Two Novel HADHB Gene Mutations in a Korean Patient with Mitochondrial Trifunctional Protein Deficiency

Home , Dehydrogenase, HADHA, HADHB

Available online at www.annclinlabsci.org Annals of Clinical & Laboratory Science, vol. 39, no. 4, 2009 399 Case Report: Two Novel HADHB Gene Mutations in a Korean Patient with Mitochondrial Trifunctional Protein Deficiency

Hyung-Doo Park,1,a Suk Ran Kim,1,a Chang-Seok Ki,1 Soo-Youn Lee,1 Yun Sil Chang,2 Dong-Kyu Jin,2 and Won Soon Park2 Departments of 1Laboratory Medicine & Genetics and 2Pediatrics, Sungkyunkwan University School of Medicine, Samsung Medical Center, Seoul, Korea (aHyung-Doo Park and aSuk Ran Kim contributed equally to the work.)

Abstract. Mitochondrial trifunctional protein (MTP) is a heterocomplex composed of 4 α-subunits containing LCEH (long-chain 2,3-enoyl-CoA hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and 4 b-subunits that harbor LCKT (long-chain 3-ketoacyl-CoA thiolase) activity. MTP deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases ranging from severe infantile cardiomyopathy to mild chronic progressive polyneuropathy. Here, we report the case of a Korean male newborn who presented with severe lactic acidosis, seizures, and heart failure. A newborn screening test and plasma acylcarnitine profile analysis by tandem mass spectrometry showed an increase of 3-hydroxy species: 3-OH-palmitoylcarnitine, 0.44 nmol/ml (reference range, RR <0.07); 3-OH- linoleylcarnitine, 0.31 nmol/ml (RR <0.06); and 3-OH-oleylcarnitine, 0.51 nmol/ml (RR <0.04). These findings suggested either long-chain 3-hydroxyacyl-coA dehydrogenase deficiency or complete MTP deficiency. By molecular analysis of theHADHB gene, the patient was found to be a compound heterozygote for c.358dupT (p.A120CfsX8) and c.1364T>G (p.V455G) mutations. These 2 mutations of the HADHB gene were novel and inherited. Although the patient was treated by reduction of glucose administration and supplementation of a medium-chain triglyceride-based diet with L-carnitine, he died 2 mo after birth due to advanced cardiac failure.

Keywords: mitochondrial trifunctional protein (MTP) deficiency,HADHB gene mutations

Introduction b-oxidation of fatty acids, which consists of multiple transport steps, is initiated by a catalytic reaction Fatty acid oxidation is a major source of energy for mediated by a long-chain acyl-CoA dehydrogenase, skeletal and cardiac muscle. Mitochondrial trifunct- followed by MTP [2]. ional protein (MTP) is bound to the inner mito- MTP deficiency, an autosomal recessive chondrial membrane and is a heterocomplex of 4 disorder, leads to a spectrum of diseases ranging α-subunits containing LCEH (long-chain 2,3- from severe infantile cardiomyopathy, inducing enoyl-CoA hydratase) and LCHAD (long-chain early death, to mild chronic progressive sensorimotor 3-hydroxyacyl CoA dehydrogenase) activity, and 4 polyneuropathy with episodic rhabdomyolysis [1]. b-subunits that harbor LCKT (long-chain 3- Deficiency of either MTP or LCHAD in association ketoacyl-CoA thiolase) activity [1]. Mitochondrial with fetal MTP defects occurs at a rate of 1/ 38,000 pregnancies, calculated from a molecular screening Address correspondence to Won-Soon Park, M.D., Ph.D., study of 351 normal subjects [3]. MTP complex Department of Pediatrics, Samsung Medical Center, 50 Ilwon- dong, Gangnam-gu, Seoul, 135-710, Korea; tel 82 2 3410 disorders are classified into 2 phenotypes: isolated 3523; fax 82 2 3410 0043; e-mail [email protected]. LCHAD deficiency and general MTP deficiency.

Different nuclear genes, namely, HADHA and The clinical status of the patient did not improve following HADHB, consisting of 20 and 16 exons, respectively, onset of these symptoms, and he exhibited a pale appearance, decreased activity, and tachypnea. encode each subunit of MTP. Both genes are Four days after birth, a blood spot was collected from located on chromosome 2p23. More than 60% of the patient’s original newborn screening card and butylated cases associated with LCHAD deficiency have the acylcarnitines were analyzed by tandem mass spectrometry E474Q (c.1528G>C) mutation in the α-subunit (Waters, Manchester, UK). Initial laboratory findings [4,5]. The remaining cases consist of complete included serum urea, 31.4 mg/dl (reference range, RR 8-22); creatinine, 1.25 mg/dl (RR 0.7-1.3); AST, 128 U/L (RR <40); MTP deficiency that is caused by defects in either ALT, 57 U/L (RR <40); and glucose 63 mg/dl (RR 70-110). the α- or b-subunits encoded by the HADHB gene The serum ammonia level was 358 µmol/L (RR 56-92), and [5,6]. Generally, all 3 enzyme activities of the MTP the lactic acid level was 24.8 mmol/L (RR 0.7-2.5). Plasma complex are undetectable in MTP deficiency due amino acids and urine organic acids were analyzed. Quantitative acylcarnitine profile testing in plasma (Mayo to a lack of both HADHA and HADHB proteins Medical Lab, Rochester, MN) was also performed. [7]. In contrast to many patients with LCHAD Five days after birth the patient developed frequent deficiency, only a few patients with MTP deficiency seizures, and electroencephalography showed abnormal have been reported. Here, we present a Korean findings. Postnatal echocardiography revealed a significant patient with complex MTP deficiency confirmed left ventricular dilatation, reduced cardiac dysfunction (ejection fraction, 25%), moderate mitral regurgitation, and by clinical, biochemical, and molecular findings. tricuspid regurgitation. Brain MRI analysis suggested liquefaction of hemorrhages in both frontal lobes. The serum Materials and Methods levels of cardiac markers were as follows: CK-MB, 127.6 ng/ ml (RR <5); cardiac troponin I, 1.21 ng/ml (RR <0.78); and The male patient in this study was born at 36 weeks of N-terminal pro-BNP, 35,000 pg/ml (RR <88). gestation to healthy, non-consanguineous Korean parents. Molecular defects in the HADHA and HADHB genes The weight of the patient at birth was 2600 g (25-50th were investigated to confirm the diagnosis of MTP deficiency. percentile), the length was 48.5 cm (50-75th percentile), and After obtaining informed consent from the parents, blood the head circumference was 33 cm (50th percentile). The samples were collected from the patient and parents. Genomic patient’s Apgar score was 8 at 1 min and 10 at 5 min. The DNA was isolated from peripheral blood leukocytes using a family history was unremarkable. Chest retractions with Wizard genomic DNA purification kit according to the grunting sounds were observed 14 hr after birth. Blood gas manufacturer’s instructions (Promega, Madison, WI). The patient’s HADHA and HADHB genes were amplified by PCR analysis showed pH 6.98, pO2 56.1 mmHg, bicarbonate 6.8 mmol/L, and base excess -23.9 mmol/L, indicating severe using primers designed by the authors (Table 1) and a Thermal metabolic acidosis. Thereafter, hypotension (BP, 22/15 Cycler 9700 (Applied Biosystems, Foster City, CA). Sequence mmHg) and oliguric renal failure developed and the patient analyses of all coding exons and the flanking introns of the was treated with intravenous dopamine, dobutamine, HADHA and HADHB genes were performed using the epinephrine, sodium bicarbonate, glucose, and vasopressin. BigDye Terminator Cycle Sequencing Ready Reaction kit

Table 1. Primer sequences for mutation analysis of the HADHB gene.

Exon Primer Sequence (5’→3’) Primer Sequence (5’→3’)

2 2F AGTGGTTGCTGCAATGTGAA 2R CTCGTAGCTGGGAGGAACAG 3 3F ATCAAAATGGGCCCTCAGAT 3R GCAGGTTCAAATCCCAGAAA 4 4F AAGCTGTCCAGACCAAAACG 4R TCATGGGACTGCTATCCAAA 5 5F TGAAATGATGGACTGCCTTG 5R TGATCAATCGAGTCCTGTGG 6 6F AGAAGGTGCCAAATGCTTGT 6R GACAATGTCCTAAACCAGCTCA 7 7F TCATAGCCTCGTGTCTGCAC 7R GGCAGGATGATCTCTTGAGC 8 8F ACGTCCATATGGCAGGAATG 8R CACCTATTACAGCATAGCAGAGTCC 9 9F CTGCTTGTCTTGGACTTGATTG 9R TCCCAAAGTGCTGAGATTAGTG 10 10F AAGCATTTAGATGATTTCCCAAT 10R GGGCCTTAAAACCGTGATTC 11 11F GCTTGGCCATGAGCATTTAT 11R GTCCAAGGATACAAACTGCTACC 12 12F AAGCCGAAGGCATATTTGAG 12R CAAAACCTCCCGAGTAGCTG 13 13F CCTTGCCTTGCTCTTTGAAC 13R CTCCCAGCAGTGTGAATCAG 14 14F GCGTAGAGGAACATGAATAACG 14R TCCAATTATTAACGTGCTTTGAA 15 15F TGACCTAGACTTACTTTCTTTTGCAG 15R AACAAAAAGTTTTATCAGAATTACAGC 16 16F TGAGCCCCATTTTGTAGAGG 16R GGCAAGGCTTAAGTGCAAAC Novel HADHB mutations in a patient with MTP deficiency 401

Fig. 1. Acylcarnitine profiling in a healthy newborn (A) and in the study patient (B). Elevated levels of 3-hydroxydicarboxylic derivatives of the C16:0 and C18:1 species are shown.

(Applied Biosystems) on an ABI Prism 3130 genetic analyzer 3-hydroxysebacic acid. Quantitative acylcarnitine (Applied Biosystems). profiling in plasma showed prominent accumulation of 3-hydroxy species levels as follows: 3-OH- Results palmitoylcarnitine (C16-OH), 0.44 nmol/ml (RR <0.07); 3-OH-linoleylcarnitine (C18:2-OH), 0.31 A newborn screening test by tandem mass spectro- nmol/ml (RR <0.06); and 3-OH-oleylcarnitine metry revealed elevation of 3-hydroxydicarboxylic (C18:1-OH), 0.51 nmol/ml (RR <0.04). derivatives of the C16:0 and C18:1 species (C16- We identified 2 novel mutations in theHADHB OH: 1.17 µmol/L, cut-off <0.07; C18:1-OH: 0.44 gene of the patient with MTP deficiency belonging µmol/L, cut-off <0.07) (Fig. 1). Plasma amino acid to the second phenotype as described above. profiling produced nonspecific findings, and urine Specifically, the patient was a compound organic acids revealed increases of adipic acid and heterozygote for c.358dupT and c.1364T>G 402 Annals of Clinical & Laboratory Science, vol. 39, no. 4, 2009

Fig. 2. Direct sequencing of the HADHB gene in the patient revealed 2 novel mutation: c.358dupT (p.A120CfsX8) and c.1364T>G (p.V455G). The patient’s father was heterozygous for the c.358dupT mutation and his mother was a carrier for the c.1364T>G mutation. mutations of the HADHB gene (Table 2). An exonic Discussion single T duplication at c.358 in exon 7 created a novel early termination codon (p.A120CfsX8) We have identified 2 novelHADHB mutations in a while the c.1364T>G transition resulted in an neonate affected by MTP complex deficiency. amino acid substitution of Val to Gly at codon 455 Valine, with a hydropathy index of 4.2, is one of (p.V455G) in exon 15 (reference sequence from the most hydrophobic amino acids [8]. Glycine is NM_000183.2). The 2 molecular defects in the much less hydrophobic compared to valine, and as HADHB gene originated from the parents. a result the p.V455G mutation of HADHB may Specifically, the patient’s father was a carrier of the have influenced the MTP structure because c.358dupT mutation while his mother was hydrophilic amino acids tend to be located closer to heterozygous for the c.1364T>G mutation (Fig. 2). protein surfaces. In addition, the c.358dupT (p. We looked for these mutations in 100 normal A120CfsX8) frameshift mutation resulted in a Korean alleles, but neither mutation was novel internal termination codon and possible identified. nonsense-mediated RNA decay. Although the Because his laboratory findings were suggestive enzymatic activities of each component of MTP of LCHAD or MTP deficiency, glucose admin- were not determined in the patient, we assume that istration was reduced and the patient was started the HADHB mutations influenced protein stability on a medium chain triglyceride-based diet with an and function. Clinically, many patients with 2 L-carnitine supplement. However, the patient died missense HADHB mutations exhibit more mild 2 mo after birth, due to advanced cardiac failure. myopathic phenotypes [9,10]. The patient in the Novel HADHB mutations in a patient with MTP deficiency 403

Table 2. HADHB mutations in Korean patients with MTP deficiency.

Patient Sex Age at Clinical features Outcome Phenotype Nucleotide Amino acid Exon onset change change

1 M 1 day Hypoketotic Died at 2 mo Lethal c.358dupT p.A120CfsX8 7 hypoglycemia Cardiomyopathy c.1364T>G p.V455G 15

2 F 12 yr Myoglobinuria NA Myopathic c.919A>G p.N307D 10

Rhabdomyolysis c.1165A>G p.N389D 14

3 M 25 mo Metabolic acidosis NA Myopathic c.340A>G p.N114D 6

Lethargy c.919A>G p.N307D 10

NA, not available. Patient 1 is described in this study; patients 2 and 3 are described in a previous report [9]. Reference sequence from NM_000183.2. present study had a severe neonatal phenotype with for b-subunit mutations, with missense or nonsense hypoketotic hypoglycemia, cardiomyopathy, and mutations comprising a large majority [5,7,10,14]. Reye-like syndrome. He died 2 mo after birth due Approximately 69% of mutant alleles are located to cardiac failure, and it was not possible to perform on exons 4, 9, and 10 in the HADHB gene [10], an autopsy. It has been reported that mice can suggesting genetic heterogeneity of MTP deficiency exhibit a defect in the cardiac conduction system due to b-subunit mutations. caused by a mutation of Hadhb, with a reduction of MTP deficiency disease is rare, but newborn both LCHAD and LKAT enzyme activities [11]. screening by tandem mass spectrometry may be Likewise, Spiekerkoetter et al [12] reported that required because early diagnosis and treatment can fatty acid oxidation plays a significant role during help to improve clinical outcomes in the patients. intrauterine development with special regard to the Sander et al [15] recommended that neonatal heart and severe cardiac mitochondrial proliferation screening for MTP deficiency is necessary on the in MTP deficiency. basis of specified criteria. Typical acylcarnitine There have been 2 reports of Korean patients profiles in blood are characterized by increased with MTP deficiency diagnosed by acylcarnitine concentrations of 3-hydroxy-palmitoylcarnitine profiling and DNA analysis [9,13]. A heterozygous (C16-OH), 3-hydroxy-oleylcarnitine (C18:1-OH), 2 bp deletion (bp 1793_4) in the HADHA gene tetradecenoylcarnitine (C14:1), and 3-hydroxy- was first identified in a Korean patient with MTP myristoylcarnitine (C14-OH). Because acylcarn- deficiency [13]. Table 2 compares the HADHB itine analysis by tandem mass spectrometry cannot mutations found in our patient with those detected differentiate among different defects of the MTP by Choi et al [9] in 2 other Korean patients. complex, metabolic defects must be confirmed and Considering that 5 different HADHB mutations specified by additional enzyme analysis in cultured have been found in 3 patients, including 2 from the fibroblasts as well as by mutation analysis of patient in this study, there do not yet appear to be causative genes. Enzyme assays performed for any mutational hot-spots among Korean patients MTP-deficient patients tend to show a lack of 1 or with MTP deficiency, even though the number of more enzymes in cultured lymphocytes and subjects is small. Presently, >20 unique mutations fibroblasts. Although determination of enzyme have been described by studies of the HADHB deficiency is a valuable tool for the diagnosis of the genes in MTP deficient patients, as reviewed in the disease, direct sequencing of the HADHA and HADHB gene mutation database (http://www. HADHB genes should also be performed to confirm hgmd.org/). Most cases are compound heterozygotes the diagnosis. We were unable to measure enzyme 404 Annals of Clinical & Laboratory Science, vol. 39, no. 4, 2009 activities in the patient and his family, and thus 6. Spiekerkoetter U, Khuchua Z, Yue Z, Bennett MJ, genetic-based investigation was helpful for Strauss AW. General mitochondrial trifunctional protein (TFP) deficiency as a result of either alpha- or beta- determining the diagnosis of the patient and subunit mutations exhibits similar phenotypes because understanding the mutation inheritance pattern mutations in either subunit alter TFP complex expression from the parents. Molecular analysis can be an and subunit turnover. Pediatr Res 2004;55:190-196. important approach for the differential diagnosis 7. Orii KE, Aoyama T, Wakui K, Fukushima Y, Miyajima and confirmation of MTP deficiency. Indeed, the H, Yamaguchi S, Orii T, Kondo N, Hashimoto T. Genomic and mutational analysis of the mitochondrial identification of genetic mutations makes prenatal trifunctional protein beta-subunit (HADHB) gene in molecular diagnosis feasible for at-risk family patients with trifunctional protein deficiency. Hum Mol members. Genet 1997;6:1215-1224. In conclusion, we screened a patient with MTP 8. Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157: deficiency by tandem mass spectrometry and 105-132. confirmed the diagnosis by biochemical and genetic 9. Choi JH, Yoon HR, Kim GH, Park SJ, Shin YL, Yoo analysis. We envision that future work on the novel HW. Identification of novel mutations of the HADHA HADHB mutations identified in this study will and HADHB genes in patients with mitochondrial confirm their effects on the functional or structural trifunctional protein deficiency. Int J Mol Med 2007;19: 81-87. aberration of the protein. 10. Spiekerkoetter U, Sun B, Khuchua Z, Bennett MJ, Strauss AW. Molecular and phenotypic heterogeneity in References mitochondrial trifunctional protein deficiency due to beta-subunit mutations. Hum Mutat 2003;21:598-607. 1. Olpin SE, Clark S, Andresen BS, Bischoff C, Olsen RK, 11. Kao HJ, Cheng CF, Chen YH, Hung SI, Huang CC, Gregersen N, Chakrapani A, Downing M, Manning Millington D, Kikuchi T, Wu JY, Chen YT. ENU NJ, Sharrard M, Bonham JR, Muntoni F, Turnbull DN, mutagenesis identifies mice with cardiac fibrosis and Pourfarzam M. Biochemical, clinical and molecular hepatic steatosis caused by a mutation in the mito- findings in LCHAD and general mitochondrial chondrial trifunctional protein beta-subunit. Hum Mol trifunctional protein deficiency. J Inherit Metab Dis Genet 2006;15:3569-3577. 2005;28:533-544. 12. Spiekerkoetter U, Mueller M, Cloppenburg E, Motz R, 2. Rector RS, Payne RM, Ibdah JA. Mitochondrial Mayatepek E, Bueltmann B, Korenke C. Intrauterine trifunctional protein defects: clinical implications and cardiomyopathy and cardiac mitochondrial proliferation therapeutic approaches. Adv Drug Deliv Rev 2008;60: in mitochondrial trifunctional protein (TFP) deficiency. 1488-1496. Mol Genet Metab 2008;94:428-430. 3. Ibdah JA, Bennett MJ, Rinaldo P, Zhao Y, Gibson B, 13. Lee JE, Yoon HR, Paik KH, Hwang SJ, Shim JW, Chang Sims HF, Strauss AW. A fetal fatty-acid oxidation YS, Park WS, Strauss AW, Jin DK. A case of mitochondrial disorder as a cause of liver disease in pregnant women. trifunctional protein deficiency diagnosed by acyl- NEJM 1999;340:1723-1731. carnitine profile and DNA analysis in a dried blood spot 4. Ijlst L, Uskikubo S, Kamijo T, Hashimoto T, Ruiter JP, of a 4-day-old boy. J Inherit Metab Dis 2003;26:403- de Klerk JB, Wanders RJ. Long-chain 3-hydroxyacyl- 406. CoA dehydrogenase deficiency: high frequency of the 14. Ushikubo S, Aoyama T, Kamijo T, Wanders RJ, Rinaldo G1528C mutation with no apparent correlation with the P, Vockley J, Hashimoto T. Molecular characterization clinical phenotype. J Inherit Metab Dis 1995;18:241- of mitochondrial trifunctional protein deficiency: 244. formation of the enzyme complex is important for 5. Das AM, Illsinger S, Lucke T, Hartmann H, Ruiter JP, stabilization of both alpha- and beta-subunits. Am J Steuerwald U, Waterham HR, Duran M, Wanders RJ. Hum Genet 1996;58:979-988. Isolated mitochondrial long-chain ketoacyl-CoA thiolase 15. Sander J, Sander S, Steuerwald U, Janzen N, Peter M, deficiency resulting from mutations in the HADHB Wanders RJ, Marquardt I, Korenke GC, Das AM. gene. Clin Chem 2006;52:530-534. Neonatal screening for defects of the mitochondrial trifunctional protein. Mol Genet Metab 2005;85:108- 114.