DOCSLIB.ORG

What's Hot About Otoferlin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
What's Hot About Otoferlin Published online: November 7, 2016 News & Views What’s hot about otoferlin Karen B Avraham Mutations in the otoferlin (OTOF) gene problems worsen upon exposure to heat, otoferlin itself had not been characterized, lead to profound hearing loss in humans. such as a fever. other than by finding sequence homologies Interestingly, a number of missense Otoferlin is a member of the FER-1 family with the spermatogenesis factor FER-1 in otoferlin mutations cause hearing defects of transmembrane proteins distinguished by C. elegans. Eventually, a nonsense mutation but only at higher body temperature, and C2 domains that are also found in synapto- was identified in several families. Subse- the reasons for this have been elusive tagmin, PKC, and PLC isoforms. It binds quent genomic analysis led to the discovery until now. A study published in this issue calcium and membranes and triggers the of both long and short isoforms of OTOF of The EMBO Journal (Strenzke et al, 2016) fusion of neurotransmitter-filled vesicles and, based on a new mutation found in a adds insight into the underlying mecha- with the plasma membrane, presumably in southwestern Indian family, the long nisms for this heat-dependent hearing conjunction with a molecular machinery isoform was deemed essential for inner ear loss. that remains elusive (Roux et al, 2006; function (Yasunaga et al, 2000). Johnson & Chapman, 2010). An article in Mutations in OTOF have since been See also: N Strenzke et al (December this issue of The EMBO Journal also reports found to cause profound sensorineural hear- 2016) and C Vogl et al (December 2016) on the mechanism of membrane insertion of ing loss in patients in many parts of the otoferlin and shows that this is mediated via world, including Spain, Columbia, Argen- magine lying in bed with a fever, tossing, the tail-anchored protein insertion pathway tina, and the Middle East (Adato et al, 2000; and turning, trying to find a comfortable TRC40 (Vogl et al, 2016). The primary Rodrı´guez-Ballesteros et al, 2003). More- I position for your aching body. To make otoferlin defect in hearing-impaired persons over, many patients with OTOF mutations matters worse, you are having more trouble affects the inner ear’s hair cells and compro- have auditory neuropathy, a diagnosis based hearing than usual and you fear the effect mises otoferlin’s role in exocytosis of synap- on an abnormal auditory brainstem response will be lasting. Thankfully, when the fever tic vesicles at the auditory inner hair cell (ABR) and impaired speech discrimination, finally subsides, you find that your hearing ribbon synapse (Roux et al, 2006). However, but with initially normal otoacoustic emis- returns, so that the relief you yearned for the connection between deafness and sions, which measures the outer hair cells’ from the aches and pains is even more excessive heat has remained elusive. Now, response to sound (Varga et al, 2003; Fig 1). gratifying. Strenzke and colleagues have helped to First described in 1996 by the scientist (and Hearing is essential for our ability to provide an answer and, furthermore, defined sometimes jazz musician) Charles (Chuck) perceive the outside world, to be warned the molecular basis for differences in hear- Berlin and colleagues as a defect involving of danger, and to communicate with fellow ing sensitivity between humans and mice the auditory portion of the VIII cranial nerve humans. Hearing loss is therefore a crucial (Fig 1; Strenzke et al, 2016). (Starr et al, 1996), it is now defined as an impairment and even more difficult to cope Otoferlin first appeared in 1999, when it auditory synaptopathy. But how do tempera- with if the loss occurs after the acquisition was discovered that mutations of the OTOF ture sensitivity and hearing loss fit into this of hearing and language. It means having gene cause a nonsyndromic form of deafness picture? Two siblings with auditory neuro- to adapt to an entirely new situation and, (Yasunaga et al, 1999). These mutations pathy were reported to have an increase in in many ways, a new life. Such is the case were found in the pre-high-throughput the severity of their hearing loss when they for patients with specific mutations of the sequencing era, based on a genomewide had a fever (Starr et al, 1998). A subsequent OTOF gene. These individuals have normal linkage study using microsatellite markers screen of patients with auditory neuropathy hearing threshold that allows them to hear that led to the identification of a 2-cM inter- several years later led to the identification of sounds well enough to avoid dangerous val on chromosome 2 likely harboring the OTOF mutations, with one specific mutation, situations, but suffer from compromised gene responsible for deafness in affected p.Ile515Thr, associated with a temperature- speech recognition. They can hear a voice, Lebanese families. A contig of various artifi- sensitive hearing phenotype. but often are not able to make out what cial chromosomes revealed a number of The key to discovering the function of the person is saying. Moreover, for a candidate genes, but further analysis was otoferlin in humans eventually came from subset of these patients, their hearing difficult, because the mammalian form of mouse models. Many of the organ systems Department of Human Molecular Genetics & Biochemistry, Sackler Faculty of Medicine and Sagol School of Neuroscience, Tel Aviv University, Tel Aviv, Israel. E-mail: [email protected] DOI 10.15252/embj.201695881 | Published online 7 November 2016 2502 The EMBO Journal Vol 35 |No23 | 2016 ª 2016 The Author Published online: November 7, 2016 Karen B Avraham What’s hot about otoferlin The EMBO Journal HUMAN AUDITORY SYSTEM Temperature-sensitive hearing phenotype External Vestibulo- cochlear ear Vestibule nerve Frequency [kHz] CN VIII 37°C 0.1250.25 0.5 1 2 4 8 0 OTOF mutation Exposure 10 c.1544T C/c.3346C T to heat 20 f s th (e.g. fever) p k Inner ear z v h 30 g [dB] ch Cochlea 40 j mdb i a sh O r X ng OXo 50 e u O 60 X Middle p.Ile515Thr/p.Arg1116* ear RXR 70 XXO Hearing level 80 O 90 OX 100 Abnormal Auditory Brainstem Response (ABR) 110 µV CN VIII 120 X Left ear O Right ear Normal hearing thresholds msec Frequency [kHz] 0.1250.25 0.5 1 2 4 8 RXR 0 O O OX X X OX X O XO Poor discrimination 10 p.Ile515Thr- p.Ile515Thr- 20 f s th p k otoferlin otoferlin z v h 30 g [dB] Area of i ch Compromised Plasma 40 j mdb a sh normal o r speech recognition membrane-bound 50 ng speech e p.Ile515Thr-otoferlin u 60 of inner hair cells (IHCs) 70 Hearing level 80 90 100 110 X Left ear O Right ear 120 MOUSE MODELS Figure 1. The link between otoferlin, heat and hearing loss. Auditory neuropathy (AN) is a relatively common form of hearing loss, accounting for approximately 10% of childhood deafness. Sensory hair cell activity, as measured by otoacoustic emissions representing mechanical amplification of outer hair cells, and cochlear microphonics, which examines electrical potentials of both inner and outer hair cells, is normal in AN patients. However, auditory nerve activity is compromised, as measured by auditory brainstem response (ABR). The speech discrimination score, which evaluates understanding of speech, is often low. Some patients with OTOF mutations suffer from an exacerbated hearing impairment when they have a fever. Surprisingly, mice with the same mutation retain the same level of hearing upon exposure to heat. Strenzke et al (2016) determined that the culprit of this difference lies in a 20-amino acid RXR motif. Transfection of otoferlin cDNA with an OTOF mutation and RXR motif in cochlear cultures, introduced by a gene gun, demonstrated that otoferlin disappeared from the inner hair cell plasma membrane. The levels of plasma membrane-bound otoferlin correlate with functional synaptic function and sound encoding. Note that the mutations c.1544T>C (p.Ile515Thr) and c.3346C>T (p.Arg1116*) are present in the long isoform of otoferlin (NP_001274418). and physiological mechanisms are remark- complete loss of otoferlin in the organ of in synaptic sound encoding than in other ably similar among mice and humans, espe- Corti. Auditory brainstem responses indi- Otof mutants that are profoundly deaf cially the inner ear (Friedman et al, 2007). cated a hearing loss and mild impairment of (Moser & Vogl, 2016). Moreover, the human and mouse genomes synchronous auditory signaling, with an Sound encoding is a process whereby a show high sequence conservation. Finally, apparent defect of the inner hair cell temporal sequence of sound frequencies is the ability to perform gene-targeted mutage- synapse, suggested by intact distortion translated into a specialized format, that is, nesis and create mouse models to replicate product otoacoustic emissions. This mouse nerve activation patterns. Inner ear hair cell human disease is unsurpassed in compar- was then crossed with a knockout mimick- synapses encode the frequency content and ison with other model organisms. ing patients with a heat-sensitive hearing intensity fluctuations of sound and rapidly Strenzke et al (2016) generated a novel loss. As in humans, these mice had an inter- transmit the information to spiral ganglion Otof mutant mouse with a p.Ile515Thr point mediate hearing defect, enabling a more neurons with extreme temporal precision. mutation, leading to a reduction but not detailed analysis of the function of otoferlin Otoferlin plays a significant role in this ª 2016 The Author The EMBO Journal Vol 35 |No23 | 2016 2503 Published online: November 7, 2016 The EMBO Journal What’s hot about otoferlin Karen B Avraham synaptic transmission by tethering synaptic thresholds—are normal, ABR amplitudes are form, is essential for exocytosis at the auditory vesicles to the plasma membrane, exempli- reduced because of a reduction of spike rates ribbon synapse.
Load more

Recommended publications
  • Functions of Vertebrate Ferlins
    cells Review Functions of Vertebrate Ferlins Anna V. Bulankina 1 and Sven Thoms 2,* 1 Department of Internal Medicine 1, Goethe University Hospital Frankfurt, 60590 Frankfurt, Germany; [email protected] 2 Department of Child and Adolescent Health, University Medical Center Göttingen, 37075 Göttingen, Germany * Correspondence: [email protected] Received: 27 January 2020; Accepted: 20 February 2020; Published: 25 February 2020 Abstract: Ferlins are multiple-C2-domain proteins involved in Ca2+-triggered membrane dynamics within the secretory, endocytic and lysosomal pathways. In bony vertebrates there are six ferlin genes encoding, in humans, dysferlin, otoferlin, myoferlin, Fer1L5 and 6 and the long noncoding RNA Fer1L4. Mutations in DYSF (dysferlin) can cause a range of muscle diseases with various clinical manifestations collectively known as dysferlinopathies, including limb-girdle muscular dystrophy type 2B (LGMD2B) and Miyoshi myopathy. A mutation in MYOF (myoferlin) was linked to a muscular dystrophy accompanied by cardiomyopathy. Mutations in OTOF (otoferlin) can be the cause of nonsyndromic deafness DFNB9. Dysregulated expression of any human ferlin may be associated with development of cancer. This review provides a detailed description of functions of the vertebrate ferlins with a focus on muscle ferlins and discusses the mechanisms leading to disease development. Keywords: dysferlin; myoferlin; otoferlin; C2 domain; calcium-sensor; muscular dystrophy; dysferlinopathy; limb girdle muscular dystrophy type 2B (LGMD2B), membrane repair; T-tubule system; DFNB9 1. Introduction Ferlins belong to the superfamily of proteins with multiple C2 domains (MC2D) that share common functions in tethering membrane-bound organelles or recruiting proteins to cellular membranes. Ferlins are described as calcium ions (Ca2+)-sensors for vesicular trafficking capable of sculpturing membranes [1–3].
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Q829X, a Novel Mutation in the Gene Encoding Otoferlin (OTOF), Is Frequently Found in Spanish Patients with Prelingual Non-Syndr
    502 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.39.7.502 on 1 July 2002. Downloaded from Q829X, a novel mutation in the gene encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic hearing loss V Migliosi, S Modamio-Høybjør, M A Moreno-Pelayo, M Rodríguez-Ballesteros, M Villamar, D Tellería, I Menéndez, F Moreno, I del Castillo ............................................................................................................................. J Med Genet 2002;39:502–506 nherited hearing impairment is a highly heterogeneous tial for the application of palliative treatment and special edu- group of disorders with an overall incidence of about 1 in cation. Hence genetic diagnosis and counselling are being I2000 newborns.1 Among them, prelingual, severe hearing increasingly demanded. loss with no other associated clinical feature (non-syndromic) Non-syndromic prelingual deafness is mainly inherited as is by far the most frequent.1 It represents a serious handicap an autosomal recessive trait. To date, 28 different loci for auto- for speech acquisition, and therefore early detection is essen- somal recessive non-syndromic hearing loss have been Table 1 Sequence of primers used for PCR amplification of human OTOF exons Exon Forward primer (5′→3′) Reverse primer (5′→3′) Size (bp) 1 GCAGAGAAGAGAGAGGCGTGTGA AGCTGGCGTCCCTCTGAGACA 203 2 CTGTTAGGACGACTCCCAGGATGA CCAGTGTGTGCCCGCAAGA 239 3 CCCCACGGCTCCTACCTGTTAT GTTGGGAGTGTAGGTCCCCTTTTTA 256 4 GAGTCCTCCCCAAGCAGTCACAG ATTCCCCAGACCACCCCATGT
    [Show full text]
  • A Cell-Based Gene Therapy Approach for Dysferlinopathy Using Sleeping Beauty Transposon
    A cell-based gene therapy approach for dysferlinopathy using Sleeping Beauty transposon Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by HELENA ESCOBAR FERNÁNDEZ from León, Spain August 2015 This work was prepared from October 2011 to July 2015 under the supervision of Dr. Zsuzsanna Izsvák (Max-Delbrück Center for Molecular Medicine, Berlin, Germany) and Prof. Simone Spuler (Experimental and Clinical Research Center, Berlin, Germany). All the experiments were conducted in the laboratories of Dr. Izsvák and Prof. Spuler. 1st reviewer: Prof. Dr. med. Simone Spuler Institute for Chemistry and Biochemistry Department of Biology, Chemistry and Pharmacy Freie Universität, Berlin and Department of Muscle Sciences and University Outpatient Clinic for Muscle Disorders Experimental and Clinical Research Center, Berlin 2nd reviewer: Prof. Dr. Sigmar Stricker Institute for Chemistry and Biochemistry Department of Biology, Chemistry and Pharmacy Freie Universität, Berlin and Development and Disease Group Max Planck Institute of Molecular Genetics, Berlin Date of Defense: November 18th, 2015 Preface The experiments with human muscle fiber fragments were done in collaboration with Dr. Andreas Marg, from the laboratory of Prof. Simone Spuler. Dr. Marg performed the isolation of human fiber fragments and the full characterization of the fiber fragment culture model. I performed the mouse irradiation and transplantation of human fiber fragments into mice. Dr. Marg also performed the mouse irradiation and the analysis of all grafted muscles. i ii Acknowledgements First of all, I want to thank Dr. Zsuzsanna Izsvák for supervising this work and giving me opportunity to carry out my PhD in her laboratory.
    [Show full text]
  • Fera Is a Membrane-Associating Four-Helix Bundle
    www.nature.com/scientificreports OPEN FerA is a Membrane-Associating Four-Helix Bundle Domain in the Ferlin Family of Membrane-Fusion Received: 4 March 2018 Accepted: 4 July 2018 Proteins Published: xx xx xxxx Faraz M. Harsini1, Sukanya Chebrolu1, Kerry L. Fuson1, Mark A. White 2, Anne M. Rice3 & R. Bryan Sutton 1,4 Ferlin proteins participate in such diverse biological events as vesicle fusion in C. elegans, fusion of myoblast membranes to form myotubes, Ca2+-sensing during exocytosis in the hair cells of the inner ear, and Ca2+-dependent membrane repair in skeletal muscle cells. Ferlins are Ca2+-dependent, phospholipid-binding, multi-C2 domain-containing proteins with a single transmembrane helix that spans a vesicle membrane. The overall domain composition of the ferlins resembles the proteins involved in exocytosis; therefore, it is thought that they participate in membrane fusion at some level. But if ferlins do fuse membranes, then they are distinct from other known fusion proteins. Here we show that the central FerA domain from dysferlin, myoferlin, and otoferlin is a novel four-helix bundle fold with its own Ca2+-dependent phospholipid-binding activity. Small-angle X-ray scattering (SAXS), spectroscopic, and thermodynamic analysis of the dysferlin, myoferlin, and otoferlin FerA domains, in addition to clinically-defned dysferlin FerA mutations, suggests that the FerA domain interacts with the membrane and that this interaction is enhanced by the presence of Ca2+. Ferlins are a relatively new class of large, multi-domain, type II transmembrane proteins that have been implicated in a wide variety of biological functions centered on membrane fusion events.
    [Show full text]
  • A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia
    -r- A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia by Anthony Wei Peng SEP 17 2009 B.S. Electrical and Computer Engineering LIBRARIES Cornell University, 1999 SUBMITTED TO THE HARVARD-MIT DIVISION OF HEALTH SCIENCES AND TECHNOLOGY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN SPEECH AND HEARING BIOSCIENCES AND TECHNOLOGY AT THE MASSACHUSETTS INSTITUTE OF TECHNOLOGY ARCHIVES JUNE 2009 02009 Anthony Wei Peng. All rights reserved. The author hereby grants to MIT permission to reproduce and to distribute publicly paper and electronic copies o this the is document in whole or in art in any medium nov know or ereafter created. Signature of Author: I Mr=--. r IT Division of Health Sciences and Technology May 1,2009 Certified by: I/ - I / o v Stefan Heller, PhD Associate Professor of Otolaryngology Head and Neck Surgery Stanford University ---- .. Thesis Supervisor Accepted by: -- Ram Sasisekharan, PhD Director, Harvard-MIT Division of Health Sciences and Technology Edward Hood Taplin Professor of Health Sciences & Technology and Biological Engineering. ---- q- ~ r This page is intentionally left blank. I~~riU~...I~ ~-- -pyyur~. _ A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia by Anthony Wei Peng B.S. Electrical and Computer Engineering, Cornell University, 1999 Submitted to the Harvard-MIT Division of Health Science and Technology on May 7, 2009 in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Speech and Hearing Bioscience and Technology Abstract Because there is little knowledge in the areas of stereocilia development, maintenance, and function in the hearing system, I decided to pursue a proteomics-based approach to discover proteins that play a role in stereocilia function.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0198970 A1 Roberts (43) Pub
    US 2003O19897OA1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0198970 A1 Roberts (43) Pub. Date: Oct. 23, 2003 (54) GENOSTICS clinical trials on groups or cohorts of patients. This group data is used to derive a Standardised method of treatment (75) Inventor: Gareth Wyn Roberts, Cambs (GB) which is Subsequently applied on an individual basis. There is considerable evidence that a significant factor underlying Correspondence Address: the individual variability in response to disease, therapy and FINNEGAN, HENDERSON, FARABOW, prognosis lies in a person's genetic make-up. There have GARRETT & DUNNER been numerous examples relating that polymorphisms LLP within a given gene can alter the functionality of the protein 1300 ISTREET, NW encoded by that gene thus leading to a variable physiological WASHINGTON, DC 20005 (US) response. In order to bring about the integration of genomics into medical practice and enable design and building of a (73) Assignee: GENOSTIC PHARMA LIMITED technology platform which will enable the everyday practice (21) Appl. No.: 10/206,568 of molecular medicine a way must be invented for the DNA Sequence data to be aligned with the identification of genes (22) Filed: Jul. 29, 2002 central to the induction, development, progression and out come of disease or physiological States of interest. Accord Related U.S. Application Data ing to the invention, the number of genes and their configu rations (mutations and polymorphisms) needed to be (63) Continuation of application No. 09/325,123, filed on identified in order to provide critical clinical information Jun. 3, 1999, now abandoned. concerning individual prognosis is considerably less than the 100,000 thought to comprise the human genome.
    [Show full text]
  • Topics Symposia
    Abstracts Topics Symposia Symposia S_1 Structural variation S 1 Structural variation S 2 Low risk cancer genes S1_01 S 3 Transgeneration effects and Molecular Mechanisms and Clinical Consequences of Genomic Disor- epigenetic programming ders. Implementation of array CGH in Genetic Diagnostics. The Baylor S 4 Ciliopathies Experience S 5 Systems biology Pawel Stankiewicz S 6 Molecular processes in meiosis Dept. of Molecular & Human Genetics, Baylor College of Medicine, Hous- ton, TX, USA Genomic disorders are a group of human genetic diseases caused by Selected Presentations DNA rearrangements, ranging in size from an average exon (~100 bp) to megabases and affecting dosage sensitive genes. Three major mo- lecular mechanisms: non-allelic homologous recombination (NAHR), Workshops non-homologous end joining (NHEJ), and the fork stalling and tem- W 1 Clinical genetics plate switching (FoSTeS)/microhomology-mediated breakage-induced W 2 Molecular basis of disease I repair (MMBIR) have been described as causative for the vast majority W 3 Cancer genetics of genomic disorders. Recurrent rearrangements are typically mediated W 4 Molecular basis of disease II by NAHR between low-copy repeats that are usually >10 kb in size with >97% DNA sequence identity. Nonrecurrent CNVs have been found to W 5 Imprinting be formed by NAHR between highly homologous repetitive elements W 6 Genomics technology / bioinformatics (e.g. Alu, LINE) and more often by NHEJ and FoSTeS/MMBIR stimu- W 7 Complex diseases lated, but not mediated, by genomic architectural features. Further- W 8 Cytogenetics / prenatal genetics more, simple repeating DNA sequences that have a potential of adopt- ing non-B DNA conformations (e.g.
    [Show full text]
  • Supplemental Figure 1: Immunoelectron Microscopy of Ribeye on the Harvested Sucrose Pellet from the Gradient Centrifugation Shown in Multiple Panels
    Supplemental Figure 1: Immunoelectron microscopy of ribeye on the harvested sucrose pellet from the gradient centrifugation shown in multiple panels. Supplemental Figure 2: Immunoelectron microscopy of VAMP2 on the harvested 200-400 mM sucrose interface sample shown in multiple panels. Supplemental Figure 3: A. Western blots indicate the immunoprecipitation of ribeye and CtBP2 with the CtBP2 antibody. Also coimmunoprecipitation of CtBP1, actin, myosin 9H, spectrin and α-tubulin is shown. B. Western blots indicate the immunoprecipitation of only ribeye with the AD antibody and the coimmunoprecipitation of PRPF39 is indicated. Supplemental Figure 4. Colocalization of ribeye with various presynaptic proteins. The labeling of individual proteins is presented in grayscale and merged panels are depicted in color. Double-labeling with ribeye-specific antiserum reveals the localization with respect to synaptic ribbons of SNARE proteins such as syntaxin 1 (A-C), SNAP25 (D-F), VAMP2 (G-I), syntaxin 6 (J-L), SNAP23 (M-O), VAMP7 (P-R), VAP-33 (S-U); SNARE dissociation molecules such as α-SNAP, β-SNAP (V-X), NSF (Y-A′); hair-cell specific proteins such as glutamate receptors 2 and 3 (GluR2 and GluR3) (B′-D′), glutamate transporter vGluT3 (E′-G′), hair-cell specific Ca2+ channel Cav1.3 (H′-J′), calcium sensor otoferlin (K′-M′); and other synaptic proteins such as rabphilin (N′-P′), munc 18 (Q′-S′), and synapsin (T′-V′). Supplemental Figure 5. Colocalization of ribeye with endocytotic and vesicle- trafficking proteins. The labeling of individual proteins is presented in grayscale and merged panels are depicted in color. Double-labeling with ribeye-specific antiserum reveals the localization of the endocytic proteins clathrin (A-C), dynamin (D-F), SCAMP1 (G-I) and endophilin (J-L) and of the trafficking proteins Sec13 (M-O), β-COP (P-R), VCP (S-U), and GAPDH (V-X) with respect to synaptic ribbons.
    [Show full text]
  • Supplemental Table 3 Two-Class Paired Significance Analysis of Microarrays Comparing Gene Expression Between Paired
    Supplemental Table 3 Two‐class paired Significance Analysis of Microarrays comparing gene expression between paired pre‐ and post‐transplant kidneys biopsies (N=8). Entrez Fold q‐value Probe Set ID Gene Symbol Unigene Name Score Gene ID Difference (%) Probe sets higher expressed in post‐transplant biopsies in paired analysis (N=1871) 218870_at 55843 ARHGAP15 Rho GTPase activating protein 15 7,01 3,99 0,00 205304_s_at 3764 KCNJ8 potassium inwardly‐rectifying channel, subfamily J, member 8 6,30 4,50 0,00 1563649_at ‐‐ ‐‐ ‐‐ 6,24 3,51 0,00 1567913_at 541466 CT45‐1 cancer/testis antigen CT45‐1 5,90 4,21 0,00 203932_at 3109 HLA‐DMB major histocompatibility complex, class II, DM beta 5,83 3,20 0,00 204606_at 6366 CCL21 chemokine (C‐C motif) ligand 21 5,82 10,42 0,00 205898_at 1524 CX3CR1 chemokine (C‐X3‐C motif) receptor 1 5,74 8,50 0,00 205303_at 3764 KCNJ8 potassium inwardly‐rectifying channel, subfamily J, member 8 5,68 6,87 0,00 226841_at 219972 MPEG1 macrophage expressed gene 1 5,59 3,76 0,00 203923_s_at 1536 CYBB cytochrome b‐245, beta polypeptide (chronic granulomatous disease) 5,58 4,70 0,00 210135_s_at 6474 SHOX2 short stature homeobox 2 5,53 5,58 0,00 1562642_at ‐‐ ‐‐ ‐‐ 5,42 5,03 0,00 242605_at 1634 DCN decorin 5,23 3,92 0,00 228750_at ‐‐ ‐‐ ‐‐ 5,21 7,22 0,00 collagen, type III, alpha 1 (Ehlers‐Danlos syndrome type IV, autosomal 201852_x_at 1281 COL3A1 dominant) 5,10 8,46 0,00 3493///3 IGHA1///IGHA immunoglobulin heavy constant alpha 1///immunoglobulin heavy 217022_s_at 494 2 constant alpha 2 (A2m marker) 5,07 9,53 0,00 1 202311_s_at
    [Show full text]
  • Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses by a Synthetic TLR3 Ligand Mitigates
    Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021 Inducing is online at: average * The Journal of Immunology published online 16 August 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/08/16/jimmun ol.1300376 A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Autocrine IFN Signaling Feng Fang, Kohtaro Ooka, Xiaoyong Sun, Ruchi Shah, Swati Bhattacharyya, Jun Wei and John Varga J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130037 6.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 28, 2021. Published August 16, 2013, doi:10.4049/jimmunol.1300376 The Journal of Immunology A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Inducing Autocrine IFN Signaling Feng Fang,* Kohtaro Ooka,* Xiaoyong Sun,† Ruchi Shah,* Swati Bhattacharyya,* Jun Wei,* and John Varga* Activation of TLR3 by exogenous microbial ligands or endogenous injury-associated ligands leads to production of type I IFN.
    [Show full text]
  • Protein Studies in Dysferlinopathy Patients Using Llama-Derived Antibody Fragments Selected by Phage Display
    European Journal of Human Genetics (2005) 13, 721–730 & 2005 Nature Publishing Group All rights reserved 1018-4813/05 $30.00 www.nature.com/ejhg ARTICLE Protein studies in dysferlinopathy patients using llama-derived antibody fragments selected by phage display Yanchao Huang1,4, Peter Verheesen2,4, Andreas Roussis1, Wendy Frankhuizen1, Ieke Ginjaar1, Faye Haldane3, Steve Laval3, Louise VB Anderson3, Theo Verrips2, Rune R Frants1, Hans de Haard2, Kate Bushby3, Johan den Dunnen1 and Silve`re M van der Maarel*,1 1Leiden University Medical Center, Center for Human and Clinical Genetics, Leiden, The Netherlands; 2Department of Molecular and Cellular Biology, University of Utrecht, Utrecht, The Netherlands; 3Institute of Human Genetics, International Centre for Life, Central Parkway, Newcastle upon Tyne, UK Mutations in dysferlin, a member of the fer1-like protein family that plays a role in membrane integrity and repair, can give rise to a spectrum of neuromuscular disorders with phenotypic variability including limb- girdle muscular dystrophy 2B, Myoshi myopathy and distal anterior compartment myopathy. To improve the tools available for understanding the pathogenesis of the dysferlinopathies, we have established a large source of highly specific antibody reagents against dysferlin by selection of heavy-chain antibody fragments originating from a nonimmune llama-derived phage-display library. By utilizing different truncated forms of recombinant dysferlin for selection and diverse selection methodologies, antibody fragments with specificity for two different dysferlin domains could be identified. The selected llama antibody fragments are functional in Western blotting, immunofluorescence microscopy and immunoprecipitation applications. Using these antibody fragments, we found that calpain 3, which shows a secondary reduction in the dysferlinopathies, interacts with dysferlin.
    [Show full text]