Diapositiva 1

10 A Unmethylated C

Methylated ) 8 Normal Normal Tissue Cervix Esophagus 4 cervical esophageal

a.u. * *** * ***

( 6

TargetID MAPINFO Position Ca-Ski HeLa SW756 tissue COLO-680N KYSE-180 OACM 5.1C tissue cg04255070 22851591 TSS1500 0.896 0.070 0.082 0.060 0.613 0.622 0.075 0.020

2 (log2) 4 cg01593340 22851587 TSS1500 0.826 0.055 0.051 0.110 0.518 0.518 0.034 0.040 cg16113692 22851502 TSS200 0.964 0.073 0.072 0.030 0.625 0.785 0.018 0.010 2

0 cg26918510 22851422 TSS200 0.985 0.019 0.000 0.000 0.711 0.961 0.010 0.060 expression cg26821579 22851416 TSS200 0.988 0.083 0.058 0.000 0.387 0.955 0.021 0.050

TRMT12 mRNA Expression mRNA TRMT12 0 cg01129966 22851401 TSS200 0.933 0.039 0.077 0.020 0.815 0.963 0.078 0.010 -2

cg25421615 22851383 TSS200 0.958 0.033 0.006 0.000 0.447 0.971 0.037 0.020 mRNA cg17953636 22851321 1stExon 0.816 0.092 0.099 0.080 0.889 0.750 0.136 0.030 -4 Methylated

SVIP SVIP Unmethylated SVIP relative expression (a.u.) expression relative SVIP

D Cervix Esophagus

HNC Meth ) HNC Unmeth Cervix Meth 3.0 *** Cervix Unmeth ***

Esophagus Meth a.u.

( 2.5 CaCaEsophagus-Ski-Ski Unmeth COLO-680N Haematological Meth TSS B TSS Haematological Unmeth 2.0 -244 bp +104 bp 244 bp +104 bp 1.5 ** * expression -SVIP

1.0 HeLa KYSE-180 HeLa TSS TSS 0.5 -ACTB 244 bp +104 bp - 244 bp +104 bp mRNA 0.0

HeLa SW756 Ca-Ski SW756 SW756 OACM 5.1C TSS KYSE-180 TSS COLO-680NOACM 5.1 C

- 244 bp +104 bp 244 bp +104 bp

) 3.0 * Ca-Ski COLO-680N WT TSS TSS

2.0 a.u. AZA-Treated

( 2.5

-244 bp +104 bp - 244 bp +104 bp ** 1.5 2.0 * *** AZA - + - + - + 1.0 1.5 * KYSE--180180 TSS HeLa TSS expression -SVIP

0.5 1.0

+104 bp - 244 bp +104 bp 244 bp 0.5

0.0 -ACTB mRNA SVIP relative exprrelative SVIP (a.u.) 0.0 OACM5.1 C BHY SW756 OACM 5.1C TSS TSS BB30-HNCCa-Ski 244 bp +104 bp - 244 bp +104 bp KYSE-180 Ca-Ski Aza COLO-680N KYSE-180 Aza COLO-680N Aza

Supplemental Figure 1. Transcriptional silencing of SVIP by promoter CpG island hypermethylation in cervical and esophageal cancer cells. (A) SVIP expression analysis in head & neck, esophagus, cervix and haematological cell lines. A non-parametric Mann Whitney test was performed. (B) Bisulfite genomic sequencing of SVIP promoter CpG island in the studied cervical and esophageal cancer cells lines. CpG dinucleotides are represented as short vertical lines and the transcription start site (TSS) is represented as a long black arrow. Single clones are shown for each sample. Presence of an unmethylated or methylated cytosine is indicated by a white or black square, respectively. (C) DNA methylation profile of the CpG island promoter for the SVIP gene analyzed by the 450K DNA methylation microarray. Single CpG absolute methylation levels (0 – 1) are shown. Green, unmethylated; red, methylated. Data from three cervical (Ca-Ski, HeLa and SW756), three esophageal (COLO-680N, KYSE-180 and OACM 5.1C), normal cervical tissue and normal esophageal tissue are shown. (D) SVIP expression levels in cervical and esophageal cancer cell lines determined by real-time PCR (data shown represent mean.of biological replicates) (left) and western blot (right). (E) Expression of the SVIP RNA transcript (data shown represent the mean of biological replicates) (left) and protein (right) was restored in the SVIP epigenetically silent Ca-Ski, COLO-860N and KYSE-180 cells by treatment with the demethylating drug 5-aza-2’-deoxycytidine (AZA). qPCRs were analysed using a two tailed Student ‘s t-test. *P < 0.05, **P < 0.01, ***P < 0.001. BHY EV Ca-Ski EV COLO-680N EV KYSE-180 EV BHY SVIP Ca-Ski SVIP COLO-680N SVIP KYSE-180 SVIP

2.0 2.0 2.0

) ) )

) 2.0

a.u. a.u. a.u. a.u.

( ( ( (

1.5 1.5 1.5 *** *** *** *** 1.5 1.0 1.0 1.0 1.0

-SVIP -SVIP -SVIP

expression expression expression expression -SVIP 0.5 0.5 0.5 0.5

-ACTB -ACTB -ACTB -ACTB

SVIP SVIP SVIP SVIP SVIP SVIP 0.0 0.0 0.0 0.0

BHY EV BHY SVIP Ca-Ski EV Ca-Ski SVIP BHY EV KYSE-180 EV B CaCa-SKI-Ski EV EV COLO-680N EV COLOColo680N-680N EV EV KYSE-180 SVIPKYSEKYSE-180-180 EV EV BHYBHYCa-SKI EVSVIP EV COLO-680N SVIP CaCa-SKI-Ski SVIP SVIP COLOColo680N-680N SVIP SVIP KYSEKYSE-180-180 SVIP SVIP 8 BHYCa-SKI SVIP SVIP 15 8 8 8

7 7

) ) ) ) 7 6 *

6 6

a.u. a.u. a.u.

a.u. 6 **

( ( (

( 10

5 5 5 * 5 4 **

4 4 4

viability viability viability

viability 3

3 3 3 5

2 2 2

Cell Cell Cell

Cell 2

Cell viability (a.u.) viability Cell

Cell viability (a.u.) viability Cell Cell viability (a.u.) viability Cell Cell viability (a.u.) 1 viability Cell 1 1 1 00 0 0 0 00 2424 4848 72 96 120120 144144 0 24 48 72 96 120 144 0 24 48 72 96 120 144 0 24 48 72 96 120 144 Time (hours) Time (hours) Time (hours) Time (hours) Time (days) Time (days) Time (days) Time (hours) Time (days) 5

SVIP methylated (N=61) SVIP low expression (N=50) 4 * C D* Ca9-22 SVIP unmethylated (N=138) SVIP highCCND1 expression (N=50) 3 *** *** Lb771 3 *** BB30-HNC EV *** 5

2 ns ) BB30-HNC SVIP

*** 2 2 1 a.u. ( 4 *

Ca9-22 mRNA expression (a.u.) expression mRNA

* 1 0 3 *** *** Lb771 0 0 BB30-HNC EV Ca9-22 Lb771 *** 2 BB30-HNC SVIP

expression ns

CCND1 CCND1 -1 BB30-HNC EV BB30-HNC SVIP 1

-2 -2

mRNA expession (au) expession mRNA

mRNA mRNA expression (a.u.) expression mRNA 0

mRNA expression (z-score) expression mRNA -3 Supplemental Figure 2. Efficient restoration of SVIP in other cell lines. SVIP recovery upon transfection in BHY (head and neck cancer), Ca-Ski (cervical cancer), COLO-680N Lb771 (esophageal cancer) and KYSE-180 (esophageal cancer) cancer cell lines was validated by (A) qRTCa9-22-PCR (biological replicates are shown, statistical analysis was performed using a two- sided Student’s t test) and western blot (images are representative of at least three different assays). (B) Cell viability was determined by SRB assay (graphs are representative of three BB30-HNC EV independent experiments; statistical analysis was performed by comparing mean endpoints using two-tailed (C) In silicoBB30-HNC correlation SVIP of the expression of the cell cycle marker cyclin D1 depending on SVIP methylation and expression status in head and neck, esophageal, cervix and haematological cell lines. Samples whose SVIP expression was lower than the first quartile were considered “SVIP low”, whereas samples with SVIP expression levels higher than the third quartile were considered “SVIP high”. Two-tailed U-Mann Whitney test was performed to compare mRNA expression between the groups of cell lines and TCGA samples. (D) Comparison of the magnitude of SVIP overexpression in BB30-HNC cell line compared with two unmethylated cell lines, Ca9-22 and Lb771 by qPCR.*P < 0.05, **P < 0.01, ***P<0.001.

A EV SVIP B C SVIP methylated (N=61) SVIP low expression (N=50)

SVIP unmethylated (N=138) SVIP high expressionDERL3 (N=50)

4 ** 6 -p-IRE1α ** Low SVIP expression

4 High SVIP expression

-IRE1α 2 2

-PERK 0 0

DERL3 DERL3 -2

-BiP -2 mRNA expession expession mRNA(au)

mRNA expession expession mRNA(au) -4 XBP1

-ERO1-Lα 4 *** 4 *** BHY

(N=61) 2 2 -PDI (N=138)

-ACTB 0

XBP1 XBP1 -2

-2 mRNA expession expession mRNA(au) mRNA expession expession mRNA(au) -4

D E 50 100 BB30-HNC EV BB30-HNC SVIP 80 40

60 -HRD1 30 40 ns

-SEL1L %viability Cell 20 20

Ski -ACTB0 ** - 0 1 2 103 4 5 6

Ca Log[Thapsigargin (nM)] % Of X-Gal positive cells positive % Of X-Gal 0

BB30-HNC EV BB30-HNC SVIP

Supplemental Figure 3. Restoration of SVIP expression does not alter the expression of other proteins involved in ERAD machinery and also recapitulates the ER stress situation in BHY and Ca-Ski cell lines. (A) Electron microscopy images of empty vector-transfected and SVIP-expressing BHY and Ca-Ski cell lines. All scale bars represent 1µm. (B) Representative western blots of various proteins associated to UPR and protein folding in the ER after SVIP recovery in BHY and Ca-Ski cells. (C) In silico correlation of the expression of three ER-related proteins (AMFR, DERL3 and XBP1) depending on SVIP methylation and expression status in head and neck, esophageal, cervix and haematological cell lines and in head & neck TCGA cohort. Samples whose SVIP expression was lower than the first quartile were considered “SVIP low”, whereas samples with SVIP expression levels higher than the third quartile were considered “SVIP high”. Two-tailed U-Mann Whitney test was performed to compare mRNA expression between the groups of cell lines and TCGA samples. (D) Representative western blot of proteins involved in ERAD process after SVIP recovery in BB30-HNC, BHY and Ca-Ski cell lines. All western blots in B and D were performed in triplicate. (E) % of β-galactosidase-expressing cells in EV- and SVIP-transfected BB30-HNC cells. Statistical differences were determined using a two-sided Student’s t test. Normalize of Row stats of Transform of Data 1

100 BB30-HNC EV 100 BB30-HNC EV 100 100BB30-HNC EV

BB30-HNC SVIP BB30-HNCBB30-HNC EVSVIP

80 BB30-HNC SVIP 75 BB30-HNC SVIP 75 75

viability

50 ns ns

50 40 50

Cell Cell

Cell ns

% %

% Cell %viability Cell % % 25 25 20

Cell viability (a.u.) viability Cell 25

Cell viability (a.u.) viability Cell Cell viability (a.u.) viability Cell 0 0 0 0 1 2 0 3 4 5 0.0 0.5 1.0 1.5 -2 -1 0 1 Log[Bay-8762 -3 (nM)] -2 -1 0 1 LogLog[ [BortezomibBortezomib ( nM(nM)])] Log[17-AAGLog[17-AAG (µM)](uM)] LogLog[IPI [IPI-504(uM)]-504 (µM)]

100 BB30-HNC EV BB30 EV 100

80 BB30-HNC SVIP BB30 SVIP

60 viability

ns ns viability 50

Cell 40

Cell

% %

% Cell viability Cell % % % % Cell viability Cell % 20 25

0 0 -1 0 1 2 -5 -4 -3 -2 -1 Log[LogEeyarestatin [EerI (uM)] I (µM)] Log[NMS-873(uM)]Log[NMS-873 (µM)]

Supplemental Figure 4. ER-related drugs testing on BB30-HNC model. Determination of growth inhibitory effect by the SRB assay in empty vector and SVIP- transfected BB30-HNC cells upon treatemnet with Bortezomib, 17-AAG, IPI-504, Eeyarestatin I and NMS-873. All assays were performed in triplicate. Graphs are representative of the experiments. Statistical differences were determined by adjusting the curve to a third grade polynomic equation followed by extra sum of squares F-test. ns, no significant. ns ns ns ns 4 4 4 4 *** *** 4 4 ** ** 4 4 *** *** 4 4 4 4 *** *** 4 4 ** ** 4 4 *** ***

2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

-2 -2 -2 -2 -2 -2 -2 -2 ns ns -2 -2 ns ns -2 -2 ** **

-24 -2 4 4 4 *** *** 4 4 ** ** 4 4 *** *** -24 -24 4 4 *** *** 4 4 4 4 *** ***

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

ns ns -2 -2 -2 -2 ns ns -2 -2 -2 -2 4 4 4 4 *** *** 4 4 ** ** 4 4 *** *** 4 4 4 4 *** *** 4 4 ** ** 4 4 *** ***

-2 -2 -2 -2 -2 -2 -2 -2

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA -4 -4 -4 -4 -4 -4 -4 -4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 ns ns Lowns SVIPns expression ns ns ns ns 4 4 *** *** 4 4 *** *** 4 4 4 4 4 4 *** *** 4 4 *** *** 4 4 4 4 SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIPSVIP low high SVIP high HighSVIP SVIP high SVIP expression high SVIP highSVIP high SVIP high SVIP high Methylated Methylated 0Methylated0 Methylated 0 0 MethylatedMethylated 0Methylated0Methylated 0 0 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 2 2 2 2 HK1 2 2 2 2 2 2 2 2 2 2 2 2 ns ns ns ns ***

) 4 4 4 4 4 *** *** 4 4 ** ** 4 4 *** *** 1.50 4-2 -24 -24 -24 *** *** 4 4 ** ** 4 4 *** *** -2 -2 -2 -2 SVIP low expression (N=50)

A ) ns B -2 -2 -2 -2 -2 -2 -2 -2

0 0 a.u. 0 0 0 0 0 0

(

au mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high expression (N=50)

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

1.25 (a.u.) expression mRNA

0 0 0 0 ( 0 0 0 0

** mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) 2 2 2 2 2 mRNAexpession (au) 2 2 2 2 2 2 2 2-4 -42 -422 -42 -4 -4 -4 -4 1.00 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 ns ns ns ns -2 -2 -2 -2 ns ns ns ns 0 0 4 4 *** ***0 0 4 SVIP low4 SVIP*** low *** SVIP lowSVIP low 0 0 4 4 *** ***0 0 4 SVIP low4 SVIP*** low *** SVIP low SVIP low

SVIP high0.75SVIP high 4 4 40 4 SVIP highSVIP high SVIP high SVIP high 4 4 4 4 SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 0 0 0 0 MethylatedMethylated -GLUT1 0 Methylated0Methylated 0 0 MethylatedMethylated (a.u.) expression mRNA MethylatedMethylated

UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4

expression expression 0.50 -2 -2 -2 -2 2 2 2 2 -2 -2 -2 -2 2 2 2 2 2 2 2 2 ns ns -2 2 2 2 2 -2 -2 ns ns -2 -2 ** ** -24 -24 -24 -24 *** *** 4 4 ** ** 4 4 *** *** 4 4 4 4 *** *** 4 4 4 4 ***SVIP lowSVIP*** low SVIP lowSVIP low SVIP low SVIP low SVIP low SVIP low

0.25 (au) mRNA GLUT1

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

MethylatedMethylated -ACTB MethylatedMethylated MethylatedMethylated MethylatedMethylated GLUT1 GLUT1

-4 -4 -4 -4 mRNA -4 -4 -4 -4 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 0 0 0 0 0.00 0 0 0 0 2 2 2 2 -4 2 2 2 2 2 2 2 2 SIRT1 2 2 2 2 SVIP lowSVIP low SVIP low SVIP low SVIP lowSVIP lowSVIP highSVIP high SVIP highSVIP high -2 -2 ns ns -2 SVIP low-2 SVIPns SVIPlow highnsSVIP high SVIP high SVIP high -2 -2 ns ns -2 -2 ns ns MethylatedMethylated MethylatedMethylated4 4 *** *** 4 4 *** *** Methylated4 4Methylated 4 4 MethylatedMethylated4 4 *** *** 4 4 *** *** 4 4 4 4

UnmethylatedUnmethylated 0 0 -2UnmethylatedUnmethylated-2 0 0 -2 -2 UnmethylatedUnmethylated 0 0 -2Unmethylated-2Unmethylated 0 0 -2 -2

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

0 0 0 0 (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

0 0 0 0 (a.u.) expression mRNA

mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) -4 -4 -4 -4 mRNAexpession (au) -4 -4 -4 -4 2 2 2 2 2 2 2 2 ns ns -2 -2 2 2 -2 -2 2 2 ns ns -2 -2 2 2 -2 -2 2 2 4 4 4 4 *** *** 4 4 4 ** 4 ** *** ***4 4 4 *** 4 *** *** *** 44 44 *** *** 44 4 4 ****** ****** 4 4 4 ** 4 ***** ***4 4 4 *** 4 ****** *** 4 4 *** *** 4 4 *** *** -2 -2 -2 -2 -2 -2 -2 -2

SVIP low SVIPSVIP low high SVIP high SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA C SVIP highSVIP high SVIP high SVIP high Methylated Methylated 0Methylated0 Methylated 0 0 MethylatedMethylated 0Methylated0Methylated 0 0 -4 -4 0 0 UnmethylatedUnmethylated-4 -4 0 0 -4 -4 0 0 -4 -4 0 0 2 2 2 2 2 2 UnmethylatedUnmethylated 2 2 2 SVIP2 methylatedUnmethylated (N=61)Unmethylated2 2 SVIP low expression (N=50) 2SVIP methylated2 UnmethylatedUnmethylated (N=190) 2 SVIP2 low expression (N=116) 2 2 2 2 2 2 2 2 2 2 2 2 2 ns 2 ns ns ns 2 ns 2 ns ns ns 4 4 *** *** 4 4 *** *** 4 4 4 4 4-2 -24 *** *** -24 -24 *** *** 4 SVIP4 unmethylated (N=138)4 4 SVIP high expression (N=50) -2SVIP unmethylated-2 (N=274) -2 SVIP-2 high expression (N=116) SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIPSVIP low high SVIP high 0 0 -2 -2 0 0 -2 SVIP high-2 SVIP high SVIP highSVIP high 0 0 -2 -2 0 0 -2 SVIP high-2 SVIP high

Methylated Methylated Methylated Methylated 0Methylated0Methylated 0 0 SVIP methylated (N=61) MethylatedMethylated 0 0 0 0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP low expression (N=50) SVIP methylated (N=190) SVIP low expression (N=116)

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA 0 0 0 0 0 0 (a.u.) expression mRNA

UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 UCP2 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 HK1

HK1 -4 2 2 2 2 UCP2 -4 -4 -4 2 2 2 2 -4 -4 -4 -4 2 2 2 2 0 0 2 2 2 2SVIP unmethylated (N=138) SVIP0 high expression0 (N=50) SVIP unmethylated (N=274) SVIP high expression (N=116) -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 4 4 *** ***0 0 -24 SVIP-2 low4 *** *** -24 -2 4 *** *** 4 4 *** *** 0 0 -2 -2 *** ***

0 0 SVIP lowSVIP highSVIP high SVIP lowSVIP lowSVIP high 0 0 4 4 *** *** 4 SVIP low4 SVIP*** low *** 4 4 4 SVIP low4 SVIP*** low ***

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

0 0 0 0 MethylatedMethylated 0 Methylated0Methylated 0 0 (a.u.) expression mRNA MethylatedMethylated mRNAexpession (au)

mRNAexpession (au) MethylatedMethylated

mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) -4 -4 -4 -4 mRNAexpession (au) -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -2 -2 UnmethylatedUnmethylated UnmethylatedUnmethylated -2 -2 UnmethylatedUnmethylated UnmethylatedUnmethylated -2 -2 -2 -2 2 2 2 2 -2 -2 -2 -2 2 2 2 2 2 2 2 2 -2 -2 -2 -2 2 ns 2 ns ns ns -2 -2 -2 -2 ns ns ns ns 4 4 *** *** 4 SVIP low4 SVIP*** low *** SVIP lowSVIP low 4 4 *** *** 4 SVIPSVIP low low4SVIPSVIP low*** low *** 2 2 SVIP low SVIP low SVIP low SVIP low

SVIP highSVIP high 4 4 4 4 SVIPSVIP lowhighSVIPSVIP low highSVIP highSVIP high Cell lines SVIPSVIP high highSVIPSVIP high high 4 4 TCGA4 samples4 SVIPSVIP low highSVIPSVIP SVIPlow high high SVIP high SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA MethylatedMethylated MethylatedMethylatedMethylatedMethylated MethylatedMethylatedMethylatedMethylated (a.u.) expression mRNA MethylatedMethylatedMethylatedMethylated MethylatedMethylated 0 0 UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylatedUnmethylatedUnmethylated-4 -4 0 0 UnmethylatedUnmethylatedUnmethylatedUnmethylated Transform of Ca-SKI Mitotracker-4 -4 UnmethylatedUnmethylatedUnmethylatedUnmethylated-4 -4 0 0 UnmethylatedUnmethylated 0 0

0 0 0 0

2 2 2.02 2 2.5 175 2 2 2 2

0 0 1 2 2 2 2 1 2 2E * 2 2 200

D -

- *** 0 0

-2 -2 -2 -2 ) SVIP lowSVIP low SVIP lowSVIP low SVIP low) SVIP low * SVIP low SVIP low SVIP highSVIP high 4 *** *** *4 SVIP highSVIP high*** *** 4 150*** *** 4 175 ***SVIP high***SVIP high SVIP high SVIP high -2 -2 *** *** -2 -2

MethylatedMethylated MethylatedMethylated 4 -2 4-2 Methylated4Methylated 4 MethylatedMethylated4 4 *** *** 4 4 *** *** 4 4 4 4 *** *** au 2.0 au

UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 -2 -2

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 1.5 150 mRNA expression (a.u.) expression mRNA

0 0 (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 0 0 (a.u.) expression mRNA -2 -2 -40 0-4 125 -40 -40

SIRT1 -2 -2 -4 -4 -4 -4

2 2 2 2 125 2 2 2 2 MFI ( MFI

2 2 1.5 100 ( MFI 2 2

-2 -2 2 ns 2 ns -2 -2 ns ns -2 -2 2 ns 2 ns -2 -2 ns ns 4 4 *** *** 4 4 *** *** 4 4 1.04 4 4 4 *** *** 4 4100 *** *** 4 4 4 4 -2 -2 -2 -2 SVIP low SVIP low -2 -2 -2 SVIP low-2 SVIP low

SVIP high SVIP high 75 SVIP high SVIP high SVIP low SVIP low SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 1.0 0Methylated Methylated 0 mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA Methylated Methylated

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 0 0 SVIP highSVIP high SVIP high SVIP high mRNA expression (a.u.) expression mRNA

75 (a.u.) expression mRNA MethylatedMethylated 0Methylated0Methylated 0 0

mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) UnmethylatedUnmethylated 0 mRNAexpession (au) UnmethylatedUnmethylated -4 -4 · µg ATPprotein

-4 -4 · µg ATPprotein 0 -4 -4 -4 -4 0 0

2 2 2 50 UnmethylatedUnmethylated UnmethylatedUnmethylated 2 2 2 2 2 0 0 0.5 2 2 2 2 50 2 2 2 2 *** *** 0.5 0 *** 0 ***

4 4 *** *** 4 4 *** *** 4 4 4 4 *** *** 4-2 -24 ***25 *** -24 -24 25*** *** 4 4 4 4 *** *** -2 -2 -2 -2

Mitotracker (MFI (au)) Mitotracker

Mitotracker

Mitotracker (MFI (au)) Mitotracker nmol SVIP low SVIP low nmol SVIP low SVIP low SVIP low SVIP low SVIP high SVIP high -2 SVIP high-2 SVIP high SVIP highSVIP high SVIP low SVIP-2 lowSVIP high-2 SVIP high

Methylated Methylated 0Methylated0 Methylated 0 0 MethylatedMethylated 0Methylated0Methylated 0 0

mRNA expression (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 0

mRNA expression (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 0.0 0 mRNA expression (a.u.) expression mRNA

0.0 (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 0 0 UnmethylatedUnmethylated 0 0 0 0 0 0 (a.u.) expression mRNA 2 2 -2Unmethylated-2Unmethylated 2 2 -4 -4 UnmethylatedUnmethylated -4 -4 2 2 UnmethylatedUnmethylated 2 2 2 2 2 2 -2 -2 -4 -4 -4 -4 2 2 2 2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 0 0 0 0 SVIP low -2 -2 BHY EV -2 SVIP low-2SVIPCa-Ski low EV 0 0 0 0

SVIP lowSVIP highSVIP high BHY SVIP SVIP highSVIP high SVIP low SVIP low SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high SVIP high SVIP high

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA Methylated Methylated mRNA expression (a.u.) expression mRNA Methylated Methylated Ca-Ski SVIP (a.u.) expression mRNA 0 0 UCP2 0 0 MethylatedMethylated MethylatedMethylated -4 -4 Unmethylated-4 -4 Unmethylated 0 0 Unmethylated 0 0 Unmethylated -4 -4 UnmethylatedUnmethylated-4 -4 UnmethylatedUnmethylated Supplemental Figure-2 -25. Metabolic consequences-2 -2 of SVIP recovery in BHY and Ca-Ski cancer cell lines. (A) Western blot of GLUT1 in -2empty -2vector and SVIP-restored-2 -2 -2 -2 *** *** -2 -2 4 4 *** *** 4 SVIP low4 SVIP*** low *** 4 4 4 SVIP low4SVIP ***low *** *** *** *** ***

SVIPBHY high SVIPand high Ca-Ski cell lines. (B) SVIP mRNA expressionSVIP significantly highSVIP high anticorrelates with4 GLUT4 1*** mRNA*** expression4 SVIP in low4 HNC,SVIP*** lowSVIP esophagus, high***SVIP high cervix4 and 4haematological cell 4linesSVIP low4 SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

MethylatedMethylated MethylatedMethylated (a.u.) expression mRNA MethylatedMethylated mRNAexpession (au)

mRNAexpession (au) MethylatedMethylated mRNAexpession (au) -2 -2 -4 -4 -4 -4 mRNAexpession (au) -2 -2 -4 -4 -4 -4 UnmethylatedUnmethylated (N=118). SVIP expression wasUnmethylated consideredUnmethylated low when the when it was lower or equal than the Unmethylatedfirst quartile,Unmethylated while SVIP expression was considered high Unmethylatedwhen Unmethylatedit was equal or 2 2 2 2 2 2 higher than the third quartile. Expression was compared using a two-sided Mann-Whitney test. (C) In silico correlation of the expression of three2 metabolism2 -related proteins2 2 2 2 2 2 SVIP lowSVIP low 2 2 SVIP low SVIP low SVIP lowSVIP lowSVIP(HK highSVIP1 and high UCP2) depending on SVIPCell methylationlines and expressionSVIP highSVIP high status in head and neck, esophagealTCGA, cervix samples andSVIP haematological low SVIP SVIPlow high SVIP cell high lines and in head & neck TCGA cohort. SVIP high SVIP high MethylatedMethylated MethylatedMethylated MethylatedMethylated MethylatedMethylated 0 0 UnmethylatedUnmethylated Samples whose SVIP0 expression0 UnmethylatedUnmethylated was lower than the first quartile were considered “SVIP low”,Unmethylated whereasUnmethylated samples with SVIP expression levels higher0 than0 Unmethylated the thirdUnmethylated quartile 0were 0 0 0 considered “SVIP high”. Two-tailed U-Mann Whitney test was performed to compare mRNA expression between the0 groups0 of cell lines and TCGA samples. (D) ATP production 0 0 in BHY and Ca-Ski cell lines upon SVIP transfection. Data were firstly normalized against0 0 protein amount, and then relativized against EV. Graph is representative of three -2 -2 *** *** -2 -2 *** -2 -2 -2 -2 4 4 *** *** 4 4 ***independent*** experiments4 4. Values are represented4 as4 mean of*** six replicates. Statistical4 differences4 *** have*** been reported4 using4 *** two-sided*** Student’s4 t-test.4 (E) ***Mito Tracker*** median4 4 *** ***

-2 -2 -2 -2

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA fluorescence Intensity-4 (MFI)-4 was determined -4by flow-4 cytometry. Mean SD of representative (a.u.) expression mRNA experiments is shown. (G). *P<0.05,**P<0.01,***P<0.001, ns no significant. -2 -2 -2 -2 -4 -4 -4 -4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 SVIP low SVIP low SVIP low SVIP low SVIP high SVIP high SVIP high SVIP high SVIP low SVIP low Methylated Methylated 0Methylated0 Methylated 0 0 SVIP low SVIP lowSVIP highSVIP high SVIP high SVIP high MethylatedMethylated 0Methylated0Methylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 0 0 -2 -2 -2 -2 -2 -2 -2 -2

-2 -2 -2 -2

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA -2 -2 -4 -4 -4 -4 -2 -2 -4 -4 -4 -4

SVIP low SVIP low SVIP lowSVIP low SVIP low SVIP low SVIP highSVIP high SVIP highSVIP high SVIP low SVIP lowSVIP high SVIP high SVIP high SVIP high MethylatedMethylated MethylatedMethylated MethylatedMethylated MethylatedMethylated UnmethylatedUnmethylated UnmethylatedUnmethylated UnmethylatedUnmethylated UnmethylatedUnmethylated ns ns ns ns 4 4 4 4 *** *** 4 4 ** ** 4 4 *** *** 4 4 4 4 *** *** 4 4 ** ** 4 4 *** ***

2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

-2 -2 -2 -2 -2 -2 -2 -2 ns ns -2 -2 ns ns -2 -2 ** **

-24 -2 4 4 4 *** *** 4 4 ** ** 4 4 *** *** -24 -24 4 4 *** *** 4 4 4 4 *** ***

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA -4 -4 -4 -4 -4 -4 -4 -4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 SVIP lowSVIP low SVIP low SVIP low SVIP lowSVIP lowSVIP highSVIP high SVIP highSVIP high SVIP low SVIP SVIPlow high SVIP high SVIP high SVIP high MethylatedMethylated MethylatedMethylated MethylatedMethylated MethylatedMethylated 0 0 0 0 SVIP methylated (N=61) SVIP low expression (N=50) SVIP methylatedUnmethylated (N=190)Unmethylated SVIP low expression (N=116)0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated C 0 0 0 0 0 0 0 0 SVIP unmethylated (N=138) SVIP high expression (N=50) SVIP unmethylatedns (N=274)ns SVIP high expression (N=116)-2 -2 -2 -2 ns ns -2 -2 -2 -2 AMFR 4 4 4 4 *** *** 4 4 ** ** 4 4 *** *** 4 4 4 4 *** *** 4 4 ** ** 4 4 *** *** -2 -2 -2 -2 -2 -2 -2 -2

** 4.0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 4 * (a.u.) expression mRNA 4.0 4 ** *** -4 -4 -4 -4 -4 -4 -4 -4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 ns ns ns ns ns ns ns ns 4 4 *** *** 4 4 *** *** 4 4 4 4 4 4 *** *** 4 4 *** *** 4 4 4 4 2 3.5 SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low 2 3.5 SVIP low SVIPSVIP low high SVIP high SVIP high SVIP high SVIP highSVIP high SVIP high SVIP high Methylated Methylated 0Methylated0 Methylated 0 0 MethylatedMethylated 0Methylated0Methylated 0 0 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated

1 HK1 2 2 2 2 2 2 2 2

ns ns 2 2 2 2 ** ** ns ns 2 2 2 2 ** **

AMFR AMFR 0 AMFR *** *** *** *** *** *** *** *** AMFR 4 4 4 4 4 4 4 4 -2 -2 -2 -24 4 4 4 4 4 4 -2 4 -2 -2 -2 0 3.0 3.0

SVIP methylated (N=61) SVIP low expression (N=50) SVIP methylated (N=190) -2 SVIP-2 low expression (N=116)-2 -2 0 0 0 0 -2 -2 -2 -2 0 0 0 0

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

C -1 0 0 0 0 0 (a.u.) expression mRNA 0 0 0 mRNAexpession (au)

2 2 2 2 2 mRNAexpession (au) 2 2 2 mRNAexpession (au) -2 -4 -4 -4 -4 mRNAexpession (au) -4 -4 -4 -4

mRNA expression (a.u.) expression mRNA 2 2 2 2 2 2 2 2

mRNAexpession (au) mRNAexpession (au) mRNAexpession (au) SVIP high expression (N=50) SVIP unmethylated (N=274) SVIP high expression (N=116)

SVIP unmethylated (N=138) mRNAexpession (au) AMFR -2 DERL3 2.5 2.5 -2 -2 -2 -2 -2 -2 -2 -2 0 0 0 0 ns ns ns ns 0 0 0 0 ns ns ns ns ** -24 -2 4 ***4.0 *** -24 SVIP-2 low4 SVIP*** low 4 *** *** SVIP lowSVIP low -2 -2 *** *** -2 -2 *** *** SVIP low SVIP low

4 ** 4 6 4.0 4 *** SVIP highSVIP high 4 4 4 4 SVIP highSVIP high 4 4 4 SVIP low4 SVIP lowSVIP high SVIP high 4 4 4 4 SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

* 0 0 0 0 0 0 0 (a.u.) expression mRNA 0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 4 ** ** Low SVIP expressionMethylatedMethylated *** MethylatedMethylated MethylatedMethylated (a.u.) expression mRNA MethylatedMethylated UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4 3 4 High SVIP expression -2 -2 3 -2 -2 -2 -2 -2 -2 23 2 2 2 2 2 2 2 ns ns 2 2 2 2 2 2 2 2 2 2 -2 -2 ns ns -2 -2 *** ***3.5 ** ** *** *** -24 -24 -24 -24 *** *** 4 4 ** ** 4 4 *** ***

2 4 43.5 4 4 4 SVIP4 lowSVIP low 4 4 SVIP lowSVIP low SVIP low SVIP low SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 2 SVIP highSVIP high (a.u.) expression mRNA SVIP highSVIP high SVIP high SVIP high SVIP high SVIP high MethylatedMethylated -4 -4 -4 -4 MethylatedMethylated MethylatedMethylated -4 -4 -4 Methylated-4 Methylated 2 UnmethylatedUnmethylated 2 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 1 0 0 0 0

0 2 2 2 2 0 0 20 20 2 2

AMFR AMFR 0 AMFR AMFR 0 2 2 2 2 SVIP methylated (N=61) 2 SVIP low2 expression (N=50) 2 SVIP2 methylated (N=190) SVIP low expression (N=116) SIRT1

C 0 3.0 3.0 SVIP methylated (N=61) SVIP low expression (N=50) SVIP methylated (N=190) SVIP low expression (N=116)

DERL3 DERL3 DERL3 SVIP lowSVIP low SVIP lowSVIP low SVIP low expression SVIP low SVIP low SVIP low SVIP low DERL3 A SVIP highSVIP high 1 -2 SVIP -2highSVIPB high -2 -2 ns ns C SVIP high SVIP high SVIP high SVIP high ns ns SVIP high expression (N=50) SVIP unmethylated1 (N=274) MethylatedSVIPMethylated high expression (N=116) ns ns MethylatedMethylated -2 -2 ns ns -2 -2 SVIP unmethylated (N=138) -2 MethylatedMethylated 4 4 *** *** 4 4 *** *** SVIP unmethylated4 4 (N=138) SVIPSVIP4 high highexpression4Methylated expressionMethylated(N=50) SVIP unmethylated4 (N=274)4 *** ***SVIP high expression4 4 (N=116)*** *** 4 4 4 4 -1 UnmethylatedAMFRUnmethylated -2 -2 0 -2 0 Unmethylated-2 Unmethylated 0 0 UnmethylatedUnmethylated -2 -2 0-2 0-2 UnmethylatedUnmethylated 0 0 -2 (a.u.) expression mRNA

-2

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA 0 0

** 4.0 ) 0 0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

0 0 0 0 4.0 (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA mRNAexpession (au)

4 mRNAexpession (au) mRNAexpession (au) * mRNAexpession (au)

mRNAexpession (au) 4

mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) mRNAexpession (au) DERL3 XBP1 mRNAexpession (au) ** *** XBP1 8 HK1 UCP2 -2 -4 XBP12.5 0 2.5 0 -4 -4 -4 -4 -4 -4 -4 -4 DERL3 3 2 2 2 2 2 2 2 2 a.u. *** *** *** -2 -2 -2 2-2 2 2 2 ns ns -2 -2 -2 -2 ( ns ns 2 2 2 2 *** 4.5 *** 4 *** ** 4.5** *** *** ** ** 4 ** 4 6 2 4 4 ***4 4 4 4 *** ****** *** 4 4 3.5 *** *** 4*** 4 *** *** 4 ***4 *** 4 4 *** ****** *** 4 4 *** *** 4 4 *** *** *** *** *** *** ** -2 -2 2 *** -2 -2 43.5 4 4 4 4 4 6 4 4-2 -2 -2 4-2 4 4 4 4 4 4 4

Low SVIP expression SVIP low SVIP low SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP low SVIP low SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA SVIP high SVIP high SVIP high SVIP high SVIP highSVIP high 1 Methylated Methylated 0Methylated0 Methylated 0 0 MethylatedMethylated 0 0 0 0 SVIP high SVIP high

High SVIP expression 0 -4 0-4 0 -4 -4 -4 -4 -4 Methylated-4 Methylated

AMFR AMFR 4 0 AMFR 0 UnmethylatedUnmethylated 0 0 (N=61) AMFR 2 4.0 3 4.0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 2 3 2 2 3.0 2 2 2 2 2 2 2 2 2 2 2 2 UnmethylatedUnmethylated 2 2 2 2 2 0 2 2 3.0 2 2 4 2 2 2 2 2 2 (N=138) 2 2 ns ns ns ns 2 2 ns ns ns ns 4 4 *** *** 4 4 *** *** 4 4 4 4 -2 -2 4 4 *** *** 4 4 *** *** 4 4 4 4 2 -1 -2 expression -2 -2 -2 -2 -2 -2

mRNA expression (a.u.) expression mRNA SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low mRNAexpession (au) mRNAexpession (au) SVIP high SVIP high mRNAexpession (au) 3.5SVIP high SVIP high 3.5 SVIP high SVIP high SVIP highSVIP high 0 mRNAexpession (au) -2 -2 2 0 -20 -2 0 0 0 0 0 0

0 Methylated Methylated-22 DERL3 2.5 Methylated Methylated2.5 0 0 2 0 0 MethylatedMethylated -2 -2 -2Methylated-2Methylated 0 0 0 0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA 0 0 (a.u.) expression mRNA

0 0 (a.u.) expression mRNA 0 0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated mRNA expression (a.u.) expression mRNA UnmethylatedUnmethylated UnmethylatedUnmethylated (a.u.) expression mRNA

0 0 04 UCP2 0 0

XBP1 XBP1 XBP1

HK1 *** XBP1 0 4 ** 6 4 *** 2 2 2 2 -4 -4 -4 -4 2 2 2 2 -4 -4 2 2 ** 2 Low 2SVIP expression 2 2 2 2 -4 -4

0 0 mRNA 0 0

DERL3 DERL3 DERL3 3.0 DERL3 -2 3.0 1 -2 -2 -2 -2 0 -2 -2 -2 -2 41 High SVIP expression -2 -2 -2 -2 -2 -2 -2 -2 -2 3 3 -2 2 -2 -2 -2 -2 (a.u.) expression mRNA -2 -2 -2 -2 -2 (a.u.) expression mRNA 0 -20 -2 0 0 *** *** *** *** 0-2 0-2 0 0

4 4 *** *** 4 SVIP low4 SVIP*** low *** 4 4 4 SVIP low4SVIP low *** *** SVIP low SVIP*** low *** *** *** *** ***

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP low SVIP low mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA 4 4

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA 4 4 SVIP highSVIP high (a.u.) expression SLC2A1 SVIP high 4 4 4 4

mRNAexpession (au) 2 SVIP high SVIP high SVIP high

mRNAexpession (au)

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNAexpession (au)

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 0 0 mRNAexpession (au) 0 0 0 0 mRNAexpession (au) MethylatedMethylated Methylated 0 0 mRNAexpession (au) Methylated MethylatedMethylated

-2 mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au)

mRNAexpession (au) MethylatedMethylated

2.5 mRNAexpession (au)

mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) -4 2.5 0 XBP1-4 -4 2 -4 -4 mRNAexpession (au) -4 -4 -4 -4 XBP1 0 2 -4 -4 GLUT1 -4 -4 -4 -4 -4 -4 -4 -2 -2 UnmethylatedUnmethylated UnmethylatedUnmethylated -2 -2 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0

4 *** 4 4.5 4.5 -2 -2 -2 -2 2 2 2 2 -2 -2 -2 -2

DERL3 DERL3 DERL3

DERL3 *** *** *** 1 2 1 2 ns ns 2 2 2 2 -2 -2 -2 -2 -2 2 2 TCGA samplesns ns -2 -2 -2 -2 2 2 ns ns ns ns Cell lines 4 4 *** *** 4 SVIP low4 SVIP*** low *** SVIP lowSVIP low 4 4 *** *** 4 SVIP low24 SVIP*** 2low *** SVIP low SVIP low

-2 SVIP highSVIP high 4 SVIP(a.u.) 4expression mRNA lowSVIP low 4 4 SVIP highSVIP highCell lines SVIP lowSVIP low SVIP highTCGASVIP high samples4 SVIP low4 SVIP low 4 4 SVIP high SVIP high SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

MethylatedMethylated MethylatedMethylated SVIP highSVIP high MethylatedSVIPMethylated highSVIP high (a.u.) expression mRNA MethylatedMethylatedSVIP high SVIP high SVIP high SVIP high

mRNAexpession (au) mRNAexpession (au)

mRNAexpession (au) MethylatedMethylated MethylatedMethylated MethylatedMethylated MethylatedMethylated mRNAexpession (au) 0 XBP1 -44.0UnmethylatedXBP1Unmethylated 0 4.0 -4 -4 UnmethylatedUnmethylated -4 -4 0 0 UnmethylatedUnmethylated -4 -4 UnmethylatedUnmethylated -4 -4 2 (N=61) 2 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 (N=138) 4 *** 4 *** 4.5 *** 0 4.5 0 *** 0 0 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 0 0 HNC SVIP exp low 0 0 3.5 HNC SVIP exp high Cervix SVIP exp low 0 (N=61) 3.52 SVIP lowSVIP low4.0SVIP highSVIP high 4.0 SVIP lowSVIP-2 low -2 -2 -2Cervix SVIP exp high SVIP low SVIP SVIPlow high SVIP high SVIP low SVIP low 0 2 MethylatedMethylated D *** *** SVIP highSVIP*** high *** E Methylated***Methylated F -2 -2SVIP high SVIP high -2 -2 (N=138) 4 4 *** Methylated4Methylated4 *** 4 4 4 4 *** 4 4 *** *** Methylated4 Methylated4 *** *** 4 4 *** *** 4 4 *** ***

-2 -2 0 0

XBP1 XBP1 XBP1 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 0 0

XBP1 UnmethylatedUnmethylated EsophagusEsophagus SVIP exp SVIP low exp high -2 -2 UnmethylatedUnmethylated

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

0 0 0 0 (a.u.) 1.0 expression mRNA 0 3.5 3.5 1.0 0 0 0 0

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA 1.0 (a.u.) expression mRNA CCND1

-2 0 3.0 -2 -2 3.0 -4 -4 -4 -4 1.0 CCND1 SIRT1

SVIP high expression (N=99) -2 -2 -4 -4 -4 -4

XBP1 XBP1 XBP1 GLUT1 high -2 XBP1 SVIP high expression2 (N=131) 2 GLUT1 high

2 2 2 2 1.0 2 2 2 2 GLUT1 low expression (N=99) -2 0.8 3.0 (a.u.) expression mRNA -2 -2 3.0 ns0.8 ns -2 -2 ns ns GLUT1 low expression (N=131)-22 -2 2 ns ns -2 -2 ns ns 2 2 0.8 GLUT1 low *

-2 4 4 *** *** 4 4 *** *** 4 4 4 4 4 4 *** *** 4 0.8 24 ***2 *** 4 4GLUT1 low 4 4

mRNAexpession (au)

mRNAexpession (au) mRNAexpession (au) -2 -2 -2 -2 (a.u.) expression mRNA -2 -2 -2 -2

-4 2.5 2.5 **SVIP low SVIP low SVIP low SVIP low ns 0.5 survival

mRNAexpession (au) SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNAexpession (au)

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNAexpession (au) SVIP low SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP low SVIP low

survival mRNA expression (a.u.) expression mRNA 0.6 Methylated Methylated 2.5 0.6 0Methylated Methylated** 0 (a.u.) expression mRNA -4 2.5 0 0.6 0 0.6 SVIP highSVIP high 0 0 0 0 SVIP high SVIP high

mRNAexpession (au) ns

mRNAexpession (au) mRNAexpession (au) -4 -4 -4 -4 mRNAexpession (au) MethylatedMethylated MethylatedMethylated UnmethylatedUnmethylated 0 0 survival UnmethylatedUnmethylated -4 -4 -4 -4 0 0 0.0

SVIP low expression2 (N=99)2 2 2 GLUT1 high expression (N=99) survival UnmethylatedUnmethylated UnmethylatedUnmethylated free free SVIP low expression (N=131) 2 2 2 2 2 2 2 2 0 free 2 2 2 2 TCGA samples0.4 0 0.4 0 GLUT10 high expression (N=131) Cell lines Cell lines TCGA samples *** *** 0.4 0.4 *** *** 4 4 *** *** 4 4 *** *** 4 4 4 4 -2 *** -2 *** -2 -24 4 *** *** 4 4 *** *** 4 4 -0.5 4 -2 4 -2*** *** -2 -2 SVIP low SVIP low SVIP low SVIP low SVIP low SVIP low SVIP high SVIP high Overall SVIP low SVIP low Methylated Methylated 0 -2 -2 0 0 SVIP high SVIP high SVIP highSVIP high SVIP high SVIP high 0.2 Methylated0 Methylated0.2 0.2 MethylatedMethylated Overall 0-2Methylated-20Methylated 0 0 Fraction survival Fraction 0.2 -1.0

Log Rank p-value=0.0046 Log Rank p-value=0.0077 survival Fraction

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA Disease

0 (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

0 0 UnmethylatedUnmethylated 0 (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA

0 0 (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA UnmethylatedUnmethylated Log Rank0 p-value0 =0.8193UnmethylatedUnmethylated Log (a.u.) expression mRNA Rank p-value=0.054 HR(95%-2 -2 CI) = 2.006 (1.2392-3.247)2 HR(95% CI)2 = 1.6782 (1.147-4 --42.455) Disease -4 -4 2 2 UnmethylatedUnmethylated 2 2 2 2 HR(95% CI) = 1.058(0.651-1722) 2 -2HR(95%2 -2 CI) = 1.461(0.994-2.146) -1.5 -4 -4 -4 -4 2 2 0.0 0.0 0.0 2 2 0.0 -2 -2 -2 -2 -2 -2 (a.u.) expression mRNA -2 -2 0 1 2 3 4 5 0 1 2 3 4 5 0 0 (au) expession mRNA 12 24 36 48 60 72 24 48 72 96 120 144 168 192 216 -2.0 -2 -2 -2 -2 0 0 0 0 -2 -2 -2 -2 0 0 0 0

Years since diagnosis SVIP low SVIP low Years since diagnosis SVIP lowTimeTimeSVIP low(months) (months) Time (months) mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP low SVIP low mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high Time (months) SVIP low SVIP low

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high mRNA expression (a.u.) expression mRNA mRNA expression (a.u.) expression mRNA SVIP high SVIP high 0 0 MethylatedMethylated UCP2 MethylatedMethylated 0 0 SVIP high SVIP high -4 -4 -4 -4 MethylatedMethylated -4 -4 -4 Methylated-4 Methylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated -2 -2 -2 -2 -2 -2 -2 -2 -2 -2 *** *** -2 -2 4 4 *** *** 4 SVIP low4 SVIP*** lowSupplemental*** figure4 6. SVIP4 epigenetically-deficient4 SVIP low4SVIP head ***low & neck*** TCGA tumors recapitulate the phenotype observed in SVIP-recovered cell lines. (A) ***In silico*** correlation of *** ***

SVIP highSVIP high SVIP highSVIP high 4 4 *** *** 4 SVIP low4 SVIP*** lowSVIP high***SVIP high 4 4 4 SVIP low4 SVIP low

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA SVIP high SVIP high

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

MethylatedMethylated MethylatedMethylated (a.u.) expression mRNA MethylatedMethylated mRNAexpession (au)

mRNAexpession (au) MethylatedMethylated mRNAexpession (au) the expression of XBP-4 1 and-4 DERL3 depending-4 on SVIP-4 expression status in head & mRNAneckexpession (au) TCGA cohort. (B) GLUT1 expression analysis in head and-4 neck-4, esophageal and cervical-4 -4 -2 -2 UnmethylatedUnmethylated UnmethylatedUnmethylated -2 -2 UnmethylatedUnmethylated UnmethylatedUnmethylated TCGA samples. (B) 2GLUT12 expression analysis2 in head2 and neck, esophageal and cervical TCGA samples depending on SVIP expression levels. (C) In silico correlation of the 2 2 2 2 2 2 2 2 expression of HK1 and UCP2 depending on SVIP expression status in head & neck TCGA cohort. (D) Kaplan Meier 2analysis2 of disease free survival (left) and overall survival (right) SVIP lowSVIP low 2 2 SVIP low SVIP low SVIP lowSVIP lowSVIP highSVIP high Cell lines SVIP highSVIP high TCGA samplesSVIP low SVIP SVIPlow high SVIP high SVIP high SVIP high MethylatedMethylated considering SVIP expressionMethylatedMethylated in head and neck primary tumors of the TCGA data set. P- Methylatedvalue correspondsMethylated to log rank test. Results of univariate CoxMethylated regressionMethylated analysis are shown 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 0 0 by hazard ratio (HR) and 95% confidence interval (CI). (E) Kaplan Meier analysis of disease free survival (left) and overall survival (right) considering GLUT1 expression in head and neck primary tumors of the TCGA data set. P- value corresponds to log rank test. Results of univariate Cox regression0 analysis0 are shown by hazard ratio (HR) and 95% confidence 0 0 0 0 interval (CI). (F) In silico-2 correlation-2 *** of the expression-2 -2of CCND1 depending on SVIP expression status in head & neck TCGA cohort. Samples in all-2 panels-2 were divided in quartiles-2 -2 4 4 *** *** 4 4 *** *** 4 4 *** 4 4 *** *** 4 4 *** *** 4 4 *** *** 4 4 *** *** 4 4 *** ***

-2 -2 according to SVIP or GLUT1 expression. Samples whose SVIP/GLUT1 expression was lower than the first quartile -2were -2considered “low”, whereas samples with expression levels

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA higher than the third-4 quartile-4 were considered “-4high. Two-4 -tailed U-Mann Whitney test (a.u.) expression mRNA was performed to compare gene expression between the studied groups of cell lines and TCGA -2 -2 -2 -2 -4 -4 -4 -4 2 2 2 2 2 2 2 2 2 2 samples. *P<0.05,**P<0.01,***P<0.001, ns no significant. 2 2 2 2 2 2 SVIP low SVIP low SVIP low SVIP low SVIP high SVIP high SVIP high SVIP high SVIP low SVIP low Methylated Methylated 0Methylated0 Methylated 0 0 SVIP low SVIP lowSVIP highSVIP high SVIP high SVIP high MethylatedMethylated 0Methylated0Methylated 0 0 UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated UnmethylatedUnmethylated 0 0 UnmethylatedUnmethylated 0 0 0 0 -2 -2 -2 -2 -2 -2 -2 -2

-2 -2 -2 -2

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA

mRNA expression (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA (a.u.) expression mRNA -2 -2 -4 -4 -4 -4 -2 -2 -4 -4 -4 -4

SVIP low SVIP low SVIP lowSVIP low SVIP low SVIP low SVIP highSVIP high SVIP highSVIP high SVIP low SVIP lowSVIP high SVIP high SVIP high SVIP high MethylatedMethylated MethylatedMethylated MethylatedMethylated MethylatedMethylated UnmethylatedUnmethylated UnmethylatedUnmethylated UnmethylatedUnmethylated UnmethylatedUnmethylated Supplementary Table 1: List of differentially expressed proteins represented for at least two peptides in SILAC analysis upon SVIP transfection in BB30-HNC cells.

A. Upregulated upon SVIP overexpression

ID Gene Fold change p-value FXR1 32.1428571 0.0299974 DHCR7 15.1020408 1.6286E-05 RTCA 12.8333333 0.04864284 VIM 10.617284 0.04760836 CNN3 10.1557632 0.02364341 HMGCS1 8.80090498 0.003165 LPCAT1 7.62942779 0.04977868 COPS8 7.34375 0.04210733 AP3S1 7.26744186 0.0199053 ABCD3 6.91333982 0.03893685 SLC25A24 6.82983683 0.04516253 CAT 5.85714286 0.00127963 PAIP1 5.55555556 0.0228933 VAT1 5.52857143 0.00319767 DNM2 5.37634409 0.04575119 IDH1 5.20661157 0.03582669 ITGA2 5.10416667 0.04200355 TARS 5.03846154 0.04664995 CTTN 4.95495495 0.02048994 ACAT2 4.60063898 0.00282376 RBM12 4.57142857 0.00441503 EIF2AK2 4.50980392 0.04177745 ERAP1 4.48514851 0.04793058 DCDC5 4.47368421 0.01507317 OSBP 4.44444444 0.01913367 S100A13 4.41176471 0.04020444 PPP2R2A 4.375 0.00362953 TKT 4.21232877 0.01032101 DDAH1 4.20588235 0.02980616 CYB5A 4.12612613 0.02691284 CUL4B 4.07619048 0.03584337 GDI1 3.93364929 0.02618891 PRKCDBP 3.92215569 0.01801815 PGM1 3.84615385 0.02005603 BASP1 3.70588235 0.00228101 SUB1 3.66666667 0.01454491 RRM2 3.6 0.00576178 G6PD 3.47692308 0.01762289 DTD1 3.4502924 0.03773559 MCTS1 3.4351145 0.0028799 ID Gene Fold change p-value OGFR 3.42857143 0.04988295 PDIA6 3.41463415 0.01552488 KRT8 3.36585366 0.03671742 SUCLG2 3.34650856 0.01987182 GNAS 3.34117647 0.01566528 AKR1C1 3.32653061 0.04096684 RAB10 3.27058824 0.04417397 MTHFD1 3.25203252 0.01294349 RNPS1 3.24817518 0.03883771 ADIRF 3.22988506 0.01315107 GNB2 3.2183908 0.00195006 APEX1 3.2173913 0.01636789 NDUFB11 3.20512821 0.01195103 DENR 3.18181818 0.006425 PDPN 3.16363636 0.03425198 HADHB 3.08457711 0.04654997 UGDH 3.03478261 0.01298571 NUDT5 3.02325581 0.00117976 PSMF1 2.97752809 0.00378019 SLC25A5 2.96482412 0.01368587 MVP 2.92517007 0.03508987 GNAI2 2.92307692 0.00454258 APP 2.91727141 0.01900122 CORO1C 2.87096774 0.01134609 AKR1B1 2.85714286 0.03850582 LTA4H 2.84415584 0.03016842 PAFAH1B3 2.77966102 0.0310627 ACSL3 2.76960784 0.02925421 VCL 2.75630252 0.04905471 S100A6 2.7480916 0.00856122 SLC25A22 2.73737374 0.0198122 PGK1 2.72857143 0.04693298 CD82 2.72821577 0.0367791 MARS 2.7027027 0.0370125 HIBADH 2.68421053 0.00494985 MT-CO2 2.67409471 0.04651879 DDX1 2.62626263 0.03135003 ERP29 2.62365591 0.03317915 MAPRE1 2.59722222 0.00459747 APEH 2.5748503 0.00782955 AIFM1 2.57425743 0.02232868 KIF5B 2.5462963 0.02511471 NUMA1 2.5 0.02771502 PFKFB2 2.48863636 0.0479245 ECI1 2.47191011 0.01217441 ID Gene Fold change p-value PREP 2.46808511 4.0259E-05 RALY 2.46153846 0.03930777 MBOAT7 2.45901639 0.039528 YBX3 2.42105263 0.02324571 PRDX5 2.4137931 0.00031503 GSTO1 2.36538462 0.04432432 CLNS1A 2.35443038 0.04334824 HADHA 2.32365145 0.00628803 SRI 2.31944444 0.01029654 ARHGAP1 2.31428571 0.00012989 TM9SF4 2.29885057 0.04998547 AARS 2.29032258 0.0073872 APMAP 2.28571429 0.00265961 RAB6C 2.25663717 0.04348661 ARPC2 2.24489796 0.03437383 RBBP4 2.17898833 0.04339225 TSPO 2.17333333 0.03546801 CLIC4 2.1541502 0.0188887 SARS 2.15 0.03363727 PRDX6 2.12765957 0.03805794 NUDT21 2.10918114 0.04786461 PKP1 2.09146341 0.03078166 RAVER1 2.06293706 0.04912038 CDC37 2.05555556 0.03594591 EIF1 2.05417607 0.02626985

B. Downregulated upon SVIP overexpression

ID Gene Fold change p-value SIX5 0.02891892 0.02429929 TYMP 0.03857143 0.01735944 GSTP1 0.0401626 0.04078133 HSPB1 0.04258065 0.01581999 HLA-C 0.05031447 0.04112482 HLA-B 0.26961326 0.02763397 BICD2 0.27108434 0.00847096 ETFA 0.34016393 0.04288903 ETFB 0.35632184 0.00542287 APRT 0.36363636 0.04489244 ARPC5L 0.37623762 0.04469599 CLTB 0.38888889 0.04566731 PC 0.41958763 0.04420214 SLC2A1 0.46545455 0.0214964

Supplementary Table 2: Association between clinicopathological characteristics and SVIP methylation status in the TCGA head & neck squamous cell carcinoma cohort.

SVIP methylation status CHARACTERISTICS Unmethylated Methylated P* N (%) N (%) N (%)

Age (years)

< 50 48 (17%) 32 (67%) 16 (33%) 0.264 > 50 234 (83%) 135 (58%) 99 (42%) Gender

Male 200 (71%) 130 (65%) 70 (35%) 0.003** Female 82 (29%) 37 (45%) 45 (55%) Disease stage at diagnosis

I 11 (4%) 7 (64%) 4 (36%) 0.207 II 55 (19%) 27 (49%) 28 (51%) III 67 (24%) 37 (55%) 30 (45%) IV 136 (48%) 88 (65%) 48 (35%) Unknown 13 (5%) 8 (62%) 5 (38%) Tumor site

Oral cavity 104 (37%) 41 (39%) 63 (61%) <0.001*** Tongue 92 (33%) 55 (60%) 37 (40%) Tonsil 16 (6%) 15 (94%) 1 (6%) Pharynx 10 (4%) 9 (90%) 1 (10%) Larynx 59 (21%) 47 (80%) 12 (20%) Unknown 1 (1%) 0 (0%) 1 (100%) Smoking habit

Current / Former smoker 15 (5%) 7 (47%) 8 (53%) 0.287 Never smoker 185 (66%) 109 (59%) 76 (41%) Unknown 82 (29%) 51 (62%) 31 (38%) Drinking habits

Yes 177 (63%) 114 (64%) 63 (36%) 0.031* No 100 (35%) 51 (51%) 49 (49%) Unknown 5 (2%) 2 (40%) 3 (60%) HPV status

Negative 49 (17%) 37 (75%) 12 (25%) 0.358 Positive 23 (8%) 20 (87%) 3 (13%) Unknown 210 (75%) 110 (52%) 100 (48%) Treatment strategy

Surgery 94 (34%) 55 (58%) 39 (42%) 0.096 Chemotherapy 40 (14%) 31 (12%) 9 (23%) Radiotherapy 32 (11%) 22 (69%) 10 (31%) Unknown 116 (41%) 59 (51%) 57 (49%) Treatment outcome

Complete remission/Response 171 (61%) 108 (63%) 63 (37%) 0.650 Stable disease 7 (2%) 5 (71%) 2 (29%) Progressive disease 44 (16%) 25 (57%) 19 (43%) Unknown 60 (21%) 29 (48%) 31 (52%) Survival status

Alive 200 (71%) 127 (63%) 73 (37%) 0.024* Dead 82 (29%) 40 (49%) 42 (51%)

*P-value represents Fisher's exact test or Chi-square function whenever required: statistical significance under 0.05*, 0.01** and 0.001***

KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SVIP SIGMA HPA039807 phospho-IRE1α (Ser724) Thermofisher PA1-16927 p21 CST 2947 eIF2α CST 5324 phospho-eIF2α (Ser51) CST 3398 SEL1L Abcam Ab78298 SYVN1 (Hrd1) CST 14773 IRE1α CST 14C10 PERK CST D11A8 ERO1-Lα CST #3264 PDI CST C81H6 BECLIN1 CST D40C5 p62/SQTM CST #5114 LC3BI/II CST D3U4C PARP BD Pharmingen 556362 Caspase 3 SCBT H-277 HM13 Abcam ab190253 REEP5 SIGMA HPA003895 CD82 Abcam ab66400 NSDHL Abcam ab190353 SLC25A5 CST #14671 SUCLG2 Abcam ab96172 NDUFB8 (CI) Abcam ab110411 MTCO2 (CIV) Abcam ab110411 SLC2A1 CST D3J3A αTubulin-HRP Abcam 40742 LMNB1 Abcam ab16048 ACTB -HRP SIGMA A3854 Anti-rabbit HRP SIGMA A0545 Anti-mouse HRP GE HEALTHCARE NA9310 Bacterial and Virus Strains E. coli DH5α Thermofisher 18265017 Lentivirus produced with PsPPAX and PDM2 plasmids - - Chemicals, Peptides, and Recombinant Proteins 5’-azacytidine SIGMA A2385 Sulforhodamine B SIGMA S1402 Polyethylene glycol 300 SIGMA 90878-1L NMP SIGMA 494496-1L GoScript Promega A5001 Sybr green Thermofisher 4312704 jetPrime polyplus Polyplus Ref114 Bortezomib LC laboratories B-1408 Eeyarestatin I SIGMA E1286 17-AAG SIGMA A8476 IPI-504 Medchem HY-10210 Thapsigargin SIGMA T9033 SILAC-Lys8-Arg10-Kit media SILANTES 282986444 Bay-876 Sigma SML1774 NMS-873 MedChemExpress HY-15713 Oligomycin SIGMA 75351 FCCP SIGMA C2920 Rotenone A SIGMA R8875 Antimycin A SIGMA A8674 Hydrazine Sigma 53847 NAD+ Roche - Sigma 10127990001 LDH Roche - Sigma 10107085001 dATP NEBiolabs N0440S Mito Tracker Thermofisher M22426 MitoSox Thermofisher M36008 13 U- C6 labeled glucose Sigma 389374 Critical Commercial Assays EZ-DNA methylation Gold Kit Zimo research D5006 Nucleospin Gel and PCR Clean-up Machery Nagel 740609.250 Nucleospin 96 plasmid Machery Nagel 740625.24 Maxwell RSC simply RNA tissue Promega AS1340 Seahorse XF24 plates Agilent 100777-004 DC protein assay BioRad 5000116 Cell titer Glo Promega G7571 Glucose HK CP ABX diagnostics A11A01667 Experimental Models: Cell Lines BB30-HNC Sanger CVCL_1076 BHY DSMZ CVCL_1086 Ca9-22 Sanger CVCL_1102 LB-771 Sanger CVCL_1369 Ca-Ski ATCC CVCL_1100 HeLa ATCC CVCL_0030 SW756 ATCC CVCL_1727 COLO-680N DSMZ CVCL_1131 KYSE-180 DSMZ CVCL_1349 OACM 5.1 C SIGMA 11012006 HEK-293T ATCC CVCL_0063 Experimental Models: Organisms/Strains NU/NU Nude Mice INVIGO Oligonucleotides BS SVIP F TTTTTTGGAATTTAGGTTTTGG This paper BS SVIP R AAAAACACAACCCCATAAAAC This paper Cloning SVIP S This paper AAAAAAAAGAATTCGCCGCCACCATGGGGCTGTGTT TTCCTTGTCCCGGGGAGTCCGCGCCTC Cloning SVIP AS This paper AAAAAAAAGGATCCTTACTTATCGTCGTCATCCTTGT AATCGCCGGAGCCTGAAACTGTCCACCTAAGTCCA CCTTCTGGTGGGGGCCCGGATGTAGCAA sh1_SVIP S This paper gatccGACTTAGGTGGACAGTTTCTTCAAGAGAGAAA CTGTCCACCTAAGTCTTTTTTACGCGTg sh1_SVIP AS This paper aattcACGCGTAAAAAAGACTTAGGTGGACAGTTTCTC TCTTGAAGAAACTGTCCACCTAAGTCg sh4_SVIP S This paper gatccGGCTAGACTTTTCATTAAATTCAAGAGATTTAA TGAAAAGTCTAGCCTTTTTTACGCGTg sh4_SVIP AS This paper aattcACGCGTAAAAAAGGCTAGACTTTTCATTAAATC TCTTGAATTTAATGAAAAGTCTAGCCg Scr_SVIP S PMID: 28881673 gatccGCGCAGAACAAATTCGTCCATTCAAGAGATGG ACGAATTTGTTCTGCGTTTTTTACGCGTg Scr_SVIP AS PMID: 28881673 aattcACGCGTAAAAAACGCAGAACAAATTCGTCCATC TCTTGAATGGACGAATTTGTTCTGCGCg q SVIP F AAAGAGCAAAGCTTGCAGAG This paper q SVIP R GAAACTGTCCACCTAAGTCCAC This paper q GAPDH F TGCACCACCAACTGCTTAGC This paper q GAPDH R GGCATGGACTGTGGTCATGAG This paper qSLC25A5 F CTACAAATCTGATGGATTAAGGG This paper qSLC25A5 R ATGATGTCAGTTCCTTTGCG This paper qSUCLG2 F CTGATCCTAAGGTTGAAGCCA This paper qSUCLG2 R CGCTGTTGTTGAGTATCTTCTG This paper qNDUFB8 F CCCTATCCTAGGACCCCAGA This paper qNDUFB8 R TCCACACGGTTCCTGTTGTA This paper qMT-CO2 F TTCATGATCACGCCCTCATA This paper qMT-CO2 R TAAAGGATGCGTAGGGATGG This paper qHM13 F CAGACATGCCTGAAACAATCA This paper qHM13 R GATTCCCAGCACGAAGAAAT This paper qREEP5 F CTTCATCGCTCTTGGTGTCA This paper qREEP5 R GGTCAGCCACTGGGTATCAT This paper qCD82 F TGAGGACTGGCCTGTGTACC This paper qCD82 R TTGGGACCTTGCTGTAGTC This paper qNSDHL F GACCTTCCCTATGCCATGAA This paper qNSDHL R CCAAGTTCTTCCCATTTCCA This paper qSLC2A1 F CATCAACGCTGTCTTCTATTACTC This paper qSLC2A1 R ATGCTCAGATAGGACATCCA This paper Recombinant DNA PsPax2 Addgene 12260 PDM2.G Addgene 12259 pLVX-Ires-ZSgreen1 Clonetech 632187 pLVX-shRNA2 Clonetech 632179 Software and Algorithms cgds-R package The R project Bioedit Bio-Soft SPSS IBM GraphPad Prism 5 GraphPad Software, Inc Methyl Primer Express v1.0 Applied Biosystems Primer3 Source Forge UCSC genome browser UCSC