Available online at www.annclinlabsci.org Annals of Clinical & Laboratory Science, vol. 39, no. 4, 2009 399 Case Report: Two Novel HADHB Gene Mutations in a Korean Patient with Mitochondrial Trifunctional Protein Deficiency Hyung-Doo Park,1,a Suk Ran Kim,1,a Chang-Seok Ki,1 Soo-Youn Lee,1 Yun Sil Chang,2 Dong-Kyu Jin,2 and Won Soon Park2 Departments of 1Laboratory Medicine & Genetics and 2Pediatrics, Sungkyunkwan University School of Medicine, Samsung Medical Center, Seoul, Korea (aHyung-Doo Park and aSuk Ran Kim contributed equally to the work.) Abstract. Mitochondrial trifunctional protein (MTP) is a heterocomplex composed of 4 α-subunits containing LCEH (long-chain 2,3-enoyl-CoA hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and 4 b-subunits that harbor LCKT (long-chain 3-ketoacyl-CoA thiolase) activity. MTP deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases ranging from severe infantile cardiomyopathy to mild chronic progressive polyneuropathy. Here, we report the case of a Korean male newborn who presented with severe lactic acidosis, seizures, and heart failure. A newborn screening test and plasma acylcarnitine profile analysis by tandem mass spectrometry showed an increase of 3-hydroxy species: 3-OH-palmitoylcarnitine, 0.44 nmol/ml (reference range, RR <0.07); 3-OH- linoleylcarnitine, 0.31 nmol/ml (RR <0.06); and 3-OH-oleylcarnitine, 0.51 nmol/ml (RR <0.04). These findings suggested either long-chain 3-hydroxyacyl-coA dehydrogenase deficiency or complete MTP deficiency. By molecular analysis of theHADHB gene, the patient was found to be a compound heterozygote for c.358dupT (p.A120CfsX8) and c.1364T>G (p.V455G) mutations. These 2 mutations of the HADHB gene were novel and inherited. Although the patient was treated by reduction of glucose administration and supplementation of a medium-chain triglyceride-based diet with L-carnitine, he died 2 mo after birth due to advanced cardiac failure. Keywords: mitochondrial trifunctional protein (MTP) deficiency, HADHB gene mutations Introduction b-oxidation of fatty acids, which consists of multiple transport steps, is initiated by a catalytic reaction Fatty acid oxidation is a major source of energy for mediated by a long-chain acyl-CoA dehydrogenase, skeletal and cardiac muscle. Mitochondrial trifunct- followed by MTP [2]. ional protein (MTP) is bound to the inner mito- MTP deficiency, an autosomal recessive chondrial membrane and is a heterocomplex of 4 disorder, leads to a spectrum of diseases ranging α-subunits containing LCEH (long-chain 2,3- from severe infantile cardiomyopathy, inducing enoyl-CoA hydratase) and LCHAD (long-chain early death, to mild chronic progressive sensorimotor 3-hydroxyacyl CoA dehydrogenase) activity, and 4 polyneuropathy with episodic rhabdomyolysis [1]. b-subunits that harbor LCKT (long-chain 3- Deficiency of either MTP or LCHAD in association ketoacyl-CoA thiolase) activity [1]. Mitochondrial with fetal MTP defects occurs at a rate of 1/ 38,000 pregnancies, calculated from a molecular screening Address correspondence to Won-Soon Park, M.D., Ph.D., study of 351 normal subjects [3]. MTP complex Department of Pediatrics, Samsung Medical Center, 50 Ilwon- dong, Gangnam-gu, Seoul, 135-710, Korea; tel 82 2 3410 disorders are classified into 2 phenotypes: isolated 3523; fax 82 2 3410 0043; e-mail [email protected]. LCHAD deficiency and general MTP deficiency. 0091-7370/09/0400-0399. $2.10. © 2009 by the Association of Clinical Scientists, Inc. 400 Annals of Clinical & Laboratory Science, vol. 39, no. 4, 2009 Different nuclear genes, namely, HADHA and The clinical status of the patient did not improve following HADHB, consisting of 20 and 16 exons, respectively, onset of these symptoms, and he exhibited a pale appearance, decreased activity, and tachypnea. encode each subunit of MTP. Both genes are Four days after birth, a blood spot was collected from located on chromosome 2p23. More than 60% of the patient’s original newborn screening card and butylated cases associated with LCHAD deficiency have the acylcarnitines were analyzed by tandem mass spectrometry E474Q (c.1528G>C) mutation in the α-subunit (Waters, Manchester, UK). Initial laboratory findings [4,5]. The remaining cases consist of complete included serum urea, 31.4 mg/dl (reference range, RR 8-22); creatinine, 1.25 mg/dl (RR 0.7-1.3); AST, 128 U/L (RR <40); MTP deficiency that is caused by defects in either ALT, 57 U/L (RR <40); and glucose 63 mg/dl (RR 70-110). the α- or b-subunits encoded by the HADHB gene The serum ammonia level was 358 µmol/L (RR 56-92), and [5,6]. Generally, all 3 enzyme activities of the MTP the lactic acid level was 24.8 mmol/L (RR 0.7-2.5). Plasma complex are undetectable in MTP deficiency due amino acids and urine organic acids were analyzed. Quantitative acylcarnitine profile testing in plasma (Mayo to a lack of both HADHA and HADHB proteins Medical Lab, Rochester, MN) was also performed. [7]. In contrast to many patients with LCHAD Five days after birth the patient developed frequent deficiency, only a few patients with MTP deficiency seizures, and electroencephalography showed abnormal have been reported. Here, we present a Korean findings. Postnatal echocardiography revealed a significant patient with complex MTP deficiency confirmed left ventricular dilatation, reduced cardiac dysfunction (ejection fraction, 25%), moderate mitral regurgitation, and by clinical, biochemical, and molecular findings. tricuspid regurgitation. Brain MRI analysis suggested liquefaction of hemorrhages in both frontal lobes. The serum Materials and Methods levels of cardiac markers were as follows: CK-MB, 127.6 ng/ ml (RR <5); cardiac troponin I, 1.21 ng/ml (RR <0.78); and The male patient in this study was born at 36 weeks of N-terminal pro-BNP, 35,000 pg/ml (RR <88). gestation to healthy, non-consanguineous Korean parents. Molecular defects in the HADHA and HADHB genes The weight of the patient at birth was 2600 g (25-50th were investigated to confirm the diagnosis of MTP deficiency. percentile), the length was 48.5 cm (50-75th percentile), and After obtaining informed consent from the parents, blood the head circumference was 33 cm (50th percentile). The samples were collected from the patient and parents. Genomic patient’s Apgar score was 8 at 1 min and 10 at 5 min. The DNA was isolated from peripheral blood leukocytes using a family history was unremarkable. Chest retractions with Wizard genomic DNA purification kit according to the grunting sounds were observed 14 hr after birth. Blood gas manufacturer’s instructions (Promega, Madison, WI). The patient’s HADHA and HADHB genes were amplified by PCR analysis showed pH 6.98, pO2 56.1 mmHg, bicarbonate 6.8 mmol/L, and base excess -23.9 mmol/L, indicating severe using primers designed by the authors (Table 1) and a Thermal metabolic acidosis. Thereafter, hypotension (BP, 22/15 Cycler 9700 (Applied Biosystems, Foster City, CA). Sequence mmHg) and oliguric renal failure developed and the patient analyses of all coding exons and the flanking introns of the was treated with intravenous dopamine, dobutamine, HADHA and HADHB genes were performed using the epinephrine, sodium bicarbonate, glucose, and vasopressin. BigDye Terminator Cycle Sequencing Ready Reaction kit Table 1. Primer sequences for mutation analysis of the HADHB gene. Exon Primer Sequence (5’→3’) Primer Sequence (5’→3’) 2 2F AGTGGTTGCTGCAATGTGAA 2R CTCGTAGCTGGGAGGAACAG 3 3F ATCAAAATGGGCCCTCAGAT 3R GCAGGTTCAAATCCCAGAAA 4 4F AAGCTGTCCAGACCAAAACG 4R TCATGGGACTGCTATCCAAA 5 5F TGAAATGATGGACTGCCTTG 5R TGATCAATCGAGTCCTGTGG 6 6F AGAAGGTGCCAAATGCTTGT 6R GACAATGTCCTAAACCAGCTCA 7 7F TCATAGCCTCGTGTCTGCAC 7R GGCAGGATGATCTCTTGAGC 8 8F ACGTCCATATGGCAGGAATG 8R CACCTATTACAGCATAGCAGAGTCC 9 9F CTGCTTGTCTTGGACTTGATTG 9R TCCCAAAGTGCTGAGATTAGTG 10 10F AAGCATTTAGATGATTTCCCAAT 10R GGGCCTTAAAACCGTGATTC 11 11F GCTTGGCCATGAGCATTTAT 11R GTCCAAGGATACAAACTGCTACC 12 12F AAGCCGAAGGCATATTTGAG 12R CAAAACCTCCCGAGTAGCTG 13 13F CCTTGCCTTGCTCTTTGAAC 13R CTCCCAGCAGTGTGAATCAG 14 14F GCGTAGAGGAACATGAATAACG 14R TCCAATTATTAACGTGCTTTGAA 15 15F TGACCTAGACTTACTTTCTTTTGCAG 15R AACAAAAAGTTTTATCAGAATTACAGC 16 16F TGAGCCCCATTTTGTAGAGG 16R GGCAAGGCTTAAGTGCAAAC Novel HADHB mutations in a patient with MTP deficiency 401 Fig. 1. Acylcarnitine profiling in a healthy newborn (A) and in the study patient (B). Elevated levels of 3-hydroxydicarboxylic derivatives of the C16:0 and C18:1 species are shown. (Applied Biosystems) on an ABI Prism 3130 genetic analyzer 3-hydroxysebacic acid. Quantitative acylcarnitine (Applied Biosystems). profiling in plasma showed prominent accumulation of 3-hydroxy species levels as follows: 3-OH- Results palmitoylcarnitine (C16-OH), 0.44 nmol/ml (RR <0.07); 3-OH-linoleylcarnitine (C18:2-OH), 0.31 A newborn screening test by tandem mass spectro- nmol/ml (RR <0.06); and 3-OH-oleylcarnitine metry revealed elevation of 3-hydroxydicarboxylic (C18:1-OH), 0.51 nmol/ml (RR <0.04). derivatives of the C16:0 and C18:1 species (C16- We identified 2 novel mutations in theHADHB OH: 1.17 µmol/L, cut-off <0.07; C18:1-OH: 0.44 gene of the patient with MTP deficiency belonging µmol/L, cut-off <0.07) (Fig. 1). Plasma amino acid to the second phenotype as described above. profiling produced nonspecific findings, and urine Specifically, the patient was a compound organic acids revealed increases of adipic acid and heterozygote for c.358dupT and c.1364T>G 402 Annals of Clinical & Laboratory Science, vol. 39, no. 4, 2009 Fig. 2. Direct sequencing of the HADHB gene in the patient revealed 2 novel mutation: c.358dupT (p.A120CfsX8) and c.1364T>G (p.V455G). The patient’s father was heterozygous for the c.358dupT mutation and his mother was a carrier for the c.1364T>G mutation. mutations of the HADHB gene (Table 2). An exonic Discussion single T duplication at c.358 in exon 7 created a novel early termination codon (p.A120CfsX8) We have identified 2 novelHADHB mutations in a while the c.1364T>G transition resulted in an neonate affected by MTP complex deficiency. amino acid substitution of Val to Gly at codon 455 Valine, with a hydropathy index of 4.2, is one of (p.V455G) in exon 15 (reference sequence from the most hydrophobic amino acids [8].