGGTTCTATGAACAGAGTTTC AN477 pAN141 DPP1-F GTTTATTAAAACG GTAAACCCATAGAACCACCACCCATACCTTCATCGGA AN478 pCP51 DPP1-R CAAAGGATG aggtatgggtggtggttctATGGGTTTACTTAGAATTCCCTTGTA AN479 pCP51 Tfu0456-F C pFPP2, pFPP3, GAGGAATAAACCATGCATCACCATCATCACCAC FPP-FWR NcoI-F pFPP4, pFPP5 Mtub_RW pFPP2 XhoI-R AGCTGCAGATCTCGACTCGAGTTAGCGGCCGTA R AGGAGGTAAAACATATGCATCACCATCATCACCACGG TAAACCAATCCCTAATCCGTTGCTGGGTCTGGATAGC ACGGAAAACCTGTATTTTCAGGGCATTGATCCGTTTAC CATGGAGATTATCCCTCCGCGTCTGAAAGAGCCGTTG optEC- pFPP2 -- TACCGTCTGTATGAGTTGCGTCTGCGTCAAGGTCTGGC RV1086 GGCAAGCAAGTCTGATTTGCCGCGTCACATCGCGGTT CTGTGTGACGGCAATCGCCGTTGGGCACGTTCGGCTG GTTACGACGATGTTAGCTACGGTTATCGTATGGGTGCT GCCAAGATCGCGGAAATGCTGCGTTGGTGCCACGAAG 54

CGGGTATTGAGCTGGCGACCGTGTATCTGCTGAGCAC GGAGAATCTGCAACGTGACCCGGATGAGCTGGCAGCG CTGATCGAGATCATTACCGACGTGGTCGAAGAGATTT GCGCCCCAGCTAACCACTGGTCCGTGCGTACCGTCGG TGACCTGGGTCTGATCGGCGAAGAGCCGGCACGTCGC CTGCGTGGCGCGGTTGAAAGCACCCCGGAAGTGGCAA GCTTCCATGTTAATGTCGCCGTCGGCTATGGCGGTCGC CGCGAAATTGTTGACGCGGTACGTGCACTGCTGTCCA AAGAGCTGGCCAACGGCGCAACCGCGGAAGAGCTGG TGGACGCGGTTACGGTTGAGGGTATTTCTGAGAACTT GTACACCAGCGGCCAGCCGGACCCGGACCTGGTGATC CGCACGAGCGGTGAACAGCGTCTGAGCGGTTTCTTGC TGTGGCAAAGCGCGTACAGCGAGATGTGGTTTACTGA AGCGCACTGGCCAGCGTTCCGTCATGTCGATTTCCTGC GTGCCCTGCGCGATTACTCCGCTCGCCACCGCAGCTA CGGCCGCTAACTCAGA AGCTGCAGATCTCGACTCGAGTTAACAACCGAAGCGA Tfus_RWR pFPP3 XhoI-R C AGGAGGTAAAACATATGCATCACCATCATCACCACGG TAAACCAATCCCTAATCCGTTGCTGGGTCTGGATAGC ACGGAAAACCTGTATTTTCAGGGCATTGATCCGTTTAC CATGGGTCTGCTGCGTATTCCGTTGTACCGCCTGTATG AGCGTCGCCTGGAGCGTGCTCTGAGCAACGCGCCGAA GCCGCGTCACGTCGGTGTGATCCTGGATGGCAACCGC CGCTGGGCCCGTCTGTCGGGCCTGAGCAGCCCGAAAG AGGGTCACCGCGCAGGCGCCGAGAAAATCTTTGAACT GCTGGACTGGTGTGACGAAGTTGGTGTCCAGGTCGTG ACCCTGTGGCTGCTGAGCACCGATAATCTGGCGCGTC CGCCGGAAGAACTGGAACCGTTGTTCGAGATTATTGA optEC- GAACACGGTTCGTCGCCTGTGCAATGAGGGTCGTCGT pFPP3 -- Tfu0456 GTGAATCCGATGGGCGCACTGGACTTGCTGCCGGCTT CCACGGCGCAAGTGATGAAAGAAGCGGGCACCACCA CTGAGCGTAATCCAGGCCTGCTGGTTAACGTTGCCGT GGGTTACGGTGGCCGTCGCGAGATCGCAGACGCCGTC CGTAGCCTGCTGCTGGAAGAGGCGGCGAAGGGTACCA CGTTGGAAGAGCTGGCAGAACGTCTGGATCTGGACGA CATCGCGAAGCACCTGTACACCCGTGGTCAGCCGGAC CCGGATCTGTTGATTCGCACCAGCGGCGAGCAACGCT TGAGCGGTTTCCTGCTGTGGCAGAGCGCGCATTCCGA GTTCTACTTCTGCGAGGTATTTTGGCCGGCATTTCGTA AGATCGACTTCTTGCGTGCGCTGCGTTCTTATAGCGTT CGCCAACGTCGCTTCGGTTGTTAACTCAGA Ceff_RWR pFPP4 XhoI-R AGCTGCAGATCTCGACTCGAGTTACTTGCCGAAAC AGGAGGTAAAACATATGCATCACCATCATCACCACGG optEC- TAAACCAATCCCTAATCCGTTGCTGGGTCTGGATAGC pFPP4 -- CE1055 ACGGAAAACCTGTATTTTCAGGGCATTGATCCGTTTAC CATGCACCCGGGCTGGACCTGTAACTACTCGGATACC 55

CCAGGCGTGCCGGGTCAAGACTGCGTTGCCATTGTGG AACAACGTCCGGATGGTAACCGTGGTGCGGGTGTCCG CGATATCCCGGTCGTGGGTACCCGTTTGCTGAATGTCC TGAATCTGCCGCGTCTGCTGTATCCGTTGTACGAGCGT CGTCTGCTGAAAGAGCTGAACGGTGCCCGTCAACCGG GTCACGTTGCGATTATGTGCGATGGCAATCGTCGTTG GGCGCGTGAGGCTGGTTTTGTTGACCTGTCTCACGGTC ATCGTGTTGGCGCGAAGAAAATCGGCGAGTTGGTCCG CTGGTGTGACGACGTTGATGTGGACCTGGTTACGGTG TATCTGCTGAGCACGGAGAACCTGGGTCGCGACGAGG CGGAACTGCAGCTGCTGTATGACATCATTGGTGATGT GGTTGCGGAGCTGTCTTTGCCGGAAACCAACTGCCGT GTGCGCCTGGTCGGTCATCTGGACTTGCTGCCGAAAG AATTCGCGGAACGTCTGCGTGGCACCGTCTGTGAAAC GGTCGACCACACTGGCGTTGCAGTGAATATTGCAGTT GGCTACGGTGGTCGCCAAGAAATCGTAGATGCTGTGC GCGACTTGCTGACCAGCGCACGTGATGAGGGCAAGAC CCTGGACGAGGTCATTGAAAGCGTTGACGCGCAGGCA ATCAGCACCCACCTGTACACTAGCGGCCAGCCGGACC CGGATCTGGTGATCCGTACGAGCGGTGAGCAACGCCT GAGCGGTTTCATGCTGTGGCAGAGCGCCTATTCCGAG ATTTGGTTCACGGATACCTACTGGCCTGCGTTTCGTCG CATCGACTTCCTGCGCGCACTGCGCGATTACAGCCAG CGTTCCCGCCGTTTCGGCAAGTAACTCAGA Cglu_RWR pFPP5 XhoI-R AGCTGCAGATCTCGACTCGAGTTACTTACCGAAGC AGGAGGTAAAACATATGCATCACCATCATCACCACGG TAAACCAATCCCTAATCCGTTGCTGGGTCTGGATAGC ACGGAAAACCTGTATTTTCAGGGCATTGATCCGTTTAC CATGCTGAACTTGCCGCGTCTGCTGTACCCGGTGTACG AGCGCCGTCTGCTGCGTGAGCTGGATGGTGCAAAACA GCCGGGTCACGTTGCGATCATGTGTGATGGTAATCGC CGCTGGGCGCGTGAGGCAGGCTTCACCGATGTTAGCC ACGGCCACCGCGTCGGCGCGAAGAAAATTGGTGAGAT GGTTCGTTGGTGCGACGACGTGGATGTCAATCTGGTT ACGGTTTATCTGCTGTCTATGGAAAACTTGGGTCGCA optEC- GCAGCGAAGAGCTGCAACTGCTGTTCGACATCATTGC pFPP5 -- uppS1 CGACGTTGCGGACGAATTGGCGCGTCCGGAAACCAAC TGTCGCGTGCGTCTGGTGGGTCACCTGGACCTGTTGCC GGACCCGGTGGCGTGCCGTCTGCGCAAGGCCGAAGAG GCGACCGTAAACAATACCGGCATCGCTGTCAATATGG CAGTTGGCTACGGCGGTCGTCAAGAAATCGTTGATGC AGTCCAAAAGCTGCTGACGATTGGTAAAGACGAGGGC CTGTCCGTCGATGAACTGATCGAGAGCGTCAAAGTGG ATGCTATCAGCACGCATTTGTACACCAGCGGCCAGCC GGATCCAGACCTGGTGATCCGTACTAGCGGTGAGCAA CGTCTGTCCGGTTTCATGCTGTGGCAGTCTGCCTACTC GGAGATTTGGTTCACCGACACCTATTGGCCGGCATTTC 56

GTCGTATTGACTTTCTGCGTGCGATTCGTGACTATAGC CAGCGCAGCCGTCGCTTCGGTAAGTAACTCAGA

Table S4. Yeast synthetic-dropout media recipe

Ingredient Amount to 100mL 2X (13g/L) Yeast Nitrogen Base (YNB) from BD- 50mL Difco (291940) 40% Glucose 5mL 20X amino acid 5mL 1% Histidine (if required) 0.2mL 1% Leucine (if required) 0.9mL 1% Tryptophan (if required) 0.2mL 0.2% Uracil (if required) 1.0mL 4% Bacto-Agar (plates) or dH2O (liquid media) 40mL

57

Table S5. Amino acid preparation 20X amino acid mix To 500mL Sigma-Aldrich Catalog Code Adenine sulfate 0.2g S/A-8626 Arginine HCl 0.2g S/A-5006 **Aspartic acid 1.0g S/A-9256 Glutamic acid 1.0g S/G-1251 Isoleucine 0.3g S/I-2752 Lysine HCl 0.3g S/L-5626 Methionine 0.2g S/M-9625 Phenylalanine 0.5g S/P-2126 Serine 4.0g S/S-4500 **Threonine 2.0g S/T-8625 Tyrosine 0.3g S/T-3754 Valine 1.5g S/V-0500 Autoclave all and add ** when cooled, then sterile filter

Selective amino acids To 200mL Sigma-Aldrich Catalog Code 1% Histidine 2g S/H-8125 1% Leucine 2g S/L-8000 1% Tryptophan 2g S/T-0254 0.2% Uracil 0.4g S/U-0750 autoclave

58

CHAPTER 3

Novel 9-epi-Ambrox® Analogs from Biosynthetic Z,E-farnesol 59

3.1 Introduction to Ambrox®

The tricyclic lambdane ether Ambrox® [registered trademark of Firmenich SA, also known as Ambroxan (Henckel)] is a prized fragrance with a worldwide production volume of 50 tons per year, costing $500 per kilogram to purchase commercially. The story of Ambrox® (1) is another example of the power of synthetic chemistry to supersede natural extraction, specifically in this case, essentially saving the sperm whale

(Physeter macrocephalus) from extinction.

Ambrox® (1) is an oxidative-degradation product of Ambergris, itself a metabolic excretion of the sperm whale.1-3 Ambergris, from the French ambre gris, has been valued by many cultures since the ancient world for its fine organoleptic properties. The famous

English poet Alexander Pope said in 1720, “Praise is like Ambergris. A little whiff of it is very agreeable.” The great demand for ambergris led to the overhunting of the whale, prompting a ban on whaling to protect the species from extinction. One could speculate that even with this ban on whaling, that the sperm whale could still be illegally hunted for its ambergris, were it not for synthetic chemistry’s providing of an alternative for the procurement of Ambrox®, the sought-after degradation product of ambrein (main constituent of ambergris).

Ambrox® was first chemically synthesized from sclareol (2) by chemists at

Firmenich SA in 1950.4,5 Since then, it has been derived from many starting materials including sclareolide (3, current starting material for industrial production), abietic acid

(4), thujone (5), nerolidol (6), farnesol (7), and β-ionone (8) [9].2,6-8 60

OH

O

8: β-Ionone 7: Farnesol

OH OH

O 6: Nerolidol OH H H 2: Sclareol 1: Ambrox® O O 5: α-Thujone O

H 3: Sclareolide HO H O 4: Abietic acid

Figure 1. Synthetic Ambrox® production from diverse starting materials

Furthermore, extensive research programs were instituted to find more powerful analogs of Ambrox®. These structure-activity relationship studies revealed that 9-epi-

Ambrox (9) and the unsaturated analog Superambrox® (10) are, at present, the strongest of the ambergris-type odorants.2,8-11

OH

O O OH 14 steps 6 steps

H H OH Bicyclo[2,2,2] 9: 9-epi-Ambrox® 10: Superambrox® Larixol octenol $$$$

Figure 2. Potent synthetic Ambrox® analogs

However previously reported syntheses of these ambrox analogs are limited by low yield and long synthetic routes.2,8-11 Additionally, the majority of reported Ambrox analogs contain modifications to just the tetrahydrofuran ring, leaving the remaining 61

western region of the molecule essentially unexplored. To address these challenges, we sought to prepare 9-epi-Ambrox through a polyene cyclization of biosynthetically derived

Z,E-farnesol (11). Moreover, by utilizing a halonium-promoted variant of that cyclization, a chemical handle would be introduced at position 3 of the Ambrox molecule that can be used for subsequent functionalization and for the preparation of novel labdane analogs, in addition to any useful properties afforded by the halogen motif itself.

Biosynthesis Chemical synthesis O O O 3 X H H X

O O OH O Y H H HO H 9 Engineered 11: Z,E-Farnesol (--)-9-epi-Ambrox & novel analogs X = Br, I Microbe Y = O, CH2

Figure 3. Hybrid approach to 9-epi-Ambrox® and analogs

With biosynthetic Z,E-FOH in hand (see Chapter 2), we developed a homologation process that maintained the desired cis geometry at position 3 of the product Z,E-homo-FOH.

3.2 Farnesol Homologation

Critically, the homologation of Z,E-FOH to Z,E-homofarnesol (13) required a two-step reduction of the nitrile (12), first with DIBAL-H (an intractable reaction to which we found a unique solution with the use of silica to liberate the aldehyde) and then

NaBH4 (Figure 4A), as attempted alkaline hydrolysis of the nitrile led to cis-trans isomerization of one of the double bonds. 62

Fermentation 1. DIBAL-H A 1. PBr3 OH OH 2. NaCN CN 2. NaBH4 11: Z,E-FOH 13 64% (2 steps) 12 67% (2 steps)

B OH VO(OSiPh3)3 (5 mol%) 92% O OH DMFDMA 15 13 14: E,E-FOH 57% Z,E NMe 2 2 Separation : + LiBEt3H 3 Me2N C OH OH E,E O DMFDMA 90% 91% 18: NOH 16 17

Figure 4. homologation chemistry. A) Four step homologation from biosynthetic Z,E-FOH B) Two step homologation from E,E-FOH C) Two step homologation from nerolidol (previously reported route)

Based on previous reports demonstrating the conversion of nerolidol (18, NOH) to homofarnesol (figure 4C),12 we also explored deriving Z,E-homo-FOH (13) from E,E- farnesol (14). Modifying the previously reported method by the addition of a vanadium oxide catalyst allowed for the synthesis of a mixture of homofarnesyl amides 15 and 16 in 57% yield from E,E-FOH. Although 13 can be reached in just a single additional step, in our hands, this route yields E,E- homo-FOH (17) as the major product over the desired

Z,E-homo-FOH (13), requiring purification to separate the target compound from its isomeric partner (Figure 4B-C) at the amide stage. Thus, this demonstrates the importance of our biosynthetic production of Z,E-FOH to allow for the synthesis of pure

Z,E-homo-FOH. However, if from a standpoint where a mixture of the homologated material is not an issue, say for the production of isomeric mixture of Ambrox®, then the

[2,3] sigmatropic rearrangement homologation method would be the more cost effective approach. 63

3.3 Cyclization to Halo-hydrobenzofurans

We next explored polyene cyclization of Z,E-homo-FOH (13) using the previously developed halonium-based reagents BDSB (bromodiethylsulfonium bromopentachloroantimonate, Et2SBr•SbBrCl5) and IDSI (iododiethylsulfonium iodopentachloroantimonate).13-15 These halonium-donating reagents can be employed for efficient polyene cyclization that introduces a halogen handle into the polycyclic frameworks. By subjecting Z,E-homo-FOH to BDSB and IDSI in nitromethane at -20 ºC, we obtained 3-Bromo-9-epi-Ambrox (20-Br) and 3-Iodo-9-epi-Ambrox (20-I), respectively, in 41% and 40% yield. The use of a TMS protecting group (19) improves the yields of 20-Br and 20-I respectively to 65% and 64%. These products only have a slight scent, but can be readily converted to fragrant analogs including 9-epi-Ambrox (9).

Me O X O X BDSB H or 20-X IDSI OR + MeNO 2 Me O 13 R = H, 19 R = TMS X O X X = Br, I 21-X

Me Me Me O O O Me O O I H H H H 20-I 9 22 23

Figure 5. Z,E-homoFOH cyclization to 3-halo-9-epi-Ambrox and derivatization to novel analogs

64

3.4 Derivatization

9-epi-Ambrox was readily prepared in 99% yield by radical-mediated reduction of the iodo-derivative, while 2,3-ene- 9-epi-Ambrox (22) was generated in 88% yield by subjecting 20-I to DBU in pyridine. Unfortunately, attempted nucleophilic substitutions at the alkyl halide led predominantly to 22, so we therefore elected to generate further

Ambrox analogs through derivetization of the olefin in 22, namely epoxidation with mCPBA that yielded epoxide 23. These transformations demonstrate that a diversity of molecules can be derived from just a single cyclization product and precursor polyene.

3.5 Discovery of Novel Structure and Ambergris-type Scent

Interestingly, in the IDSI promoted reaction of 13, a side product with a detectable fragrance was obtained, which we found to be the iodinated octahydrobenzofuran derivative 21-I. The addition of 10% toluene to the reaction mixture led to increased yields (20%) of 21-I. Given its mild scent but instability (decomposes when left standing at room temperature), we decided to make the less sterically demanding beta epimer through IDSI promoted cyclization of E,E-homo-FOH (17). This process led to 25 in higher yields, and the compound has a very potent Ambrox-like scent.16 To date, the consensus has been that the three axial methyl groups of the

Ambrox® structure were responsible for conferring the characteristic ambergris scent.9

This understanding is known as the tri-axial rule.

Nevertheless, 25 along with its derivatives 26 and 27 break the tri-axial rule yet retain strong fragrant properties. This may indicate that factors other than the three axial methyl groups are responsible for conferring the characteristic ambergris scent. As such, 65

25, 26, 27 and their future derivatives represent a novel framework in the ambergris class of odorants.

OH Me O Me O IDSI + MeNO2:PhMe I H I 17 9:1 24, 40% 25, 35%

Me O O O

I I 26 27 25

O O O OH

I Br 28 29 30 31

Figure 6. Potent new Ambrox®-type scents that break the tri-axial rule

3.6 Inspiration for a Synthetic Patchouli Scent

Taking inspiration from 25 and 26, materials that break the triaxial rule and yet are strongly odorant, we decided to make the core of these molecules. Thus we prepared homo-geraniol (28), which was subjected to BDSB and IDSI to produce halo-hydrofurans

29 and 30 in 94% and 93% yield, respectively. Interestingly, 29, 30, and their derivative

31 possess patchouli scent,16 making these compounds the first synthetic patchouli odorant to our knowledge and potential patchouli replacer/extender. Furthermore, it is interesting to note the shared hexahydrobenzofuran core between the 26, 31, and

Firmenich’s powerful Superambrox® (10). 66

Further derivatization and/or functional group permutations on this core could prove beneficial. It would also be interesting to synthesize single-point stereochemical epimers of 29, 30, and 31 to determine which one is more responsible for the strong patchouli fragrance. Testing for biological activity is another attractive possibility for further study.

O O O

10: Superambrox® 26 31

Figure 7. Shared structural motif between Firmenich’s Superambrox® and our novel analogs

3.7 Conclusion

In conclusion, we demonstrated the concept of “jigsaw” semi-biosynthesis through the production of a series of novel Ambrox® analogs from biosynthetic Z,E- farnesol. In contrast to previous demonstrations of semi-biosynthesis, we show that it is possible to access natural product scaffolds via biosynthetically derived molecules that are not intermediates in the natural pathway. Importantly, in the approach applied here, a single biosynthetically derived intermediate carries sufficient functionality and complexity that allows for functionalization to complex natural and unnatural products, but does not carry an overly specific and restrictive architecture to limit its utility to a single natural product. Given the diversity of products obtained with simple 67

derivatization shown in Figures 5 and 6, one could imagine far more molecular scaffolds being obtained from this or similar biosynthetically derived molecules. This combined approach could be applied to other classes of molecules in a non-natural pairing of chemical synthesis and synthetic biology to efficiently produce natural products and their homologues.

We would like to note that 18.5 mg of 20-Br was derived, by way of 13, from biosynthetic Z,E-FOH (11). All of our other 9-epi-Ambrox® analogs were derived from

13 produced by chemical means.

68

3.8 References

(1) Frater, G.; Bajgrowicz, J. A.; Kraft, P. Tetrahedron 1998, 54, 7633 (2) Schäfer, B. Chemie in unserer Zeit 2011, 45, 374. (3) Barrero, A. F.; Alvarez‐Manzaneda, E. J.; Chahboun, R.; Arteaga, A. F. Synth. Commun. 2004, 34, 3631. (4) Hinder, M.; Stoll, M. Helv. Chim. Acta 1950, 33, 1251 (5) Stoll, M.; Hinder, M. Helv. Chim. Acta 1950, 33, 1308 (6) Kayama, H.; Kaku, Y.; Ohno, M. Tetrahedron Lett. 1987, 28, 2863 (7) Barrero, A. F.; Alterejos, J.; Alvarez-Manzaneda, E. J.; Ramos, J. M.; Salido, S. J. Org. Chem. 1996, 61, 2215 (8) Paquette, L. A.; Maleczka, R. E. J. Org. Chem. 1991, 56, 912 (9) Ohloff, G.; Giersch, W.; Pickenhagen, W.; Furrer, A.; Frei, B. Helv. Chim. Acta 1985, 68, 2022. (10) Farris, C.; Farris, I. Angew. Chem. Int. Ed. 2006, 45, 6904 (11) Fehr, C.; PCT, Ed.; Firmenich SA: 2009. (12) Buchi, G.; Cushman, M., Wuest, H. J. Am. Chem. Soc. 1974, 96, 5563 (13) Snyder, S. A.; Treitler, D. S. Angew. Chem. Int. Ed. 2009, 48, 7899. (14) Snyder, S. A.; Treitler, D. S.; Brucks, A. P. J. Am. Chem. Soc. 2010, 132, 14303. (15) Snyder, S. A.; Brucks, A. P.; Treitler, D. S.; Moga, I. J. Am. Chem. Soc. 2012, 134, 17714. (16) According to fragrance expert. (17) Mori, K.; Funaki, Y. Tetrahedron 1985, 41, 2369. (18) Couladouros, E. A.; Vidali, V. P. Chem. Eur. J. 2004, 10, 3822.

69

3.9 Experimental Section

General procedures: Unless otherwise stated, all reactions were carried out under argon atmosphere with dry solvents under anhydrous conditions. Reagents were purchased from commercial vendors at the highest available purity and used without further purification. Dry dichloromethane (DCM), diethyl ether (Et2O), and tetrahydrofuran (THF) were purchased from Sigma-Aldrich; nitromethane was stored over 3 A molecular sieves for 2 days before use. All reactions were stirred magnetically and monitored by TLC performed on 0.25 mm E. Merck silica gel plates (60F-254) using UV light as the visualizing agent or cerium ammonium molybdate (CAM) and heat as the developing agent. Silica gel (SiliCycle 60, academic grade) was used to carry out flash column chromatography. Unless otherwise recorded, yields refer to purified materials with spectroscopically (1H and 13C NMR) homogeneity. NMR spectra were recorded on Bruker DRX-300, DRX-400, and DRX-500 instruments calibrated using residual undeuterated solvents as internal reference. Multiciplicities were represented by the following abbreviations: s = singlet, d = doublet, t = triplet, q = quartet, dd = doublet of doublet, ddd = doublet of doublet of doublet, m = multiplet, br = broad. IR spectra were recorded on a Perkin Elmer Spectrum Two® FT-IR spectrometer, and High-resolution mass spectra (HRMS) were recorded in the Columbia University Mass Spectral Core facility on a Waters XEVO G2XS QToF mass spectrometer using electrospray ionization (ESI), atmospheric solids analysis probe (ASAP) and atmospheric pressure chemical ionization (APCI) techniques.

Abbreviations: DCM = dichloromethane, MgSO4 = Magnesium sulfate, Et2O = diethyl ether, TMHQ = trimethylhydroquinone, (NH4)2SO4 = Ammonium sulfate, NH4Cl = ammonium chloride, EtOH = ethanol, MeOH = methanol, DI = distilled, HCl = hydrogen chloride, RT = room temperature, DCE = 1,2-dichloroethane, EtOAc = ethyl acetate, DMFDMA = N,N-dimethylformamide dimethyl acetal (VO(OSiPh3)3) = Tris(triphenylsiloxy)vanadium oxide, I2 = iodine, TLC = thin layer chromatography, CAM = cerium ammonium molybdate, FOH = farnesol, hFOH = homofarnesol,

A. Cation-π Cyclization precursors preparation Z,E-Homofarnesol (13) from biosynthetic Z,E-farnesol (11): Starting from 45 mg (0.20 mmol) Z,E-farnesol (15) produced from engineered E. coli, 30.4 mg (0.13 mmol, 64%) of Z,E-farnesyl cyanide (12) is prepared as previously reported.17, 18 Subsequently, 12 (30.4 mg, 0.13 mmol, 1 equiv) is dissolved in 0.5 mL of dry dichloromethane and cooled to -78oC. 0.2 mL (0.2 mmol) of a 1M solution of DIBAL in dichloromethane is then added drop-wise and the reaction mixture stirred for 1 hour. Saturated aqueous Rochelle salt (1 mL) is then added and the resulting mixture stirred for another hour at which point, 0.5 mL of aqueous ammonium chloride (NH4Cl) is added and the organic phase is isolated. The aqueous phase is further extracted with dichloromethane (2 x 6 mL), and the pooled organic layers are washed with sodium bicarbonate and brine. The organic phase is then treated with 4 g of silica, filtered and evaporated to yield 21.3 mg (69.4%) of Z,E-homofarnesyl-aldehyde. This material (21.3 mg, 0.091 mmol, 1 equiv) is then dissolved in methanol (0.5 mL) and cooled to 0oC before the addition of 7 mg (0.18 70

mmol, 2 equiv) of sodium borohydride dissolved in 0.5 mL of methanol. The reaction mixture is stirred at room temperature for 30 minutes, quenched with 1 mL of aqueous NH4Cl, and extracted with dichloromethane (3 x 2 mL). After drying the organic layers over magnesium sulfate and removing solvent under vacuum, 21 mg (96%) of Z,E- homofarnesol (13) is obtained as a clear oil. Rf = 0.3 (silica gel, 20% EtOAc:hexanes); -1 1 IR (film) �max 3324 (br), 2964, 2917, 2857, 1667, 1445, 1377, 1046, 834, 559 cm ; H NMR (500 MHz, CDCl3) δ 5.15 – 5.04 (m, 3H), 3.58 (t, J = 6.6 Hz, 2H), 2.26 (td, J = 7.4, 0.9 Hz, 2H), 2.09 – 2.00 (m, 6H), 1.99 – 1.93 (m, 2H), 1.85 (br s, 1H), 1.71 (2 s, 3H), 1.66 (s, 3H), 1.59 (s, 3H), 1.58 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 139.0, 135.7, 131.6, 124.6, 124.2, 121.0, 62.8, 40.0, 32.3, 31.7, 27.0, 26.8, 26.0, 23.8, 17.9, 16.2; + + HRMS (ASAP) calcd for C16H29O [M + H] 237.2218, found 237.2214.

Alternative Homologation chemistry [2,3] sigmatropic rearrangement with DMFDMA E,E-Farnesol (1 g, 4.5 mmol, 1 equiv) and VO(OSiPh3)3 (180 mg, 0.2 mmol, 0.05 equiv) are added to 10 mL of xylenes. The reaction mixture is refluxed for 30 minutes, then DMFDMA (4.8 mL, 36 mmol, 8 equiv) is added and the reaction flask is fitted with a Dean-Stark apparatus filled with xylenes, 3A molecular sieves (MS), and 6 mL DMFDMA. After refluxing overnight, xylenes is evaporated and the remaining residue is applied to silica gel to obtain 703 mg (57%) of a mixture of Z,E-homofarnesyl-N,N- dimethylamide (15) and E,E-homofarnesyl-N,N-dimethylamide (16), which are separated on silica gel (20% EtOAc:Hexanes) into 282 mg of 15 and 421 mg of 16.

One also arrives at 15 and 16 in 90% yield by replacing E,E-Farnesol and VO(OSiPh3)3 with nerolidol (18) in the preceding procedure (see ref. 12, Buchi et al.).

Z,E-Homofarnesyl-N,N-dimethylamide (15): Rf = 0.41 (silica gel, 40% EtOAc:hexanes); IR (film) �max 2965, 2917, 2855, 1648, 1492, 1444, 1392, 1263, 1134, 836 cm-1; 1H NMR (500 MHz, CDCl3) δ 5.31 (t, J = 6.6 Hz, 1H), 5.13 – 5.02 (m, 2H), 3.04 (d, J = 6.7 Hz, 2H), 2.97 (s, 3H), 2.91 (s, 3H), 2.11 – 1.99 (m, 7H), 1.98 – 1.90 (m, 2H), 1.72 (s, 3H), 1.65 (s, 3H), 1.58 (s, 3H), 1.57 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 172.2, 138.4, 135.7, 131.6, 124.5, 124.0, 117.9, 40.0, 37.6, 35.7, 33.5, 32.5, 26.9, 26.4, + + 26.0, 23.7, 17.9, 16.2; HRMS (ASAP) calcd for C18H32NO [M + H] 278.2484, found 278.2484.

E,E-Homofarnesyl-N,N-dimethylamide (16): Rf = 0.32 (silica gel, 40% EtOAc:hexanes); IR (film) �max 2964, 2917, 2854, 1647, 1492, 1443, 1392, 1262, 1134, 835 cm-1; 1H NMR ((500 MHz, CDCl3) δ 5.24 (t, J = 6.1 Hz, 1H), 5.06 – 4.93 (m, 2H), 2.99 (d, J = 6.5 Hz, 2H), 2.92 (s, 3H), 2.85 (s, 3H), 2.06 – 1.92 (m, 6H), 1.92 – 1.84 (m, 2H), 1.59 (s, 3H), 1.57 (s, 3H), 1.51 (s, 6H); 13C NMR (125 MHz, CDCl3) δ 172.1, 138.1, 135.2, 131.3, 124.4, 124.0, 117.0, 39.8, 39.7, 37.4, 35.6, 33.9, 26.8, 26.5, 25.8, + + 17.8, 16.6, 16.1; HRMS (ASAP) calcd for C18H32NO [M + H] 278.2484, found 278.2491.

71

Homofarnesyl-N,N-dimethylamide reduction to homofarnesol: 15 (600 mg, 2.21 mmol, 1 equiv) is dissolved in 6 mL of dry tetrahydrofuran (THF) and o cooled to 0 C with stirring. A 1M solution of Lithium triethylborohydride (LiBEt3H) in THF (8.7 mmol, 4 equiv) is subsequently added, and the reaction mixture is stirred as it warms to room temperature. 100 mL of aqueous NH4)2SO4 is then added along with 50 mL of brine and the reaction mixture is extracted with diethyl ether (3 x 50mL). The organic layers are pooled, dried over magnesium sulfate (MgSO4) and concentrated. The residue is purified by flash column to give 477 mg (92%) of Z,E-homofarnesol (13). Physical spectra of 13 thus produced is identical to that of the material produced using the nitrile homologation method detailed above.

E,E-Homofarnesol (17)”4” is obtained in 93% yield by subjecting 16 to LiBEt3H as above. Rf = 0.3 (silica gel, 20% EtOAc:hexanes); IR (film) �max 3324 (br), 2964, 2917, 2857, 1667, 1445, 1377, 1046, 834, 559 cm-1; 1H NMR (500 MHz, CDCl3) δ 5.14 – 5.04 (m, 3H), 3.57 (t, J = 6.6 Hz, 2H), 2.26 (q, J = 6.8 Hz, 2H), 2.12 – 1.90 (m, 10H), 1.71 (d, J = 1.1 Hz, 1H), 1.66 (s, 4H), 1.62 (s, 2H), 1.58 (s, 8H); 13C NMR (125 MHz, CDCl3) δ 138.9, 138.9, 135.6, 135.5, 131.6, 131.5, 124.6, 124.3, 124.1, 121.0, 120.2, 62.8, 62.6, 40.1, 40.0, 32.2, 31.8, 31.7, 27.0, 26.8, 26.7, 26.0, 24.0, 18.0, 16.4, 16.3, 16.2; HRMS + + (ASAP) calcd for C16H29O [M + H] 237.2218, found 237.2217.

E,E-Homogeraniol and Z,E-homogeraniol (28): First, a homogeranyl-N,N- dimethylamide (S1) is prepared as a mixture of isomers by the reaction of linalool with DMFDMA {clear oil, Rf = 0.35 (E,E) and 0.44 (Z,E) (silica gel, 40% EtOAc:hexanes); -1 1 IR (film) �max 3397 (br), 2965, 2923, 1643, 1447, 1394, 1132, 830 cm ; H NMR (500 MHz, CDCl3) δ 5.25 – 5.19 (m, 1H), 5.04 – 4.95 (m, 1H), 3.00 – 2.95 (m, 2H), 2.91 (s, 3H), 2.86 – 2.82 (2 s, 3H), 2.04 – 1.91 (m, 4H), 1.65 (d, J = 1.1 Hz, 1H), 1.6 – 1.54 (2 s, 5H), 1.53 – 1.48 (2 s, 3H); 13C NMR (125 MHz, CDCl3) δ 172.3, 172.2, 138.2, 138.1, 131.9, 131.6, 124.2, 124.1, 117.7, 117.0, 39.7, 37.5, 35.6, 33.9, 33.3, 32.3, 26.6, 26.3, + + 25.8, 23.5, 17.8, 17.7, 16.5; HRMS (ASAP) calcd for C13H24NO [M + H] 210.1858, found 210.1861.} Subsequently, this material was reduced with LiBEt3H to furnish 28 as a mixture of isomers. Light oil, Rf = 0.33 (silica gel, 20% EtOAc:hexanes); IR (film) �max 3679, 3348 (br), 2965, 2922, 1441, 1219, 1051, 1016, 833 cm-1; 1H NMR (500 MHz, CDCl3) δ 5.16 – 5.04 (m, 2H), 3.75 (dd, J = 13.5, 6.8 Hz, 1H), 3.60 (t, J = 6.4 Hz, 1H), 2.31 – 2.20 (m, 2H), 2.12 – 2.02 (m, 3H), 1.99 (dd, J = 15.2, 7.2 Hz, 1H), 1.72 (s, 1H), 1.70 (s, 1H), 1.68 (s, 3H), 1.64 (s, 1H), 1.63 – 1.60 (3 s, 4H), 0.91 (t, J = 7.8 Hz, 1H), 0.73 (dd, J = 15.6, 7.8 Hz, 1H); 13C NMR (125 MHz, CDCl3) δ 139.2, 139.1, 137.6, 137.6, 132.2, 132.0, 131.9, 131.7, 124.6, 124.5, 124.5, 124.3, 121.3, 121.1, 120.4, 120.2, 63.6, 63.4, 62.9, 62.7, 40.1, 40.1, 32.3, 32.3, 31.8, 31.7, 30.9, 30.8, 27.0, 27.0, 26.9, 26.8, 26.0, 23.8, + + 23.8, 18.0, 17.9, 16.5, 16.4, 8.2; HRMS (ASAP) calcd for C11H21O [M + H] 169.1592, found 169.1594.

Cyclization Catalysts—BDSB and IDSI: The halonium donors BDSB (bromodiethylsulfonium bromopentachloroantimonate) and IDSI 72

(bis(diethyliodosulfonium)chloride hexachloroantimonate) were synthesized according to the method described by Snyder et al. (refs. 13 - 15). The IDSI preparation method was modified by lowering the volume of DCE such that the concentration of I2 was 0.5 M. This modification improved the product yield to 95%.

3-Bromo-9-(-)-epi-Ambroxide (20-Br)—representative procedure of the Cation-π cyclization to halo-octahydrobenzofurans derivatives: 50 mg (0.213 mmol, 1 equiv) of 13 is dissolved in 21 mL of nitromethane and cooled to - 20oC under argon. To this vigorously stirring mixture, a solution of BDSB (127.4 mg, 0.235, 1.1 equiv) in 0.5 mL of nitromethane is quickly added. The resulting mixture is left to warm to 0oC with stirring over 10 minutes and then 10 mL each of 5% aqueous sodium sulfite (Na2SO3) and sodium bicarbonate (NaHCO3) are successively added and the mixture is stirred vigorously at room temperature for 30 minutes or until all reddish coloration has disappeared. 20 mL of brine is then added to the mixture before it is extracted with dichloromethane (3 x 20 mL). The pooled organic fractions are washed with brine (30 mL), dried over magnesium sulfate, and evaporated to yield 27.4 mg (41%) of 20-Br after column purification (4% EtOAc:hexanes) as a colorless oil that crystallizes into a white solid when stored at 0oC. An alternative method to synthesize 20-Br in higher yield is to protect the free alcohol of 13 with a trimethyl silyl (TMS). The TMS-protected homofarnesol (19) was prepared by dissolving 13 (25 mg, 0.11 mmol, 1 equiv) in nitromethane (0.4 mL), adding bis(trimethylsilyl)amine (HMDS) (19 mg, 0.12 mmol, 1.1 equiv) and stirring at room temperature for 30 minutes. At this point, 3 Å MS (2 beads) is added to the reaction flask to soak up the ammonia side product, the reaction diluted with more nitromethane (9 mL), cooled to -20oC and BDSB directly added to produce 20-Br (21.9 mg, 64%). o Clear oil that crystallizes when stored at 0 C. Rf = 0.22 (silica gel, 15% EtOAc:hexanes); -1 IR (film) �max 3706, 3680, 3665, 2970, 2940, 2922, 2866, 2075, 1322, 1055, 1032 cm ; 1H NMR (500 MHz, CDCl3) δ 3.97 (dd, J = 12.7, 4.2 Hz, 1H), 3.85 (td, J = 9.0, 2.9 Hz, 1H), 3.77 (dd, J = 16.7, 8.4 Hz, 1H), 2.25 (ddd, J = 26.3, 13.3, 3.7 Hz, 1H), 2.11 – 1.86 (m, 4H), 1.69 – 1.41 (m, 8H), 1.37 (s, 3H), 1.36 – 1.21 (m, 5H), 1.14 (s, 3H), 1.10 (s, 3H), 0.94 (s, 3H), 0.88 (s, 1H), 0.84 (s, 1H); 13C NMR (125 MHz, CDCl3) δ 80.7, 69.4, 64.3, 58.9, 47.6, 39.9, 39.7, 36.4, 35.8, 31.2, 31.1, 29.1, 27.8, 23.8, 22.2, 18.7; HRMS + + (ASAP) calcd for C16H27BrO [M ] 315.1324, found 315.1303.

Note that from biosynthetically derived 13 (21 mg, 0.089 mmol), 18.5 mg of 20-Br was derived. For all other halonium induced cyclization to produce the halogenated Ambrox® and novel derivatives, additional 13 was derived by the chemical means described above.

3-Iodo-9-(-)-epi-Ambrox (20-I): By replacing BDSB with IDSI in the procedure for 20- Br, 20-I was produced from 13 in 55% yield. Colorless oil; Rf = 0.22 (silica gel, 15% -1 EtOAc:hexanes); IR (film) �max 2938, 2871, 1460, 1378, 1125, 998, 846, 650, 430 cm ; 1H NMR (500 MHz, CDCl3) δ 4.21 (dd, J = 13.0, 4.1 Hz, 1H), 3.84 (td, J = 9.2, 2.9 Hz, 1H), 3.76 (dd, J = 16.7, 8.4 Hz, 1H), 2.45 (ddd, J = 26.6, 13.3, 3.6 Hz, 1H), 2.30 – 2.23 (m, 1H), 2.05 – 1.95 (m, 1H), 1.94 – 1.85 (m, 2H), 1.74 – 1.65 (m, 2H), 1.61 – 1.52 (m, 4H), 1.50 – 1.16 (m, 2H), 1.14 (s, 3H), 1.08 (s, 1H), 1.07 (s, 3H), 0.98 (s, 1H), 0.97 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 80.7, 64.3, 58.9, 53.9, 46.3, 41.7, 39.4, 36.7, 35.9, 73

+ + 34.1, 33.8, 29.1, 27.8, 23.3, 23.1, 21.6; HRMS (ASAP) calcd for C16H28IO [M + H] 363.1185, found 363.1185.

5-Iodo-4,4-dimethyl-4-homogeranyl-octahydro-9-epi-benzofuran (21-I): was recovered in 8% yield from the reaction of 13 with IDSI. The addition of toluene (10% volume of nitromethane) to the reaction mixture prior to IDSI addition increases the yield of 21-I (20%). Colorless oil; faint ambroxide scent; Rf = 0.31 (silica gel, 15% - EtOAc:hexanes); IR (film) �max 2964, 2925, 2876, 1448, 1379, 1133, 1002, 937, 678 cm 1; 1H NMR (500 MHz, CDCl3) δ 5.07 (t, J = 7.0 Hz, 1H), 4.36 (dd, J = 11.3, 4.9 Hz, 1H), 3.88 – 3.75 (m, 4H), 2.33 – 2.20 (m, 3H), 2.03 – 1.94 (m, 6H), 1.69 (s, 4H), 1.62 (s, 4H), 1.37 (s, 6H), 1.21 (s, 4H), 1.20 – 1.12 (m, 3H), 1.10 – 0.92 (m, 5H); 13C NMR (125 MHz, CDCl3) δ 132.0, 124.5, 80.5, 63.9, 51.6, 46.0, 39.5, 36.3, 34.9, 28.6, 26.9, 26.0, + + 24.5, 22.1, 18.1; HRMS (ASAP) calcd for C16H28IO [M + H] 363.1185, found 363.1186.

9-(-)-epi-Ambroxide (9): 85 mg (0.235 mmol, 1 equiv) of 20-I was dissolved in 3.5 mL of toluene along with tris(trimethylsilane)silane (117 mg, 0.47 mmol, 2 equiv) and azobisisobutyronitrile (11.5 mg, 0.07 mmol, 0.3 equiv) and the reaction was heated at 95oC for 3.5 hours to yield 53.33 mg (99%) of 41 after concentration and silica gel purification (10% EtOAc:hexanes). Clear oil, pleasing scent, Rf = 0.36 (silica gel, 15% EtOAc:hexanes); IR (film) �max 3706, 3680, 3665, 2968, 2940, 2866, 2075, 1346, 1056, 1013, 841 cm-1; 1H NMR (500 MHz, CDCl3) δ 3.84 (td, J = 9.0, 3.0 Hz, 1H), 3.76 (q, J = 8.3 Hz, 1H), 2.03 (dq, J = 12.1, 9.3 Hz, 1H), 1.94 – 1.85 (m, 1H), 1.69 – 1.47 (m, 5H), 1.42 – 1.37(m, 2H), 1.36 (s, 3H), 1.30 – 1.09 (m, 6H), 1.08 (s, 3H), 0.88 (s, 3H), 0.80 (s, 3H), 0.17 – 0.04 (m, 6H); 13C NMR (125 MHz, CDCl3) δ 81.2, 64.4, 59.3, 47.0, 42.6, 39.0, 36.3, 36.1, 33.9, 33.2, 29.1, 28.0, 23.1, 22.1, 20.7, 18.8; HRMS (ASAP) calcd for + + C16H29O [M + H] 237.2218, found 237.2216.

2,3-ene-9-(-)-epi-Ambrox (22): To 20-I (100 mg, 0.28 mmol, 1 equiv) in 0.5 mL of toluene was added DBU (0.43 mL, 2.8 mmol, 10 equiv). The reaction mixture was heated o at 85 C for 6 hours, then brine (5 mL) and NH4Cl (7 mL) were added, and it was extracted with ether (3 X 10 mL). The pooled organic layers were dried over MgSO4, evaporated, and purified over silica (10% EtOAc:hexanes) to yield 57 mg (88%) of 22 as a clear oil. 22 was also obtained as the single product when 20-I is heated (85oC) with NaOH in DMSO for a few hours. Clear oil, pleasing ambroxide-like scent, Rf = 0.3 (silica gel, 15% EtOAc:hexanes); IR -1 1 (film) �max 3715, 3673, 2938, 2866, 1454, 1379, 1055, 723 cm ; H NMR (500 MHz, CDCl3) δ 5.44 (ddd, J = 9.9, 6.0, 1.5 Hz, 1H), 5.32 (dd, J = 10.1, 2.8 Hz, 1H), 3.87 – 3.80 (m, 1H), 3.76 (q, J = 8.4 Hz, 1H), 2.08 – 1.86 (m, 3H), 1.81 – 1.39, (m, 9H), 1.37 (s, 3H), 1.36 – 1.20 (m, 2H), 1.10 (s, 1H), 1.09 (s, 3H), 1.02 (s, 1H), 0.96 (s, 3H), 0.94 (s, 1H), 0.88 (s, 1H), 0.85 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 138.0, 121.8, 80.9, 64.1, 57.2, 43.9, 38.5, 35.3, 34.9, 34.8, 32.0, 29.7, 27.2, 23.4, 23.2, 21.6; HRMS ((ASAP) calcd for + + C16H27O [M + H] 235.2062, found 235.2061. 74

2,3-Epoxy-9-(-)-epi-Ambrox (23): 22 (26 mg, 0.11 mmol, 1 equiv) was dissolved in 1.5 o mL of DCM along with NaHCO3 (49 mg, 0.55 mmol, 5 equiv) and cooled to 0 C with stirring. 29.6 mg (0.17 mmol, 1.5 equiv) of m-Chloroperoxybenzoic acid (mCPBA) was then added and the reaction was stirred at room temperature for 3 hours. Then the mixture was washed with Na2SO3 (2 x 3 mL), NaHCO3 (4 x 3 mL) and brine (3 mL) to yield 23 as a clear oil after drying over MgSO4 and evaporation. NMR showed presence of m- benzoic acid contaminants even following several aqueous NaHCO3 washed—however, 23’s sensitivity to silica gel, further purification was not attempted. Rf = 0.12 (silica gel, - 15% EtOAc:hexanes); IR (film) �max 2942, 2874, 1768, 1466, 1387, 1216, 945, 826 cm 1; 1H NMR (500 MHz, CDCl3) δ 3.85 (td, J = 9.8, 3.9 Hz, 1H), 3.78 (q, J = 8.4 Hz, 1H), 3.29 – 3.21 (m, 1H), 2.84 (t, J = 3.8 Hz, 1H), 2.61 – 2.34 (m, 1H), 2.12 – 1.53 (m, 10H), 1.52 (s, 2H), 1.45 (s, 1H), 1.39 (s, 1H), 1.36 (s, 2H), 1.32 – 1.19 (m, 4H), 1.16 – 0.91 (m, 14H), 0.85 (s, 1H); 13C NMR (125 MHz, CDCl3) δ 86.7, 85.6, 64.0, 62.0, 61.6, 57.3, 55.3, 53.1, 52.4, 39.6, 39.4, 38.4, 38.0, 36.0, 35.3, 34.5, 33.4, 32.6, 29.7, 28.3, 28.3, 26.8, + + 26.6, 25.6, 22.8, 21.0, 20.0; HRMS (ASAP) calcd for C16H27O2 [M + H] 251.2011, found 251.2013.

3-Iodo-Ambrox (24): was obtained as a mixture with its 9-epi isomer by the reaction of E,E-homofarnesol (17) with IDSI. Clear oil, Rf = 0.22 (silica gel, 15% EtOAc:hexanes); -1 1 IR (film) �max 2937, 2870, 1460, 1378, 1126, 998, 846, 650, 431 cm ; H NMR (300 MHz, CDCl3) δ 4.30 – 4.16 (m, 1H), 3.97 – 3.71 (m, 2H), 2.57 – 2.36 (m, 1H), 2.35 – 2.21 (m, 1H), 2.06 – 1.83 (m, 2H), 1.77 – 1.63 (m, 2H), 1.53 (s, 3H), 1.48 – 1.39 (m, 2H), 1.37 (s, 2H), 1.15 (s, 1H), 1.11 – 1.03 (3 s, 5H), 1.00 – 0.96 (2 s, 3H), 0.90 (s, 2H); 13C NMR (125 MHz, CDCl3) δ 78.2, 78.0, 74.3, 74.1, 73.1, 72.7, 72.0, 71.6, 71.5, 69.6, 68.8, 68.4, 68.0, 67.9, 67.8, 67.2, 67.1, 66.9, 66.5, 66.4, 65.2, 64.9, 63.8, 63.8, 63.7, 63.7, 63.3, + + 63.3, 63.2, 61.8; HRMS (ASAP) calcd for C16H28IO [M + H] 363.1185, found 363.1188.

5-Iodo-4,4-dimethyl-4-homogeranyl-octahydro-benzofuran (25): was obtained as a single isomer (35% yield) as a side product of the reaction of E,E-homofarnesol (17) with IDSI to yield 25 (toluene was added to promote this side product generation). Clear oil; potent ambroxide and patchouli scent, Rf = 0.31 (silica gel, 15% EtOAc:hexanes); IR -1 1 (film) �max 2963, 2925, 2875, 1449, 1379, 1133, 1002, 938, 678 cm ; H NMR (300 MHz, CDCl3) δ 5.10 (t, J = 7.1 Hz, 1H), 4.27 (dd, J = 12.7, 4.5 Hz, 1H), 3.93 – 3.66 (m, 3H), 2.49 – 2.36 (m, 1H), 2.26 (ddd, J = 16.8, 13.6, 4.0 Hz, 1H), 2.01 – 1.71 (m, 8H), 1.69 (s, 3H), 1.63 (s, 3H), 1.55 (s, 2H), 1.49 – 1.29 (m, 5H), 1.15 (s, 3H), 1.11 – 1.00 (m, 3H), 0.95 (s, 3H), 0.90 – 0.79 (m, 2H); 13C NMR (125 MHz, CDCl3) δ 132.3, 124.0, 79.7, 64.8, 50.3, 44.6, 43.4, 41.2, 40.9, 35.3, 26.0, 25.7, 21.8, 20.9, 18.2, 15.2; HRMS + + (ASAP) calcd for C16H28IO [M + H] 363.1185, found 363.1182.

4,7-dimethyl-4-homogeranyl-hexahydrobenzofuran (26): was derived from 25’s reaction with DBU according to the procedure outlined for the preparation of 22. Clear oil; potent patchouli scent with a note of saffron; Rf = 0.3 (silica gel, 15% 75

EtOAc:hexanes); IR (film) �max 2962, 2922, 2874, 1635, 14512, 1374, 1035, 1001, 728 cm-1; 1H NMR (500 MHz, CDCl3) δ 5.58 (ddd, J = 9.9, 5.8, 1.9 Hz, 1H), 5.39 (dd, J = 9.9, 2.0 Hz, 1H), 5.06 (t, J = 7.1 Hz, 1H), 3.96 – 3.89 (m, 1H), 3.88 – 3.73 (m, 2H), 2.21 (dd, J = 15.9, 5.9 Hz, 1H), 2.14 (s, 1H), 2.10 (s, 1H), 2.00 – 1.77 (m, 7H), 1.66 (s, 3H), 1.58 (s, 3H), 1.42 (s, 1H), 1.39 – 1.23 (m, 6H), 1.06 (s, 3H), 0.96 (s, 3H), 0.90 (s, 1H), 0.82 (d, J = 3.5 Hz, 1H); 13C NMR (125 MHz, CDCl3) δ 136.6, 131.6, 125.1, 124.2, 79.8, 65.0, 50.7, 44.9, 40.2, 39.5, 26.0, 24.0, 23.3, 21.1, 20.7, 17.9; HRMS (ASAP) calcd + + for C16H2O [M + H] 235.2062, found 235.2060.

5-Iodo-4,4-dimethyl-4-methylpentanyl-octahydrobenzofuran (27): 25 (20 mg, 0.0552 mmol, 1 equiv) was dissolved in 1 mL of methanol (MeOH) along with 6 mg (0.00552 mmol, 0.1 equiv) of 10 wt% palladium on carbon. A balloon filled with hydrogen was then affixed to the reaction, and, after stirring overnight at room temperature, the reaction mixture was filtered through a celite plug to yield 18 mg (90%) of 27 as a clear oil after evaporation. Rf = 0.33 (silica gel, 15% EtOAc:hexanes); IR (film) �max 3707, 3680, 2951, 2867, 1455, 1381, 1055, 1032, 1010 cm-1; 1H NMR ((300 MHz, CDCl3) δ 4.25 (dd, J = 12.6, 4.5 Hz, 1H), 3.93 – 3.65 (m, 4H), 2.47 – 2.36 (m, 1H), 2.25 (ddd, J = 27.1, 13.5, 3.9 Hz, 2H), 1.98 – 1.17 (m, 26H), 1.14 (s, 6H), 1.11 – 0.96 (m, 5H), 0.94 (s, 4H), 0.89 (s, 4H), 0.87 (s, 4H), 0.85 – 0.78 (m, 2H); 13C NMR (125 MHz, CDCl3) δ 79.6, 64.8, 50.3, 45.0, 43.7, 41.2, 40.9, 39.7, 35.3, 28.1, 25.6, 23.0, 22.9, 21.0, 20.9, 20.6; + + HRMS (ASAP) calcd for C16H30IO [M + H] 365.1341, found 365.1330.

5-Iodo-4,4,7-dimethyloctahydrobenzofuran (29): made by the reaction of 28 with IDSI according to the procedure detailed for the preparation of 20-I. Interestingly, the yield was much higher at 94%. 29 is a clear oil with strong patchouli scent; Rf = 0.35 (silica gel, 15% EtOAc:hexanes); IR (film) �max 2964, 2873, 1454, 1375, 1139, 1063, 1049, 945; 1H NMR (500 MHz, CDCl3) δ 4.40 (dd, J = 11.5, 3.8 Hz, 1H), 4.08 (dd, J = 12.9, 4.4 Hz, 1H), 3.91 – 3.76 (m, 5H), 2.43 – 2.36 (m, 1H), 2.27 – 2.09 (m, 4H), 2.05 – 1.80 (m, 6H), 1.75 – 1.39 (m, 8H), 1.35 (s, 3H), 1.20 (s, 3H), 1.12 (s, 4H), 1.06 (s, 3H), 1.03 (s, 4H), 0.97 (s, 4H); 13C NMR (125 MHz, CDCl3) δ 80.3, 79.3, 65.0, 64.1, 54.7, 53.5, 49.3, 45.7, 41.3, 39.1, 37.6, 36.0, 35.8, 34.3, 32.8, 31.0, 29.2, 28.4, 27.2, 26.1, 20.3, 20.0; + + HRMS (ASAP) calcd for C11H20IO [M + H] 295.0559, found 295. 0562.

5-bromo-4,4,7-dimethyloctahydrobenzofuran (30) “18”: made from 28’s reaction with BDSB in 93% yield. Clear oil with strong patchouli scent, Rf = 0.35 (silica gel, 15% EtOAc:hexanes); IR (film) �max 2960, 2873, 1456, 1376, 1153, 1127, 1067, 1041, 1001, 783, 583; 1H NMR (500 MHz, CDCl3) δ 4.23 (dd, J = 11.0, 3.8 Hz, 1H), 3.95 – 3.75 (m, 9H), 2.28 – 2.21 (m, 2H), 2.16 – 1.79 (m, 15H), 1.76 – 1.46 (m, 8H), 1.35 (s, 3H), 1.17 (s, 3H), 1.13 (s, 7H), 1.09 – 1.06 (2 s, 9H), 0.95 (s, 6H); 13C NMR (125 MHz, CDCl3) δ 80.2, 79.2, 66.2, 65.3, 64.2, 63.2, 56.3, 54.8, 39.6, 39.1, 37.7, 34.5, 33.2, 31.6, 30.7, 29.0, + + 28.9, 27.3, 25.7, 25.1, 20.4, 17.3; HRMS (ASAP) calcd for C11H19BrO [M ] 247.0697, found 247.0698.

4,4,7-Trimethylhexahydrobenzofuran (31): was derived from 29’s reaction with DBU according to the procedure detailed for the preparation of 22. Clear oil; woody, clary 76

sage, sclareol scent; Rf = 0.38 (silica gel, 15% EtOAc:hexanes); IR (film) �max 3716, 3673, 2958, 2954, 2863, 1646, 1265, 1058, 1032, 1014 cm-1; 1H NMR (500 MHz, CDCl3) δ 5.53 – 5.46 (m, 1H), 5.42 – 5.37 (m, 1H), 3.96 – 3.91 (m, 1H), 3.88 – 3.76 (m, 1H), 3.72 – 3.64 (m, 1H), 2.23 – 2.09 (m, 2H), 1.99 – 1.72 (m, 4H), 1.69 (dd, J = 12.9, 7.3 Hz, 1H), 1.34 (s, 1H), 1.07 – 1.03 (2 s, 5H), 1.02 (s, 1H), 0.96 (s, 2H); 13C NMR (125 MHz, CDCl3) δ 138.4, 135.9, 122.9, 122.5, 80.5, 79.7, 65.0, 64.4, 54.2, 53.7, 40.3, 36.4, + 35.0, 34.7, 32.5, 31.3, 29.6, 29.0, 28.7, 23.9, 21.7, 20.8; HRMS (ESI) calcd for C11H17O [M – H]+ 166.1436, found 166.1057 (fragmentation made it difficult to observe the molecular ion).

OH 13

(CDCl3, 500 MHz) 77

OH 13

(CDCl3, 125 MHz) 78

O

Me2N 15

(CDCl3, 500 MHz) 79

O

Me2N 15

(CDCl3, 125 MHz)

80

NMe2

O

16

(CDCl3, 500 MHz) 81

NMe2

O

16

(CDCl3, 125 MHz) 82

OH

17

(CDCl3, 500 MHz) 83

OH

17

(CDCl3, 125 MHz) 84

Me O

Br H

20-Br

(CDCl3, 500 MHz) 85

Me O

Br H

20-Br

(CDCl3, 125 MHz) 86

Me O

I H

20-I

(CDCl3, 500 MHz) 87

Me O

I H

20-I

(CDCl3, 125 MHz) 88

Me O

I

21-I

(CDCl3, 500 MHz) 89

Me O

I

21-I

(CDCl3, 125 MHz) 90

Me O

H

9

(CDCl3, 500 MHz) 91

Me O

H

9

(CDCl3, 125 MHz) 92

Me O

H

22

(CDCl3, 500 MHz) 93

Me O

H

22

(CDCl3, 125 MHz) 94

Me O O H

23

(CDCl3, 500 MHz) 95

Me O O H

23

(CDCl3, 500 MHz)

HO O

Cl 96

Me O

I H

24

(CDCl3, 300 MHz) 97

Me O

I H

24

(CDCl3, 125 MHz) 98

Me O

I

25

(CDCl3, 300 MHz) 99

Me O

I

25

(CDCl3, 125 MHz) 100

O

26

(CDCl3, 500 MHz) 101

O

26

(CDCl3, 125 MHz) 102

O

I

27

(CDCl3, 300 MHz) 103

O

I

27

(CDCl3, 125 MHz) 104

105

2 NMe O S1 , 500 MHz) 3 (CDCl 106

2

NMe

O S1 , 125 MHz) 3 (CDCl

OH

28

(CDCl3, 500 MHz) 107

OH

28

(CDCl3, 125 MHz) 108

O

I

29

(CDCl3, 500 MHz) 109

O

I

29

(CDCl3, 125 MHz) 110

O

Br

30

(CDCl3, 500 MHz) 111

O

Br

30

(CDCl3, 125 MHz) 112

O

31

(CDCl3, 500 MHz) 113

114

O 31 , 125 MHz) 3 (CDCl 115

CHAPTER 4

Geranylgeraniol Biosynthesis 116

4.1 Introduction

Totalling over 7,000 members, diterpenes are a diverse class of terpenoids with important properties.1 Molecules such as Prostratin (2, anti-HIV activity), Totarol (3, antibacterial), and the famous Taxol® (4, anti-cancer) all belong to the diterpene family.

+ IPP OH DMAPP 1: GGOH fragrance FPPS OH H OPP O OAc H HO HO OPP H H H FPP IPP 3: Totarol 2: Prostratin Antimicrobial GGPPS OH Anti-HIV AcO O OH O O Ph O P P O - O - OH BzHN O GGPP O O OH H O 4: Taxol® HOBzO AcO Anti-cancer

Figure 1. Examples of diterpenes.

The biogenesis of diterpenes follows the same model discussed in Chapter 2; in other words, they are generated from the head to tail condensation of the universal 5- carbon building blocks isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate

(DMAPP) into farnesyl pyrophosphate (FPP), to which is added an additional IPP unit to make the 20-carbon geranylgeranyl pyrophosphate (GGPP). GGPP then undergoes further transformations at the hand of cyclases, reductases, and oxygenases to afford more complex diterpenes.

The hydrolysis product of GGPP, geranylgeraniol (GGOH, 1), is a crucial raw material in the synthetic production of vitamin A and E in addition to its widespread use in the cosmetic industry as an ingredient in perfumes.2,3 GGOH has also been shown to possess apoptotic powers against many cancer cell lines.4 117

Biosynthesis Chemical synthesis R1 Single step HO OH R2 O Engineered 1: GGOH 5: Tocotrienols microbe R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ)

Figure 2. Single step hybrid approach to tocotrienols

While GGOH can be produced by synthetic means (see figure 3),1,5 we aimed to engineer yeast to produce GGOH to serve as the renewable starting material in our single step synthesis of the tocotrienols (5, figure 2). As with other terpenoids (see Chapter 2),

GGOH production in yeast is typically achieved by over-expressing the terpenoid pathway enzymes HMG1 (hydroxymethyl-Co-A reductase, rate-limiting enzyme in the mevalonate pathway), ERG20 [farnesyl diphosphate (FPP) synthase] and BTS1

[geranylgeranyl diphosphate (GGPP) synthase] often combined with repression of ERG9

(squalene synthase), which diverts FPP and GGPP to ergosterol synthesis (Figure 4).

Overproduced GGPP is then hydrolyzed by endogenous phosphatases such as DPP1.

1. 7, R-NH , MeO 2 H Carroll Na2CO3 1. R-NH , Na CO decarb. O 2 2 3 O O O O 2. H2 , Lindlar HO 10 11 HO H O O 2. H2 Lindlar 6 7 8 9 MeO

O O Rearrang. 1. LiCH3 n - 1 2. TsCl 3. LiS-Ph OS n-BuLi 15 Ph OH Li, Ph-NH2 OH 1. NaH, BnCl OH 2. SeO2 n OBn 3. LiCH3 SPh 13 4. TsCl 14 16 1: GGOH, n = 3 5. LiCl Cl

Figure 3. Synthetic approaches to GGOH production

118

Figure 4.Triple fusion construct-engineered S. cerevisiae

4.2 Double Enzyme Fusion Exploration

Recently, enzyme fusions have been employed in metabolic engineering to enhance active site proximity and allow for better substrate channeling. This process not only helps prevent diffusive loss between steps of the pathway but also keeps the substrates from being diverted into competing pathways, thereby resulting in higher fermentation yields. For instance, yeast YPH499 was engineered with HMG1 and a double fusion of ERG20–BTS1 to achieve GGOH production with titer yields of 138 mg/L in a 5L fermenter, although with concomitant production of squalene at 60 mg/L.6

This same group later reported titer yields of 3.3 g/L under optimal fermentation conditions for YPH499 overexpressing HMG1 and the two double fusions BTS1–DPP1 and BTS1–ERG20.7

We attempted similar double fusion strategies not only in the reported YPH499 background strain, but also in the yeast ATCC200589 carrying the AUR1C mutation, which was previously reported to produce 2.3 mg/L of GGOH when engineered with additional HMG1.8 Note that yeast strain with the AURC1 mutation has not previously 119

been engineered beyond additional HMG1. We introduced the AURC1 mutation into

ATCC200589 using CRISPR, resulting in strain AN159Y.

We found that co-expression of the two double fusions DPP1–BTS1 and BTS1–

ERG20 on the same plasmid together with tHMG1 on a second plasmid led to GGOH titers of ~5 mg/L (Figure 5) in the background strain YPH499 (strain AN-GG1-T3), but no production in AN159Y.

Figure 5. GGOH fermentation titers

4.3 Triple Enzyme Fusion Advent

To date, only double fusions of enzymes have been reported. We hypothesized that a triple fusion of DPP1–BTS1–ERG20 could improve substrate channeling to a greater extent, thus leading to higher titer yields (Figures 4). We found that this triple fusion construct along with tHMG1 in the background strain AN159Y (strain AN-GG2-

T3) leads to GGOH production titers of ~13 mg/L with no detectable levels of squalene despite no ERG9 repression (Figure 5). This outcome is likely due to less FPP and GGPP being diverted into the competing ergosterol pathway (Figure 4), suggesting that the triple fusion, if properly expressed, is effective in substrate channeling for GGOH production. To our knowledge, this report is the first successful use of a triple fusion enzyme for metabolic engineering. 120

Some geranyllinalool (GLOH), the tertiary allylic alcohol isomer of GGOH, was sometimes produced, with more acidic media leading to increased GLOH content. This outcome is similar to reports of farnesol production often being accompanied by its tertiary allylic alcohol isomer, nerolidol, depending on pH.9

Figure 6. Comparison of GGOH, FOH, NOH and squalene yields in various strains. **Data plotted on log scale to capture full range of production values. D-B: DPP1-BTS1 double enzyme fusion. B-E: BTS1-ERG20 double enzyme fusion. D-B-E: DPP1-BTS1-ERG20 triple fusion. Numbers in bracket represent For each strain, the number in brackets indicates the number of independent transformant colonies tested, except for AN159Y/tHMG1/D-B-E (AN-GG2-T3), where five independent colonies derived from a streak of one original transformant colony were tested. Error bars = ±1 standard deviation.

121

4.4 Fusion Constructs in Opposite Backgrounds

Surprisingly, the triple fusion construct in YPH499 (AN-GG1-T4) and the double fusion constructs in AN159Y (AN-GG2-T5) did not produce detectable levels of GGOH

(Figure 6). This outcome could be due to our small sample size. Furthermore, we observed a generally low transformation efficiency with the triple fusion plasmids (only four colonies for AN-GG2-T3 and two for AN-GG1-T4). And out of the four colonies for

AN-GG2-T3, only one led to GGOH production. This result could be due to high metabolic burden imposed on the cell given that the plasmid is high copy and the triple fusion is expressed from a strong, constitutive PGK1 promoter. There could also be problems with the folding of the enzyme fusion constructs. In the future, these could be remediated by growing the strain at a lower temperature or using promoter libraries to tune the expression levels of the fusion constructs.

Still, the triple fusion engineered strain (AN-GG2-T3) consistently produced

GGOH across multiple runs and scales.

4.5 Enzyme Order in the Fusion Constructs

In deciding on the enzyme order in the fusion, we noted that reports of double fusion enzymes have shown that constructs where the later enzyme in the pathway came first in the fusion led to greater titer yields of the target compound, suggesting that the fused enzymes’ active sites are in closer proximity in those constructs.10 Given time constrains, we decided to focus on such enzyme order for our constructs. 122

4.6 Bench Scale Production Optimizations Without Appropriate Fermenter

As was the case with our large scale fermentation of Z,E-FOH (see Chapter 2), our 3L-scale fermentation of GGOH led to dramatically lower titer yields (6 mg/L) from

13.5 mg, which is likely due to our less than ideal large scale fermentation conditions. It is likely that when grown in better fermentative conditions with more favorable aeration, pH, mixing, nutrients, and evaporation control, that our strains would produce GGOH in higher titers.

In Chapter 2, we discussed how overproduction of prenyl alcohols is deleterious to the organism. As such, the addition of a surfactant to the fermentation culture helps isolate the product from the organism preventing not only toxicity but also feedback inhibition. With our engineered yeast strains, we found that the addition of 2.5% decane content by volume helped increase geranylgeraniol production. Higher contents of decane were toxic, leading to inhibited growth.

4.7 Titer Yield Calculation

Our production yields are based on mg/L of growth media and not on the organic extract. Furthermore, our yields have not been adjusted to account for the efficiency of the extraction process. It is known that a significant portion of prenyl alcohols (farnesol and geranylgeraniol among others) remain bound within the cell membrane even with the addition of soybean oil as a surfactant.11 Therefore, our actual production yields could in fact be higher even in our less than ideal fermentation conditions. 123

4.8 Conclusion

We engineered yeast with a set of fusion enzyme constructs, including a first of its kind triple fusion enzyme construct, which led to geranylgeraniol production with no squalene side product despite not repressing squalene synthase (ERG9). With this triple fusion-engineered strain, we produced 27 mg of isolated GGOH in a very rudimentary, homemade fermentor.

**I would like to note that the following people contributed to the work in this chapter: Yao Zong Ng: strain construction and fermentation 124

4.9 References

(1) Breitmaier, E. Terpenes; Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006. (2) Hyatt, J. A. K., G. S.; Effler, J. Org. Process Res. Dev. 2002, 6, 782 (3) Perfumes: Art, Science and Technology; Springer Science+Business Media: Dordrecht, 1994. (4) Ohizumi, H. M., Y.; Nakajo, S.; Sakai, I.; Ohsawa, S.; Nakaya, K. J. Bio-chem. 1995, 117, 11 (5) Altman, L. J.; Ash, L.; Kowerski, R. C.; Epstein, W. W.; Larsen, B. R.; Rilling, H. C.; Muscio, F.; Gregonis, D. E. J. Am. Chem. Soc. 1972, 94, 3257. (6) Ohto, C.; Muramatsu, M.; Obata, S.; Sakuradani, E.; Shimizu, S. Appl. Microbiol. Biotechnol. 2010, 87, 1327. (7) Tokuhiro, K.; Muramatsu, M.; Ohto, C.; Kawaguchi, T.; Obata, S.; Muramoto, N.; Hirai, M.; Takahashi, H.; Kondo, A.; Sakuradani, E.; Shimizu, S. Appl. Microbiol. Biotechnol. 2009, 75, 5536. (8) Ohto, C.; Muramatsu, M.; Obata, S.; Sakuradani, E.; Shimizu, S. Appl. Microbiol. Biotechnol. 2009, 82, 837. (9) McNeil, C. V.; Morlacchi, P.; Baevich, A.; Matsuda, S. P. T. 2010. (10) Zhou, Y. J.; Gao, W.; Rong, Q.; Jin, G.; Chu, H.; Liu, W.; Yang, W.; Zhu, Z.; Li, G.; Zhu, G.; Huang, L.; Zhao, Z. K. J. Am. Chem. Soc. 2012, 134, 3234. (11) Muramatsu, M.; Ohto, C.; Obata, S.; Sakuradani, E.; Shimizu, S. J. Biosci. Bioeng. 2008, 106, 263. (12) DiCarlo, J. E.; Norville, J. E.; Mali, P.; Rios, X.; Aach, J.; Church, G. M. Nucleic Acids Research 2013, 41, 4336. (13) Ostrov, N.; Wingler, L. M.; Cornish, V. W. Methods Mol. Biol. 2013, 978, 187. (14) Sikorski, R. S.; Hieter, P. Genetics 1989, 122, 19. 125

4.10 Experimental Section

Strain construction The yeast (Saccharomyces cerevisiae) strain ATCC200589 and YPH499 (ATCC76625) were obtained from the American Type Culture Collection, Rookville. AN159Y which contains mutations (F158Y and A240C) in the AUR1C gene of ATCC2005898 was constructed by the CRISPR method.12 In brief, pAN70 (a kind gift from the Church lab) containing yeast codon-optimized Cas9 under a constitutive TEF1p promoter was transformed into ATCC200589. A guide RNA (gRNA) plasmid, pAN151, was constructed to target Cas9 to AUR1C. A repair fragment (for homology-directed repair) containing the desired mutations was created by PCR of AUR1C in 3 parts using ATCC200589 genomic DNA as template and the following primer pairs: AUR1C-a: AN627/AN628; AUR1C-b: AN629/AN630; AUR1C-c: AN631/AN632. The three parts were fused by PCR using the external primers AN627/AN632. pAN151 (500ng) and the repair fragment (2µg) were transformed into the previously obtained ATCC200589/pAN70-Cas9 colonies and plated on SC agar plates lacking histidine, tryptophan and uracil. Correct clones were confirmed by PCR of genomic DNA (YeaStar Genomic DNA Kit, Zymo Research). PCR was performed using Phusion polymerase (NEB). The other strains used in this study (see Table S1) were constructed by transforming various combinations of plasmids (see Table S2) into either of the background strains AN159Y or YPH499. For yeast transformations, 30mL of selective SC media in a 250mL flask was inoculated with a starter culture to an OD600 of 0.1. When the culture reached an OD600 of 1, 300µL of 2.5M dithiothreitol was added, and the culture left to shake for 20 min. The cells were then pelleted by centrifugation, washed twice with E buffer and resuspended in 30µL E buffer. 80µL of cells was mixed with 2µg of the plasmid to be transformed and electroporated at 1500V. The cells were allowed to recover for 2h in YPD (30ºC, 230rpm) and the transformants were selected on SC agar plates lacking specific amino acids to select for the auxotrophic markers on the plasmids. For other details on yeast media and the electroporation protocol, please see Ostrov et al.13

Plasmid construction The strategy adopted for the construction of the yeast expression plasmids pAN117, pAN119, pAN127 and pAN128 (see Table S2) was: (a) PCR of the individual parts (see Table S3 for primers and parts), (b) fusion PCR (external primers AN409/AN412 for pAN117/pAN119; AN568/AN569 for pAN127/pAN128) to create a transcriptional unit (TU) composed of the promoter, ORF and terminator, (c) Gibson assembly (NEB, E2611S) to insert the TU into the cut plasmid backbone (pRS42614 digested with SacI and KpnI for pAN117/pAN119; pRS424 digested with SacI and KpnI for pAN127/pAN128), (d) transformation of the Gibson mixture into electro-competent E. coli TG1 cells followed by selection on LB/ampicillin plates, (e) testing of colonies by amplification in LB/ampicillin media overnight followed by plasmid extraction (Miniprep kit, Qiagen), sequencing and restriction analysis to determine correct constructs. 126

pAN120 was constructed by gibson assembly of the vector pAN117 (digested with KpnI) and PCR products of PGK1 (AN536/AN540) and BTS1-ERG20 (AN541/AN537) using pAN119 as a template. pAN151 was constructed by PCR of SNR52p (AN318/AN625) and SUP4t (AN626/AN321) using a CAN1-gRNA plasmid12 as template (kind gift from the Church lab), followed by fusion pcr, restriction digestion (SacI/XhoI) and ligation into SacI/XhoI-digested pRS426.

Small-scale fermentation trials Yeast prenyl alcohol production was performed in sterilized, 50 ml Erlenmeyer flasks (VWR) in an incubator shaker (New Brunswick, Innova 43R) at 30ºC and 230rpm for a total of 7 days. On Day 1, 0.3ml of saturated, overnight culture grown in selective SD media was added to 2.7ml of SD or YPD media. On Day 2, 3ml of YPD and 150µl of decane (final concentration of 2.5%) were added. On Day 3, 4ml of YPD and 100µl of decane were added. Cultures were harvested on Day 8 after incubation for 7 days. As a measure of cell growth, the final optical density (OD600) was determined by 10-fold dilution of the culture broth with YPD.

Bench-scale production Bench-scale production was performed in a 6L vessel (L/P Vessel W/4 S/A, 6L, Bellco Glass). The vessel was incubated in a water bath set at a temperature of 30ºC. Filtered air was supplied via a sparger, and vented via an exit port with a moisture trap. Mixing was performed solely by the sparged air. There was no control of dissolved oxygen, pH or nutrient availability. On Day 1, 100mL of starter culture grown for 2 days was added to 2L of YPD to start the fermentation. On Day 2, 1L of YPD and 50mL of decane were added. On Day 3 and Day 6, another 1L of YPD and 100mL decane were added. The culture was harvested on Day 8 (1 week).

Extraction of prenyl alcohols For small-scale fermentation trials, 1ml of the final culture broth was removed for pH and OD600 measurements. The remainder of the culture (~8.4ml) was transferred into a 15ml falcon tube. 1ml of brine and 2ml of hexane were added. The tube was placed horizontally in an incubator shaker (230rpm) for 1 hour to mix. The mixture was centrifuged at 3200rpm for 10min and the top hexane layer was filtered and transferred into a glass GC-MS vial for analysis. For bench-scale production, 8.4ml of the broth was sampled as above and analyzed by GC-MS after 7 days. The remainder of the broth was mixed in batches with ethyl acetate and transferred into a 2L-separating funnel. The organic layer was collected, dried (MgSO4) and concentrated under reduced pressure. The resulting concentrate was purified on silica gel to yield an oil, which was weighed and its identity further confirmed by 1H-NMR.

Analysis of prenyl alcohols Geranylgeraniol (GGOH), farnesol (E,E-FOH), nerolidol (NOH) and squalene were analyzed using a ThermoFinnigan PolarisQ GC-MS (Agilent J&W column, #CP8907, VF-1ms 15m X 0.25mm x 0.25µm). GC-MS runs were carried out with the following method: MS: ion source 225ºC, EI/NICI, mass range 50-600. GC: helium gas, 1.2 127

ml/min, inlet temperature 225ºC, initial column temperature 50ºC, hold 2.5 minutes, raise at 17ºC/min to 285ºC, hold 3.5 minutes. For quantitative analysis, undecanol was used as an internal standard. The selected ion peak area (67 mass fragment) of 25 mg/l undecanol to that of 25 mg/l of authentic standards of GGOH (Sigma, G3278), E,E-FOH (Sigma, 277541), NOH (Sigma, 18143) and squalene (Sigma, S3626) were used as a standard ratio. The amount of prenyl alcohol in a sample was determined by comparison of this ratio to the ratio in a sample spiked with 25 mg/l undecanol. 128

GGOH Extracted Yield (mg/L) 14

12

10

8

6

4

2

0 YPH499 (3) AN159Y (3) AN159Y (2) (5) (3) (3) YPH499/tHMG1 (4) AN159Y/tHMG1 (3) YPH499/tHMG1/D-B-E AN159Y/tHMG1/D-B-E AN159Y/HMG1/D-B/B-E YPH499/tHMG1/D-B/B-E Fig. S1. GGOH extracted yield from engineered yeast strains. D-B: DPP1-BTS1 double enzyme fusion. B-E: BTS1-ERG20 double enzyme fusion. D- B-E: DPP1-BTS1-ERG20 triple fusion. Extracted yields are reported in mg/L of growth media. For each strain, the number in brackets indicates the number of independent transformant colonies tested, except for AN159Y/tHMG1/D-B-E (AN-GG2-T3), where 129

five independent colonies derived from a streak of one original transformant colony were tested. Error bars = ±1 standard deviation.

Prenyl Alcohol Extracted Yield (mg/L) GGOH EE-FOH 10 NOH Squalene

1

0.1Log scale

0.01 YPH499 (3) AN159Y (3) AN159Y YPH499/tHMG1 (4) AN159Y/tHMG1 (3) YPH499/tHMG1/D-B-E (2) AN159Y/tHMG1/D-B-E (5) AN159Y/HMG1/D-B/B-E (3) YPH499/tHMG1/D-B/B-E (3) Fig. S2. Comparison of GGOH, FOH, NOH and squalene yields of various strains. Data is plotted on a log scale to capture the full range of production values. Strains are labelled as in Fig.S1. 130

B (i) (ii)

(iii) (iv)

Fig. S3 GC-MS analysis of yeast fermentation extracts and authentic GGOH standard. (A) GC chromatographs of (i) authentic GGOH standard; GGOH produced from small- scale fermentation trials of (ii) AN-GG1-T3, (iii) AN-GG2-T3 and (iv) bench-scale 131

production of AN-GG2-T3. The undecanol internal standard is present in each trace at retention time (RT) ~7.68 min. RT of E,E-FOH is ~10.08 min. RT of GGOH is ~12.72 min. (B) Mass spectra of GGOH peak for (i), (ii), (iii) and (iv). 132

Fig. S4 1H-NMR of biosynthetic GGOH from bench-scale yeast fermentation. 133

Table S1. Strains used in this study.

Name Genotype/Plasmids-insert Source YPH499 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 ATCC (ATCC76625) leu2-Δ1 ATCC200589 MATalpha can1 leu2 trp1 ura3 aro7 ATCC AN159Y ATCC200589/AUR1C This study,8 AN-CP4-S1 YPH499/pAN127-tHMG1 This study AN-CP2-S4 AN159Y/pAN127-tHMG1 This study YPH499/pAN127-tHMG1/pAN120-DPP1-BTS1/BTS1- AN-GG1-T3 This study ERG20 AN-GG1-T4 YPH499/pAN127-tHMG1/pAN119-DPP1-BTS1-ERG20 This study AN-GG2-T3 AN159Y/pAN127-tHMG1/pAN119-DPP1-BTS1-ERG20 This study AN159Y/pAN128-HMG1/pAN120-DPP1-BTS1/BTS1- AN-GG2-T5 This study ERG20

134

Table S2. Plasmids used in this study.

Transcriptional Unit Name Type Marker (Promoter-ORF- Details Terminator) CEN, Gift from Di Carlo, pAN70 TRP1 TEF1p-Cas9-CYC1t yeast Church lab CRISPR gRNA 2µ, pAN151 URA3 SNR52p-cr17-gRNA-SUP4t plasmid to create yeast AUR1C mutation 2µ, pAN127 TRP1 TEF1p-tHMG1-ACT1t Truncated HMG1 yeast 2µ, pAN128 TRP1 TEF1p-HMG1-ACT1t Wild-type HMG1 yeast 2µ, Double fusion DPP1- pAN117 URA3 PGK1p-DPP1-BTS1-ADH1t yeast BTS1 2µ, PGK1p-DPP1-BTS1- Triple fusion DPP1- pAN119 URA3 yeast ERG20-ADH1t BTS1-ERG20 Two double fusions PGK1p-DPP1-BTS1-ADH1t 2µ, DPP1-BTS1/BTS1- pAN120 URA3 / PGK1p-BTS1-ERG20- yeast ERG20 on one ADH1t-rev plasmid

135

Table S3. Primers used in this study.

Name Plasmid Template Sequence (5’ – 3’) ctaaagggaacaaaagctgGAGCTCTCTTTGAAAAG AN318 pAN151 SNR52p-F ATAATG SNR52p- GCTCTAAAACaaatgaaatagtccgtacggGATCATTT AN625 pAN151 R ATCTTTCACTGCGGAGAAG ccgtacggactatttcatttGTTTTAGAGCTAGAAATA AN626 pAN151 SUP4t-F GCAAGTTAAAATAAG gacataactaattacatgaCTCGAGAGACATAAAAAA AN321 pAN151 SUP4t-R CAAAAAAAG AN627 NA AUR1a-F ATGGCAAACCCTTTTTCGAGATGG AN628 NA AUR1a-R GAAATAGTCCGTACGGTAACCATGC cattttagcatggttaccgtacggactatttcattaTGGGGCCCCA AN629 NA AUR1b-F TTTGTCGTTG gcaccgaaaatgacggaggaatttgaaaaacaTGTAGTATAC AN630 NA AUR1b-R ATATTAATACCGAG AN631 NA AUR1c-F TTTTTCAAATTCCTCCGTCATTTTCG AN632 NA AUR1c-R TTAAGCCCTCTTTACACCTAGTGAC pAN127/ CACTAAAGGGAACAAAAGCTGGAGCTATAG AN569 TEF1p-F pAN128 CTTCAAAATGTTTCACT1TCC GTTTTCACCAATTGGTCCATAAACTTAGATT AN387 pAN127 TEF1p-R AGATTGCTATGCT tagcaatctaatctaagtttATGGACCAATTGGTGAAAA AN388 pAN127 tHMG1-F CTGAAG pAN127/ tacgcgcacaaaagcagagaTTAGGATTTAATGCAGGT AN401 tHMG1-R pAN128 GACGG pAN127/ AN402 ACT1t-F tcacctgcattaaatcctaaTCTCTGCTTTTGTGCGCG pAN128 pAN127/ gactcactatagggcgaattgggtacACACTATGATATATA AN568 ACT1t-R pAN128 AATATAATAGTTTTTCG cttgaatagcggcggcatAAACTTAGATTAGATTGCTA AN571 pAN128 TEF1p-R TGCT AN570 pAN128 HMG1-F tagcaatctaatctaagtttATGCCGCCGCTATTCAAGG All cctcactaaagggaacaaaagctggagctcGAAGTACCTTCA AN409 except PGK1p-F AAGAATGGGGTC pAN127 pAN117/ ttttaataaacgaaactctgttcatTTGTTTTATATTTGTTGT AN420 PGK1p-R pAN119 AAAAAGTAGATAATTAC pAN117/ actttttacaacaaatataaaacaaATGAACAGAGTTTCGT AN421 DPP1-F pAN119 TTATTAAAACG pAN117/ cagctcatctatcttggcctccatagaaccaccaccCATACCTTC AN441 DPP1-R pAN119 ATCGGACAAAGGATG 136

pAN117/ catcctttgtccgatgaaggtatgggtggtggttctATGGAGGCC AN442 BTS1-F pAN119 AAGATAGATGAG aaatcataaatcataagaaattcgcTCACAATTCGGATAAG AN443 pAN117 BTS1-R TGGTCTA aatagaccacttatccgaattgtgaGCGAATTTCTTATGAT AN444 pAN117 ADH1t-F TTATGATTTTTAT All tacgactcactatagggcgaattgggtaccGAGCGACCTCAT AN412 except ADH1t-R GCTATACC pAN127 taatttctttttctgaagccatagaaccaccaccCAATTCGGATA AN445 pAN119 BTS1-R AGTGGTCTATTATAT aatagaccacttatccgaattgggtggtggttctATGGCTTCAG AN446 pAN119 ERG20-F AAAAAGAAATTAGG aaatcataaatcataagaaattcgcCTATTTGCTTCTCTTGT AN424 pAN119 ERG20-R AAACTTTG caaagtttacaagagaagcaaatagGCGAATTTCTTATGA AN425 pAN119 ADH1t-F TTTATGATTTTTAT PGK1p(R tacgactcactatagggcgaattgggtaccGAAGTACCTTCA AN536 pAN120 C)-F AAGAATGGGGTC PGK1p(R tcatctatcttggcctccatTTGTTTTATATTTGTTGTAA AN540 pAN120 C)-R AAAGTAGATAATTAC BTS1(RC) ctttttacaacaaatataaaacaaATGGAGGCCAAGATAG AN541 pAN120 -F ATGAG ERG20(R ctcaggtatagcatgaggtcgctcggtaccCTATTTGCTTCTC AN537 pAN120 C)-R TTGTAAACTTTG

137

CHAPTER 5

Tocotrienols in a Single Step from Biosynthetic Geranylgeraniol 138

5.1 Introduction

Vitamin E and its synthetic analogs are prime, lipid-soluble antioxidants whose roles extend beyond radical scavenging to numerous other benefits, including as cardioprotective agents.1-3 The natural vitamin E family comprises the tocopherols (1), the tocotrienols (2), the recently discovered α-tocomonoenol (3) and cold-water adapted

Marine Derived Tocopherol (MDT, 4).4

A R1 R1 HO HO

R2 O R2 O 1: Tocopherols (most widely distributed in nature) 2: Tocotrienols

R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ) R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ)

HO HO

O O 3: α−Tocomonoenol 4: Marine Derived Tocopherol (MDT) B OH OH HO HO

OH OH

NH2 O O 1. Vitamin E cyclase

CO2H CO2H O 2. Methyltrasferases Tyrosine p-Hydroxy- Homogentisate (if applicable) phenylpyruvate 3. ene [R]/rearrangement (if applicable) O PPO 1, 2, 3, 4 SCoA Phytyl-PP

IPP + DMAPP PPO GGPP

Figure 1. A) Natural vitamin E family. B) Vitamin E biosynthetic pathway.

Tocopherols and tocotrienols represent the major constituents of the natural vitamin E family. Between these two classes, the tocotrienols have drawn much less attention despite having 60 times the antioxidant potential of the tocopherols and 139

possessing anti-cancer, neuro-protective, radioprotective and hypocholesteromic properties to boot.5,6

This dearth of appreciation of the tocotrienols as compared to the tocopherols may be due to the tocotrienols’ scarcity in nature. Furthermore, their unsaturated farnesyl side chain, which grants them their greater activity, renders their synthetic preparation non- trivial. Whereas racemic α-tocopherol is produced industrially in a single step condensation of racemic isophytol (5) with trimethylhydroquinone (TMHQ, 6), an analogous direct synthesis of α-tocotrienol through the condensation of geranyllinalool

(GLOH, 7) with TMHQ has not been reported given the challenging regioselective cycloetherification that must be achieved with additional sensitive olefins present. As such, nearly all of the reported racemic5,7,8 as well as asymmetric9-11 tocotrienol preparation methods involve the assembly of the molecule in different stages—first the construction of the chroman skeleton (8), followed by addition of the polyene chain in an overall arduous process as illustrated in Figure 3.

A HO OH Acid, Δ

O 5: (all-rac)-isophytol HO (all-rac)-α-1 6: TMHQ B OH HO OH

Acid, Δ O 7: GLOH (all-rac)-α-2 C R1 R1 Chroman head HO HO synthesis Tail attachment Z R2 O R2 O 8 2: Tocotrienols R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ)

Figure 2. A) Current industrial production of α-tocopherol. B) lack of analogous method for the more potent α-tocotrienol. C) Common discrete approach to tocotrienol synthesis.

140

A Geraniol 1. MEMCl HO . HO NaH MEMO MEMO BF3 Et2O

2. O OH O 3 O CHO O CO2Et 6 7 9 11 Ph3P CO2Et + 10 HO

1. AlH3 O 2. NCS, Me S 8 2

R1 SO2Toly R1 1. Pd H MEMO MEMO 2. LiEt3BH 2 (rac)-2 Cl 3. C H BClS R2 O n-Buli R2 O 2 4 2 13 SO2Toly HMPA 12

R 1. AlH3 1 2. NCS, Me S HO 2 16 10 CO2Et R1 R2 OH 1. 1. MEMO PPh3 . BF3 Et2O O O CHO RO CO Et 2. PPTS 2 R2 O CO2Et 14 15 2. PTSA 17 3. MEMCl, NaH H

B CO2Me R1 R1 R1 18 HO 1. HO Succinic HO (HCHO)n Anhydride O 1. LiOH OH O 2. BnBr R2 OH R2 O PS-30 Lipase R2 O OH 16 on HyfloCell 20 2. LAH 19 O 3. Tf2O

R 1 R1 R1 HO HO BnO MeNH2 SO2Ph R O OTf 2 Li R2 O R2 O (R)-2 22 21 nBuLi 1. PBr3 Farnesol PhO2S 23 2. PhSO2Na

Figure 3. Selected tocotrienol syntheses. A) Racemic synthesis by Pearce et al.5 B) Asymmetric synthesis by Couladouros et al.11

With the aim to make the tocotrienols and their analogs more readily accessible, we set out to achieve a direct synthesis of the tocotrienols that would be analogous to the current industrial tocopherol synthesis. Namely, a one-pot/tandem C-C coupling of the geranylgeranyl chain to TMHQ along with the regioselective cycloetherification of the 3- geranygeranyl-hydroquinone (25, n = 3, Figure 5A), engaging only the most proximal 141

vinyl of the polyene to arrive at tocotrienol. Furthermore, we believe that a hybrid strategy, in which metabolic engineering is drawn upon to procure the terpenoid portion of the molecule in the form of geranylgeraniol (GGOH, 24, see Chapter 4), may represent a renewable route to produce tocotrienols and their analogs.

Biosynthesis Chemical synthesis R1 Single step HO OH R2 O Engineered 24: GGOH 2: Tocotrienols microbe R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ)

Figure 4. Hybrid approach to tocotrienols

5.2 Designing the Catalyst System

Our idea resided in the formation of an amphiphathic catalyst structure with microenvironments where polar reacting groups and non-participating, non-polar chains partition to drive the desired Friedel–Crafts C–C coupling and regioselective cycloetherification while concomitantly leaving the rest of the reactive polyene chain intact. We elected to employ a phase transfer catalyst (PTC, 26) as the framework for this system. We also considered the use of long chain nitroalkanes such as nitrodecane (27), but we ultimately focused on PTCs not only because they are more readily available in a variety of structures, but they are easier to handle and also offer more control of the system.

142

Neutral/non polar Charged/polar environment core

A

H

n OH OH R1 Cat. HO R1

R HO 2 R2 OH 25 H Cat. n R HO 1

R2 O

H n

B X O Y N O Y = N, P X = Cl, Br, I, HSO4, etc. 26: PTC 27: Nitrodecane

Figure 5. A) Schematic of amphipathic system allowing for regioselective cyclization. B) Considered system frameworks

5.3 Choosing a Catalyst: Improving the In(III)-Promoted Synthesis of Tocopherol: from Phytyl Acetate to Phytyl Trifluoroacetate

For the choice of catalyst needed to achieve the envisioned single step synthesis of tocotrienol, Lewis acids have proven quite advantageous in the classical syntheses of 143

α-tocopherol. We started with Indium triflate [In(OTf)3], which was recently reported to catalyze the condensation of phytyl acetate (28) with TMHQ to produce α-tocopherol with low catalyst loading.12 However, in this report, 16 hours of reaction time and 10 equivalents of TMHQ were required for every equivalent of phytyl acetate. We improved on this method by modulating the reactivity of the phytyl group down to match that of

TMHQ through the use of a trifluoroacetate group instead (29). This allowed for increased yields (quantitative), shorter reaction times (a few minutes when heated to reflux), and many fewer equivalents (1) of TMHQ while using the same catalyst loading originally reported. Similar yields are achieved overnight at room temperature with 1 equivalent of TMHQ to 29 in MeNO2.

In(OTf)3 (3 mol%) A o O 1,2-DCE, 40 C, 16h 91% O 28: (R,R)-Phytyl acetate 10 eq. HO HO 6: TMHQ B OH O 1 eq. ambo-α-1 O

O CF3 In(OTf)3 (3 mol%) 1,2-DCE, 80oC, 10 min 29: (R,R)-Phytyl trifluoroacetate 99%

Figure 6. A) Previous report. B) Improved method (this work).

5.4 Synthesis of Polyprenyl-chromans, including α-Tocotrienol

We tested the amphiphatic catalyst concept in the coupling of geranyl trifluoroacetate (30) with TMHQ towards prenyl-chroman 7 with a tetrabutylammonium bromide (34)–In(OTf)3 system. Pleasingly, we found that 7 could be obtained when a non-polar solvent such as hexane, heptane, mesitylene, or decane was employed, with decane evidencing the cleanest reaction profile by TLC. Polar solvents such as MeNO2 144

and CH2Cl2 led to practically no regioselectivity. Taken together, we decided to focus on decane as the choice solvent for the reaction.

HO O 6 O CF OH n 3 HO 30 (n = 1), 31 (n = 2), 32 (n = 3) 10% 35-In(OTf) Or O n CF3 0.5% nButylether:Decane O or 2.5% nOctylether: Decane 100°C, low vacuum, 20 min 7 (n = 1), 36 (n = 2), α-2 (n = 3) n O 91-96% 33 (n = 3)

HO Br N N Br N

34 35 CF3 Figure 7. Optimized single step synthesis of polyprenyl-benzopyrans/chromans

Catalyst Conversion (%) Yield of α−2 (%)

In(Otf)3 100 0 35 0 0

In(OTf)3−35 100 90

Table 1. Importance of PTC in the catalyst system

% Alkyl ether in Time to full Product Yield (%)* decane conversion (min) 7 36 α−2 100 5 0 N/A N/A 50 5 0 N/A N/A 20 5 40 N/A N/A n-Butyl 10 5 50 0 N/A ether 5 10 94 0 N/A 2 10 95 45 55 0.5 20 96 65 85 0 120 92 55 75 n-Octyl 2.5 20 N/A 95 91 ether 5 15 N/A 85 N/A Table 2. Effect of alkyl ether additive on reaction yield and time to completion. *Includes small, inseparable side product 145

In our efforts to improve the catalyst system, we found that a much shorter reaction time, greater yields and near-perfect purity were achieved in the synthesis of 7 with an N-[4-(Trifluoromethyl)benzyl]cinchoninium bromide (35)–In(OTf)3 system in

0.5% dibutyl ether:decane at 100oC (see Table 2). This doping of the decane solvent with dibutyl ether was helpful to achieve greater solubility of TMHQ, leading to higher yields of the Friedel–Crafts C–C coupling step while still maintaining a sufficient non-polar environment to achieve the regioselective cycloetherification. Generally, we found that greater portions of dibutyl ether led to speedier reactions and greater conversions, but lower regioselectivity of the cycloetherification, further pointing to the importance of maintaining a non-polar solvent environment. Additionally, we found that it was key that the trifluoroacetylated prenyl alcohol be added last to the reaction mixture to prevent the generation of side products.

With the same catalyst and solvent system, we successfully synthesized geranyl- chroman (36) by condensing farnesyl trifluoroacetate (31) with TMHQ. Likewise, we derived racemic α-tocotrienol (α-2) from geranylgeranyl trifluoroacetate (32) or geranyllinalyl trifuoroacetate (33). With these longer polyene chains, dioctyl ether proved a superior additive for the regioselective cycloetherification. Moreover, we found that applying a slight vacuum to the reaction flask was helpful not only in keeping oxygen out, but also in removing all the trifluoacetic acid (TFA) side product, further preventing it from reacting with the polyene side chain.

It is worth noting that NMR spectra evidences the presence of a small, inseparable side product in these reactions. This side product could potentially be overcyclized product. Efforts to employ LC-MS to unmask its identity has so far led to inconclusive results. 146

A OH Acid, Δ HO

O 5: (all-rac)-isophytol HO (all-rac)-α-1 6 B O OH

O CF3 HO 32: GG-TFA Or CF3 O O O PTC-acid 33: GL-TFA n-octyl ether:decane (rac)-α-2

Figure 8: Analogous single step synthesis of α-tocotrienol. A) Industrial α-tocopherol synthesis. B) This work.

With this system, and in demonstration of the hybrid approach, we derived 29.6 mg (0.070 mmol) of α-2 from 27 mg (0.093 mmol) of biosynthetic GGOH (24, see

Chapter 4) in a 75% overall yield. We also showed in a pilot study that the TFA protection step could be combined with the condensation step to produce α-tocotrienol in a two-step-single-purification process from GGOH or GLOH. Taken together, the amphiphatic acid catalyst concept developed here is poised to be applied for a scalable production of α-tocotrienol similar to the current industrial production of α-tocopherol.

5.5 Accessing the Rest of the Tocotrienol Family: Effect of Deactivating

Protection Groups

To access the rest of the tocotrienol class, namely β-, ɣ-, and δ-tocotrienols (2), a deactivating group was necessary to prevent over-alkylation of the additional open arene positions, leading to complex product formation. With an acetyl group on the 1-OH position, the geranylgeranyl group is directed only to the 3 position. However, only a 147

small portion of the product is cyclized into tocotrienol acetate (2-Ac), with the bulk of the obtained product being the non-cyclized 3-geranylgeranyl-hydroquinone acetate (37–

39), potentially due to the lower nucleophilicity of the 4-OH.

R1 O

O O R2 OH R1 R1 O CF O O 3 3 10% 35-In(OTf ) 32 Or 3 + CF3 2.5% octylether O O O in decane R2 OH R2 O 100°C, low vacuum 3 3 3 O 33 30 min R1, R2 = Μe, H 37, 70% β-2-Ac, 20% = H, Me 38, 88% γ-2-Ac, 11% = H, H 39, 80% δ-2-Ac, 5% = Me, Me 40 α-2-Ac

Figure 9: Synthesis of β-, ɣ-, and δ-tocotrienols by the type I acid catalyst system: effect of an electron withdrawing protecting group

5.6 Next Generation Approach: Type II Adanve Acids

To cyclize 37, 38, and 39 into their corresponding tocotrienol acetates, we turned to the Bronsted acid version of the catalyst system (41–47), which has an acid moiety directly attached to an ammonium or phosphonium within the confines of a large framework. With these acids, we were able to cyclize 37, 38, and 39 respectively into β-,

ɣ-, and δ-tocotrienol acetates (2-Ac) at room temperature in polar solvents such as

CH2Cl2 or 1,2-dichloroethane. We observed that 39 had a lower conversion rate than 37 and 38, which in turn have a lower conversion rate than geranylgeranyl-TMHQ-acetate

(40). This outcome is likely due to the lower phenol nucleophilicity stemming from the lower methyl substitution.

148

R1 R1 O O 41 - 47 O O R2 OH DCE R2 O 37 - 40 2-4 days, RT 2-Ac 26-75% conversion/yield R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ) MeO tBu tBu tBu OMe R4 R3O Br Br HO Br O tBu N N P O O SO H n O F F 3 S F N N O Br P SO3H HO HCl H S O Cl HO 41: Adanve-C-S1-OH, R3 = H, R4 = H, n = 1 O O tBu 42: Adanve-C-S2-OH, R3 = H, R4 = H, n = 2 44: Adanve-HC-S2F-OH 45: Adanve- 43: Adanve-HQ-S2-OClBz, R3 = ClBz, R4 = P-R2 OMe OMe, n = 2 tBu tButBu MeO Br Br MeO MeO N N O O Br Cl Br S O S O N H N HO HO O N O N NN Cl Cl SO H O O SO H O O OH OH O O N N 46: Adanve-(HQN)2- H 47: Adanve-(HQN)2- H R2-OAQN Cl R2-OPHAL MeO Cl MeO

Figure 10: Synthesis of β-, ɣ-, and δ-tocotrienols by the type II acid catalyst system.

Still, it was noteworthy that the type II Adanve acids (41–47) could cyclize these substrates (37–40) into the benzopyrans at room temperature in 1,2-dichloroethane whereas camphorsulfonic acid (CSA, 48) and its derivatives (49, 50) failed to do so in the same conditions. This phenomenon is likely explained not only by the higher complexation capacity of the type II acids, but also by the lower pKa of their sulfonic acid group as a result of the neighboring quaternary ammonium/phosphonium. With amino acids, it is known that a positively charged ammonium lowers the pKa of carboxylic acids

(from 4.76 for acetic acid to 2.34 for glycine).13 By analogy, a similar effect could be operational with these acids, thereby enhancing the strength of the acid moiety.

149

No TO No TO No TO TO

Br HO HO N O O S O O O S O S S OH OH HO O HO O F3C HO O N 48: (1R)-(-)-10-CSA 49 50 H Cl 51: Adanve- CD-R1-OH

Figure 11. Enhancing effects of the charged species: Adanve acid comparison with CSA and its derivatives

Moreover, we noted that the dimeric catalysts (45–47) were especially active beyond their obvious carrying of two acid moieties, pointing to a possible synergistic effect of the two sulfonic acids. This point will be discussed further in Chapter 6.

Unlike the type I catalyst system, the type II Adanve acids were unfortunately not catalytic with this particular substrate unless heated to 100 °C with accompanying lowering of the regioselectivity. We hypothesize that this result is due to product inhibition. On the positive side, this binding of the tocotrienols to the Adanve acids keeps them stable in solution in ambient air when they are known to be prone to oxidation.

Another advantage of the type II acids, as with the type I system, is that most of them are solid allowing for easy manipulation and easy recovery for reuse. Moreover, they are readily synthesized from cheap starting materials in a modular process, which allows for ready variation of not only the chain length of the acid moiety, but also of the overall molecular architecture.

150

5.7 Conclusion

We developed a single step process for the production of α-tocotrienol that is analogous to the current industrial process for α-tocopherol. To make the process more renewable, we devised a semi-synthetic route that harnesses the power of bioengineering to produce the terpenoid portion of the tocotrienol molecule in yeast through a novel triple fusion enzyme construct. To access the rest of the tocotrienols, a deactivating group is necessary on the 1-OH of the hydroquinone, which deactivates the 4-OH, leading to most of the product remaining non-cyclized. By engaging the Bronsted acid version of our catalyst system, we achieved the regioselective cycloetherification of these 3- geranylgeranyl-hydroquinone intermediates into β-, ɣ-, and δ-tocotrienol acetates in mild conditions. Together, these new acid catalysts offer mild reaction conditions, low catalyst loading, and ease of manipulation and recovery owing to their solid state. Even in cases where the catalysts are soluble in CH2Cl2 or 1,2-dichloroethane, the addition of hexanes results in their crashing out of solution. 151

5.8 References

(1) Shen, H. C. Tetrahedron 2009, 65, 3931. (2) Weimann, B. J. W., H. Am. J. Clin. Nutr. 1991, 53, 1056S (3) Weiser, H. V., M. Internat. J. Vit. Nutr. Res 1982, 52, 351 (4) Yamamoto, Y. F., A.; Hara, A.; Dunlap, W. Proc. Nat. Acad. Sci. 2001, 98, 13144 (5) Pearce, B. C. P., R. A.; Deason, M. E.; Qureshi, A. A.; Wright, J. J. J. Med. Chem. 1992, 35, 3595 (6) Compadre, C. M.; Singh, A.; Thakkar, S.; Zheng, G.; Breen, P. J.; Ghosh, S.; Kiaei, M.; Boerma, M.; Varughese, K. I.; Hauer-Jensen, M. Drug Development Research 2014, 75, 10. (7) Urano, S. N., S.-I.; Matsuo, M. Chem. Pharm. Bull. 1983, 31, 4341. (8) Mayer, H. M., H.; Isler, O. Helv. Chim. Acta 1967, 50, 1376. (9) Scott, J. W. B., F. T.; Parrish, D. R.; Saucy, D. Helv. Chim. Acta 1976, 59, 290 (10) Chenevert, R. C., G.; Pelchat, N. Bioorganic & Medicinal Chemistry 2006, 14, 5389 (11) Couladouros, E. A. M., V. I.; Lampropoulou, M.; Little, J. L.; Hyatt, J. A. J. Org. Chem. 2007, 72, 6735 (12) Vece, V.; Ricci, J.; Poulain-Martini, S.; Nava, P.; Carissan, Y.; Humbel, S.; Duñach, E. Eur. J. Org. Chem. 2010, 2010, 6239. (13) Barrett, G. C. E., D. T. Amino Acids and Peptides; Cambridge University Press: Cambridge, 1998. (14) Harmer, M. A.; Junk, C.; Rostovtsev, V.; Carcani, L.; Vickery, J.; Schnepp, Z. Eur. Green Chem. 2007, 9, 30. (15) Acidity and Basicity of Solids: Theory, Assessment and Utility; Kluwer Academic Publishers: Dordrecht, 1994. 152

5.9 Experimental Section

General procedures: All reactions were carried out under argon atmosphere with dry solvents under anhydrous conditions, unless otherwise stated. Reagents were purchased from commercial vendors at the highest available purity and used without further purification. Dry dichloromethane (CH2Cl2), diethyl ether (Et2O), and tetrahydrofuran (THF) were purchased from Sigma-Aldrich. All reactions were stirred magnetically and monitored by TLC performed on 0.25 mm E. Merck silica gel plates (60F-254) using UV light as the visualizing agent or cerium ammonium molybdate (CAM) and heat as the developing agent. Silica gel (SiliCycle 60, academic grade) was used to carry out flash column chromatography. Unless otherwise recorded, yields refer to purified materials with spectroscopically (1H and 13C NMR) homogeneity. NMR spectra were recorded on Bruker DRX-300, DRX-400, and DRX-500 instruments calibrated using residual undeuterated solvents as internal reference. Multiciplicities were represented by the following abbreviations: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, AB = AB quartet, br = broad. IR spectra were recorded on a Perkin Elmer Spectrum Two® FT-IR spectrometer, and High-resolution mass spectra (HRMS) were recorded in the Columbia University Mass Spectral Core facility on a Waters XEVO G2XS QToF mass spectrometer using electrospray ionization (ESI), atmospheric solids analysis probe (ASAP) and atmospheric pressure chemical ionization (APCI) techniques.

Abbreviations: CH2Cl2 = dichloromethane, PLE = pig liver esterase, DIPEA = diisopropyl ethyl amine, MgSO4 = Magnesium sulfate, Et2O = diethyl ether, TMHQ = trimethylhydroquinone, (NH4)2SO4 = Ammonium sulfate, NH4Cl = ammonium chloride, EtOH = ethanol, MeOH = methanol, DI = distilled, HCl = hydrogen chloride, RT = room temperature, DCE = 1,2-dichloroethane, TeCE = 1,1,2,2-tetrachloroethane, EtOAc = ethyl acetate, Et3N = triethyl amine, TLC = thin layer chromatography, CAM = cerium ammonium molybdate

A. Terpenoid precursors preparation Geranyltrifluoroacetate (30): To a solution of geraniol (4 g, 26 mmol, 1 equiv) and o Et3N (7.2 mL, 52 mmol, 2 equiv) in CH2Cl2 (50 mL) at 0 C was added dropwise TFAA (4.68 mL, 33.8 mmol, 1.3 equiv). The resulting mixture was stirred for 1 hour at 0oC, whereupon it was quenched with cold water (75 mL). The organic fraction was recovered and the aqueous fraction further extracted with CH2Cl2 (2 X 50 mL). The pooled organic fractions were washed with brine, dried with MgSO4 and concentrated to afford a crude orange oil. This oil was eluted through a silica plug already impregnated with 50% EtOAc-hexanes to afford the pure product after concentration as light orange/greenish oil (6.3 g, 97%). Rf = 0.70 (silica gel, 15% EtOAc:hexanes); IR (film) 2971, 2920, 2860, 1782, 1669, 1450, 1386, 1220, 1142, 910, 428; 1H NMR (500 MHz, CDCl3) δ 5.39 (t, J = 7.3 Hz, 1H), 5.06 (t, J = 6.0 Hz, 1H), 4.85 (d, J = 7.4 Hz, 2H), 2.16 – 2.04 (m, 4H), 1.75 (s, 3H), 1.67 (s, 3H), 1.59 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 158.3, 158.0, 157.7, 157.3, 146.0, 132.4, 123.7, 116.4, 116.1, 113.8, 65.1, 39.84, 26.4, 25.8, 17.9, 16.8; HRMS analysis was attempted, but fragmentation prevented observation of the

153

molecular ion.

E,E-Farnesyltrifluoroacetate (31): Light oil with slight green tinge. Rf = 0.67 (silica gel, 15% EtOAc:Hexanes); IR (film) 2971, 2919, 2857, 1782, 1670, 1448, 1219, 1139, 909, 428; 1H NMR (500 MHz, CDCl3) δ 5.39 (t, J = 7.3 Hz, 1H), 5.09 (t, J = 6.2 Hz, 2H), 4.85 (d, J = 7.4 Hz, 2H), 2.12 – 2.03 (m, 7H), 1.99 (d, J = 7.7 Hz, 2H), 1.76 (s, 3H), 1.67 (s, 3H), 1.60 (s, 6H); 13C NMR (125 MHz, CDCl3) δ 158.0, 157.7, 157.3, 146.1, 136.1, 131.6, 124.6, 123.6, 116.3, 116.1, 113.8, 65.1, 40.0, 39.8, 27.0, 26.4, 25.9, 17.9, + + 16.8, 16.3; HRMS (ASAP) calcd for C17H25F3O2 [M] 318.1807, found 318.1815.

E,E,E-Geranyltrifluoroacetate (32): Yellow tinged oil. Rf = 0.67 (silica gel, 15% EtOAc:Hexanes); IR (film) 2971, 2919, 2858, 1781, 1671, 1449, 1219, 1139, 910, 428; 1H NMR ( 500 MHz, CDCl3) δ 5.40 (t, J = 7.1 Hz, 1H), 5.11 (br s, 3H), 4.85 (d, J = 7.4 Hz, 2H), 2.20 2.03 (m, 9H), 2.02 1.94 (m, 4H), 1.76 (s, 3H), 1.68 (s, 3H), 1.61 (s, 9H); 13C NMR (125 MHz, CDCl3) δ 158.0, 157.7, 146.1, 136.1, 135.3, 131.6, 124.7, 124.5, 123.6, 116.3, 116.1, 113.8, 65.1, 40.1, 40.0, 39.9, 27.1, 26.9, 26.4, 26.0, 18.0, 16.9, 16.3, + + 16.3; HRMS (ASAP) calcd for C22H33F3O2 [M] 386.2433, found 386.2439.

E,E-Geranyllynalyltrifluoroacetate (33): Yellow tinged oil. Rf = 0.75 (silica gel, 15% EtOAc:Hexanes); IR (film) 2918, 2919, 2856, 1781, 1450, 1368, 1217, 1156, 989, 832, 776, 680, 453; 1H NMR (500 MHz, CDCl3) δ 5.98 (ddd, J = 17.2, 11.0, 5.9 Hz, 1H), 5.35 – 5.22 (m, 3H), 5.11 (br s, 3H), 2. 15 – 1.92 (m, 12H), 1.91 – 1.83 (m, 1H), 1.74 – 1.57 (6 s, 16H); 13C NMR (125 MHz, CDCl3) δ 156.3, 155.9, 139.3, 139.3, 136.7, 136.6, 136.5, 135.8, 135.6, 135.5, 135.4, 131.8, 131.6, 125.3, 125.1, 124.7, 124.7, 124.6, 124.4, 124.3, 124.0, 123.8, 123.1, 115.9, 115.8, 113.6, 89.2, 89.1, 53.7, 40.3, 40.1, 40.1, 40.0, 39.7, 32.5, 32.3, 32.3, 32.2, 27.1, 27.0, 27.0, 26.8, 26.8, 26.8, 27.0, 26.0, 26.0, 23.7, 23.6, 23.4, 23.3, 22.4, 22.3, 22.3, 17.9, 17.9, 16.3, 16.2, 16.2; HRMS (ASAP) calcd for + + C22H33F3O2 [M] 386.2433, found 386.2429.

B. Hydroquinone precursors preparation 2,3,6-Trimethylhydroquinone-1-acetate (S1): To a solution of 2,3,5- trimethylhydroquinone (2g, 13.1 mmol, 1 equiv) in CH2Cl2 (11 mL) at RT was added DIPEA (6 ml, 34.2 mmol, 2.6 equiv) followed by Ac2O (3 mL, 32 mmol, 2.4 equiv). The mixture was stirred overnight when it was diluted with EtOAc (100 mL) and washed with (NH4)2SO4 (aq, 100 mL), water (100 mL) and brine (100 mL). Upon drying (MgSO4) and solvent evaporation, a reddish solid (3.1 g, trimethylhydroquinone di-acetate) was obtained. 2g (8.5 mmol, 1 equiv) of this solid was dissolved into EtOH:H2O (10:1, 15.4 mL), Na2S2O4 (3.7 g, 21.2 mmol, 2.5 equiv) added, and under vigorous stirring at RT, titrated with a concentration aqueous solution of NaOH (monitored by TLC). At completion, the reaction mixture was quenched with (NH4)2SO4 (aq, 100 mL), brine (50 mL) and extracted with Et2O (3 X 50 mL). The pooled organic fractions were washed with brine, dried (MgSO4), and concentrated to yield a reddish brown solid (1.64 g, 99%). Rf = 0.45 (silica gel, 30% EtOAc:hexanes); IR (film) 3457, 2926, 1730, 1589, 1366, 1318, 1242, 1188, 1075, 850, 594, 505; 1H NMR (300 MHz, CDCl3) δ 6.33 (s, 1H), 5.46 (br s, 1H),

154

2.34 (s, 3H), 2.07 (s, 3H), 2.04 (s, 3H), 2.03 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 170.7, 151.6, 141.7, 129.7, 127.5, 121.8, 114.9, 20.8, 16.4, 13.3, 12.1; HRMS (ESI) + calcd for C11H14O3Na [M + Na] 217.0841, found 217.0848.

2,5-Dimethylhydroquinone-1-acetate (S2): was made according to method for S1 from 2,5-dimethyl-1,4-benzoquinone (2.5 equivalent of Na2S2O4 was added into the di-acetate formation reaction) followed by purification on silica gel (10% EtOAc:hexanes). White solid; Rf = 0.44 (silica gel, 30% EtOAc:hexanes); IR (film) 3423, 3242 (br), 2929, 1722, 1631, 1522, 1463, 1411, 1369, 1241, 1174, 1151, 925, 584, 516; 1H NMR (500 MHz, CDCl3) δ 6.74 (s, 1H), 6.57 (s, 1H), 4.80 (s, 1H), 2.29 (s, 3H), 2.17 (s, 3H), 2.07 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 170.4, 151.8, 142.8, 128.6, 124.1, 122.6, 117.4, 21.1, + 16.1, 15.7; HRMS (ESI) calcd for C10H12O3Na [M + Na] 203.0684, found 203.0685.

2,3-Dimethylhydroquinone-1-acetate (S3): was made according to method for S1 from 2,3-dimethylhydroquinone. Light brown solid; Rf = 0.44 (silica gel, 30% EtOAc:hexanes); IR (film) 3452, 2928, 1733, 1589, 1486, 1458, 1372, 1240, 1223, 1046, 1011, 822, 613; 1H NMR (500 MHz, CDCl3) δ 6.66 (d, J = 8.6 Hz, 1H), 6.46 (d, J = 8.6 Hz, 1H), 5.48 (br s, 1H), 2.32 (s, 3H), 2.11 (s, 3H), 2.05 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 171.0, 151.9, 142.9, 130.0, 124.6, 119.4, 113.3, 21.2, 13.2, 12.3; HRMS (ESI) + calcd for C10H12O3Na [M + Na] 203.0684, found 203.0688.

3-Methylhydroquinone-1-acetate (S4): To a solution of 2-methylhydroquinone (1g, o 8.06 mmol, 1 equiv) in CH2Cl2 (74 mL) at 0 C was added dropwise DIPEA (1.47 mL, 8.46 mmol, 1.05 equiv) followed by Ac2O (0.76 mL, 8.06 mmol, 1 equiv). Upon stirring for 4 hours at this temperature, the reaction mixture was washed with aqueous NH4Cl (100 mL) and water (100 mL). After drying (MgSO4) and concentration, the crude solid was purified on silica gel (10% EtOAc:hexanes) to yield 0.79 g (63%) of the the mono- acetate as a white solid. Rf = 0.44 (silica gel, 30% EtOAc:hexanes); IR (film) 3463, 3433, 2926, 1733, 1507, 1430, 1371, 1229, 1179, 1102, 1016, 910, 817, 597, 508, 447; 1H NMR (500 MHz, CDCl3) δ 6.82 (s, 1H), 6.74 (d, J = 8.6 Hz, 1H), 6.64 (d, J = 8.6 Hz, 1H), 5.17 (s, 1H), 2.27 (s, 3H), 2.19 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 170.9, 152.0, 144.1, 125.6, 123.9, 119.9, 115.8, 21.4, 16.2; HRMS (ESI) calcd for C9H10O3Na [M + Na]+ 189.0528, found 189.0529.

C. Geranylgeranyl-hydroquinone precursors 6-Geranylgeranyl-2,3,5-trimethylhydroquinone (S5): Trimethylhydroquinone (0.5 g, 3.29 mmol, 1 equiv) and geranyllynalool (1.24 g, 4.27 mmol, 1.3 equiv) were dissolved . into 1,4-dioxane (14 mL) at room temperature. To this mixture, BF3 Et2O (0.1 mL, 0.82 mmol, 0.25 equiv) was added dropwise with stirring. The resulting reaction mixture was heated at 65oC for 1 hour, the dioxane removed under reduced pressure, and the crude brownish paste dissolved in ether (60 mL). After washing the resulting solution successively with NaHCO3 (aq., 75 mL), Na2S2O4 (aq., 50 mL X 2), brine (50 mL) and drying it (MgSO4), the solvent was removed to yield a brown paste. This material was triturated in hexanes, cooled to -65oC, centrifuged cold for 3 minutes and the hexanes decanted. This cold centrifugation process was repeated twice more after which a white

155

oily solid (darkens upon drying under high vac) is obtained. NMR spectra showed that this material still contained some trimethylhydroquinone contaminant, however, given the material’s susceptibility to oxidation, we chose to refrain from any further purification. Rf = 0.27 (silica gel, 15% EtOAc:hexanes); IR (film) 3368 (br), 2968, 2920, 2863, 1645, 1448, 1326, 1211, 1075, 1045, 593; 1H NMR (500 MHz, CDCl3) δ 5.16 – 5.02 (m, 4H), 4.70 (s, 1H), 4.26 (s, 1H), 3.38 (d, J = 6.5 Hz, 2H), 2.22 – 2.13 (m, 17H), 1.98 (br s, 3H), 1.84 – 1.80 (2 s, 3H), 1.69 (s, 6H), 1.64 – 1.56 (m, 7H); 13C NMR (125 MHz, CDCl3) δ 147.3, 146.7, 146.2, 146.0, 135.8, 125.4, 124.8, 124.7, 124.5, 124.1, 122.4, 122.3, 121.2, 114.7, 40.3, 40.1, 40.0, 32.3, 27.1, 27.0, 26.9, 26.8, 26.8, 26.7, 26.5, 26.0, 23.7, 18.0, + 18.0, 16.6, 16.5, 16.4, 16.2, 12.6, 12.5, 12.3; HRMS (ESI) calcd for C29H44O2Na [M + Na]+ 447.3239, found 447.3235.

5-Geranylgeranyl-2,3,6-trimethylhydroquinone-1-acetate (40): was made from S1 and geranyllynalool according to the method described for S5 but without the centrifugation. Following silica gel purification (5% EtOAc:hexanes), 40 was obtained as a viscous oil. Rf = 0.31 (silica gel, 15% EtOAc:hexanes); IR (film) 3494 (br), 2968, 2920, 2856, 1742, 1449, 1370, 1206, 1074, 1051, 941, 832, 501; 1H NMR (300 MHz, CDCl3) δ 5.17 – 5.04 (m, 5H), 3.37 (d, J = 6.7 Hz, 1H), 2.34 (s, 3H), 2.15 (s, 3H), 2.09 – 2.03 (2 s, 14H), 2.04 – 1.95 (m, 3H), 1.82 (s, 3H), 1.69 (s, 6H), 1.61 (s, 6H); 13C NMR (125 MHz, CDCl3) δ 170.0, 150.8, 150.7, 141.9, 138.7, 138.6, 136.1, 136.0, 135.9, 135.8, 135.6, 135.5, 135.3, 135.2, 131.8, 131.6, 127.4, 125.9, 125.4, 125.3, 124.8, 124.7, 124.7, 124.6, 124.4, 124.0, 123.9, 123.7, 121.9, 121.8, 40.3, 40.3, 40.1, 40.0, 32.6, 32.3, 27.1, 27.0, 27.0, 26.9, 26.9, 26.8, 26.7, 26.7, 26.5, 26.0, 23.7, 20.8, 18.0, 17.9, 16.6, 16.5, 16.5, 16.4, 16.3, 16.3, 13.4, + + 13.2, 12.4; HRMS (ESI) calcd for C31H46O3Na [M + Na] 489.3345, found 489.3349.

3-Geranylgeranyl-2,5-dimethylhydroquinone-1-acetate (37): obtained as the major product (70%; 20% is cyclized to β-tocotrienol acetate) in the reaction of S2 and 32 (or 33) catalyzed by the N-[4-(Trifluoromethyl)benzyl]cinchoninium bromide–In(OTf)3 system in 2% n-octyl ether-decane (see below for a representative procedure with the difference that GGOTFA (32) was added nearly immediately after adding S2 given the better solubility). Silica gel purification (3% EtOAc:hexanes) yields 37 as a clear oil. Rf = 0.30 (silica gel, 15% EtOAc:hexanes); IR (film) 3494 (br), 2964, 2919, 2854, 1742, 1476, 1447, 1369, 1206, 1076, 511; 1H NMR (500 MHz, CDCl3) δ 6.68 (s, 1H), 5.16 – 5.03 (m, 5H), 3.38 (d, J = 6.5 Hz, 2H), 2.30 (s, 3H), 2.18 (s, 3H), 2.11 – 1.95 (m, 15H), 1.82 (d, J = 4.2 Hz, 3H), 1.69 (s, 6H), 1.61 (s, 6H), 1.23 – 1.17 (m, 1H); 13C NMR (125 MHz, CDCl3) δ 170.3, 151.0, 142.7, 138.6, 135.8, 126.6, 125.4, 124.7, 124.4, 124.0, 122.9, 121.7, 121.7, 121.5, 40.3, 40.1, 40.0, 32.3, 27.0, 27.0, 26.9, 26.7, 26.5, 26.0, 23.7, + + 21.1, 18.0, 16.6, 16.5, 16.4, 16.2, 12.9; HRMS (ESI) calcd for C30H44O3Na [M + Na] 475.3188, found 475.3188.

5-Geranylgeranyl-2,3-dimethylhydroquinone-1-aceate (38): obtained as the major product (88%) in the reaction of S3 and 32 (or 33) as with 37. Silica gel purification (3% EtOAc:hexanes) yields 38 as a clear oil. Rf = 0.30 (silica gel, 15% EtOAc:hexanes); IR (film) 3489, 2965, 2922, 2852, 1766, 1742, 1448, 1373, 1206, 1070, 906, 831, 499; 1H NMR (500 MHz, CDCl3) δ 6.62 (s, 1H), 5.30 (t, J = 6.3 Hz, 1H), 5.16 (s, 1H), 5.14 –

156

5.04 (m, 3H), 3.31 (d, J = 7.1 Hz, 2H), 2.30 (s, 3H), 2.16 (s, 3H), 2.14 – 2.05 (m, 6H), 2.04 (s, 6H), 2.01 – 1.95 (m, 3H), 1.78 (d, J = 5.2 Hz, 3H), 1.68 (s, 6H), 1.62 – 1. 59 (2 s, 6H); 13C NMR (125 MHz, CDCl3) δ 170.4, 150.9, 142.6, 139.7, 139.6, 136.3, 136.0, 135.5, 135.4, 131.8, 131.6, 128.0, 125.4, 125.3, 124.9, 124.7, 124.7, 124.6, 124.6, 124.4, 123.9, 122.4, 121.8, 121.6, 120.1, 40.3, 40.3, 40.1, 40.0, 32.6, 32.3, 30.6, 30.3, 27.1, 27.1, 27.0, 26.9, 26.8, 26.7, 26.4, 26.1, 26.0, 23.7, 21.1, 18.0, 18.0, 16.6, 16.5, 16.4, 16.3, 13.1, + + 12.5; HRMS (ESI) calcd for C30H44O3Na [M + Na] 475.3188, found 475.3187.

5-Geranylgeranyl-3-methylhydroquinone-1-acetate (39): obtained as the major product (80%) in the reaction of S4 and 32 (or 33) as with 37 and 38. Silica gel purification (3% EtOAc:hexanes) yields 39 as a clear oil. Rf = 0.30 (silica gel, 15% EtOAc:hexanes); IR (film) 3406 (br), 2964, 2920, 2854, 1767, 1447, 1376, 1203, 912; 1H NMR (300 MHz, CDCl3) δ 6.72 (s, 1H), 6.68 (s, 1H), 5.31 (t, J = 6.7 Hz, 1H), 5.15 – 5.05 (m, 4H), 3.33 (d, J = 7.1 Hz, 2H), 2.23 (s, 3H), 2.21 (s, 3H), 2.14 – 1.95 (m, 12H), 1.77 (d, J = 1.7 Hz, 2H), 1.69 (s, 6H), 1.61 (s, 6H), 0.92 – 0.84 (m, 2H); 13C NMR (125 MHz, CDCl3) δ 170.5, 150.9, 143.7, 139.6, 135.5, 127.3, 125.8, 124.7, 121.9, 121.6, 120.4, 40.3, 40.0, 39.6, 32.3, 30.5, 27.0, 26.6, 26.0, 23.7, 21.4, 18.0, 16.6, 16.3; HRMS + + (ESI) calcd for C29H42O3Na [M + Na] 461.3032, found 461.3027.

Type I Adanve Acids general preparation method: A suspension of Lewis acid (1 equiv) and PTC (1.3 equiv) in decane (or mixture of alkyl ether:decane) is heated with stirring at 100oC for 10 minutes. The resulting white solid can be used directly (reactants added to the suspension) or filtered and stored to be used at a later time.

Prenyl-chroman (7)—representative procedure for the single step Friedel-Crafts and regioselective cycloetherification: To a stirring suspension of N-[4-(Trifluoromethyl)benzyl]cinchoninium bromide– o In(OTf)3, 37 mg, 9.5 mol%) in 0.5% n-Butyl ether:decane (3 mL) at 100 C was added TMHQ (92 mg, 0.61 mmol, 2 equiv). The resulting suspension was stirred for 20 minutes, then geranyl trifluoroacetate (30, 76 mg, 0.3 mmol, 1 equiv) in 1 mL of 0.5% n- butyl ether:decane is added all at once and the reaction mixture put under house vacuum. The reaction mixture continued to be stirred and heated under this light vacuum for 15 minutes when TLC showed complete conversion of 30. At this point, following filtering out of excess TMHQ, the reaction mixture was directly purified on silica gel (3% EtOAc:hexanes) to yield 7 as a clear oil (84.4 mg, 96% based on 30). Rf = 0.33 (silica gel, 15% EtOAc:hexanes); IR (film) 3457 (br), 2925, 2857, 1720, 1452, 1377, 1256, 1167, 1086, 1038, 926; 1H NMR (300 MHz, CDCl3) δ 5.13 (t, J = 7.1 Hz, 1H), 4.16 (s, 1H), 2.62 (t, J = 6.9 Hz, 1H), 2.20 – 2.05 (m, 14H), 1.86 – 1.73 (m, 2H), 1.72 – 1.49 (m, 9H), 1.25 (s, 2H), 1.14 (s, 1H), 1.01 (s, 1H), 0.93 (s, 1H); 13C NMR (125 MHz, CDCl3) δ 145.8, 144.9, 131.7, 124.9, 123.0, 121.4, 118.8, 117.7, 75.7, 74.6, 48.7, 42.1, 40.3, 39.9, 33.7, 32.4, 31.9, 26.0, 24.0, 22.7, 22.3, 21.1, 20.9, 20.2, 20.1, 17.9, 12.5, 12.2, 12.1, 11.6; + + HRMS (ASAP) calcd for C19H28O2 [M] 288.2089, found 288.2088.

Geranyl-chroman (36): Synthesized from 31 and TMHQ in 95% yield according to the procedure described for 7 with the difference that the solvent in this case was 2.5% n- octyl ether:decane. Colorless oil; Rf = 0.33 (silica gel, 15% EtOAc:hexanes); IR (film)

157

3456 (br), 2925, 2856, 1719, 1452, 1377, 1255, 1166, 1086, 1037, 926; 1H NMR (300 MHz, CDCl3) δ 5.18 – 5.06 (m, 2H), 4.18 (s, 1H), 2.66 – 2.57 (m, 2H), 2.17 (s, 4H), 2.12 (s, 7H), 2.07 – 1.93 (m, 4H), 1.85 – 1.74 (m, 2H), 1.67 (br s, 4H), 1.65 – 1.51 (4 s, 8H), 1.28 – 1.20 (m, 4H), 1.01 (s, 1H), 0.96 – 0.82 (m, 3H); 13C NMR (125 MHz, CDCl3) δ 145.8, 144.9, 135.4, 131.7, 125.5, 124.7, 124.7, 123.6, 122.9, 121.4, 120.2, 118.8, 117.6, 74.6, 40.2, 40.0, 39.8, 31.9, 27.4, 27.0, 26.0, 24.0, 23.6, 22.5, 21.1, 19.9, 18.0, 16.2, 12.5, + + 12.1, 11.6; HRMS (ASAP) calcd for C24H36O2 [M] 356.2715, found 356.2723.

α-Tocotrienol (α-2): Synthesized from 32 (or 33) and TMHQ in an average yield of 91% according to the procedure described above for 7 with the difference that the solvent in this case was 2.5% n-octyl ether:decane). 1H NMR shows the presence of an inseparable side product. Note that from mg (0.083 mmol, 89%) of α-2 was derived from 27 (0.093) mg of biosynthetic GGOH (24). Two-step-single purification from GGOH (24): 100 mg (0.34 mmol) of 24 was trifluoroacetylated as described above to yield 32. CH2Cl2 was then removed under reduced pressure. This non-purified material was resuspended in 2.5% n-octyl ether:decane and reacted with TMHQ as before to yield 79.4 mg (0.19 mmol, 55% yield) of α-2. Colorless viscous oil; Rf = 0.33 (silica gel, 15% EtOAc:hexanes); IR (film) 3457 (br), 2924, 2855, 1719, 1451, 1376, 1257, 1166, 1086, 1038, 925; 1H NMR (300 MHz, CDCl3) δ 5.17 – 5.07 (m, 3H), 4.15 (s, 1H), 2.61 (t, J = 6.5 Hz, 1H), 2.16 (s, 4H), 2.11 (s, 8H), 2.04 (br s, 6H), 2.00 – 1.94 (m, 3H), 1.84 – 1.73 (m, 2H), 1.68 (s, 8H), 1.60 (s, 9H), 1.53 (s, 3H), 1.29 – 1.18 (m, 6H), 0.94 – 0.80 (m, 3H); 13C NMR (125 MHz, CDCl3) δ 145.7, 144.8, 135.3, 131.8, 125.3, 124.6, 122.9, 121.2, 118.7, 117.5, 74.5, 68.4, 40.2, 40.0, 39.7, 32.2, 31.8, 29.9, 27.0, 26.8, 26.6, 26.0, 24.0, 23.7, 22.5, 22.3, 21.0, 17.9, 17.9, + + 16.1, 12.5, 12.0, 11.5; HRMS (ESI) calcd for C29H44O2Na [M + Na] 447.3239, found 447.3239.

Adanve-C-S1-OH (41)—representative procedure for the preparation of type II Adanve Acids: A suspension of sodium bromomethanesulfonate# (500 mg, 2.54 mmol, 1 equiv) and cinchonine (784.5 mg, 2.67 mmol, 1.05 equiv) in DMF (4 mL) is heated with stirring at 130oC overnight. The solvent is then removed under reduced pressure, and the left over brown residue is dissolved in EtOH (10 mL) and cooled to 0oC. An ethanoic solution of HCl (1.25 M, 6.1 mL, 7.6 mmol, 3 equiv) is then added dropwise, and the resulting reaction mixture stirred at RT for 3 hours. At this point, the white precipitate (NaCl) is filtered out, and solvent removed under reduced pressurefrom the filtrate to yield a brown paste. Et2O (5 mL) is added to this material and removed under reduced pressure to yield a brown solid, which is dried under high vacuum for 24 hours (1.28 g, 99%). (Note: proton NMR shows evidence of trace DMF that is hard to remove). IR (film) 3131 (br), 2950, 2775, 2526 (br), 2286, 2054, 1982, 1893, 1662, 1627, 1599, 1542, 1229, 1182, 1037, 838, 762, 571, 514, 464, 411; 1H NMR (500 MHz, DMSO) δ 11.51 (s, 1H), 9.24 (d, J = 5.4 Hz, 1H), 8.84 (d, J = 7.7 Hz, 1H), 8.45 – 8.33 (m, 1H), 8.11 (dd, J = 13.7, 6.3 Hz, 2H), 7.94 (t, J = 7.7 Hz, 1H), 7.87 (s, 1H), 6.99 (br s, 1H), 6.62 (s, 1H), 5.97

158

(ddd, J = 17.4, 10.3, 7.2 Hz, 1H), 5.20 – 5.05 (m, 2H), 3.96 (s, 1H), 3.90 – 3.77 (m, 1H), 3.51 (t, J = 9.2 Hz, 1H), 3.41 (t, J = 11.4 Hz, 1H), 3.29 (t, J = 11.1 Hz, 1H), 3.15 (dd, J = 20.4, 10.4 Hz, 1H), 2.42 (d, J = 1.2 Hz, 2H), 2.24 – 2.14 (m, 1H), 1.86 (s, 1H), 1.74 – 1.72 (m, 1H), 1.65 – 1.60 (m, 1H), 1.14 – 1.11 (m, 1H), 1.01 – 0.72 (2 t, 1H); 13C NMR (125 MHz, DMSO) δ 162.3, 144.8, 137.7, 134.1, 130.0, 125.3, 125.0, 122.0, 119.7, 116.8, 66.3, 59.0, 48.3, 47.1, 43.0, 36.2, 35.8, 34.1, 30.8, 26.6, 22.5, 17.1, 11.4; HRMS + (ESI) calcd for C20H24N2O4SNa [M – HBr – HCl + Na] 411.1354, found 411.1349.

Adanve-C-S2-OH (42): Made from sodium bromoethanesulfonate and cinchonine according to the procedure described above for 41. Light brown solid; IR (film) 3171 (br), 2954, 2916, 2774, 2527 (br), 2055, 1982, 1627, 1599, 1430, 1216, 1167, 1038, 853, 761, 518, 412; 1H NMR (500 MHz, DMSO) δ 11.62 (s, 1H), 9.27 (d, J = 5.6 Hz, 1H), 8.88 (d, J = 8.6 Hz, 1H), 8.45 (d, J = 8.5 Hz, 1H), 8.16 – 8.06 (m, 2H), 7.94 (t, J = 7.7 Hz, 1H), 7.87 (s, 1H), 7.05 (br s, 1H), 6.65 (s, 1H), 6.35 (dd, J = 16.8, 10.1 Hz, 1H), 5.98 (ddd, J = 17.4, 10.2, 7.3 Hz, 1H), 5.52 (d, J = 16.8 Hz, 1H), 5.23 – 5.06 (m, 2H), 3.91 – 3.80 (m, 1H), 3.51 (t, J = 9.3 Hz, 1H), 3.41 (t, J = 11.2 Hz, 1H), 3.32 – 3.23 (m, 1H), 3.22 – 3.08 (m, 1H), 2.43 (s, 2H), 2.26 – 2.15 (m, 1H), 1.86 (s, 1H), 1.80 – 1.70 (m, 1H), 1.69 – 1.60 (m, 1H), 1.16 – 1.12 (m, 1H), 0.8 (t, J = 7.2 Hz, 1H); 13C NMR ( 126 MHz, DMSO) δ 162.3, 158.3, 144.4, 142.9, 137.7, 137.5, 134.3, 130.1, 125.3, 125.1, 121.5, 119.7, 116.8, 116.2, 66.3, 59.0, 48.3, 47.0, 36.2, 35.8, 34.1, 30.8, 26.7, 24.4, 23.9, 22.5, + 17.0, 11.4; HRMS (ESI) calcd for C21H27N2O4S [M – HBr – HCl + H] 403.1692, found 403.1685.

Adanve-HC-S2F-OH (44): Made from sodium 2-chloro-1,1,2-trifluoroethanesulfonate14 and hydrocinchonine according to the procedure described above for 41 with the modification that NaBr (1.05 equiv) was added to the initial reaction mixture. Amorphous, dark brown solid; IR (film) 3167, 2915, 2614, 2502 (br), 2022, 1626, 1599, 1542, 1454, 1419, 1382, 1278, 1225, 1080, 991, 942, 838, 774, 760, 936, 554, 530, 410; 1H NMR (500 MHz, DMSO) δ 10.78 (s, 1H), 9.29 (d, J = 4.4 Hz, 1H), 8.77 (d, J = 8.2 Hz, 1H), 8.35 (d, J = 8.1 Hz, 2H), 8.15 (dd, J = 15.7, 6.0 Hz, 2H), 7.98 – 7.91 (m, 2H), 7.87 (s, 2H), 6.83 (dd, J = 46.0, 14.2 Hz, 3H), 6.50 (s, 1H), 3.64 – 3.55 (m, 1H), 3.51 (t, J = 8.3 Hz, 1H), 3.40 (t, J = 10.4 Hz, 1H), 3.35 – 3.26 (m, 1H), 3.20 – 3.10 (m, 1H), 3.08 (s, 1H), 2.50 – 2.41 (2 s, 2H), 2.23 – 2.12 (m, 1H), 1.83 (br s, 1H), 1.80 – 1.71 (m, 1H), 1.70 – 1.58 (m, 2H), 1.54 – 1.40 (m, 2H), 1.19 – 0.80 (m, 1H), 0.81 (t, J = 6.6 Hz, 3H); 13C NMR (125 MHz, DMSO) δ 162.5, 158.6, 144.7, 137.4, 134.6, 130.4, 125.4, 125.1, 121.5, 119.9, 116.8, 116.6, 114.6, 114.3, 112.3, 112.1, 98.5, 98.3, 98.2, 98.0, 96.5, 96.3, 96.3, 96.1, 66.6, 59.3, 49.1, 48.6, 36.0, 34.3, 34.2, 30.9, 24.5, 23.9, 23.1, 17.1, 11.5; 19F NMR (282 MHz, DMSO) δ -109.54 (dd, J = 248.1, 15.6 Hz, 1F), -121.12 – -123.21 (m, 1F), -147.30 (dt, J = 46.1, 16.2 Hz, 1F). HRMS analysis was attempted, but fragmentation of the fluoroalkyl sulfonate prevented observation of the molecular ion.

Adanve-P-R2 (45): Derived from sodium bromoethanesulfonate and (R)-DTBM- Segphos® according to the the procedure described for 41 with the modification that 2 equivalents of sodium bromoethanesulfonate were used. Sticky, off white solid; IR (film) 3355 (br), 2957, 2912, 2866, 1670, 1591, 1446, 1408, 1390, 1363, 1261, 1228, 1183, 1141, 1115, 1054, 1032, 1003, 922, 885, 811, 778, 659, 610, 557, 527, 448; 1H NMR

159

(500 MHz, CDCl3) δ 9.24 (s, 2H), 7.68 – 6.42 (m, 15H), 5.83 – 5.50 (m, 2H), 3.80 – 3.54 (m, 11H), 3.38 (s, 2H), 2.61 (t, J = 5.3 Hz, 6H), 1.39 – 1.21 (m, 90H); 13C NMR ((125 MHz, CDCl3) δ 163.8, 37.9, 36.2, 35.2, 32.6, 32.0, 32.0, 31.9, 31.8, 31.8, 30.3, 30.2, 30.0; HRMS analysis was attempted, but fragmentation of the fluoroalkyl sulfonate prevented observation of the molecular ion.

Adanve-HQ-R2-OBzCl (S6, pseudoenantiomer of 43): Derived from sodium bromoethanesulfonate and O-(4-Chlorobenzoyl)hydroquinine according to the procedure described for 41. Dark, viscous oil; IR (film) 3425 (br), 2933, 2768, 2443 (br), 1729, 1664, 1601, 1495, 1462, 1430, 1385, 1260, 1171, 1086, 1012, 851, 755, 684, 529; 1H NMR (500 MHz, CDCl3) δ 12.53 (s, 1H), 9.01 – 8.95 (2 br s, 3H), 8.45 (d, J = 8.7 Hz, 1H), 8.16 (s, 1H), 8.00 (s, 2H), 7.75 (s, 1H), 7.61 (d, J = 8.5 Hz, 1H), 7.43 (d, J = 5.7 Hz, 2H), 4.16 (s, 3H), 3.86 (s, 1H), 3.78 – 3.69 (m, 1H), 3.68 – 3.46 (2 br s, 2H), 3.27 (br s, 1H), 2.61 (s, 6H), 2.51 – 2.37 (br s, 1H), 2.30 – 1.86 (3 br s, 4H), 1.33 (s, 2H), 0.77 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 163.6, 163.2, 162.0, 150.9, 141.3, 140.0, 139.1, 134.3, 131.4, 129.7, 129.1, 128.3, 126.6, 123.5, 120.9, 119.4, 102.8, 70.3, 58.8, 58.3, 57.0, 53.8, 43.7, 38.7, 37.2, 35.2, 35.1, 32.0, 26.9, 25.2, 24.7, 20.4, 11.7; HRMS (ESI) + calcd for C29H34N2O6SCl [M – HCl + H] 573.1826, found 573.1819.

Standard procedure for regioselective cycloetherification of Geranylgeranyl- hydroquinones to Tocotrienols using Type II Adanve Acids: All of the Type II Adanve Acids were effective in promoting the regioselective cycloetherification of 3- geranylgeranyl-hydroquinones to tocotrienols in halogenated solvents such as DCE, CH2Cl2, or TeCE. Typically, the appropriate 3-geranylgeranyl-hydroquinone starting material is dissolved into DCE (0.12 M) followed by the addition of the type II Adanve Acid (3 equiv for monomeric forms, 1 equiv for dimeric forms or super acid variant 44). The resulting reaction mixture is stirred at room temperature and monitored by TLC.

α-Tocotrienol (α-2): 75% conversion/yield after 2 days with Adanve-P-R2 (45) in DCE at room temperature.

α-Tocotrienol acetate (α-2-Ac): 65% conversion/yield after 2 days with Adanve-P-R2 44) in DCE at RT. 35% conversion/yield after 2 days with Adanve-S2-OH (42) at RT. Purification by silica gel (4% EtOAc:hexanes), colorless oil. Rf = 0.37 (silica gel, 15% EtOAc:hexanes); IR (film) 2927, 2862, 1758, 1453, 1369, 1208, 1167, 1111, 1079; 1H NMR (400 MHz, CDCl3) δ 5.16 5.06 (s, 3H), 2.60 (t, J = 6.1 Hz, 2H), 2.32 (s, 3H), 2.09 (d, J = 3.3 Hz, 4H), 2.02 (s, 4H), 1.98 (s, 5H), 1.68 (s, 6H), 1.60 (d, 5H), 1.54 (s, 4H), 1.26 – 1.22 (m, 5H), 0.92 – 0.830 (m, 3H) ; 13C NMR (100 MHz, CDCl3) δ 170.1, 149.7, 140.9, 135.5, 127.0, 125.3, 124.7, 123.4, 117.7, 75.2, 40.3, 40.1, 32.3, 31.4, 30.1, 26.9, 26.0, 23.8, 22.5, 22.4, 20.9, 18.0, 16.2, 13.3, 12.4, 12.2, 1.4; HRMS (ESI) calcd for + + C31H46O3Na [M + Na] 489.3345, found 489.3341.

β-Tocotrienol acetate (β-2-Ac): 40% conversion/yield after 4 days with Adanve-S2-OH (42) in DCE at RT. Purification by silica gel (4% EtOAc:hexanes), colorless oil. Rf =

160

0.36 (silica gel, 15% EtOAc:hexanes); IR (film) 2927, 2862, 1758, 1650, 1474, 1373, 1207, 1165, 1085, 1013, 927; 1H NMR (400 MHz, CDCl3) δ 6.64 (s, 1H), 5.18 – 5.04 (m, 3H), 2.61 (t, J = 6.4 Hz, 2H), 2.29 (s, 3H), 2.12 (d, J = 3.6 Hz, 4H), 2.09 – 1.95 (m, 10H), 1.83 – 1.49 (m, 20H), 1.26 (s, 3H), 0.95 – 0.80 (m, 3H); 13C NMR (100 MHz, CDCl3) δ 170.4, 150.1, 141.5, 135.5, 125.8, 125.4, 124.9, 124.7, 124.6, 121.4, 120.3, 75.2, 40.3, 40.1, 34.6, 32.3, 31.3, 30.1, 27.0, 26.9, 26.7, 26.0, 24.2, 23.7, 22.5, 21.2, 21.0, + + 18.0, 16.3, 12.2; HRMS (ESI) calcd for C30H44O3Na [M + Na] 475.3188, found 475.3184.

ɣ-Tocotrienol acetate (ɣ-2-Ac): 39% conversion/yield after 4 days with Adanve-S2-OH (42) in DCE at RT. Purification by silica gel (4% EtOAc:hexanes), colorless oil. Rf = 0.36 (silica gel, 15% EtOAc:hexanes); IR (film) 2927, 2859, 1759, 1447, 1369, 1206, 1103, 1076, 936; 1H NMR (400 MHz, CDCl3) δ 6.57 (s, 1H), 5.2 – 5.05 (m, 3H), 2.73 – 2.67 (m, 2H), 2.11 (d, J = 3.5 Hz, 4H), 2.07 – 1.93 (m, 11H), 1.81 – 1.51 (m, 18H), 1.29 – 1.23 (m, 5H), 0.97 – 0.80 (m, 3H); 13C NMR (100 MHz, CDCl3) δ 170.5, 152.3, 149.9, 142.0, 135.6, 135.5, 127.4, 126.2, 125.4, 124.7, 124.6, 123.4, 119.2, 118.7, 76.1, 40.4, 32.3, 31.4, 30.1, 27.0, 26.0, 24.5, 23.8, 22.6, 22.5, 21.2, 18.0, 16.3, 13.0, 12.3; HRMS + + (ESI) calcd for C30H44O3Na [M + Na] 475.3188, found 475.3195.

δ-Tocotrienol acetate (δ-2-Ac): 26% conversion/yield after 4 days with Adanve-S2-OH (42) in DCE at RT. Purification by silica gel (4% EtOAc:hexanes), colorless oil. Rf = 0.36 (silica gel, 15% EtOAc:hexanes); IR (film) 2927, 2855, 1759, 1474, 1454, 1370, 1205, 1018; 1H NMR (400 MHz, CDCl3) δ 6.66 (s, 1H), 6.61 (s, 1H), 5.16 – 5.04 (m, 3H), 2.75 – 2.70 (m, 2H), 2.25 (s, 3H), 2.16 – 1.90 (m, 14H), 1.77 – 1.49 (m, 21H), 1.30 – 1.16 (m, 7H), 0.97 – 0.83 (m, 5H); 13C NMR (100 MHz, CDCl3) δ 170.6, 142.9, 127.7, 121.5, 121.3, 121.2, 120.8, 119.4, 76.4, 40.2, 37.3, 31.3, 30.1, 26.1, 24.5, 23.8, 23.4, 22.8, + + 22.5, 21.4, 18.0, 17.0, 16.9, 16.5, 16.3; HRMS (ESI) calcd for C29H42O3Na [M + Na] 461.3032, found 461.3038.

Improved method for α-tocopherol production α-Tocopherol (α-1): Trimethylhydroquinone (6, 200 mg, 1.31 mmol) and In(OTf)3 (22 mg, 0.039 mmol, 3 mol%) were dissolved in DCE and heated to 80ºC with stirring. Phytyltrifluoroacetate (29, 514 mg, 1.21 mmol, 1 equiv) was then added. After 10 minutes, the reaction mixture was filtered through a silica plug and concentrated to yield ## mg (558.7 mg, 1.3 mmol, 99% yield) of α-1 as a clear oil. Alternatively, the reagents were combined as above in MeNO2 and stirred at room temperature overnight to yield α-1 in 95% yield. Rf = 0.34 (silica gel, 15% EtOAc:hexanes); IR (film) 3567 (br), 2924, 2866, 1458, 1377, 1260, 1211, 1159, 10583, 1058, 1009, 918, 647; 1H NMR (300 MHz, CDCl3) δ 2.61 (t, J = 6.8 Hz, 1H), 2.16 (s, 2H), 2.12 (s, 3H), 1.79 (dq, J = 13.5, 6.6 Hz, 1H), 1.62 – 1.00 (m, 13H), 0.90 – 0.82 (m, 6H); 13C NMR (100 MHz, CDCl3) δ 145.9, 144.9, 123.0, 121.3, 117.7, 100.3, 74.9, 40.25, 40.18, 39.7, 37.9, 37.8, 37.8, 37.7, 37.6, 33.2, 33.1, 31.9, 31.9, 28.3, 25.2, 24.8, 24.1, 23.1, 23.0, 21.4, 21.1, 20.1, 12.1, 11.6; HRMS (ASAP) calcd for + + C29H51O2 [M + H] 431.3889, found 431.3894.

161

3 CF O O 30 , 500 MHz) 3 (CDCl

162

3 CF

O

O

30 , 125 MHz) 3 (CDCl

163

3 CF O O 31 , 500 MHz) 3 (CDCl

164

3 CF

O O

31 , 125 MHz) 3 (CDCl

165

3 CF O O 32 , 500 MHz) 3 (CDCl

166

3 CF

O O

32 , 125 MHz) 3 (CDCl

167

3

CF O O 33 , 500 MHz) 3 (CDCl

168

3

CF O

O 33 , 125 MHz) 3 (CDCl

169

OH S1 , 300 MHz) 3 O O (CDCl

170

OH S1 , 125 MHz) 3 O O (CDCl

171

OH S2 , 500 MHz) 3 O O (CDCl

172

OH S2 , 125 MHz) 3 O O (CDCl

173

OH S3 , 500 MHz) 3 O O (CDCl

174

OH S3 , 125 MHz) 3 O O (CDCl

175

OH S4 , 500 MHz) 3 O O (CDCl

176

OH S4 , 125 MHz) 3 O O (CDCl

177

S5 , 500 MHz) 3 OH (CDCl HO

178

S5 , 500 MHz) 3 OH (CDCl HO

179

40 , 300 MHz) OH 3 (CDCl O O

180

40 , 125 MHz) OH 3 (CDCl O O

181

37 , 500 MHz) 3 OH (CDCl O O

182

37 , 125 MHz) 3 OH (CDCl O O

183

38 , 500 MHz) 3 OH (CDCl O O

184

38 , 125 MHz) 3 OH (CDCl O O

185

39 , 300 MHz) 3 OH (CDCl O O

186

39 , 125 MHz) 3 OH (CDCl O O

187

7 , 300 MHz) 3 O (CDCl HO

188

7 , 125 MHz) 3 O (CDCl HO

189

36 , 300 MHz) 3 O (CDCl HO

190

36 , 125 MHz) 3 O (CDCl HO

191

α - 2 , 300 MHz) 3 O (CDCl HO

192

α - 2 , 125 MHz) 3 O (CDCl HO

193

O Br O S N HO 41

HO

N Cl H (DMSO, 500 MHz)

194

O Br O S N HO 41 HO N Cl H (DMSO, 125 MHz)

195

Br O O N S HO 42

HO

N Cl

H (DMSO, 500 MHz)

196

Br O O N S HO 42 HO N Cl H (DMSO, 125 MHz)

197

F

Br

F

O O N S F HO 44 HO N Cl H (DMSO, 500 MHz)

198

F Br F O O N S F HO 44 HO N Cl H (DMSO, 125 MHz)

199

F Br F O O N S F HO 44 HO N Cl H (DMSO, 282 MHz)

200

tBu tBu OMe H H OMe 3 3 SO SO tBu tBu tBu tBu Br P P 45 , 500 MHz) 3 Br MeO MeO tBu tBu (CDCl O O O O

201

tBu tBu OMe H H OMe 3 3 SO SO tBu tBu tBu tBu Br P P 45 , 125 MHz) 3 Br MeO MeO tBu tBu (CDCl O O O O

202

O Cl O S Br HO N O O S6 , 500 MHz) 3 N H (CDCl Cl

MeO

203

O

Cl

O

S

Br HO N O O S6 , 125 MHz) 3 N H (CDCl Cl MeO

204

, 400 MHz) 3 α - 2 -Ac O (CDCl O O

205

, 100 MHz) 3 α - 2 -Ac O (CDCl O O

206

, 400 MHz) 3 β - 2 -Ac O (CDCl O O

207

, 100 MHz) 3 β - 2 -Ac O (CDCl O O

208

, 400 MHz) 3 ɣ - 2 -Ac O (CDCl O O

209

, 100 MHz) 3 ɣ - 2 -Ac O (CDCl O O

210

, 400 MHz) 3 ! - 2 -Ac O (CDCl O O

211

, 100 MHz) 3 ! - 2 -Ac O (CDCl O O

212

α - 1 , 300 MHz) 3 O (CDCl HO

213

α - 1 , 100 MHz) 3 O (CDCl HO

214

CHAPTER 6

Novel Chiral Acid for Asymmetric Proton Transfer: Adanve Acids Applied to Chiral Vitamin E Synthesis 215

6.1 Introduction

Asymmetric synthesis is a key cornerstone in the broader sphere of synthetic chemistry. A well-established set of asymmetric induction tools are chiral Lewis acid catalysts whereby a Lewis acidic metal is combined (typically in situ) with a chiral Lewis basic ligand to form a chiral complex with net Lewis acidic character.1 The substitution of the metal for a proton, the smallest Lewis acid, is an attractive objective given that

Bronsted acids typically have lower cost, better environmental friendliness, and superior handling, storage, and stability properties. Several reports have shown the effectiveness of such chiral Bronsted acid catalysts to impact enantioselectivity.1-8

Decreasing pKa A OH O OH HO OH OH O S O O OH O O OH Tartaric acid Mandelic acid Camphorsulfonic acid

B R Ar Ar Ar S O H R R OH O O O N N SnCl4 P O O O OH H H OH H Ar Ar R Ar

Thiourea TADDOL Lewis acid-assisted 1 derivatives derivatives chiral Bronsted acids

C MeO tBu tBu tBu OMe

Br HO Br HO Br O tBu N P N O SO H O F F 3 O F Br SO H N S N O P 3 O H HO HCl S Cl HO O O tBu 3: Adanve- C-S1-OH 4: Adanve- HC-S2F-OH OMe tBu tButBu MeO 2: Adanve- P-R2

Figure 1. A) Examples of early chiral Bronsted acids (used in enzymatic resolution). B) Examples of chiral Bronsted acids for asymmetric catalysis. C) Examples of Adanve acids II (this work)

216

But there are only a few examples of such chiral Bronsted acids, headlined by the binaphtol-derived phosphoric acids (1). Moreover, most are weak acids.3,9 To expand the arsenal of this emerging chiral Bronsted acid catalysis field, we developed the Adanve acids II (examples 2 – 4) described in the last chapter. As discussed there, the type II

Adanve acids are readily synthesized, highly tunable chiral acids with levers of control at the linker chain length, the scaffold’s size and architecture, the acid moiety strength and character, as well as the counterion size and reactivity. Given the large library of known chiral bases, by reversing their polarity (Figure 2), a large diversity of chiral Bronsted acids could in principle be synthesized. The integration of a charged ammonium or phosphonium at the system’s center could impact interesting reaction enhancing properties. In addition to their ready, modular synthesis, these novel chiral acids are easy to handle given their solid state with positive implication for their recovery from reaction mixtures. Lastly, outside of their use as chiral proton shuttles, we envision the use of super acid variants such as 4 as chiral diflate counterions for Lewis acidic metals.

A z = H, F, Cl Y RO A RO X n = 1 - 3 1. X = Cl, Br, I, HSO4, etc. N z z n N z R = H, alkyl, aryl, n z Adanve acid II, N 2. Ion exchange N A polymer, etc. H Cl A = CO2H, PO3H2, SO2H, SO3H, etc.

B HO Br HO 1. Br SO3Na N N DMF, 120ºC O S O 2. HCl, EtOH N N H HO Qant. over 2 steps Cl Cinchonine 3: Adanve-C-S1-OH

Figure 2. A) Ready, modular synthesis of the Adanve acid as demonstrated on cinchona alkaloids. B) Example of cinchonine derived Adanve acid with a 1-carbon linker.

217

We undertook an early exploration of the ability of the type II Adanve acids to induce asymmetric cyclization to chiral chromans. Chromans are hydrobenzofuran motifs that constitute the core of many bioactive natural and synthetic molecules (Figure 3).10

The vitamin E family and their synthetic analogs represent the most recognizable chromans. In addition to their wide-spread use as lipid-soluble anti-oxidant and radical scavenger, they have been shown to have cardioprotective, hypocholesteromic and anti- cancer properties.11-13

Furthermore, studies have shown that the stereochemistry at C2 of the chroman ring is key in determining the biopotency of vitamin E. That is, natural vitamin E isomers with an R configuration at the C2 position of the chroman ring possess far greater activity as they are preferentially accumulated by mammalian organisms.14,15 As such, significant efforts have been made to achieve the asymmetric synthesis of vitamin E.13,16 Most of the asymmetric methods to Vitamin E involve the asymmetric production of the chroman core by various means (chiral resolution,17-21 enzymatic resolution,22-26 chiral auxiliary,27-

29 metal-mediated asymmetric catalysis,30-33 and organic catalyst-mediated asymmetric catalysis34) before appending the appropriate terpenoid tail (Figure 4A-B). One method, that of the Woggon group, stands out in its creative use of a chiral auxiliary directly attached to the chroman core to affect asymmetric proton transfer in pseudo bio-mimicry of the natural vitamin E cyclase (Figure 4C).35,36

While all of these asymmetric approaches to vitamin E synthesis are ingenious, they have not yet proven amenable to large-scale production, which largely explains why current industrial production of vitamin E remains racemic. Therefore, the development of a practical asymmetric approach to vitamin E synthesis remains a challenge. 218

A B R1 R3O HO 2 OH R2 O Y O O R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ) 7: Trolox

HO Y = H C 2 5: Tocopherols

O N OTs

Y = H2C 8: MDL-73404 6: Tocotrienols

C O H δ− Enzyme Enzyme H O O δ+ H O

D O OH

OH HN OH

OH O O

n-Pent O H HO H 1 Puupehediol Δ -THC Stachyflin Anti-cancer Psychoactive Anti-influenza A

F F H H HO2C O N O H H OH OH O Nebivolol Rhododaurichromanic acid Antihypertensive Anti-HIV

Figure 3. Chiral chromans in important molecules. A) Natural vitamin E. B) Vitamin E analogs. C) Tocopherol cyclase’s asymmetric proton transfer mechanism. D) Selected molecules with the chroman motif.

219

A R1 R1 Asymmetric strategy R3O Tail attachment HO to chroman core 2 Z R2 O R2 O 5 or 6 R1, R2 = Me, Me (α); Μe, H (β); H, Me (γ); H, H (δ) Optical resolution B HO CO2H HO HO HO HO HO O CO2H O O O O O CO H O O 2 O CO2H 1st asymmetric approach 1976, 1982 1979 1991 1992 O reported, 1963 O Enzymatic resolution

HO HO HO OAc OBn O CO2H OH CO2H O OH O O O 1991 1994 1997 2002, 2006

O Chiral auxiliary pTol MeO MeO S MeO OMe O O OMe O OMe HO CO2R* OMe N 1984 1989 O 1990

Asymmetric catalysis R1 MeO BnO HO RO O N O R O N OMe OH O O 2 Ph O 1985 1990 - 2004 2005, 2006 2014

C Biomimetic proton transfer (2006, 2009)

H TsO H N H CO2H N H CO2H O N O N 12 steps O CO2 O TsOH CO2H 3 steps O pTSA O O O 48 h α-6 H H OH 41% O O O 3 65% e.e. 3

D This work RO Br R 1 R1 N R3O Adanve Acid R O Type II 3 z O n z S O R OH Y N 2 R2 O Y H HO z = H, F Cl n = 1 - 3 Adanve Acid Type II , Y = CO2H , H2C H2C 7: Trolox 5: Tocopherols 6: Tocotrienols

Figure 4. A) Typical multi-stage approach to asymmetric vitamin E. B) Selected asymmetric strategies to the chroman core. C) Reported biomimetic method to vitamin E. D) Our direct biomimetic approach to vitamin E using our novel chiral acid system.

220

With the type II Adanve acids, we aimed to achieve a direct asymmetric synthesis of vitamin E in a mimic of the natural vitamin E cyclases where a combination of asymmetric proton transfer and binding of the reactive intermediate by the chiral environment of the catalyst would be in effect (Figure 4D). Chiral phosphoric acids are not strong enough to perform this envisioned cyclization. Figure 5 shows a representative set of the Adanve acids investigated.

A B C D 10 11 3 3 MeO HO Br 6' HO Br 6' HO Br Br N O N N N O O 9 O S O S O S O Cl 1' S O OH OH N Cl N N H HO HO HO Cl H H N Cl 17: Adanve-devC-S2-OH 3: Adanve-C-S1-OH H 11: Adanve-CD-R1-OH 14: Adanve-HC-S1-OH 3 Cl O HO X Br HO Br MeO 3 6' N N N O Br O 9 N N O OH S O N S Cl O H HO HO H S Cl O Cl O N HO N S Cl O HO 9: Adanve-C-S2-OH Br, X = Br H 12: Adanve-CD-R2-OH 15: Adanve-Q-S1-OH H O 20: Adanve-C-S2-OH I, X = I 18: Adanve-HQ-S2-OClBz MeO HO Br Br HO Br 3 N N N MeO 6' O O Br O N S N N O OH 9 H OH H S O Cl O N Cl S Cl HO O H Cl N S O HO H HO 10: Adanve-C-S3-OH 13: Adanve-CD-R3-OH 16: Adanve-Q-S2-OH O 19: Adanve-HQ-S2-OPHN E MeO tBu tBu tBu Br OMe HO X MeO N Br N O Br O tBu F O Cl F S P F H N O N HO SO3H O O H S N NN Br SO H Cl HO Cl SO O P 3 O H O O OH 4: Adanve-HC-S2F-OH Br, X = Br O tBu 21: Adanve-HC-S2F-OH I, X = I N H OMe MeO Cl tBu tButBu 22: Adanve-(HQN)2-R2-OPHAL MeO 2: Adanve-P-R2

Figure 5. Representative examples of Adanve acids investigated. A) Linker length effects. B) Pseudoenantiomer effects. C) C3 and C6’ substitutient effects (includes 17). D) C9-OH protecting group effects. E) Additional factors: acid strength, dimerization, bulky groups, and different scaffold.

221

6.2 Cyclization Conditions: Effects of Solvent, Substrate Concentration, Catalyst Loading, and Temperature on Product Yield and Enantioselectivity

Using phytyl-TMHQ (23H) as the substrate, we first screened for conditions for the successful transformation of this starting material into α-tocopherol (24H) by the

Adanve acids. Some of these factors are discussed below. At this stage, we chose 14C-

NMR as a convenient method to determine the product’s enantioselective excess

(e.e.).37,38 While some e.e. was seemingly evident by this method (see Figure 7), the low signal to noise ratio of the acquired spectra, a result of the small reaction scales, do not permit us to draw a concrete conclusion.

RO RO Adanve acid II 2 OH O 1' 23 (R)-24

O RO O

O R = H , , , , S O O O O O O O (S)-24 25 H Ac Bz (S)-CPN Ms

Figure 6. Enantioselective cyclization efforts

Solvents

We found that the Adanve acids performed best in halogenated solvents such as

CH2Cl2, 1,2-DCE, and 1,1,2,2-tetrachloroethane (TeCE). While CH2Cl2 and TeCE led to the better yields of 24H, 1,2-DCE led apparently to the better qualitative (14C-NMR) enantioselectivities.

222

Substrate concentration

We found that a substrate concentration of at least 0.1M was helpful in achieving considerable conversion to product in the face of the competing oxidation of 23-H to 25.

Going forward, we opted for a substrate concentration of 0.15M.

Temperature

Most of the sulfonic acid-based Adanve acids were active between 0 and 100 ºC, the reaction becoming catalytic (less than stochiometric amount of acid required) at higher temperatures but with no enantioselectivity by 14C-NMR.

Adanve acids equivalents

This factor proved to be dependant on the type of Adanve acid II used and on the reaction temperature. For the typical monomers (3 for example) at room temperature and below, more than stochiometric amounts (typically 3 equivalents) are required for considerable substrate conversion to the product (24H). The substituents on the catalyst scaffold factor into this matter as they may make the catalyst more soluble, thus requiring less of it. For example, catalysts with C6’-OMe were typically more soluble, thus more active. The counterion also plays a role. For example, 20 with an iodide counterion, was much more active than 9, which has a bromide counterion. The acid strength is another factor. For example, 4 and 21 were very active, nearly catalytic even at cold temperatures. 3 was a little more active than 9, which was in turn a lot more active than

10.

The dimeric Adanve acids (2 and 22) were more active beyond their obvious carrying of two sufonic acids moieties. With these dimers, often 1 equivalent was enough 223

to achieve complete cyclization when two equivalents of the monomer types did not yield the same results. This outcome points to a possible synergistic effect of the two sulfonic groups in proximity or to the enhancing effects of clusters of charged groups.

Lastly, with the cinchona-based acids, we observed that those with S configuration (cinchonine) were generally more active than those with R configuration

(cinchonidine). This observation is in line with literature reports that cinchonine and quinidine are more active than cinchonidine and quinine in spurring various processes.39,40

Cat. (mol [23-H] Solvent Δ (ºC) Time Outcome eq.) (M) DCE 3 (3) 0.15 25 3 d *(S)-24H, 60% y

CH2Cl2 3 (3) 0.15 25 2 d (rac)-24H, 85% y TeCE 3 (3) 0.15 25 2 d (rac)-24H, 80% y DCE 3 (3) 0.15 0 4 d mostly 25, little 24H DCE 3 (2) 0.15 50 8 h (rac)-24H, 70% y DCE 3 (0.5) 0.15 100 8 h (rac)-24H, 90% y DCE 9 (4) 0.15 25 2.5 d *(R)-24H, 50% y DCE 10 (6) 0.15 50 10 h mostly 25, little 24H DCE 11 (4) 0.15 25 5 d *(R)-24H, 57% y DCE 12 (4) 0.15 25 5 d *(S)-24H, 50% y DCE 13 (6) 0.15 25 5 d *(S)-24H, 28% y DCE 14 (3) 0.15 25 3 d *(S)-24H, 62% y DCE 15 (3) 0.15 25 2 d (rac)-24H, 50% y DCE 16 (3) 0.15 25 2 d *(S)-24H, 65% y DCE 17 (3) 0.15 25 2 d *(R)-24H, 63% y DCE 18 (3) 0.15 25 2 d *(S)-24H, 50% y DCE 19 (4) 0.15 50 2 d (rac)-24H, 20% y DCE 4 (0.9) 0.15 0 8 h (rac)-24H, 70% y DCE 20 (1) 0.15 25 10 h (rac)-24H, 90% y DCE 22 (1.2) 0.15 25 2 d (rac)-24H, 66% y

Table 1. Summary of exploration with 23H. **diastereomer determination only denotes a qualitative excess as determined by diastereomeric C1’ peak heights in 14C-NMR spectra 224

HO

A O 1' (R)-24H Commercial

1’

B HO

O 1' Ambo-24H

1’

C

1’

D

1’

E

1’

Figure 7. Qualitative determination of 24H diastereomers by 13C-NMR. A) Commercial (R)- 24H. B) Ambo-24H. C) 24H from the reaction of 23H with 9. D) 24H from the reaction of 23Ac with 9 and subsequent LiAlH4 reduction. E) 24H from reaction of 23H with 18. 225

As summarized in Table 1, it appears that with the cinchona-based Adanve acids, the linker chain length, the C6’ substitution on the quinoline, and the counterion for the ammonium were the primary factors affecting asymmetric determination in the chroman formation. As such, we decided to focus on Adanve-C-S2-OH (9) to further explore other means to increase the diastereoselectivity, namely through modifications to the substrate

23. We expected that once a modification of 23 was identified to achieve high diastereomic excess with 9, that the opposite diastereomer could be achieved with 3 or

16.

6.3 Substrate Modifications: 1-OH Protecting Group Effects

On the hypothesis that the nature of the substituent on the 1-OH of 23 could play a role in setting the stereochemistry at C2, we synthesized 23Ac, 23Bz, 23CPN, and

23Ms.

With the acetyl, benzoyl and mesyl groups of 23Ac, 23Bz and 23Ms respectively, we anticipated that their electron withdrawing effect would lower the nucleophilicity of the 4-OH, which may give enough time for the charged reactive intermediate to match the chiral environment provided by the catalyst before 4-OH attack of the tertiary carbocation at C2. With 23CPN, we hoped that the bulky (S)-camphanoyl group (CPN) occupying one face of the proto-chroman would force the acid catalyst to only approach from the other side, thereby donating the proton from only that side. Furthermore, we anticipated that specific asymmetric interactions between the two chiral groups

(camphanoyl and cinchona)41 could enhance the diastereselectivity of the chroman formation. 226

Interestingly, the (S)-camphanoyl group led to zero diastereoselectivity (as comfirmed by both chiral HPLC and qualitative 14C-NMR). The benzoyl group also led to practically no diastereoselectivity despite its electron-withdrawing effect. Meanwhile, the mesyl group (not only electron-withdrawing but also “stickier”) seemed to lead to slightly higher diastereoselectivity (4.5%, however this result cannot yet be fully confirmed as the chiral separation by HPLC suffered from overlapping peaks with the conditions tried so far).

Taken together, these results pointed to a possible interaction between the

“sticky” group on the 1-OH and the hydrogen-bond-network42 of the Adanve acid, i.e., the stickier the group, the higher the stereoselectivity, which would explain why the bulkier groups led to no diastereoselectivity given their higher sterics. As such, we decided to explore such “sticky” groups further. More importantly, we hypothesized that such a group on the side chain itself (figure 7B, 26) instead of on the 1-OH, would have a positive effect on the enantioselectivity.

Catalyst Time Substrate Δ (ºC) Outcomea, b (mol eq.) (d) (S)-24Ac, 50% y, 23Ac 9 (4) 25 5 2% e.e. (S)-24Bz, 55% y, 23Bz 9 (4) 25 5 2% e.e. (rac)-24CPN, 48% 23CPN 9 (4) 25 5 y, 0% e.e. 24Ms, 40% y, e.e. 23Ms 9 (4) 25 7 (TBC, overlap) 24Ms, 80% y, e.e. 23Ms 20 (2) 25 2 (TBC, overlap)

Table 2. Substrate modification effects: 1-OH protecting group. All experiments performed in DCE with a substrate concentration of 0.15M. a) Isolated yields; b) Diastereomer determination was performed by chiral HPLC; TBC = to be confirmed 227

6.4 Substrate Modifications: “Sticky” Side Chain Effects

To investigate our hypothesis that a “sticky” group on the pro-chroman tail would allow for the fixation on the side chain through interactions with the hydrogen-bond- network of the Adanve acid, this “fixation” in turn enhancing asymmetric proton delivery to the vinyl (see Figure 8), we decided to start with carboxylic acid 26. The cyclization of

26 would lead to the commercially relevant, water-soluble vitamin E analog Trolox®

(27).

HO N Cl Br O N S O H H O O H RO O O H

Figure 8. “Sticky” side chain interaction with hydrogen-bond-network of the Adanve acid

Unfortunately, when subjected to the Adanve acids, oxidation of 26 to quinone 28 and other side decomposition reactions take precedence over proton-induced cyclization.

Adding zinc dust or sodium dithionite to the reaction only lead to starting material decomposition.

To mitigate these side reactions, we decided to protect the radical generation prone 1-OH with a methyl group. When carboxylic acid 29 is subjected to the acids in

CH2Cl2, Trolox methyl ether (30) is obtained in about 40% conversion after 10 days. The slow conversion is likely due to the lower nucleophilicity of the vinyl as a result of the 228

deactivating effect of the neighboring carboxylic acid group. As to the enantioselectivity

of the cyclization, the key goal here, efforts are ongoing to develop a chiral separation

method for compound 30.

Adanve HO acid II HO HO O

OH CO2H O CO2H O CO2H O CO2H

26 (S)-27 (R)-27 28

MeO Adanve MeO MeO acid II

OH CO2H O CO2H O CO2H 29 (S)-30 (R)-30

Figure 9. Early “sticky” side chain investigations

Catalyst Time Substrate Δ (ºC) Outcome (mol eq.) (d)

26 9 (4) RT 2 28, decomposition

26 2 (1) RT 2 28, decomposition

30 (40% y, e.e. 29 9 (4) RT 10 TBD) 30 (43% y, e.e. 29 3 (4) RT 10 TBD)

Table 3. Substrate modification effects: “sticky” side chain. **All experiments were performed in CH2Cl2 with a substrate concentration of 0.15M. TBD = to be determined

A note about the synthesis of 26 and 29

En route to 26, the hydrolysis of ester 32 could only be achieved with pig liver esterase. All other chemical hydrolysis methods, even the reported mild ones,43, 44 led to 229

decomposition of the starting material. This outcome is likely due to the very labile benzylic protons given the neighboring α,β-unsaturated system. Furthermore, the successfully obtained 26 was very sensitive and quickly oxidized to quinone 28.

For the synthesis of 29, the initial methylation of the starting material 31 was only successful with the trimethyloxonium tetrafluoroborate and proton-sponge® conditions.45

All other methylation conditions (MeI or MeOTf with K2CO3 or Ag2O) led to starting material decomposition. Furthermore, hydrolysis of ester 34 only responded to PLE when an organic solvent additive such as methyl tert-butyl ether was added to the reaction.

Chemical hydrolysis methods led to the compound’s decomposition.

It would also be interesting to cyclize ester 34 (Figure 9B) by the Adanve acids although we do not anticipate great enantioselectivity given the bulky ethyl and lack of a proton to participate in the catalyst’s hydrogen-bond-network.

A Na2S2O4 HO HO HO O 1. Dibal-H PLE O + O O Phosphate 2. OH OH CO2H O CO2H O buffer 31 Ph3P 32 O 26 28 OEt Me3OBF4 Proton-sponge®

MeO MeO MeO 1. Dibal-H PLE O O O 2. OH MTBE:Phosphate OH CO H O buffer (1:1) 2 Ph P 33 3 34 O 29 OEt B MeO Adanve MeO MeO acid II O O O OH O O O O O 34 (S)-35 (R)-36

Figure 10. Synthesis of 26 and 29 230

6.5 Additional Chiral Acids Synthesized and Explored

Similar to the type I catalyst system (Chapter 5), we synthesized contructs combining a strong organic Bronsted acid (PTSA) with chiral phase transfer catalysts

(37–39). In an early investigation of these constructs’ ability to induce asymmetric proton transfer, we found that they could cyclize 23H to 24H with slight enantioselectivity (13C

NMR). Similarly, we synthesized and investigated 40 with a combination of PTSA with very slight asymmetric success.

Furthermore, we synthesized CSA derivatives 41 and 42. Given their structural similarity to the cinchona-based Adanve acids, we thought they would be good model systems to investigate the enhancing effect of the ammonium group in the chiral acid. 41 and 42 failed to convert 23H to 24H. The implications of these results were discussed in

Chapter 5.

F F O O S O O F S O O N Br N H H H Br N Br OH CF3 O O O N F O S N H OTs H OTs 37 38 F 39 F

HO Br HO HO N H O O O O N S S O O HO O F3C HO O H 40 41 42

Figure 11. Additional acids explored 231

6.6 Conclusion

In the hope to help expand the arsenal of the exciting chiral Bronsted acid catalysis field, we developed a new class of chiral Bronsted acids (Adanve acids), materials that are highly tunable, easy to synthesize, and easy to handle as well as recover. In a preliminary exploration of the ability of these chiral acids to induce asymmetric proton transfer, we investigated their usage to impart asymmetric formation of chromans, namely the important vitamin E family.

Our early findings suggest that a host of factors play a role in the ability of this novel acid catalyst system to induce asymmetric chroman formation. A more rigorous screening of solvent, concentration, temperature, and pressure conditions could reveal favorable conditions to achieve asymmetric formation of vitamin E by these acids.

Furthermore, a type II Adanve acid with a more constraining chiral scaffold to limit the conformational freedoms of the docked subrates could be advantageous. 232

6.7 References

(1) Phipps, R. J.; Hamilton, G. L.; Toste, F. D. Nat. Chem. 2012, 4, 603. (2) Coric, I.; List, B. Nature 2012, 483, 315. (3) Akiyama, T. Chemical Reviews 2007, 107, 5744. (4) Taylor, M. S.; Jacobsen, E. N. Angew. Chem. Int. Ed. 2006, 45, 1520. (5) Uraguchi, D.; Terada, M. J. Am. Chem. Soc. 2004, 126, 5356. (6) Courant, T.; Kumarn, S.; He, L.; Retailleau, P.; Masson, G. Advanced Synthesis & Catalysis 2013, 355, 836. (7) Terada, M.; Soga, K.; Momiyama, N. Angew. Chem. Int. Ed. 2008, 47, 4122. (8) Hatano, M.; Moriyama, K.; Maki, T.; Ishihara, K. Angew. Chem. 2010, 122, 3911. (9) Christ, P.; Lindsay, A. G.; Vormittag, S. S.; Neudörfl, J.-M.; Berkessel, A.; O'Donoghue, A. C. Chemistry – A European Journal 2011, 17, 8524. (10) Shen, H. C. Tetrahedron 2009, 65, 3931. (11) Pearce, B. C.; Parker, R. A.; Deason, M. E.; Qureshi, A. A.; Wright, J. J. J. Med. Chem. 1992, 35, 3595 (12) Compadre, C. M.; Singh, A.; Thakkar, S.; Zheng, G.; Breen, P. J.; Ghosh, S.; Kiaei, M.; Boerma, M.; Varughese, K. I.; Hauer-Jensen, M. Drug Dev. Res. 2014, 75, 10. (13) Netscher, T. Chimia 1996, 50, 563 (14) Weiser, H.; Vecchi, M. Internat. J. Vit. Nutr. Res 1982, 52, 351 (15) Weiser, H.; Riss, G.; Kormann, A. W. J. Nut. 1996, 126, 2539. (16) Netscher, T. Vitamins & Hormones; Gerald, L., Ed.; Academic Press: 2007; Vol. Volume 76, p 155. (17) Mayer, H.; Schudel, P.; Ruegg, R.; Isler, O. Helv. Chim. Acta. 1963, 46, 650. (18) Scott, J. W.; Bizzarro, F. T.; Parrish, D. R.; Saucy, G. Helv. Chim. Acta. 1976, 59, 290. (19) Cohen, N.; Lopresti, R. J.; Saucy, G. J. Am. Chem. Soc. 1979, 101, 6710. (20) Walther, W.; Vetter, W.; Vecchi, M.; Schneider, H.; Muller, R. K.; Netscher, T. Chimia 1991, 45. (21) Netscher, T.; Gautschi, I. Liebigs Ann. chem. 1992, 543. (22) Sugai, T.; Watanabe, N.; Ohta, H. Tetrahedron: Asymmetry 1991, 2, 371. (23) Mizuguchi, E.; Suzuki, T.; Achiwa, K. Synlett 1994. (24) Hyatt, J. A.; Skelton, C. Tetrahedron: Asymmetry 1997, 8. (25) Chenevert, R.; Courchesne, G. Tetrahedron Lett. 2002, 43, 7971. (26) Chenevert, R.; Courchesne, G.; Pelchat, N. Bioorg. Med. Chem. 2006, 14. (27) Soladie, G.; Moine, G. J. Am. Chem. Soc. 1984, 106, 6097. (28) Yoda, H.; Takabe, K. Chem. Lett. 1989. (29) Hubscher, J.; Barner, R. Helv. Chim. Acta. 1990, 73, 1068. (30) Takabe, K.; Okisaka, K.; Uchiyama, Y.; Katagiri, T.; Yoda, H. Chem. Lett. 1985. (31) Knierzinger, A.; Scalone, M. 1990. (32) Trost, B. M.; Shen, H. C.; Dong, L.; Surivet, J.-P.; Sylvain, C. J. Am. Chem. Soc. 2004, 126, 11966. (33) Tietze, L. F.; Stecker, F.; Zinngrebe, J.; Sommer, K. M. Chem. Eur. 2006, 12, 8770. (34) Uyanik, M.; Hayashi, H.; Ishihara, K. Science 2014, 345, 291. 233

(35) Grütter, C.; Alonso, E.; Chougnet, A.; Woggon, W.-D. Angew. Chem. Int. Ed. 2006, 45, 1126. (36) Chapelat, J.; Chougnet, A.; Woggon, W.-D. Europ. J. Org. Chem. 2009, 2009, 2069. (37) Brownstein, S.; Burton, G. W.; Hughes, L.; Ingold, K. U. J. Org. Chem. 1989, 54, 560. (38) Bremser, W.; Vogel, F. G. M. Organic Magnetic Resonance 1980, 14, 155. (39) Tsurubou, S. Analytica Chimica Acta 1988, 215, 119. (40) Druilhe, P.; Brandicourt, O.; Chongsuphajaisiddhi, T.; Berthe, J. Antimicrobial Agents and Chemotherapy 1988, 32, 250. (41) Tsurubou, S. Analytical Sciences 1991, 7, 45. (42) Hintermann, L.; Ackerstaff, J.; Boeck, F. Chemistry – A European Journal 2013, 19, 2311. (43) Nicolaou, K. C.; Estrada, A. A.; Zak, M.; Lee, S. H.; Safina, B. S. Angew. Chem. Int. Ed. 2005, 44, 1378. (44) Motorina, I. A.; Huel, C.; Quiniou, E.; Mispelter, J.; Adjadj, E.; Grierson, D. S. J. Am. Chem. Soc. 2001, 123, 8. (45) Evans, D. A.; Ratz, A. M.; Huff, B. E.; Sheppard, G. S. Tetrahedron Lett. 1994, 35, 7171. (46) Bienaymé, H.; Ancel, J.-E.; Meilland, P.; Simonato, J.-P. Tetrahedron Lett. 2000, 41, 3339. (47) Smith, L. I.; MacMullen, C. W. J. Am. Chem. Soc. 1936, 58, 629. (48) Gilbert, J. C.; Pinto, M. J. Org. Chem. 1992, 57, 5271.

234

6.8 Experimental Section

General procedures: All reactions were carried out under argon atmosphere with dry solvents under anhydrous conditions, unless otherwise stated. Reagents were purchased from commercial vendors at the highest available purity and used without further purification. Dry dichloromethane (DCM), diethyl ether (Et2O), and tetrahydrofuran (THF) were purchased from Sigma-Aldrich. All reactions were stirred magnetically and monitored by TLC performed on 0.25 mm E. Merck silica gel plates (60F-254) using UV light as the visualizing agent or cerium ammonium molybdate (CAM) and heat as the developing agent. Silica gel (SiliCycle 60, academic grade) was used to carry out flash column chromatography. Unless otherwise recorded, yields refer to purified materials with spectroscopically (1H and 13C NMR) homogeneity. NMR spectra were recorded on Bruker DRX-300, DRX-400, and DRX-500 instruments calibrated using residual undeuterated solvents as internal reference. Multiciplicities were represented by the following abbreviations: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, AB = AB quartet, br = broad. IR spectra were recorded on a Perkin Elmer Spectrum Two® FT-IR spectrometer, and High-resolution mass spectra (HRMS) were recorded in the Columbia University Mass Spectral Core facility on a Waters XEVO G2XS QToF mass spectrometer using electrospray ionization (ESI), atmospheric solids analysis probe (ASAP) and atmospheric pressure chemical ionization (APCI) techniques.

Abbreviations: DCM = dichloromethane, PLE = pig liver esterase, DIPEA = diisopropyl ethyl amine, MgSO4 = Magnesium sulfate, Et2O = diethyl ether, TMHQ = trimethylhydroquinone, (NH4)2SO4 = Ammonium sulfate, NH4Cl = ammonium chloride, EtOH = ethanol, MeOH = methanol, DI = distilled, HCl = hydrogen chloride, RT = room temperature, DCE = 1,2-dichloroethane, TeCE = 1,1,2,2-tetrachloroethane, EtOAc = ethyl acetate, Et3N = triethyl amine, TLC = thin layer chromatography, CAM = cerium ammonium molybdate

Hydroquinone precursors preparation 2,3,6-Trimethylhydroquinone-1-acetate (S1): see section 5.9 of Chapter 5.

2,3,6-Trimethylhydroquinone-1-benzoyl (S2): was synthesized according to the method of for S1 described in Section 5.9, Chapter 5. Light yellow solid; Rf = 0.50 (silica gel, 30% EtOAc:hexanes); IR (film) 3456, 2927, 1708, 1585, 1451, 1417, 1314, 1271, 1190, 1084, 1071, 708, 595; 1H NMR (300 MHz, CDCl3) δ 8.26 (d, J = 7.2 Hz, 1H), 7.70 – 7.60 (m, 1H), 7.53 (t, J = 7.7 Hz, 1H), 6.48 (s, 1H), 2.14 (s, 3H), 2.09 (s, 3H), 2.08 (s, 3H); 13C NMR (125 MHz, CDCl3) δ 165.7, 151.7, 141.9, 133.9, 133.2, 130.5, 130.5, 130.2, 129.9, 129.7, 129.0, 128.8, 128.7, 128.0, 121.8, 115.0, 16.6, 13.5, 12.2; HRMS + (ESI) calcd for C16H16O3Na [M + Na] 279.0997, found 279.1004.

Phytyl-hydroquinone precursors preparation 235

6-Phylty-2,3,5-trimethylhydroquinone (23H): Made from trimethylhydroquinone and natural R,R-phytol according to the method described for the synthesis of geranylgeranyl- trimethylhydroquinone in Section 5.9, Chapter 5. In this case, the centrifugation procedure yielded the clean product as an oily white solid that darkens slightly in storage. Rf = 0.25 (silica gel, 15% EtOAc:hexanes); IR (film) 3363 (br), 2953, 2924, 2866, 1460, 1379, 1325, 1246, 1078, 1046, 557; 1H NMR (500 MHz, CDCl3) δ 5.14 (t, J = 6.6 Hz, 1H), 4.77 (s, 1H), 4.33 (s, 1H), 3.40 (d, J = 6.7 Hz, 2H), 2.22 (s, 3H), 2.19 (s, 7H), 1.84 (s, 2H), 1.55 (td, J = 13.3 Hz, 6.7 Hz, 1H), 1.43 – 1.03 (m, 18H), 0.92 – 0.88 (2 s, 7H), 0.88 – 0.84 (m, 5H); 13C NMR (125 MHz, CDCl3) δ 146.7, 146.0, 139.0, 138.6, 123.9, 122.6, 121.9, 121.6, 121.2, 119.8, 114.7, 40.3, 39.7, 37.8, 37.7, 37.6, 37.4, 37.0, 33.1, 33.1, 33.0, 32.6, 28.3, 26.6, 26.4, 25.7, 25.1, 24.8, 23.8, 23.1, 23.0, 20.1, 16.5, 16.2, 12.6, + + 12.5, 12.3; HRMS (ASAP) calcd for C30H44O2 [M + H] 431.3889, found 431.3880.

5-Phytyl-2,3,6-trimethylhydroquinone-1-acetate (23Ac): Synthesized from S1 and natural phytol according to the method described Section 5.9, Chapter 5 but without the centrifugation step. Instead, after purification on silica gel (5% EtOAc:hexanes), 23Ac was obtained as a viscous oil. Rf = 0.28 (silica gel, 15% EtOAc:hexanes); IR (film) 3496 (br), 2925, 2866, 1743, 1459, 1369, 1206, 1073, 940, 735, 501; 1H NMR (300 MHz, CDCl3) δ 5.14 (t, J = 6.5 Hz, 1H), 5.07 (s, 1H), 3.37 (d, J = 6.7 Hz, 2H), 2.33 (s, 3H), 2.15 (s, 3H), 2.07 (s, 3H), 2.04 (s, 3H), 2.02 1.96 (m, 2H), 1.81 (s, 2H), 1.74 – 1.71 (m, 1H), 1.57 – 1.00 (m, 22H), 0.90 – 0.83 (m, 13H); 13C NMR (125 MHz, CDCl3) δ 170.0, 150.8, 141.9, 139.2, 127.5, 125.9, 123.7, 121.9, 121.4, 40.3, 39.7, 37.8, 37.7, 37.6, 37.0, 33.1, 33.0, 28.3, 26.7, 25.6, 25.1, 24.8, 23.1, 23.0, 20.9, 20.1, 20.0, 16.6, 13.4, 13.2, 12.4; + + HRMS (ESI) calcd for C31H52O3Na [M + Na] 495.3814, found 495.3818.

5-Phytyl-2,3,6-trimethylhydroquinone-1-benzoyl (23Bz)15: Synthesized from S2 and natural phytol according to the method described Section 5.9, Chapter 5 minus the centrifugation step. After purification on silica gel (5% EtOAc:hexanes), 23Bz was obtained as a yellow oily solid. Rf = 0.32 (silica gel, 15% EtOAc:hexanes); IR (film) 3467, 2924, 2867, 1710, 1599, 1454, 1378, 1274, 1236, 1109, 1095, 713; 1H NMR (300 MHz, CDCl3) δ 8.27 (d, J = 7.1 Hz, 2H), 7.68 – 7.61 (m, 1H), 7.54 (t, J = 7.5 Hz, 2H), 5.21 – 5.10 (m, 2H), 3.41 (d, J = 6.7 Hz, 2H), 2.19 (s, 3H), 2.13 (s, 3H), 2.10 (s, 3H), 2.02 (t, J = 7.5 Hz, 2H), 1.83 (s, 2H), 1.76 – 1.40 (m, 1H), 1.59 – 1.02 (m, 22H), 0.91 – 0.85 (m, 13H); 13C NMR (125 MHz, CDCl3) δ 165.4, 150.8, 142.0, 139.1, 133.8, 130.5, 129.9, 128.9, 127.7, 126.2, 123.9, 121.9, 121.5, 40.3, 39.7, 37.8, 37.7, 37.6, 37.0, 33.1, 33.0, 28.3, 26.7, 25.6, 25.1, 24.8, 23.0, 23.0, 20.1, 20.0, 16.6, 13.5, 13.3, 12.4; HRMS + + (ESI) calcd for C36H54O3Na [M + Na] 557.3971, found 557.3979.

5-Phytyl-2,3,6-trimethylhydroquinone-1-methanesulfonate (23Ms): To a stirring o solution of Ms2O (161.8 mg, 0.92 mmol, 1 equiv) in DCM (4 mL) at 0 C was added 23H (400 mg, 0.92 mmol, 1 equiv). Upon dissolution of 23H, DIPEA (0.22 mL, 1.2 mmol, 1.3 equiv) was added dropwise followed by a small grain of DMAP. When 23H was fully converted (TLC), the reaction mixture was poured into NH4Cl (aq, 20 mL) and extracted with DCM (3 X 14 mL). The pooled organic fractions were washed with brine (20 mL), dried (MgSO4) and concentrated to yield, following silica gel purification (5% EtOAc:hexanes), 23Ms as a white solid (206 mg, 44%). Rf = 0.22 (silica gel, 15% 236

EtOAc:hexanes); IR (film) 2954, 2921, 2869, 1718, 1607, 1460, 1376, 1252, 1175, 1047, 967, 862, 795, 515; 1H NMR (500 MHz, CDCl3) δ 5.20 (br s, 1H), 5.12 (t, J = 6.6 Hz, 1H), 3.37 (d, J = 6.6 Hz, 2H), 3.24 (s, 3H), 2.30 (s, 3H), 2.26 (s, 3H), 2.15 (s, 3H), 2.00 (br s, 1H), 1.81 (s, 2H), 1.73 (s, 1H), 1.52 (td, J = 13.2, 6.6 Hz, 1H), 1.46 – 0.99 (m, 23H), 0.90 – 0.81 (m, 15H); 13C NMR (500 MHz, CDCl3) δ 96.0, 93.3, 93.1, 90.5, 90.1, 89.1, 88.7, 88.7, 88.5, 88.3, 68.0, 67.9, 67.7, 67.4, 67.4, 67.4, 67.2, 66.2, 66.2, 65.0, 64.6, 64.3, 64.2, 64.1, 63.7, 63.7, 63.0, 62.9, 62.1, 61.7, 61.6, 61.1; HRMS (ESI) calcd for + + C30H52O4SNa [M + Na] 531.3484, found 531.3478.

5-Phytyl-2,3,6-trimethylhydroquinone-1-(S)-camphanoyl (23CPN): Synthesized from 23H and (S)-Camphanic chloride in 36% yield according to the method described for 23Ms. White solid; Rf = 0.22 (silica gel, 15% EtOAc:hexanes); IR (film) 3474 (br), 2953, 2925, 2869, 1795, 1755, 1461, 1378, 1311, 1165, 1095, 1057, 990, 958, 795, 730, 509; 1H NMR (500 MHz, CDCl3) δ 5.15 (s, 1H), 5.13 – 5.07 (m, 1H), 3.72 (s, 1H), 3.36 (d, J = 6.6 Hz, 2H), 2.62 – 2.53 (m, 1H), 2.29 – 2.17 (m, 2H), 2.14 (s, 4H), 2.12 (s, 1H), 2.08 (s, 3H), 2.05 (s, 4H), 2.02 – 1.96 (m, 3H), 1.80 (s, 3H), 1.72 (s, 1H), 1.70 (s, 1H), 1.52 (td, J = 13.2, 6.6 Hz, 1H) 1.44 – 1.21 (m, 15H), 1.20 – 1.14 (3 s, 14H), 1.10 – 1.00 (m, 5H), 0.90 – 0.80 (m, 16H); 13C NMR (125 MHz, CDCl3) δ 178.3, 166.5, 151.0, 141.4, 139.3, 127.0, 125.5, 123.9, 122.0, 121.9, 121.3, 91.4, 55.2, 54.5, 43.8, 40.3, 39.7, 37.7, 37.7, 37.61, 37.0, 33.1, 33.0, 33.0, 31.8, 29.3, 28.3, 26.62, 25.6, 25.1, 24.8, 23.0, 22.9, 20.1, 20.0, 17.3, 17.2, 16.5, 13.6, 13.4, 12.4, 10.0; HRMS (ESI) calcd for + + C39H62O3Na [M + Na] 633.4495, found 633.4498.

3-(Ethyl-trans-2’,3’-dimethylacrylate)-2,5,6-trimethylhydroquinone (32): To a vigorously stirring solution of 5-Hydroxy-4,6,7-trimethyl-2(3H)-benzofuranone47, 48 (31, 285mg, 1.48 mmol, 1 equiv) in DCM (15 mL) at -78oC was added dropwise a 1 M solution of DIBAL-H in heptane (3.7 mL, 3.7 mmol, 2.5 equiv). The resulting reaction mixture was subsequently stirred vigorously for 15 minutes, then 1 M HCl (10 mL) was poured into it at -78oC. The resulting mixture was warmed to room temperature and extracted with ether (3 X 30 mL). After washing the pooled organic fractions with brine and drying over MgSO4, the solvent was removed under reduced pressure to yield white flakes. This material was dissolved in DCM (15 mL) followed by the addition of (Carbethoxyethylidene)triphenylphosphorane (1.1 g, 2.96 mmol, 2 equiv). After stirring for 3 hours at RT, the solvent was removed and the resulting sticky solid extracted with 50% Ether:hexane to yield, after silica gel purification (5% EtOAc:hexanes), a mixture of 32 and its quinone as an oil (307 mg, 75%). 32 quickly converts into its quinone in chloroform-d; the following characterization data is for the quinone form. Rf = 0.70 (silica gel, 30% EtOAc:Hexanes); IR (film) 2987, 2854, 1680, 1636, 1426, 1374, 1309, 1276, 1265, 1210, 862, 741, 422; 1H NMR (300 MHz, CDCl3) δ 6.51 (td, J = 7.3, 1.5 Hz, 1H), 4.29 – 4.11 (m, 4H), 3.38 (d, J = 7.2 Hz, 2H), 2.05 – 2.01 (3 s, 10H), 1.98 (d, J = 1.2 Hz, 3H), 1.53 (s, 8H), 1.35 – 1.22 (m, 6H); 13C NMR 125 MHz, CDCl3) δ 141.3, 140.2, 137.0, 61.0, 34.3, 26.5, 22.9, 14.6, 13.2, 13.0, 12.9, 12.8; HRMS (ESI) calcd for + + C16H20O4Na [M + Na] 299.1259, found 299.1264.

237

3-(trans-2’,3’-dimethylacrylic acid)-2,5,6-trimethylquinone (28): To a suspension of 32 (250 mg, 0.9 mmol, 1 equiv) in 0.1 M phosphate buffer (20 mL, pH 7) was added PLE (100 mg) and CH3CN (2 mL). The suspension was stirred vigorously for 8 hours whereupon it was diluted with NH4Cl (aq., 40 mL) and extracted with ether (4 X 25 mL, centrifugation was helpful in breaking the emulsion). The pooled organic fractions were dried over MgSO4 and concentrated to yield 28 as an off white solid (223 mg, 99%). Rf = 0.51 (silica gel, 5% MeOH:DCM); IR (film) 2918 (br), 2849 (br), 2652 (br), 2562 (br), 1686, 1635, 1428, 1372, 1302, 1275, 1260, 1208, 863, 740, 715, 421; 1H NMR (400 MHz, CDCl3) δ 6.65 (td, J = 7.3, 1.4 Hz, 1H), 3.41 (d, J = 7.3 Hz, 2H), 2.04 (s, 3H), 2.02 (s, 6H), 2.00 (s, 3H), 1.25 (s, 3H); 13C NMR (100 MHz, CDCl3) δ 187.7, 186.8, 171.4, 149.1, 142.0, 141.1, 140.9, 140.9, 139.8, 128.6, 30.0, 26.7, 12.8, 12.8, 12.7, 12.7; HRMS + + (ESI) calcd for C14H16O4Na [M + Na] 271.0946, found 271.0949.

3-(trans-2’,3’-dimethylacrylic acid)-2,5,6-trimethyl-1-methoxyhydroquinone (29): A slurry of 31 (0.7 g, mmol, 1 equiv), [Me3OBF4] (3 equiv), and proton-sponge® (3.3 equiv) in CH2Cl2 was stirred vigorously overnight at room temperature. The reaction mixture was then directly applied to a silica gel column and eluted with 2% EtOAc in hexanes to yield 33 as a white solid that turns pink upon standing. 29 was derived from 33 according to the same DIBAL-H followed by Wittig olefination process outlined above for 32. The resulting ester 34 was hydrolyzed with PLE in a 1:1 mixture of phosphate buffer and t-butyl methyl ether over four days at room temperature to yield 29 as a white powder. Rf = 0.35 (silica gel, 30% EtOAc:Hexanes); IR (film) 3660, 2960, 2920, 2850, 1705, 1460, 1400, 1370, 1350, 1025; 1H NMR (400 MHz, CDCl3) δ 6.82 (t, J = 6.7 Hz, 1H), 3.62 (s, 3H), 3.55 (d, J = 7.1 Hz, 2H), 2.20 (s, 6H), 2.13 (s, 3H), 2.01 (s, 3H); 13C NMR (100 MHz, CDCl3) δ 172.4, 151.0, 148.3, 143.2, 128.7, 127.9, 127.1, - 122.3, 120.3, 60.8, 27.4, 13.2, 12.7, 12.6, 12.5; HRMS (ESI) calcd for C15H19O4 [M - H]- 263.1283, found 263.1285.

Type II Adanve Acids preparation: See Section 5.9 of Chapter 5 for synthesis and characterization data for selected type II Adanve acids.

Standard procedure for enantio-selective cycloetherification to chiral chromans using Type II Adanve Acids: Same as in the regioselective cycloetherification of geranylgeranyl-hydroquinones described in Section 5.9 of the preceding chapter.

α-Tocopherol (24H): See Table 1. Purification by silica gel gel (4% EtOAc:hexanes); clear viscous oil. Rf = 0.34 (silica gel, 15% EtOAc:hexanes); IR (film) 3567 (br), 2924, 2866, 1458, 1377, 1260, 1211, 1159, 10583, 1058, 1009, 918, 647; 1H NMR (300 MHz, CDCl3) δ 2.61 (t, J = 6.8 Hz, 1H), 2.16 (s, 2H), 2.12 (s, 3H), 1.79 (dq, J = 13.5, 6.6 Hz, 1H), 1.62 – 1.00 (m, 13H), 0.90 – 0.82 (m, 6H); 13C NMR (100 MHz, CDCl3) δ 145.9, 144.9, 123.0, 121.3, 117.7, 100.3, 74.9, 40.25, 40.18, 39.7, 37.9, 37.8, 37.8, 37.7, 37.6, 33.2, 33.1, 31.9, 31.9, 28.3, 25.2, 24.8, 24.1, 23.1, 23.0, 21.4, 21.1, 20.1, 12.1, 11.6; + + HRMS (ASAP) calcd for C29H51O2 [M + H] 431.3889, found 431.3894; HPLC (Chiralcel OD-H, 0.5% 2-propanol in hexanes, 1.0 mL/min, 25 ºC, 220 nm): t(2R, 4’R,8’R) = 9.5 min, t(2S, 4’R,8’R) = 10.6 min. 238

α-Tocopherol acetate (24Ac): See Table 2. Purification by silica gel (4% EtOAc:hexanes); clear viscous oil that crystallizes at 0 ºC. Rf = 0.40 (silica gel, 15% EtOAc:hexanes); IR (film) 2925, 2866, 1758, 1459, 1367, 1205, 1160, 1077, 849, 680, 617, 484; 1H NMR (300 MHz, CDCl3) δ 2.59 (t, J = 6.7 Hz, 2H), 2.33 (s, 3H), 2.09 (s, 3H), 2.02 (s, 3H), 1.98 (s, 3H), 1.87 – 1.68 (m, 2H), 1.60 – 1.55 (m, 1H), 1.53 (s, 2H), 1.52 – 1.26 (m, 10H), 1.24 (s, 4H), 1.22 – 1.00 (m, 7H), 0.92 – 0.81 (m, 12H); 13C NMR (100 MHz, CDCl3) δ 170.0, 149.8, 140.9, 127.0, 125.2, 123.4, 117.7, 75.4, 39.7, 37.8, 37.6, 33.1, 33.1, 31.4, 28.3, 25.1, 24.8, 23.1, 23.0, 21.4, 20.9, 20.9, 20.1, 20.0, 13.3, 12.4, + + 12.2; HRMS (ESI) calcd for C31H52O3Na [M + Na] 495.3814, found 495.3812; HPLC (Chiralcel OD-H, 0.02% 2-propanol in hexanes, 1.0 mL/min, 25 ºC, 220 nm): t(2R, 4’R,8’R) = 25.9 min, t(2S, 4’R,8’R) = 28.8 min.

α-Tocopherol mesylate (24Ms): See Table 2. Purification by silica gel (4% EtOAc:hexanes), viscous oil that crystallizes into an off white solid upon storage at 0 ºC. Rf = 0.30 (silica gel, 15% EtOAc:hexanes); IR (film) 2926, 2856, 1743, 1461, 1409, 1342, 1176, 1106, 1056, 967, 909, 872, 730, 649, 517; 1H NMR (500 MHz, CDCl3) δ 5.40 5.32 (m, 1H), 3.23 (s, 3H), 2.60 (t, J = 6.7 Hz, 2H), 2.32 (t, J = 7.4 Hz, 1H), 2.25 (s, 3H), 2.22 (s, 3H), 2.10 (s, 3H), 2.08 – 2.00 (m, 1H), 1.87 1.73 (m, 2H), 1.64 – 1.03 (m, 32H), 0.92 0.85 (m, 14H); 13C NMR (125 MHz, CDCl3) δ 150.5, 139.9, 130.5, 130.3, 128.9, 128.4, 128.2, 127.5, 124.1, 118.4, 75.7, 69.2, 62.4, 40.3, 39.7, 39.0, 37.8, 37.7, 37.7, 37.6, 34.3, 33.1, 33.0, 31.8, 31.3, 30.1, 30.0, 29.9, 29.7, 29.5, 29.4, 28.3, 27.5, 26.0, 25.1, 24.8, 24.2, 23.0, 22.95, 22.9, 21.3, 21.0, 20.1, 20.0, 14.8, 14.4, 14.4, 14.0, 12.2 ; + + HRMS (ESI) calcd for C30H52O4SNa [M + Na] 531.3484, found 531.3483; HPLC ([Chiralcel OD-H, 0.05% 2-propanol in hexanes, 1.0 mL/min, 25 ºC, 220 nm] has given the best separation so far but still with some overlap).

Methyl-Trolox® (30): See Table 3. IR (film) 3240, 2963, 2919, 2852, 1705, 1461, 1402, 1371, 1349, 1020 1H NMR (400 MHz, CDCl3) δ 3.62 (s, 3H), 2.71 – 2.53 (m, 2H), 2.42 – 2.32 (m, 1H), 2.19 (s, 3H), 2.15 (s, 3H), 2.12 (s, 3H), 2.02 – 1.90 (m, 1H), 1.62 (s, 3H); 13C NMR (100 MHz, CDCl3) δ 176.5, 151.0, 146.8, 145.4, 128.9, 126.5, 123.1, 117.8, - - 60.7, 30.1, 24.6, 20.7, 12.9, 12.2, 12.0; HRMS (APCI) calcd for C15H19O4 [M - H] 263.1283, found 263.1290; HPLC (ongoing).

O

O OH

S2

(CDCl3, 300 MHz) 239

O

O OH

S2

(CDCl3, 125 MHz) 240

HO

OH

23H

(CDCl3, 500 MHz) 241

HO

OH

23H

(CDCl3, 125 MHz) 242

O

O OH

23Ac

(CDCl3, 300 MHz) 243

O

O OH

23Ac

(CDCl3, 125 MHz) 244

O

O OH

23Bz

(CDCl3, 300 MHz) 245

O

O OH

23Bz

(CDCl3, 125 MHz) 246

O S O O OH

23Ms

(CDCl3, 500 MHz) 247

O S O O OH

23Ms

(CDCl3, 125 MHz) 248

O

O O

O OH

23CPN

(CDCl3, 500 MHz) 249

250

, 125 MHz) 3 23CPN OH

(CDCl O O O O

O O

O O

32 (quinone form)

(CDCl3, 300 MHz) 251

O O

O O

32 (quinone form)

(CDCl3, 125 MHz) 252

O OH

O O

28

(CDCl3, 400 MHz) 253

O OH

O O

28

(CDCl3, 100 MHz) 254

MeO OH

O OH

29

(CDCl3, 400 MHz)

255

MeO OH

O OH

29

(CDCl3, 100 MHz) 256

HO

O

24H

(CDCl3, 300 MHz) 257

HO

O

24H

(CDCl3, 100 MHz) 258

O

O O

24Ac

(CDCl3, 300 MHz) 259

O

O O

24Ac

(CDCl3, 100 MHz) 260

O S O O O

24Ms

(CDCl3, 500 MHz) 261

262

, 500 MHz) 24Ms 3 O (CDCl O O S O

MeO

OH O O

30

(CDCl3, 400 MHz) 263

264

OH

O

O 30 , 100 MHz) 3 (CDCl MeO