DOCSLIB.ORG

A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia -r- A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia by Anthony Wei Peng SEP 17 2009 B.S. Electrical and Computer Engineering LIBRARIES Cornell University, 1999 SUBMITTED TO THE HARVARD-MIT DIVISION OF HEALTH SCIENCES AND TECHNOLOGY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN SPEECH AND HEARING BIOSCIENCES AND TECHNOLOGY AT THE MASSACHUSETTS INSTITUTE OF TECHNOLOGY ARCHIVES JUNE 2009 02009 Anthony Wei Peng. All rights reserved. The author hereby grants to MIT permission to reproduce and to distribute publicly paper and electronic copies o this the is document in whole or in art in any medium nov know or ereafter created. Signature of Author: I Mr=--. r IT Division of Health Sciences and Technology May 1,2009 Certified by: I/ - I / o v Stefan Heller, PhD Associate Professor of Otolaryngology Head and Neck Surgery Stanford University ---- .. Thesis Supervisor Accepted by: -- Ram Sasisekharan, PhD Director, Harvard-MIT Division of Health Sciences and Technology Edward Hood Taplin Professor of Health Sciences & Technology and Biological Engineering. ---- q- ~ r This page is intentionally left blank. I~~riU~...I~ ~-- -pyyur~. _ A Hair Bundle Proteomics Approach to Discovering Actin Regulatory Proteins in Inner Ear Stereocilia by Anthony Wei Peng B.S. Electrical and Computer Engineering, Cornell University, 1999 Submitted to the Harvard-MIT Division of Health Science and Technology on May 7, 2009 in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Speech and Hearing Bioscience and Technology Abstract Because there is little knowledge in the areas of stereocilia development, maintenance, and function in the hearing system, I decided to pursue a proteomics-based approach to discover proteins that play a role in stereocilia function. I employed a modified "twist-off" technique to isolate hair bundle proteins, and I developed a method to purify proteins and to process them for analysis using multi-dimensional protein identification technology (MudPIT). The MudPIT analysis yielded a substantial list of proteins. I verified the presence of 21 out of 34 (62%) existing proteins known to be present in stereocilia. This provided strong evidence that my proteomics approach was efficient in identifying hair bundle proteins. Next, I selected three proteins and localized them to murine cochlear stereocilia. StarD10, a putative phospholipid binding protein, was detectable along the shaft of stereocilia. Nebulin, a putative F-actin regulator, was located toward the base of stereocilia. Finally, twinfilin 2, a putative modulator of actin polymerization, was found at the tips of stereocilia. In order to determine the function of twinfilin 2, I localized the protein predominately to the tips of shorter stereocilia where it is up-regulated during the final phase of elongation. When overexpressed, I found that twinfilin 2 causes a shortening of microvilli in LLC-PK1/CL4 cells and in native cochlear stereocilia. The main result of this thesis was determining the sub-cellular localization of three interesting proteins and functionally characterizing one protein. My thesis also confirmed the proteomics screen I developed as an efficient method for identifying proteins in stereocilia. Thesis Supervisor: Stefan Heller Title: Associate Professor, Department of Otolaryngology - Head and Neck Surgery, Stanford University School of Medicine, Stanford, CA ~g, --- -_~.,._L -- I~---- I--- I I_ I I I_ This page is intentionally left blank. ITF~riF~'~'4%1LEP~""~"~l----Clb-~L" Acknowledgements I am very blessed to have many people in my life to support me through completing my thesis and to teach me different skills and techniques. My mentor, Dr. Stefan Heller, has been instrumental in shaping my research plan and constantly providing me support. He always had faith in me, and he continued to push me and challenge me to do better. His never-ending ideas always pushed me forward when I doubted. Dr. Tony Ricci has also provided me with microscopy knowledge and given me invaluable advice. Drs. Eduardo Corrales and Kazuo Oshima patiently taught me how to dissect the inner ear. Sabine Mann taught me how to work with Sf9 cells and helped with protein expression and antibody production. Zhigang Xu provided insight on cloning and helped with experiments. Patrick Hsu spearheaded the work with StarD10. The Heller lab has provided me with years of feedback and comments. My thesis committee (Dr. M. Charles Liberman, Dr. William Sewell, and Dr. Clifford Woolf) guided me along, put me back on the path when I started to stray, and provided helpful feedback. Drs. Inna Belyantseva and Thomas Friedman welcomed me to visit their lab and perform some of my experiments with them. My parents, Thomas, Sophia, and the Chang's have supported me through all my schooling and my research. Without their love and support I would not be where I am today. Finally, my fiance Amanda Graves for her support and love. I'm truly lucky to have her, and I am lucky to join her wonderful family who has also supported me to the end. - 1 'P+i' This page is intentionally left blank. i~i-. i -- Table of contents C hapter 1: Introd uctio n ................................................................................................. 11 1.1 Hearing O verview .......................................... ................................................. 11 1.2 Stereocilia structure importance for MET ....................................... ........ 12 1.3 Actin filament structure.....................................................13 1.4 S tereocilia S tructure ............................................................................................. 15 1.5 Stereocilia Developm ent ...................................................................................... 16 1.6 Actin Dynamics of Stereocilia.............................................. 18 1.7 Introduction to this thesis ..................................................................................... 20 Chapter 2: Development of the Proteomics Screen ..................................... .... 31 2.1 Introduction to Proteom ics ................................................ ................................. 31 2.2 Development of the sample preparation method....................................33 2.2.1 Bundle isolation and protein solubilization ..................................... .... 33 2.2.2 Protein separation and detergent removal ..................................... .... 36 2.2.3 Protein cleavage........................................................39 2.2.4 Large-scale proteomics method ..................................... ......... 40 2 .3 C o nclusio ns....................................................... ............................................. 4 1 Chapter 3: Results of the Proteomics Screen.................................................................. 55 3.1 Overview of known hair bundle proteins ............................................................... 55 3.1.1 Structural / Cytoskeletal Proteins............................. ............. 55 3.1.2 Ca2+ regulation proteins................................................ 56 3.1.3 pH regulation .............................................................................................. .. 57 3.1.4 Myosin Motors in stereocilia ..................................... ............ 57 3.1.5 Energy metabolism proteins ..................................... ........... 58 3.1.6 Other scaffolding proteins............................................... 58 3 .2 Me th o d s ............................................................................................................... 5 9 3.3 Analysis of identified proteins from the MudPIT and validation of approach........61 3.3.1. Results of proteomics screen .......................................................................... 61 3.3.2 Comparison to results from Dr. Gillespie's laboratory........................... 62 -- -- I 3.3.3 Identification of known stereocilia proteins ................................................. 63 3.4 Conclusions ....................................................................... .............................. 64 Chapter 4: Sub-cellular localization of three new stereocilia proteins identified in the proteom ic screen .......................................................................................................... 77 4.1 Introduction to the three newly identified proteins ..................................... .. 77 4.2 Methods ...................................... .............................. .................................... 79 4.2.1 Antibodies ..................................................................... ............................ 79 4.2.2 Sf9 cell protein expression and purification ................................................ 80 4.2.3 Antibody generation and affinity purification .................................... ... 81 4.2.4 HEK 293 cell transfection and im m unostaining ............................................. 82 4.2.5 W hole-mount im m uno-fluorescence .............................................................. 83 4.3 Sub-cellular localization of proteins in cochlear hair cells ..................................... 84 4.3.1 StarD10 ........................................................................ ................................. 84 4.3.2 Nebulin .............................................. ..........
Load more

Recommended publications
  • Myosin Myth4-FERM Structures Highlight Important Principles of Convergent Evolution
    Myosin MyTH4-FERM structures highlight important principles of convergent evolution Vicente José Planelles-Herreroa,b, Florian Blanca,c, Serena Sirigua, Helena Sirkiaa, Jeffrey Clausea, Yannick Souriguesa, Daniel O. Johnsrudd, Beatrice Amiguesa, Marco Cecchinic, Susan P. Gilberte, Anne Houdussea,1,2, and Margaret A. Titusd,1,2 aStructural Motility, Institut Curie, CNRS, UMR 144, PSL Research University, F-75005 Paris, France; bUPMC Université de Paris 6, Institut de Formation Doctorale, Sorbonne Universités, 75252 Paris Cedex 05, France; cLaboratoire d’Ingénierie des Fonctions Moléculaires, Institut de Science et d’Ingénierie Supramoléculaires, UMR 7006 CNRS, Université de Strasbourg, F-67083 Strasbourg Cedex, France; dDepartment of Genetics, Cell Biology and Development, University of Minnesota, Minneapolis, MN 55455; and eDepartment of Biological Sciences, Rensselaer Polytechnic Institute, Troy, NY 12180 Edited by James A. Spudich, Stanford University School of Medicine, Stanford, CA, and approved March 31, 2016 (received for review January 15, 2016) Myosins containing MyTH4-FERM (myosin tail homology 4-band (Fig. 1). These MF myosins are widespread and likely quite an- 4.1, ezrin, radixin, moesin, or MF) domains in their tails are found cient because they are found in many different branches of the in a wide range of phylogenetically divergent organisms, such as phylogenetic tree (5, 6), including Opisthokonts (which includes humans and the social amoeba Dictyostelium (Dd). Interestingly, Metazoa, unicellular Holozoa, and Fungi), Amoebozoa, and the evolutionarily distant MF myosins have similar roles in the exten- SAR (Stramenopiles, Alveolates, and Rhizaria) (Fig. 1 A and B). sion of actin-filled membrane protrusions such as filopodia and Over the course of hundreds of millions years of parallel evolution bind to microtubules (MT), suggesting that the core functions of the MF myosins have acquired or maintained roles in the formation these MF myosins have been highly conserved over evolution.
    [Show full text]
  • Functions of Vertebrate Ferlins
    cells Review Functions of Vertebrate Ferlins Anna V. Bulankina 1 and Sven Thoms 2,* 1 Department of Internal Medicine 1, Goethe University Hospital Frankfurt, 60590 Frankfurt, Germany; [email protected] 2 Department of Child and Adolescent Health, University Medical Center Göttingen, 37075 Göttingen, Germany * Correspondence: [email protected] Received: 27 January 2020; Accepted: 20 February 2020; Published: 25 February 2020 Abstract: Ferlins are multiple-C2-domain proteins involved in Ca2+-triggered membrane dynamics within the secretory, endocytic and lysosomal pathways. In bony vertebrates there are six ferlin genes encoding, in humans, dysferlin, otoferlin, myoferlin, Fer1L5 and 6 and the long noncoding RNA Fer1L4. Mutations in DYSF (dysferlin) can cause a range of muscle diseases with various clinical manifestations collectively known as dysferlinopathies, including limb-girdle muscular dystrophy type 2B (LGMD2B) and Miyoshi myopathy. A mutation in MYOF (myoferlin) was linked to a muscular dystrophy accompanied by cardiomyopathy. Mutations in OTOF (otoferlin) can be the cause of nonsyndromic deafness DFNB9. Dysregulated expression of any human ferlin may be associated with development of cancer. This review provides a detailed description of functions of the vertebrate ferlins with a focus on muscle ferlins and discusses the mechanisms leading to disease development. Keywords: dysferlin; myoferlin; otoferlin; C2 domain; calcium-sensor; muscular dystrophy; dysferlinopathy; limb girdle muscular dystrophy type 2B (LGMD2B), membrane repair; T-tubule system; DFNB9 1. Introduction Ferlins belong to the superfamily of proteins with multiple C2 domains (MC2D) that share common functions in tethering membrane-bound organelles or recruiting proteins to cellular membranes. Ferlins are described as calcium ions (Ca2+)-sensors for vesicular trafficking capable of sculpturing membranes [1–3].
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Vocabulario De Morfoloxía, Anatomía E Citoloxía Veterinaria
    Vocabulario de Morfoloxía, anatomía e citoloxía veterinaria (galego-español-inglés) Servizo de Normalización Lingüística Universidade de Santiago de Compostela COLECCIÓN VOCABULARIOS TEMÁTICOS N.º 4 SERVIZO DE NORMALIZACIÓN LINGÜÍSTICA Vocabulario de Morfoloxía, anatomía e citoloxía veterinaria (galego-español-inglés) 2008 UNIVERSIDADE DE SANTIAGO DE COMPOSTELA VOCABULARIO de morfoloxía, anatomía e citoloxía veterinaria : (galego-español- inglés) / coordinador Xusto A. Rodríguez Río, Servizo de Normalización Lingüística ; autores Matilde Lombardero Fernández ... [et al.]. – Santiago de Compostela : Universidade de Santiago de Compostela, Servizo de Publicacións e Intercambio Científico, 2008. – 369 p. ; 21 cm. – (Vocabularios temáticos ; 4). - D.L. C 2458-2008. – ISBN 978-84-9887-018-3 1.Medicina �������������������������������������������������������������������������veterinaria-Diccionarios�������������������������������������������������. 2.Galego (Lingua)-Glosarios, vocabularios, etc. políglotas. I.Lombardero Fernández, Matilde. II.Rodríguez Rio, Xusto A. coord. III. Universidade de Santiago de Compostela. Servizo de Normalización Lingüística, coord. IV.Universidade de Santiago de Compostela. Servizo de Publicacións e Intercambio Científico, ed. V.Serie. 591.4(038)=699=60=20 Coordinador Xusto A. Rodríguez Río (Área de Terminoloxía. Servizo de Normalización Lingüística. Universidade de Santiago de Compostela) Autoras/res Matilde Lombardero Fernández (doutora en Veterinaria e profesora do Departamento de Anatomía e Produción Animal.
    [Show full text]
  • Spectrum of MYO7A Mutations in an Indigenous South African
    G C A T T A C G G C A T genes Article Spectrum of MYO7A Mutations in an Indigenous South African Population Further Elucidates the Nonsyndromic Autosomal Recessive Phenotype of DFNB2 to Include Both Homozygous and Compound Heterozygous Mutations Rosemary Ida Kabahuma 1,2,*, Wolf-Dieter Schubert 2, Christiaan Labuschagne 3, Denise Yan 4, Susan Halloran Blanton 4,5 , Michael Sean Pepper 6 and Xue Zhong Liu 4,5,* 1 Department of Otorhinolaryngology, University of Pretoria, Pretoria 0001, South Africa 2 Departments of Biochemistry, Genetics and Microbiology, Faculty of Natural and Agricultural Sciences, University of Pretoria, Pretoria 0001, South Africa; [email protected] 3 Inqaba Biotechnical Industries, Pretoria 0002, South Africa; [email protected] 4 Department Otolaryngology, University of Miami Miller School of Medicine, Miami, FL 33136, USA; [email protected] (D.Y.); [email protected] (S.H.B.) 5 Dr. John T. Macdonald Foundation Department of Human Genetics, and John P. Hussman Institute for Human Genomics, University of Miami Miller School of Medicine, Miami, FL 33136, USA 6 Department Immunology and SAMRC Extramural Unit for Stem Cell Research and Therapy, Faculty of Health Sciences, Institute for Cellular and Molecular Medicine, University of Pretoria, Citation: Kabahuma, R.I.; Pretoria 0001, South Africa; [email protected] Schubert, W.-D.; Labuschagne, C.; * Correspondence: [email protected] (R.I.K.); [email protected] (X.Z.L.) Yan, D.; Blanton, S.H.; Pepper, M.S.; Liu, X.Z. Spectrum of MYO7A Abstract: MYO7A gene encodes unconventional myosin VIIA, which, when mutated, causes a phe- Mutations in an Indigenous South notypic spectrum ranging from recessive hearing loss DFNB2 to deaf-blindness, Usher Type 1B African Population Further (USH1B).
    [Show full text]
  • Chapter 1. Epithelium (Epithelia)
    Chapter 1. Epithelium (Epithelia) ▶ Epithelia separate the internal environment from the external environment by forming tightly cohesive sheets of polarized cells held together by specialized junctional complexes and cell adhesion molecules ▶ Epithelial cells participate in embryo morphogenesis and organ development This chapter address the structural characteristics of epithelial cells General Characteristics of epithelia 1) tightly cohesive sheet of cells that covers or lines body surface (skin, intestine, secretory ducts) and forms functional units of secretory gland (salivary gland, liver) 2) basic function; protection (skin) ; absorption (small and large intestine) ; transport of material at the surface (mediated by cilia) ; secretion (gland) ; excretion (tubules of kidney) ; gas exchange (lung alveolus) ; gliding between surface (mesothelium, 중피세포) 3) Most epithelial cells renew continuously by mitosis (regeneration) 4) Epithelia lack direct blood and lymphatic supply (avascular; no blood supply). Nutrients are delivered by diffusion 5) Epithelial cells have no free intercellular substance (in contrast to connective tissues) (Control of permeability) 6) The cohesive nature of an epithelium is maintained by cell adhesion molecules and junctional complexes (attachment). 7) Epithelia are anchored to a basal lamina (바닥판). The basal lamina and connective tissues components cooperate to form basement membrane (기저막) 8) Epithelia have structural and functional polarity Epithelial Tissue - Characteristics & Functions https://www.youtube.com/watch?v=xI2hsH-ZHR4
    [Show full text]
  • Stereocilia Rootlets: Actin-Based Structures That Are Essential for Structural Stability of the Hair Bundle
    International Journal of Molecular Sciences Review Stereocilia Rootlets: Actin-Based Structures That Are Essential for Structural Stability of the Hair Bundle Itallia Pacentine, Paroma Chatterjee and Peter G. Barr-Gillespie * Oregon Hearing Research Center & Vollum Institute, Oregon Health & Science University, Portland, OR 97239, USA; [email protected] (I.P.); [email protected] (P.C.) * Correspondence: [email protected]; Tel.: +1-503-494-2936 Received: 12 December 2019; Accepted: 1 January 2020; Published: 3 January 2020 Abstract: Sensory hair cells of the inner ear rely on the hair bundle, a cluster of actin-filled stereocilia, to transduce auditory and vestibular stimuli into electrical impulses. Because they are long and thin projections, stereocilia are most prone to damage at the point where they insert into the hair cell’s soma. Moreover, this is the site of stereocilia pivoting, the mechanical movement that induces transduction, which additionally weakens this area mechanically. To bolster this fragile area, hair cells construct a dense core called the rootlet at the base of each stereocilium, which extends down into the actin meshwork of the cuticular plate and firmly anchors the stereocilium. Rootlets are constructed with tightly packed actin filaments that extend from stereocilia actin filaments which are wrapped with TRIOBP; in addition, many other proteins contribute to the rootlet and its associated structures. Rootlets allow stereocilia to sustain innumerable deflections over their lifetimes and exemplify the unique manner in which sensory hair cells exploit actin and its associated proteins to carry out the function of mechanotransduction. Keywords: rootlet; actin; stereocilia; hair cell 1. Introduction Eukaryotic cells use actin as a basic building block of the cytoskeleton.
    [Show full text]
  • MYO7A Gene Myosin VIIA
    MYO7A gene myosin VIIA Normal Function The MYO7A gene provides instructions for making a protein called myosin VIIA, which is part of a group of proteins called unconventional myosins. These proteins, which have similar structures, help transport molecules within cells. Myosins interact with actin, a protein that is important for cell movement and shape. Researchers believe that myosins use long filaments of actin as tracks along which to transport other molecules. Myosin VIIA is made in the inner ear and in the retina, which is the light-sensitive tissue at the back of the eye. In the inner ear, myosin VIIA plays a role in the development and maintenance of hairlike projections called stereocilia. Stereocilia, which are rich in actin, line the inner ear and bend in response to sound waves. This bending motion is critical for converting sound waves to nerve impulses, which are then transmitted to the brain. Stereocilia are also elements of the vestibular system, the part of the inner ear that helps maintain the body's balance and orientation in space. Bending of these stereocilia is needed to transmit signals from the vestibular system to the brain. In the retina, myosin VIIA is found primarily in a thin layer of cells called the retinal pigment epithelium (RPE). Myosin VIIA probably plays a role in the development and maintenance of this tissue, which supports and nourishes the retina. Research suggests that one function of myosin VIIA is to carry small sacs of pigment (called melanosomes) within the RPE. This pigment is necessary for normal vision. Myosin VIIA is also found in other parts of the retina, where it likely carries additional proteins and molecules that are important for vision.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Head Region Mutations
    Copyright 1998 by the Genetics Society of America Molecular Genetic Dissection of Mouse Unconventional Myosin-VA: Head Region Mutations Jian-Dong Huang,* M. Jamie T. V. Cope,²,1 Valerie Mermall,³ Marjorie C. Strobel,* John Kendrick-Jones,² Liane B. Russell,²² Mark S. Mooseker,³,§,** Neal G. Copeland,* and Nancy A. Jenkins,* *ABL-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702, ²MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, United Kingdom, ³Department of Biology, §Department of Pathology, **Department of Cell Biology, Yale University, New Haven, Connecticut 06520, ²²Biology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 Manuscript received September 19, 1997 Accepted for publication December 23, 1997 ABSTRACT The mouse dilute (d) locus encodes unconventional myosin-VA (MyoVA). Mice carrying null alleles of dilute have a lightened coat color and die from a neurological disorder resembling ataxia and opisthotonus within three weeks of birth. Immunological and ultrastructural studies suggest that MyoVA is involved in the transport of melanosomes in melanocytes and smooth endoplasmic reticulum in cerebellar Purkinje cells. In studies described here, we have used an RT-PCR-based sequencing approach to identify the mutations responsible for 17 viable dilute alleles that vary in their effects on coat color and the nervous system. Seven of these mutations mapped to the MyoVA motor domain and are reported here. Crystallo- graphic modeling and mutant expression studies were used to predict how these mutations might affect motor domain function and to attempt to correlate these effects with the mutant phenotype. HE mouse dilute (d) locus encodes unconventional motor protein is used for the long-range transport of Tmyosin-VA (MyoVA).
    [Show full text]
  • Purification and Initial Protein Characterization of Hair Cell Stereocilia
    Proc. Nail. Acad. Sci. USA Vol. 86, pp. 4973-4977, July 1989 Cell Biology "Bundle blot" purification and initial protein characterization of hair cell stereocilia (mechanotransduction/auditory system/vestibular system/cytoskeleton/ummunocytochemistry) GORDON M. G. SHEPHERD, BARBARA A. BARRES, AND DAVID P. COREY Neuroscience Group, Howard Hughes Medical Institute, and Department of Neurology, Wellman 414, Massachusetts General Hospital, Fruit Street, Boston, MA 02114; and Program in Neuroscience, Harvard Medical School, Boston, MA 02115 Communicated by Thomas S. Reese, April 4, 1989 ABSTRACT Stereocilia were isolated from bullfrog (Rana To study the biochemistry of stereocilia we developed a catesbeiana) saccular hair cells by nitrocellulose adhesion. The purification technique that exploits the adhesion of the apical high purity and high yield of the preparation were demon- ends of stereocilia to nitrocellulose paper and the mechanical strated by microscopy. SDS/PAGE of stereociliary proteins fiagility of the narrow basal ends. A related strategy has been resolved 12-15 major bands. Actin, previously identified as a used to adsorb small numbers of piscine stereocilia onto cov- component of the stereociliary core, was identified in purified erslips for ultrastructural studies (13). The nitrocellulose adhe- stereocilia as a band comi rating with authentic actin and by sion method, which we term "bundle blot" purification, gave a phalloidin labeling of intact isolated stereocilia. Fimbrin was sufficiently high yield of pure stereocilia for biochemical anal- identified in immunoblots of purified stereocilia. The most ysis. Some results have appeared in preliminary form (14). abundant other proteins migrated at 11, 14, 16-19, 27, and 36 kDa. Demembranated stereociliary cores consisted primarily METHODS of protein bands corresponding to actin and fimbrin and several proteins ranging from 43 to 63 kDa.
    [Show full text]
  • Q829X, a Novel Mutation in the Gene Encoding Otoferlin (OTOF), Is Frequently Found in Spanish Patients with Prelingual Non-Syndr
    502 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.39.7.502 on 1 July 2002. Downloaded from Q829X, a novel mutation in the gene encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic hearing loss V Migliosi, S Modamio-Høybjør, M A Moreno-Pelayo, M Rodríguez-Ballesteros, M Villamar, D Tellería, I Menéndez, F Moreno, I del Castillo ............................................................................................................................. J Med Genet 2002;39:502–506 nherited hearing impairment is a highly heterogeneous tial for the application of palliative treatment and special edu- group of disorders with an overall incidence of about 1 in cation. Hence genetic diagnosis and counselling are being I2000 newborns.1 Among them, prelingual, severe hearing increasingly demanded. loss with no other associated clinical feature (non-syndromic) Non-syndromic prelingual deafness is mainly inherited as is by far the most frequent.1 It represents a serious handicap an autosomal recessive trait. To date, 28 different loci for auto- for speech acquisition, and therefore early detection is essen- somal recessive non-syndromic hearing loss have been Table 1 Sequence of primers used for PCR amplification of human OTOF exons Exon Forward primer (5′→3′) Reverse primer (5′→3′) Size (bp) 1 GCAGAGAAGAGAGAGGCGTGTGA AGCTGGCGTCCCTCTGAGACA 203 2 CTGTTAGGACGACTCCCAGGATGA CCAGTGTGTGCCCGCAAGA 239 3 CCCCACGGCTCCTACCTGTTAT GTTGGGAGTGTAGGTCCCCTTTTTA 256 4 GAGTCCTCCCCAAGCAGTCACAG ATTCCCCAGACCACCCCATGT
    [Show full text]