DOCSLIB.ORG

Dbase for Nature W/MIM Number

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Dbase for Nature W/MIM Number Human Disease Genes Database G. Jimenez-Sanchez, B. Childs, D. Valle Page 1 of 29 Prot Mode Age Life MIM # Locus Name Disease name funct Freq Inher onset Expect Malfor 600994 Deafness, autosomal dominant 5 Deafness, autosomal dominant 5 (3) 000 604392 Arylhydrocarbon-interacting receptor Leber congenital amaurosis, 604393 (3) 010 protein-like 1 154500 Treacher Collins-Franceschetti syndrome-1 Treacher Collins mandibulofacial 011 (TREACLE) dysostosis (3) 301200 Amelogenin Amelogenesis imperfecta (3) 010 309000 Oculocerebrorenal syndrome of Lowe Lowe syndrome (3) 02 300500 Ocular albinism-1, Nettleship-Falls type Ocular albinism, Nettleship-Falls type (3) 02 300031 Fragile site, folic acid type, rare, fra(X)(q28) Mental retardation, X-linked, FRAXF type 020 (3) 180090 Retinaldehyde-binding protein-1, cellular Retinitis pigmentosa, autosomal recessive 030 (3) 604365 Prominin, mouse, homolog-like 1 Retinal degeneration, autosomal recessive, 030 prominin-related (3) 602280 Tubby-like protein-1 Retinitis pigmentosa-14, 600132 (3) 030 603937 Oxygen-regulated photoreceptor protein-1 Retinitis pigmentosa-1, 180100 (3) 030 (retinitis pigmentosa-1) 153700 Vitelliform macular dystrophy (Best Macular dystrophy, vitelliform type (3) 030 disease) 601652 Myocilin (trabecular meshwork-induced Glaucoma 1A, primary open angle, juvenile- 030 glucocorticoid response protein) onset, 137750 (3); Glaucoma 1A, primary open angle, recessive (3) 142640 Histidine-rich glycoprotein Thrombophilia due to HRG deficiency (3); 040 ?Thrombophilia due to elevated HRG (1) 603904 Integral membrane protein 2B (BRI gene) Dementia, familial British, 176500 (3); 040 Dementia, familial Danish, 117300 (3) 163890 Synuclein, alpha (non A4 component of Parkinson disease, type 1, 601508 (3) 040 amyloid precursor) 137290 Membrane component, chromosome 1, Corneal dystrophy, gelatinous drop-like, 050 surface marker 1 (40kD glycoprotein, 204870 (3) identified by monoclonal antibody GA733) 601517 Ataxin-2 Spinocerebellar ataxia-2, 183090 (3) 030 162200 Neurofibromin (neurofibromatosis, type I) Neurofibromatosis, type 1 (3); Watson 03 syndrome, 193520 (3); Leukemia, juvenile myelomonocytic (3) 235200 Hemochromatosis Hemochromatosis (3); Porphyria variegata, 040 176200 (3) 240300 Autoimmune regulator Autoimmune polyglandular disease, type I 040 (3) 173910 Polycystin-2 Polycystic kidney disease, adult, type II (3) 040 602452 Budding uninhibited by benzimidazoles 1, Colorectal cancer with chromosomal 050 S. cerevisiae, homolog of (mitotic instability (3) checkpoint gene BUB1) 602117 Necdin Prader-Willi syndrome, 176270 (3) 011 219800 Cystinosis Cystinosis, nephropathic (3) 020 256731 Ceroid-lipofuscinosis, neuronal-5 Ceroid-lipofuscinosis, neuronal-5, variant 030 late infantile (3) 253800 Fukuyama congenital muscular dystrophy Muscular dystrophy, Fukuyama congenital 031 (3); ?Walker-Warburg syndrome, 236670 (2) 208900 Ataxia-telangiectasia mutated (includes Ataxia-telangiectasia (3); T-cell 030 complementation groups A, C, D, and E) prolymphocytic leukemia, sporadic (3); Lymphoma, B-cell non-Hodgkin, somatic (3); {Breast cancer, susceptibility to} (3); Lymphoma, mantel cell (3) 229300 Frataxin Friedreich ataxia (3); Friedreich ataxia with 030 retained reflexes (2) 156570 5-methyltetrahydrofolate-homocysteine Methylcobalamin deficiency, cbl G type (3) 03 methyltransferase 1 222300 Wolframin Wolfram syndrome (3) 030 256100 Nephronophthisis-1 gene Nephronophthisis, juvenile (3) 030 190080 Avian myelocytomatosis viral (v-myc) Burkitt lymphoma, 113970 (3) 030 oncogene homolog 191100 Tuberous sclerosis-1 Tuberous sclerosis-1 (3) 030 603009 Dysferlin Muscular dystrophy, limb-girdle, type 2B, 040 253601 (3); Miyoshi myopathy, 254130 (3); Myopathy, distal, with anterior tibial onset (3) Copyright 2001 Johns Hopkins University. All rights reserved Human Disease Genes Database G. Jimenez-Sanchez, B. Childs, D. Valle Page 2 of 29 Prot Mode Age Life MIM # Locus Name Disease name funct Freq Inher onset Expect Malfor 164500 Spinocerebellar ataxia 7 Spinocerebellar ataxia-7 (3) 040 (olivopontocerebellar atrophy with retinal degeneration) 605018 Cylindromatosis gene Cylindromatosis, familial, 132700 (3) 040 601556 Ataxin-1 Spinocerebellar ataxia-1, 164400 (3) 0 4 191092 Tuberous sclerosis-2 (tuberin) Tuberous sclerosis-2 (3) 040 193300 von Hippel-Lindau syndrome von Hippel-Lindau syndrome (3); Renal cell 040 carcinoma (3) 170993 Peroxisomal membrane protein-3, 35kD Zellweger syndrome-3 (3); Refsum 011 disease, infantile form, 266510 (3) 604831 Ellis-van Creveld syndrome gene Ellis-van Creveld syndrome, 225500 (3); 011 Weyers acrodental dysostosis, 193530 (3) 214500 Lysosomal trafficking regulator Chediak-Higashi syndrome (3) 020 600354 Survival of motor neuron 1, telomeric Spinal muscular atrophy-1, 253300 (3); 020 Spinal muscular atrophy-2, 253550 (3); Spinal muscular atrophy-3, 253400 (3) 185620 Surfeit-1 Leigh syndrome, due to COX deficiency, 020 256000 (3) 257220 Niemann-Pick disease, type C Niemann-Pick disease, type C1 (3); 02 Niemann-Pick disease, type D, 257250 (3) 600005 MHC class II transactivator MHC class II deficiency, complementation 020 group A, 209920 (3) 156490 Non-metastatic cells 1, protein (NM23A) Neuroblastoma (3) 02 expressed in 204200 Ceroid-lipofuscinosis, neuronal-3, juvenile Ceroid-lipofuscinosis, neuronal-3, juvenile 030 (Batten disease) (3) 216400 Cockayne syndrome 1, classical Cockayne syndrome-1 (3) 030 253250 Mulibrey nanism gene Mulibrey nanism, 253250 (3) 030 312080 Proteolipid protein Pelizaeus-Merzbacher disease (3); Spastic 03 paraplegia-2, 312920 (3) 164040 Nucleophosmin 1 (nucleolar Leukemia, acute promyelocytic, 040 phosphoprotein B23, numatrin) NPM/RARA type (3) 143100 Huntingtin Huntington disease (3) 04 480000 Sex-determining region Y (testis Gonadal dysgenesis, XY type (3) 00 determining factor) 119500 Popliteala pterygium syndrome Popliteal pterygium syndrome (3) 011 302060 Tafazzin Endocardial fibroelastosis-2 (2); Barth 01 syndrome (3); Cardiomyopathy, X-linked dilated, 300069 (3); Noncompaction of left ventricular myocardium, isolated, 300183 (3) 115501 Tyrosinase-related protein 1 Albinism, brown, 203290 (1); Albinism, 02 rufous, 278400 (3) 305100 Ectodermal dysplasia-1, anhidrotic Ectodermal dysplasia-1, anhidrotic (3) 020 109150 Machado-Joseph disease (spinocerebellar Machado-Joseph disease (3) 040 ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant); ataxin-3 603680 Spinocerebellar ataxia 8 Spinocerebellar ataxia 8 (3) 040 604214 KREV interaction trapped 1 Cerebral cavernous malformations-1, 041 116860 (3) 604277 Spastin Spastic paraplegia-4, 182601 (3) 040 601097 Peripheral myelin protein-22 Charcot-Marie-Tooth neuropathy-1A, 0 4 118220 (3); Dejerine-Sottas disease, 145900 (3); Neuropathy, recurrent, with pressure palsies, 162500 (3); Charcot- Marie-Tooth disease with deafness, 118300 (3) 113705 Breast cancer-1, early onset Breast cancer-1 (3); Ovarian cancer (3) 040 201460 Acyl-Coenzyme A dehydrogenase, long Acyl-CoA dehydrogenase, long chain, 121000 chain deficiency of (3) 274500 Thyroid peroxidase Thyroid iodine peroxidase deficiency (1); 13100 Goiter, congenital (3); Hypothyroidism, congenital (3) 138571 Glycogen synthase-2, liver Glycogen storage disease, type 0, 240600 10110 (3) 603005 ATP sulfurylase/APS kinase 2 SEMD, Pakistani type (3) 101101 601771 Cytochrome P450, subfamily I, dioxin- Glaucoma 3A, primary infantile, 231300 (3) 121100 inducible, polypeptide 1 Copyright 2001 Johns Hopkins University. All rights reserved Human Disease Genes Database G. Jimenez-Sanchez, B. Childs, D. Valle Page 3 of 29 Prot Mode Age Life MIM # Locus Name Disease name funct Freq Inher onset Expect Malfor 250790 Cytochrome b5 Methemoglobinemia due to cytochrome b5 131100 deficiency (3) 300180 Arylsulfatase E Chondrodysplasia punctata, X-linked 103101 recessive, 302950 (3); Chondrodysplasia punctata, brachytelephalangic, 302940 (3) 203100 Tyrosinase Albinism, oculocutaneous, type IA (3); 101200 Waardenburg syndrome/ocular albinism, digenic, 103470 (3) 250800 Diaphorase (NADH); cytochrome b-5 Methemoglobinemia, type I (3); 101200 reductase Methemoglobinemia, type II (3) 604313 Galactokinase-1 Galactokinase deficiency with cataracts, 10120 230200 (3) 203200 Oculocutaneous albinism II (pink-eye Albinism, oculocutaneous, type II (3); 121201 dilution, murine, homolog of) Albinism, ocular, autosomal recessive (3) 261600 Phenylalanine hydroxylase Phenylketonuria (3); 12120 [Hyperphenylalaninemia, mild] (3) 103850 Aldolase A, fructose-bisphosphatase Aldolase A deficiency (3) 131200 203500 Homogentisate 1,2-dioxygenase Alkaptonuria (3) 131200 (homogentisate oxidase) 222900 Sucrase-isomaltase Sucrose intolerance (3) 131200 250850 Methionine adenosyltransferase I, alpha Hypermethioninemia, persistent, autosomal 131200 dominant, due to methionine adenosyltransferase I/III deficiency (3); Methionine adenosyltransferase deficiency, autosomal recessive (3) 261630 Quinoid dihydropteridine reductase Phenylketonuria due to dihydropteridine 13120 reductase deficiency (3) 261640 6-pyruvoyltetrahydropterin synthase Phenylketonuria due to PTS deficiency (3) 13120 107730 Apolipoprotein B (including Ag(x) antigen) Hypobetalipoproteinemia (3); 11220 Abetalipoproteinemia (3); Hyperbetalipoproteinemia, 144400 (3); Apolipoprotein B-100, ligand-defective, 144010 (3) 305900 Glucose-6-phosphate dehydrogenase G6PD deficiency (3); Favism (3); Hemolytic 113200 anemia due to G6PD deficiency (3) 308100 Steroid sulfatase, microsomal (arylsulfatase Ichthyosis, X-linked (3); Placental
Load more

Recommended publications
  • Transferrin Variants and Conjugates
    (19) TZZ Z ¥ T (11) EP 2 604 623 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 19.06.2013 Bulletin 2013/25 C07K 14/79 (2006.01) A61K 47/48 (2006.01) A61K 38/40 (2006.01) C12N 5/10 (2006.01) (21) Application number: 12189421.6 (22) Date of filing: 08.08.2008 (84) Designated Contracting States: • Friis, Esben Peter AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 2730 Herlev (DK) HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT • Hay, Joanna RO SE SI SK TR Nottingham, Nottinghamshire NG2 6QW (GB) • Finnis, Christopher John Arthur (30) Priority: 08.08.2007 EP 07114012 Nottingham, Nottinghamshire NG7 1JB (GB) 02.04.2008 EP 08153938 (74) Representative: Williams, Rachel Clare (62) Document number(s) of the earlier application(s) in Novozymes Biopharma UK Limited accordance with Art. 76 EPC: Castle Court 08787067.1 / 2 201 036 59 Castle Boulevard Nottingham (71) Applicant: Novozymes Biopharma DK A/S Nottinghamshire NG7 1FD (GB) 2880 Bagsvaerd (DK) Remarks: (72) Inventors: This application was filed on 22-10-2012 as a • Sleep, Darrell divisional application to the application mentioned Nottingham, Nottinghamshire NG2 5DS (GB) under INID code 62. (54) Transferrin variants and conjugates (57) Based on the three-dimensional structure of "thiotransferrin"). The variant polypeptide may be conju- transferrin, the inventors have designed variant polypep- gated through the sulphur atom of the Cysteine residue tides (muteins) which have one or more Cysteine resi- to a bioactive compound. dues with a free thiol group (hereinafter referred to as EP 2 604 623 A2 Printed by Jouve, 75001 PARIS (FR) EP 2 604 623 A2 Description Reference to sequence listing 5 [0001] This application contains a Sequence Listing in computer readable form.
    [Show full text]
  • Mass Spectrometry-Based Proteomics Techniques and Their Application in Ovarian Cancer Research Agata Swiatly, Szymon Plewa, Jan Matysiak and Zenon J
    Swiatly et al. Journal of Ovarian Research (2018) 11:88 https://doi.org/10.1186/s13048-018-0460-6 REVIEW Open Access Mass spectrometry-based proteomics techniques and their application in ovarian cancer research Agata Swiatly, Szymon Plewa, Jan Matysiak and Zenon J. Kokot* Abstract Ovarian cancer has emerged as one of the leading cause of gynecological malignancies. So far, the measurement of CA125 and HE4 concentrations in blood and transvaginal ultrasound examination are essential ovarian cancer diagnostic methods. However, their sensitivity and specificity are still not sufficient to detect disease at the early stage. Moreover, applied treatment may appear to be ineffective due to drug-resistance. Because of a high mortality rate of ovarian cancer, there is a pressing need to develop innovative strategies leading to a full understanding of complicated molecular pathways related to cancerogenesis. Recent studies have shown the great potential of clinical proteomics in the characterization of many diseases, including ovarian cancer. Therefore, in this review, we summarized achievements of proteomics in ovarian cancer management. Since the development of mass spectrometry has caused a breakthrough in systems biology, we decided to focus on studies based on this technique. According to PubMed engine, in the years 2008–2010 the number of studies concerning OC proteomics was increasing, and since 2010 it has reached a plateau. Proteomics as a rapidly evolving branch of science may be essential in novel biomarkers discovery, therapy decisions, progression predication, monitoring of drug response or resistance. Despite the fact that proteomics has many to offer, we also discussed some limitations occur in ovarian cancer studies.
    [Show full text]
  • Functions of Vertebrate Ferlins
    cells Review Functions of Vertebrate Ferlins Anna V. Bulankina 1 and Sven Thoms 2,* 1 Department of Internal Medicine 1, Goethe University Hospital Frankfurt, 60590 Frankfurt, Germany; [email protected] 2 Department of Child and Adolescent Health, University Medical Center Göttingen, 37075 Göttingen, Germany * Correspondence: [email protected] Received: 27 January 2020; Accepted: 20 February 2020; Published: 25 February 2020 Abstract: Ferlins are multiple-C2-domain proteins involved in Ca2+-triggered membrane dynamics within the secretory, endocytic and lysosomal pathways. In bony vertebrates there are six ferlin genes encoding, in humans, dysferlin, otoferlin, myoferlin, Fer1L5 and 6 and the long noncoding RNA Fer1L4. Mutations in DYSF (dysferlin) can cause a range of muscle diseases with various clinical manifestations collectively known as dysferlinopathies, including limb-girdle muscular dystrophy type 2B (LGMD2B) and Miyoshi myopathy. A mutation in MYOF (myoferlin) was linked to a muscular dystrophy accompanied by cardiomyopathy. Mutations in OTOF (otoferlin) can be the cause of nonsyndromic deafness DFNB9. Dysregulated expression of any human ferlin may be associated with development of cancer. This review provides a detailed description of functions of the vertebrate ferlins with a focus on muscle ferlins and discusses the mechanisms leading to disease development. Keywords: dysferlin; myoferlin; otoferlin; C2 domain; calcium-sensor; muscular dystrophy; dysferlinopathy; limb girdle muscular dystrophy type 2B (LGMD2B), membrane repair; T-tubule system; DFNB9 1. Introduction Ferlins belong to the superfamily of proteins with multiple C2 domains (MC2D) that share common functions in tethering membrane-bound organelles or recruiting proteins to cellular membranes. Ferlins are described as calcium ions (Ca2+)-sensors for vesicular trafficking capable of sculpturing membranes [1–3].
    [Show full text]
  • Human Neurophysin II Antibody
    Human Neurophysin II Antibody Monoclonal Mouse IgG2B Clone # 62865 Catalog Number: MAB009 DESCRIPTION Species Reactivity Human Specificity Detects human Neurophysin II in direct ELISAs. Source Monoclonal Mouse IgG2B Clone # 62865 Purification Protein A or G purified from ascites Immunogen Synthetic peptide containing human Neurophysin II Accession # P01186 Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. *Small pack size (-SP) is supplied either lyophilized or as a 0.2 μm filtered solution in PBS. APPLICATIONS Please Note: Optimal dilutions should be determined by each laboratory for each application. General Protocols are available in the Technical Information section on our website. Recommended Sample Concentration Immunohistochemistry 5-25 µg/mL See Below DATA Immunohistochemistry Neurophysin II in Human Brain Hippocampus Tissue. Neurophysin II was detected in immersion fixed paraffin- embedded sections of human brain hippocampus tissue using Mouse Anti- Human Neurophysin II Monoclonal Antibody (Catalog # MAB009) at 5 µg/mL for 1 hour at room temperature followed by incubation with the Anti-Mouse IgG VisUCyte™ HRP Polymer Antibody (Catalog # VC001). Before incubation with the primary antibody, tissue was subjected to heat-induced epitope retrieval using Antigen Retrieval Reagent- Basic (Catalog # CTS013). Tissue was stained using DAB (brown) and counterstained with hematoxylin (blue). Specific staining was localized to neurons. View our protocol for IHC Staining with VisUCyte HRP Polymer Detection Reagents. PREPARATION AND STORAGE Reconstitution Reconstitute at 0.5 mg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. *Small pack size (-SP) is shipped with polar packs.
    [Show full text]
  • Diversity of Central Oxytocinergic Projections
    Cell and Tissue Research (2019) 375:41–48 https://doi.org/10.1007/s00441-018-2960-5 REVIEW Diversity of central oxytocinergic projections Gustav F. Jirikowski1 Received: 21 September 2018 /Accepted: 6 November 2018 /Published online: 29 November 2018 # Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract Localization and distribution of hypothalamic neurons expressing the nonapeptide oxytocin has been extensively studied. Their projections to the neurohypophyseal system release oxytocin into the systemic circulation thus controlling endocrine events associated with reproduction in males and females. Oxytocinergic neurons seem to be confined to the ventral hypothalamus in all mammals. Groups of such cells located outside the supraoptic and the paraventricular nuclei are summarized as Baccessory neurons.^ Although evolutionary probably associated with the classical magocellular nuclei, accessory oxytocin neurons seem to consist of rather heterogenous groups: Periventricular oxytocin neurons may gain contact to the third ventricle to secrete the peptide into the cerebrospinal fluid. Perivascular neurons may be involved in control of cerebral blood flow. They may also gain access to the portal circulation of the anterior pituitary lobe. Central projections of oxytocinergic neurons extend to portions of the limbic system, to the mesencephalon and to the brain stem. Such projections have been associated with control of behaviors, central stress response as well as motor and vegetative functions. Activity of the different oxytocinergic systems seems to be malleable to functional status, strongly influenced by systemic levels of steroid hormones. Keywords Hypothalamo neurohypophyseal system . Circumventricular organs . Liquor contacting neurons . Perivascular system . Limbic system Introduction been shown to occur in prostate, gonads, or skin, OTexpression in the brain seems to be confined to the hypothalamus.
    [Show full text]
  • Pnas11138correction 14002..14003
    Corrections MEDICAL SCIENCES Correction for “Regulation of bone remodeling by vasopressin New, Alberta Zallone, and Mone Zaidi, which appeared in issue 46, explains the bone loss in hyponatremia,” by Roberto Tamma, November 12, 2013, of Proc Natl Acad Sci USA (110:18644–18649; Li Sun, Concetta Cuscito, Ping Lu, Michelangelo Corcelli, first published October 28, 2013; 10.1073/pnas.1318257110). Jianhua Li, Graziana Colaianni, Surinder S. Moonga, Adriana The authors note that Fig. 1 appeared incorrectly. The cor- Di Benedetto, Maria Grano, Silvia Colucci, Tony Yuen, Maria I. rected figure and its legend appear below. Fig. 1. Bone cells express Avprs. Immunofluorescence micrographs (A) and Western immunoblotting (B) show the expression of Avpr1α in osteoblasts and osteoclasts, and as a function of osteoblast (mineralization) and osteoclast (with Rankl) differentiation. The expression of Avp (ligand) and Avpr1α (receptor) in osteoblasts is regulated by 17β-estradiol, as determined by quantitative PCR (C) and Western immunoblotting (D). (Magnification: A,63×.) Because Avp is a small peptide, its precursor neurophysin II is measured. Statistics: Student t test, P values shown compared with 0 h. Stimulation of Erk phosphorylation − (p-Erk) as a function of total Erk (t-Erk) by Avp (10 8 M) in osteoclast precursors (preosteoclasts), osteoclasts (OC), and osteoblasts establishes functionality of − the Avpr1α in the presence or absence of the receptor inhibitor SR49059 (10 8 M) (E). Western immunoblotting showing the expression of Avpr2 in pre- −/− osteoclasts, OCs (F), and osteoblasts (G) isolated from Avpr1α mice, as well as in MC3T3.E1 osteoblast precursors (G). Functionality of Avpr2 was confirmed −/− by the demonstration that cells from Avpr1α mice remained responsive to AVP in reducing the expression of osteoblast differentiation genes, namely Runx2, Osx, Bsp, Atf4, Opn, and Osteocalcin (quantitative PCR, P values shown) (H).
    [Show full text]
  • Supplementary Table 5. Functional Annotation of the Largest Gene Cluster(221 Element)
    Annotation Tool AFFYID VALUE SYMBOL LOCUSLINK OMIM GENENAME GENEONTOLOGY SUMMARY [Proteome FUNCTION:] Expressed 203054_s_at TCTA 6988 600690 T-cell leukemia translocation altered gene tumor suppressor ubiquitously [Proteome FUNCTION:] May be involved in protein-protein interactions; contains five WD 44563_at FLJ10385 55135 hypothetical protein FLJ10385 domains (WD-40 repeats) [Proteome FUNCTION:] Weakly similarity to 212261_at TNRC15 26058 trinucleotide repeat containing 15 a region of rat nestin (Rn.9701) [SUMMARY:] Actin alpha 1 which is expressed in skeletal muscle is one of six different actin isoforms which have been identified. Actins are highly conserved proteins that are involved in cell motility, actin filament; motor activity; muscle structure and integrity. Alpha actins are a contraction; muscle development; structural major constituent of the contractile 203872_at ACTA1 58 102610 actin, alpha 1, skeletal muscle constituent of cytoskeleton apparatus. [SUMMARY:] Annexin VIII belong to the family of Ca (2+) dependent phospholipid binding proteins (annexins), and has a high 56% identity to annexin V (vascular anticoagulant-alpha). It was initially isolated as 2.2 kb vascular anticoagulant-beta transcript from human placenta, a Ca (2+) dependent phospholipid binding protein that inhibits coagulation and phospholipase A2 activity. However, the fact that annexin VIII is neither an extracellular protein nor associated with the cell surface suggests that it may not play a role in blood coagulation in vivo and its physiological role remains unknown. It is expressed at low levels in human placenta and shows restricted expression in lung endothelia, skin, liver, and kidney. The gene is also found to be selectively overexpressed in acute 203074_at ANXA8 244 602396 annexin A8 myelocytic leukemia.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Clinical Chemistry
    June 1 2007, Volume 53, Issue 6,pp.999- 1180 Editorials Andrew McCaddon and Peter R. Hudson Methylation and Phosphorylation: A Tangled Relationship? Clin Chem 2007 53: 999-1000. Bob Palais Quantitative Heteroduplex Analysis Clin Chem 2007 53: 1001-1003. Eleftherios P. Diamandis Oncopeptidomics: A Useful Approach for Cancer Diagnosis? Clin Chem 2007 53: 1004-1006. Roger D. Klein The Pain Protective Haplotype: Introducing the Modern Genetic Test Clin Chem 2007 53: 1007-1009. Molecular Diagnostics and Genetics Jörn Lötsch, Inna Belfer, Anja Kirchhof, Bikash K. Mishra, Mitchell B. Max, Alexandra Doehring, Michael Costigan, Clifford J. Woolf, Gerd Geisslinger, and Irmgard Tegeder Reliable Screening for a Pain-Protective Haplotype in the GTP Cyclohydrolase 1 Gene (GCH1) Through the Use of 3 or Fewer Single Nucleotide Polymorphisms Clin Chem 2007 53: 1010-1015. Published online March 15, 2007; 10.1373/clinchem.2006.082883 Kerstin L. Edlefsen, Jonathan F. Tait, Mark H. Wener, and Michael Astion Utilization and Diagnostic Yield of Neurogenetic Testing at a Tertiary Care Facility Clin Chem 2007 53: 1016-1022. Published online April 19, 2007; 10.1373/clinchem.2006.083360 Sara Bremer, Helge Rootwelt, and Stein Bergan Real-Time PCR Determination of IMPDH1 and IMPDH2 Expression in Blood Cells Clin Chem 2007 53: 1023-1029. Published online April 26, 2007; 10.1373/clinchem.2006.081968 Elizabeth Herness Peters, Sandra Rojas-Caro, Mitchell G. Brigell, Robert J. Zahorchak, Shelley Ann des Etages, Patricia L. Ruppel, Charles R. Knight, Bradley Austermiller, Myrna C. Graham, Steve Wowk, Sean Banks, Lakshmi V. Madabusi, Patrick Turk, Donna Wilder, Carole Kempfer, Terry W. Osborn, and James C.
    [Show full text]
  • Q829X, a Novel Mutation in the Gene Encoding Otoferlin (OTOF), Is Frequently Found in Spanish Patients with Prelingual Non-Syndr
    502 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.39.7.502 on 1 July 2002. Downloaded from Q829X, a novel mutation in the gene encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic hearing loss V Migliosi, S Modamio-Høybjør, M A Moreno-Pelayo, M Rodríguez-Ballesteros, M Villamar, D Tellería, I Menéndez, F Moreno, I del Castillo ............................................................................................................................. J Med Genet 2002;39:502–506 nherited hearing impairment is a highly heterogeneous tial for the application of palliative treatment and special edu- group of disorders with an overall incidence of about 1 in cation. Hence genetic diagnosis and counselling are being I2000 newborns.1 Among them, prelingual, severe hearing increasingly demanded. loss with no other associated clinical feature (non-syndromic) Non-syndromic prelingual deafness is mainly inherited as is by far the most frequent.1 It represents a serious handicap an autosomal recessive trait. To date, 28 different loci for auto- for speech acquisition, and therefore early detection is essen- somal recessive non-syndromic hearing loss have been Table 1 Sequence of primers used for PCR amplification of human OTOF exons Exon Forward primer (5′→3′) Reverse primer (5′→3′) Size (bp) 1 GCAGAGAAGAGAGAGGCGTGTGA AGCTGGCGTCCCTCTGAGACA 203 2 CTGTTAGGACGACTCCCAGGATGA CCAGTGTGTGCCCGCAAGA 239 3 CCCCACGGCTCCTACCTGTTAT GTTGGGAGTGTAGGTCCCCTTTTTA 256 4 GAGTCCTCCCCAAGCAGTCACAG ATTCCCCAGACCACCCCATGT
    [Show full text]
  • Recent Applications of Retro-Inverso Peptides
    International Journal of Molecular Sciences Review Recent Applications of Retro-Inverso Peptides Nunzianna Doti 1, Mario Mardirossian 2, Annamaria Sandomenico 1 , Menotti Ruvo 1,* and Andrea Caporale 3,* 1 Institute of Biostructures and Bioimaging (IBB), National Research Council (CNR), 80134 Napoli, Italy; [email protected] (N.D.); [email protected] (A.S.) 2 Department of Medicine, Surgery and Health Sciences, University of Trieste, 34149 Trieste, Italy; [email protected] 3 Institute of Crystallography (IC), National Research Council (CNR), 34149 Trieste, Italy * Correspondence: [email protected] (M.R.); [email protected] (A.C.) Abstract: Natural and de novo designed peptides are gaining an ever-growing interest as drugs against several diseases. Their use is however limited by the intrinsic low bioavailability and poor stability. To overcome these issues retro-inverso analogues have been investigated for decades as more stable surrogates of peptides composed of natural amino acids. Retro-inverso peptides possess reversed sequences and chirality compared to the parent molecules maintaining at the same time an identical array of side chains and in some cases similar structure. The inverted chirality renders them less prone to degradation by endogenous proteases conferring enhanced half-lives and an increased potential as new drugs. However, given their general incapability to adopt the 3D structure of the parent peptides their application should be careful evaluated and investigated case by case. Here, we review the application of retro-inverso peptides in anticancer therapies, in immunology, in neurodegenerative diseases, and as antimicrobials, analyzing pros and cons of this interesting subclass of molecules. Keywords: retro-inverso peptides; anticancer peptides; drug delivery; peptide antigens; Aβ; IAPP; Citation: Doti, N.; Mardirossian, M.; antimicrobial peptides Sandomenico, A.; Ruvo, M.; Caporale, A.
    [Show full text]
  • 1 Supplementary Table S1. Histological And
    Supplementary Table S1. Histological and immunocytochemestry of the bcMCF clones. Clones Tumor type AE1 CAM5.2 EMA Vimentin bcMCF-1 Invasive poorly - - - +++ bcMCF-4 differentiated spindle cell type bcMCF-2 Invasive poorly +/- +/- +/- ++ bcMCF-6 differentiated bcMCF-7 epithelial cell type bcMCF-3 Invasive poorly - +/- +/- ++ bcMCF-5 differentiated with mix features of spindle and epithelial type The mouse monoclonal antibodies anti- human cytokeratin of low molecular weight (AE1, Biogenex, San Ramon, CA), cytokeratin peptides 7 and 8 (CAM5.2, Ventana, Tucson, AZ), epithelial membrane antigen (EMA) clone E29 and vimentin, clone V9, both from DakoCytomation Inc. (Fort Collins, CO) were used. Negative (-), weak (+/-), moderate (++) or strong (+++). 1 Supplementary Table S2. Differentially expressed apoptosis genes (GO:00009165) in tumorigenic bcMCF cells. Fold change Symbol Gene name trMCF bcMC caMCF AHR aryl hydrocarbon receptor Ns* -2.1 Ns APP amyloid beta (A4) precursor protein Ns -1.7 -1.7 BAG1 BCL2-associated athanogene Ns -7.6 -9.2 BAG5 BCL2-associated athanogene 5 Ns -1.8 Ns BIRC4 baculoviral IAP repeat-containing 4 Ns -2.0 -2.7 BNIP3L BCL2/adenovirus E1B interacting protein 3-like Ns -2 -1.9 CASP14 caspase 14, apoptosis-related cysteine peptidase Ns -12 -12.3 CASP3 caspase 3, apoptosis-related cysteine peptidase Ns -2.4 Ns CASP6 caspase 6, apoptosis-related cysteine peptidase Ns -4.1 -4.1 CD14 CD14 antigen Ns -4.7 Ns DAPK1 death-associated protein kinase 1 Ns -4.1 -13.4 ELMO3 engulfment and cell motility 3 Ns -9.9 -10.8 ELMOD2 ELMO
    [Show full text]