DOCSLIB.ORG

Case Report Clinica Chimica Acta

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Clinica Chimica Acta 493 (2019) S199–S259 Contents lists available at SciVerse ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim Case report M145 Background-aim Overlap of chronic Hepatitis C and autoimmune hepatitis Congenital analbuminemia is an extremely rare autosomal recessive disorder diagnosed in adulthood. It is characterized by an S. Aatfaoui, F. Boulhen, I. Elfaiz, S. Elhentifi, J. Elbakkouri, B. Farouqi absence or a major decrease in the plasma concentration of albumin. Laboratory of Immunology of CHU Ibn Rochd of Casablanca, Morocco its frequency is estimated at less than 1/1000000. The clinical presentation remains poor with asthenia, hypotension, oedemas and Background-aim hyperlipemia The overlap between chronic viral hepatitis C and autoimmune Methods hepatitis (HAI) is an unusual and delicate clinical situation that can be diagnostically and therapeutically challenging. We report the case of a 46-year-old woman with recurrent erysipelas as antecedents and followed for primary lymphedema on Methods bilateral elephantiasis. It is the case of a women of 62 years-old, with no particular history, Results presenting a fever, jaundice, and asthenia. A liver test has been prescribed. The search for markers of viral hepatitis B and C is carried our case presented on the biological assays a normal out by chemiluminescence, the search for the viral load of the virus oh proteinemia: 64g/l, a positive protein reactive C 136 mg/l and a hepatitis C virus was carried out by molecular biology. Antinuclear ver low rate of albuminenia on two consecutive assessments: antibodies were detected by indirect Immunofluorescence (IFI) on the first dosage: 12.6g /l and the second dosage 9.45g/l, the Hep-20-10 cells. Soluble antigens were objectified by dot blot. cholestérolemia 2.21g/l, the rest of the assessments was without particularities. Plasma protein electrophoresis was requested on the Results advice of the biologist who reported a major decrease of the albumin fraction at 5.7 g/l and an increase in the other fractions of The biological assessment reveals Alanine minotransferase (AST) electrophyte with alpha1 at 6.4 g/l, alpha2 at 13 g/l, 5g/l and at 231 IU/l and Aspartate aminotransferase (ALT) at 220 IU/l, gamma at 24.1g/l. hypergammaglobulinemia at 30g/l, positive serology of HVC, a high viral load at 6.19 106 IU/ml, anti-nuclear antibodies (AAN ) showed Conclusions cytoplasmic fluorescence, the anti-DNAs were negative. Liver biopsy revealed lymphoplasmocytic infiltrates and steatosis. congenital analbuminemia is an rarely reported anomaly in literature, it is due to a mutation in the fourth chromosome, the Conclusions confirmation is done by electrophoresis of plasma proteins (absence of albumin band), it is tolerated in adults and remains, besides the Overlap of autoimmune hepatitis and a viral hepatitis C is a poor quality of life, without serious consequences. difficult diagnosis, and the only way to have a confirmation is to use the anatomo-pathology. doi:10.1016/j.cca.2019.03.414 doi:10.1016/j.cca.2019.03.413 M147 M146 Iatrogenic hyponatraemia secondary to surgical irrigation during transurethral resection of the prostate A giant lymphedema revealing a congenital analbuminemia E. Millar, J. Newmark, S. Henery, K. Deans, B. Croal F. Boulhen, S. Aatfaoui, M. Zinoune, N. Kamal Department of Clinical Biochemistry, Aberdeen Royal Infirmary, United Laboratory of Biochemistry of CHU Ibn Rochd of Casablanca, Morocco Kingdom 0009-8981/$ – see front matter Abstracts / Clinica Chimica Acta 493 (2019) S199–S259 Background-aim Methods A 69 year old man was admitted on 13/11/18 for a Transurethral Newborn after emergency caesarean section. Resection of the Prostate (TURP) for T3aN0M0 prostate cancer, and suffered iatrogenic dilutional hyponatraemia secondary to surgical Results irrigation. He had previously presented to his GP with nocturia and difficulty voiding, and was found to have a PSA of 10.3ng/mL Postnatal analysis: Red blood cells (RBC) 2.71*106/uL [4-6.6], (reference interval b4.0ng/mL). Initial examination revealed a smooth haemoglobin (Hb) 11.7g/dL [14.5-23], hematocrit 33.4% [43.5-70], prostate and CT and MRI imaging in July and August 2018 respectively, reticulocytes 0.46% [0.59-2.07]. Positive placental culture to E.coli. showed no evidence of metastatic spread. He was commenced on Rest of the analysis and physical examination were normal. Triptorelin, a GnRH analogue designed to decrease secretion of FH/ First month of life analysis: Baby presented severe anemia and LSH, with adjuvant radiotherapy planned post-TURP. In Sept 2018 a altered iron metabolism (Hb 6.5g/dL [10-17], mean corpuscular bladder scan revealed a urine volume of 1.5 litres, and a long-term volume (MCV) 111.7fL [85-120], reticulocytes 0.3% [0.59-2.07], iron catheter was sited. He had no other significant past medical history. 175ug/dL [30-160], ferritin 507.4ng/mL [15-150]). Hematological study showed macrocytic anemia, negative direct Coombs test, Methods reticulocytopenia and anisocytosis. Postinfectious anemia was ini- tially suspected, so infant was finally hospitalized. We reviewed case notes and laboratory data to glean pertinent Third month of life analysis: Baby was afebrile, still pale and weak information as it pertained to this case report. (Hb 8.2g/dL [9.5-13.5], reticulocytes 0.23% [0.59-2.07], iron 172ug/dL [30-160], ferritin 581.3ng/mL [15-150]) but exhaustive exploration Results and complementary test were negatives. Finally heterozygous mutation c.375-1GNA after the sequencing of the RPS19 gene was Routine bloods prior to his TURP procedure were within normal found. parameters. The surgery was carried out on 13/11/2018. During the procedure hypotonic sterile solution was used to irrigate. Post- Conclusions procedure, he complained of blurred vision and became hypotensive. His serum sodium was found to have dropped from 142mmol/L prior It is a pure congenital erythroid aplasia of autosomal dominant to admission, to 120 mmol/L. This was managed with NaCl 0.9% and inheritance with incomplete penetrance. It is characterized by furosemide, and his sodium improved to 127mmol/L the following macrocytic anemia without reticulocytosis and decreased erythroid day, with it ultimately increasing to 134mmol/L on the day of precursors in the bone marrow. Differential diagnosis: discharge. erythroblastopenia secondary to infections and transient erythroblastopenia of the infant. The onset of clinical manifestations Conclusions is earlier than in Fanconi anemia, usually appears at 2-3 months of age, but it may be present at birth. Patients are at risk of developing There is an increased risk of TURP syndrome in procedures that malignant diseases. do not use isotonic solutions for irrigation, with prolonged surgical The thoroughness in the exploration and the laboratory tests exposure of the venous sinuses, and with procedures that last over carried out allowed the correct diagnosis. Thanks to the rapid 60 minutes. It occurs in 1-8% of TURP patients and carries a mortality implantation of treatment with red blood cells transfusions, the of 0.2-0.8%. It can present as late as 24 hours post procedure. Bipolar infant´s quality of life improved. Currently, the baby is monitored and resectoscopy can mitigate this risk by allowing for electrolyte- treated with periodic transfusions. containing solutions (the concern being that unipolar resectoscopy may dissipate current with electrolyte-containing solutions), though doi:10.1016/j.cca.2019.03.416 risks of fluid overload remain. doi:10.1016/j.cca.2019.03.415 M149 Acute promyelocytic leukemia. Clinical case report M148 B. De Alba Iriarte, M.E. Redin Sarasola, J. Barado Hualde, R. Cabezon Blackfan-Diamond anemia. Clinical case report Vicente, M.J. Izquierdo Vicente, P. Pascual Usandizaga, R. Oliveros Conejero, A.M. Irurzun Moran B. De Alba Iriartea, M. Lacasta Esaina, I. Perez Casasa, J.A. Wong Clinical Biochemistry Laboratory, Donostia University Hospital, Dono- Artetaa, M.A. Zarco Fernandeza, D. Monzon Casadob, M.M. Gradin stia-San Sebastian, Spain Purroya, M.E. Redin Sarasolaa aClinical Biochemistry Laboratory, Donostia University Hospital, Dono- Background-aim stia-San Sebastian, Spain bImmunology Laboratory, Donostia University Hospital, Donostia-San Acute promyelocytic leukemia (APL) is a subtype of acute Sebastian, Spain myeloid leukemia (AML-M3) that presents specific cell morphology, consumption coagulopathy and hemorrhagic complications. Background-aim Methods Blackfan-Diamond Anemia (BDA) or congenital erythroblastopenia is presented in childhood as severe anemia with an isolated change of 42-year-old man attended to the emergency room due to erythroid series and normality on the rest of blood cell lines. asthenia, febrile sensation and purpuric lesions of 4 days of Abstracts / Clinica Chimica Acta 493 (2019) S199–S259 evolution. No abdominal pain, no apparent infectious focus. No autoimmune diseases). They can present with general symptoms, medical history of interest. arthralgias, renal, neuropathic and cutaneous affectations. Results Methods Emergency blood test altered: A 63-year-old woman came to the emergency department with Lactate dehydrogenase (LDH) 481U/L [135-250], C-reactive pain in the lower limbs and violaceous-blackish color of both feet of protein (CRP) 38.1mg/L [0-5], red blood cells (RBC) 2.15*106/ 2 weeks of evolution associated with functional impotence. Recent ⎧L [4.3-5.6], haemoglobin (Hb) 7.3g/dL [13-17], platelets 9*103/ weight loss of 10 Kg. ⎧L [140-400], leukocytes 3.84*103/⎧L [3.8-10], neutrophils 20% Physical examination: signs of distal ischemia of the lower limbs, [40-75] and 0.76*103/⎧L [1.6 -7.5], monocytes 59% [3.5-12] and with digital necrosis in feet. 2.27*103/⎧L [0.2-0.9]. Large vessel arterial disease is ruled out. Anemia, neutropenia, monocytosis, blasts and thrombocytopenia Analytical: blood count, coagulation study, PCR, liver and kidney forced to check the blood smear.
Recommended publications
  • Table 2. Significant

    Table 2. Significant

    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
  • Potassium Channels in Epilepsy

    Potassium Channels in Epilepsy

    Downloaded from http://perspectivesinmedicine.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Potassium Channels in Epilepsy Ru¨diger Ko¨hling and Jakob Wolfart Oscar Langendorff Institute of Physiology, University of Rostock, Rostock 18057, Germany Correspondence: [email protected] This review attempts to give a concise and up-to-date overview on the role of potassium channels in epilepsies. Their role can be defined from a genetic perspective, focusing on variants and de novo mutations identified in genetic studies or animal models with targeted, specific mutations in genes coding for a member of the large potassium channel family. In these genetic studies, a demonstrated functional link to hyperexcitability often remains elusive. However, their role can also be defined from a functional perspective, based on dy- namic, aggravating, or adaptive transcriptional and posttranslational alterations. In these cases, it often remains elusive whether the alteration is causal or merely incidental. With 80 potassium channel types, of which 10% are known to be associated with epilepsies (in humans) or a seizure phenotype (in animals), if genetically mutated, a comprehensive review is a challenging endeavor. This goal may seem all the more ambitious once the data on posttranslational alterations, found both in human tissue from epilepsy patients and in chronic or acute animal models, are included. We therefore summarize the literature, and expand only on key findings, particularly regarding functional alterations found in patient brain tissue and chronic animal models. INTRODUCTION TO POTASSIUM evolutionary appearance of voltage-gated so- CHANNELS dium (Nav)andcalcium (Cav)channels, Kchan- nels are further diversified in relation to their otassium (K) channels are related to epilepsy newer function, namely, keeping neuronal exci- Psyndromes on many different levels, ranging tation within limits (Anderson and Greenberg from direct control of neuronal excitability and 2001; Hille 2001).
  • Functions of Vertebrate Ferlins

    Functions of Vertebrate Ferlins

    cells Review Functions of Vertebrate Ferlins Anna V. Bulankina 1 and Sven Thoms 2,* 1 Department of Internal Medicine 1, Goethe University Hospital Frankfurt, 60590 Frankfurt, Germany; [email protected] 2 Department of Child and Adolescent Health, University Medical Center Göttingen, 37075 Göttingen, Germany * Correspondence: [email protected] Received: 27 January 2020; Accepted: 20 February 2020; Published: 25 February 2020 Abstract: Ferlins are multiple-C2-domain proteins involved in Ca2+-triggered membrane dynamics within the secretory, endocytic and lysosomal pathways. In bony vertebrates there are six ferlin genes encoding, in humans, dysferlin, otoferlin, myoferlin, Fer1L5 and 6 and the long noncoding RNA Fer1L4. Mutations in DYSF (dysferlin) can cause a range of muscle diseases with various clinical manifestations collectively known as dysferlinopathies, including limb-girdle muscular dystrophy type 2B (LGMD2B) and Miyoshi myopathy. A mutation in MYOF (myoferlin) was linked to a muscular dystrophy accompanied by cardiomyopathy. Mutations in OTOF (otoferlin) can be the cause of nonsyndromic deafness DFNB9. Dysregulated expression of any human ferlin may be associated with development of cancer. This review provides a detailed description of functions of the vertebrate ferlins with a focus on muscle ferlins and discusses the mechanisms leading to disease development. Keywords: dysferlin; myoferlin; otoferlin; C2 domain; calcium-sensor; muscular dystrophy; dysferlinopathy; limb girdle muscular dystrophy type 2B (LGMD2B), membrane repair; T-tubule system; DFNB9 1. Introduction Ferlins belong to the superfamily of proteins with multiple C2 domains (MC2D) that share common functions in tethering membrane-bound organelles or recruiting proteins to cellular membranes. Ferlins are described as calcium ions (Ca2+)-sensors for vesicular trafficking capable of sculpturing membranes [1–3].
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Upregulated Connexin 43 Induced by Loss-Of-Functional S284L-Mutant 4

    Upregulated Connexin 43 Induced by Loss-Of-Functional S284L-Mutant 4

    pharmaceuticals Article Upregulated Connexin 43 Induced by Loss-of-Functional S284L-Mutant α4 Subunit of Nicotinic ACh Receptor Contributes to Pathomechanisms of Autosomal Dominant Sleep-Related Hypermotor Epilepsy Kouji Fukuyama 1, Masashi Fukuzawa 2, Ruri Okubo 1 and Motohiro Okada 1,* 1 Department of Neuropsychiatry, Division of Neuroscience, Graduate School of Medicine, Mie University, Tsu, Mie 514-8507, Japan; [email protected] (K.F.); [email protected] (R.O.) 2 Department of Biology, Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki 036-8560, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-59-231-5018 Received: 8 March 2020; Accepted: 27 March 2020; Published: 29 March 2020 Abstract: To study the pathomechanism and pathophysiology of autosomal dominant sleep-related hypermotor epilepsy (ADSHE), this study determined functional abnormalities of glutamatergic transmission in the thalamocortical motor pathway, from the reticular thalamic nucleus (RTN), motor thalamic nuclei (MoTN) tosecondary motor cortex (M2C) associated with the S286L-mutant α4β2-nicotinic acetylcholine receptor (nAChR) and the connexin43 (Cx43) hemichannel of transgenic rats bearing the rat S286L-mutant Chrna4 gene (S286L-TG), which corresponds to the human S284L-mutant CHRNA4 gene using multiprobe microdialysis, primary cultured astrocytes and a Simple Western system. Expression of Cx43 in the M2C plasma membrane fraction of S286L-TG was upregulated compared with wild-type rats. Subchronic nicotine administration decreased Cx43 expression of wild-type, but did not affect that of S286L-TG; however, zonisamide (ZNS) decreased Cx43 in both wild-type and S286L-TG. Primary cultured astrocytes of wild-type were not affected by subchronic administration of nicotine but was decreased by ZNS.
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • (253), Re15. [DOI: 10.1126/Stke.2532004Re15] 2004

    (253), Re15. [DOI: 10.1126/Stke.2532004Re15] 2004

    The VGL-Chanome: A Protein Superfamily Specialized for Electrical Signaling and Ionic Homeostasis Frank H. Yu and William A. Catterall (5 October 2004) Sci. STKE 2004 (253), re15. [DOI: 10.1126/stke.2532004re15] The following resources related to this article are available online at http://stke.sciencemag.org. This information is current as of 7 July 2009. Article Tools Visit the online version of this article to access the personalization and article tools: http://stke.sciencemag.org/cgi/content/full/sigtrans;2004/253/re15 Supplemental "Supplementary Table 1" Materials http://stke.sciencemag.org/cgi/content/full/sigtrans;2004/253/re15/DC1 Related Content The editors suggest related resources on Science's sites: http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/360/tw376 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/350/pe33 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/333/tw149 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2005/307/pe50 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2005/302/pe46 Downloaded from http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2005/270/tw55 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/233/pe22 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/233/pe23 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/227/pe16 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/219/re4 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2003/194/pe32 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2003/188/re10
  • Ion Channels

    Ion Channels

    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
  • Q829X, a Novel Mutation in the Gene Encoding Otoferlin (OTOF), Is Frequently Found in Spanish Patients with Prelingual Non-Syndr

    Q829X, a Novel Mutation in the Gene Encoding Otoferlin (OTOF), Is Frequently Found in Spanish Patients with Prelingual Non-Syndr

    502 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.39.7.502 on 1 July 2002. Downloaded from Q829X, a novel mutation in the gene encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic hearing loss V Migliosi, S Modamio-Høybjør, M A Moreno-Pelayo, M Rodríguez-Ballesteros, M Villamar, D Tellería, I Menéndez, F Moreno, I del Castillo ............................................................................................................................. J Med Genet 2002;39:502–506 nherited hearing impairment is a highly heterogeneous tial for the application of palliative treatment and special edu- group of disorders with an overall incidence of about 1 in cation. Hence genetic diagnosis and counselling are being I2000 newborns.1 Among them, prelingual, severe hearing increasingly demanded. loss with no other associated clinical feature (non-syndromic) Non-syndromic prelingual deafness is mainly inherited as is by far the most frequent.1 It represents a serious handicap an autosomal recessive trait. To date, 28 different loci for auto- for speech acquisition, and therefore early detection is essen- somal recessive non-syndromic hearing loss have been Table 1 Sequence of primers used for PCR amplification of human OTOF exons Exon Forward primer (5′→3′) Reverse primer (5′→3′) Size (bp) 1 GCAGAGAAGAGAGAGGCGTGTGA AGCTGGCGTCCCTCTGAGACA 203 2 CTGTTAGGACGACTCCCAGGATGA CCAGTGTGTGCCCGCAAGA 239 3 CCCCACGGCTCCTACCTGTTAT GTTGGGAGTGTAGGTCCCCTTTTTA 256 4 GAGTCCTCCCCAAGCAGTCACAG ATTCCCCAGACCACCCCATGT
  • Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis

    Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of Key Pathways and Genes in Dementia via Integrated Bioinformatics Analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract To provide a better understanding of dementia at the molecular level, this study aimed to identify the genes and key pathways associated with dementia by using integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing dataset GSE153960 derived from the Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between patients with dementia and healthy controls were identified. With DEGs, we performed a series of functional enrichment analyses. Then, a protein–protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network was constructed, analyzed and visualized, with which the hub genes miRNAs and TFs nodes were screened out. Finally, validation of hub genes was performed by using receiver operating characteristic curve (ROC) analysis.
  • Therapeutic Approaches to Genetic Ion Channelopathies and Perspectives in Drug Discovery

    Therapeutic Approaches to Genetic Ion Channelopathies and Perspectives in Drug Discovery

    fphar-07-00121 May 7, 2016 Time: 11:45 # 1 REVIEW published: 10 May 2016 doi: 10.3389/fphar.2016.00121 Therapeutic Approaches to Genetic Ion Channelopathies and Perspectives in Drug Discovery Paola Imbrici1*, Antonella Liantonio1, Giulia M. Camerino1, Michela De Bellis1, Claudia Camerino2, Antonietta Mele1, Arcangela Giustino3, Sabata Pierno1, Annamaria De Luca1, Domenico Tricarico1, Jean-Francois Desaphy3 and Diana Conte1 1 Department of Pharmacy – Drug Sciences, University of Bari “Aldo Moro”, Bari, Italy, 2 Department of Basic Medical Sciences, Neurosciences and Sense Organs, University of Bari “Aldo Moro”, Bari, Italy, 3 Department of Biomedical Sciences and Human Oncology, University of Bari “Aldo Moro”, Bari, Italy In the human genome more than 400 genes encode ion channels, which are transmembrane proteins mediating ion fluxes across membranes. Being expressed in all cell types, they are involved in almost all physiological processes, including sense perception, neurotransmission, muscle contraction, secretion, immune response, cell proliferation, and differentiation. Due to the widespread tissue distribution of ion channels and their physiological functions, mutations in genes encoding ion channel subunits, or their interacting proteins, are responsible for inherited ion channelopathies. These diseases can range from common to very rare disorders and their severity can be mild, Edited by: disabling, or life-threatening. In spite of this, ion channels are the primary target of only Maria Cristina D’Adamo, University of Perugia, Italy about 5% of the marketed drugs suggesting their potential in drug discovery. The current Reviewed by: review summarizes the therapeutic management of the principal ion channelopathies Mirko Baruscotti, of central and peripheral nervous system, heart, kidney, bone, skeletal muscle and University of Milano, Italy Adrien Moreau, pancreas, resulting from mutations in calcium, sodium, potassium, and chloride ion Institut Neuromyogene – École channels.
  • A Cell-Based Gene Therapy Approach for Dysferlinopathy Using Sleeping Beauty Transposon

    A Cell-Based Gene Therapy Approach for Dysferlinopathy Using Sleeping Beauty Transposon

    A cell-based gene therapy approach for dysferlinopathy using Sleeping Beauty transposon Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by HELENA ESCOBAR FERNÁNDEZ from León, Spain August 2015 This work was prepared from October 2011 to July 2015 under the supervision of Dr. Zsuzsanna Izsvák (Max-Delbrück Center for Molecular Medicine, Berlin, Germany) and Prof. Simone Spuler (Experimental and Clinical Research Center, Berlin, Germany). All the experiments were conducted in the laboratories of Dr. Izsvák and Prof. Spuler. 1st reviewer: Prof. Dr. med. Simone Spuler Institute for Chemistry and Biochemistry Department of Biology, Chemistry and Pharmacy Freie Universität, Berlin and Department of Muscle Sciences and University Outpatient Clinic for Muscle Disorders Experimental and Clinical Research Center, Berlin 2nd reviewer: Prof. Dr. Sigmar Stricker Institute for Chemistry and Biochemistry Department of Biology, Chemistry and Pharmacy Freie Universität, Berlin and Development and Disease Group Max Planck Institute of Molecular Genetics, Berlin Date of Defense: November 18th, 2015 Preface The experiments with human muscle fiber fragments were done in collaboration with Dr. Andreas Marg, from the laboratory of Prof. Simone Spuler. Dr. Marg performed the isolation of human fiber fragments and the full characterization of the fiber fragment culture model. I performed the mouse irradiation and transplantation of human fiber fragments into mice. Dr. Marg also performed the mouse irradiation and the analysis of all grafted muscles. i ii Acknowledgements First of all, I want to thank Dr. Zsuzsanna Izsvák for supervising this work and giving me opportunity to carry out my PhD in her laboratory.