DOCSLIB.ORG

Protein Studies in Dysferlinopathy Patients Using Llama-Derived Antibody Fragments Selected by Phage Display

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein Studies in Dysferlinopathy Patients Using Llama-Derived Antibody Fragments Selected by Phage Display European Journal of Human Genetics (2005) 13, 721–730 & 2005 Nature Publishing Group All rights reserved 1018-4813/05 $30.00 www.nature.com/ejhg ARTICLE Protein studies in dysferlinopathy patients using llama-derived antibody fragments selected by phage display Yanchao Huang1,4, Peter Verheesen2,4, Andreas Roussis1, Wendy Frankhuizen1, Ieke Ginjaar1, Faye Haldane3, Steve Laval3, Louise VB Anderson3, Theo Verrips2, Rune R Frants1, Hans de Haard2, Kate Bushby3, Johan den Dunnen1 and Silve`re M van der Maarel*,1 1Leiden University Medical Center, Center for Human and Clinical Genetics, Leiden, The Netherlands; 2Department of Molecular and Cellular Biology, University of Utrecht, Utrecht, The Netherlands; 3Institute of Human Genetics, International Centre for Life, Central Parkway, Newcastle upon Tyne, UK Mutations in dysferlin, a member of the fer1-like protein family that plays a role in membrane integrity and repair, can give rise to a spectrum of neuromuscular disorders with phenotypic variability including limb- girdle muscular dystrophy 2B, Myoshi myopathy and distal anterior compartment myopathy. To improve the tools available for understanding the pathogenesis of the dysferlinopathies, we have established a large source of highly specific antibody reagents against dysferlin by selection of heavy-chain antibody fragments originating from a nonimmune llama-derived phage-display library. By utilizing different truncated forms of recombinant dysferlin for selection and diverse selection methodologies, antibody fragments with specificity for two different dysferlin domains could be identified. The selected llama antibody fragments are functional in Western blotting, immunofluorescence microscopy and immunoprecipitation applications. Using these antibody fragments, we found that calpain 3, which shows a secondary reduction in the dysferlinopathies, interacts with dysferlin. European Journal of Human Genetics (2005) 13, 721–730. doi:10.1038/sj.ejhg.5201414 Published online 13 April 2005 Keywords: dysferlin; HCAb; phage display; immunohistochemistry; immunoprecipitation Introduction early age, but show progressive decline in muscle function The limb-girdle muscular dystrophies (LGMD) comprise a and increased muscle weakness from their late teens to large group of clinically and genetically heterogeneous early 20s. Mutations in DYSF not only cause LGMD2B with disorders with autosomal dominant or recessive inheri- prominent involvement of the proximal muscles of the tance. Recessive LGMD2B is typically slowly progressive limb and trunk but also the clinically distinct Myoshi and caused by mutations in the dysferlin gene (DYSF, MIM myopathy (MM),1,2 which mainly affects the posterior 603009).1 Usually, LGMD2B patients appear normal at an distal muscles of the lower limb. Mutations in DYSF were also shown to cause distal anterior compartment myo- pathy (DMAT).3 To date, approximately 100 DYSF muta- *Correspondence: Dr SM van der Maarel, Leiden University Medical Center, Center for Human and Clinical Genetics, Wassenaarseweg 72, tions have been reported (Leiden Muscular Dystrophy 2333 AL Leiden, The Netherlands. pages: http://www.dmd.nl/md.html) and there is no Tel: þ 31 71 527 1915; apparent genotype–phenotype correlation, with consider- Fax: þ 31 71 527 6075; E-mail: [email protected] able intrafamilial clinical heterogeneity.4 4These authors contributed equally to this work Received 13 October 2004; revised 8 February 2005; accepted 22 February Dysferlin is a member of the fer1-like family also 2005 including otoferlin, myoferlin and Fer1L4 and defined by Dysferlin antibody fragments Y Huang et al 722 homology to the Caenorhabditis elegans fer-1 gene.2,5,6 HCAb fragments or single-domain antibody fragments Dysferlin seems to play a crucial role in membrane repair.7 can be produced efficiently by microorganisms such as Dysferlin-null mice develop slowly progressive muscular Escherichia coli15 and Saccharomyces cerevisiae.16 dystrophy with vesicular accumulations and sarcolemmal We have already shown the utility of the selection and disruptions similar to those observed in human dysferlino- use of HCAb fragments from an immune library specific for pathy. Defects in these mice suggest a role for dysferlin in poly(A) binding protein nuclear 1 (PABPN1), which is Ca2 þ -dependent membrane repair. Specifically, these mice mutated in autosomal dominant and recessive oculophar- show an impairment of the process whereby the sarcolem- yngeal muscular dystrophy.17 We describe here the identi- ma of isolated myofibres was resealed following high- fication of HCAb fragments specific for different domains intensity laser irradiation. of dysferlin from a nonimmune library (ie generated from Patients with mutations in dysferlin often show reduc- nonimmunized animals), which eliminates the need for a tion or almost complete absence of dysferlin at the time-consuming immunization protocol. Using these anti- sarcolemmal membrane.8,9 Dysferlin was shown to interact body fragments for protein expression analyses in a panel with caveolin-3,10 which is also a sarcolemmal protein that of proven dysferlinopathy patients, we illustrate the is important for the formation of caveolae and mutated in variable pattern of protein expression in this group and the autosomal dominant LGMD1C.11 Interestingly, abnor- its application in functional analysis of dysferlin. mal intracellular localization of dysferlin can be observed in LGMD1C patients10 as well as other forms of LGMD.9 Only a few antibodies for dysferlin have been reported and Materials and methods the availability of a range of highly specific dysferlin Recombinant antigen production antibodies might facilitate diagnosis and improve the Two recombinant fusion proteins were generated to select understanding of this disease. HCAb fragments. DYSF1 contains amino-acid (aa) residues Typically, monoclonal antibodies are generated in 2–245 and has high homology with myoferlin and hybridoma cell lines, a laborious and expensive process otoferlin, while DYSF2 contains residues 1666–1788 and that has relatively limited application since antibody shows no homology to any known human protein.18 To design is impossible and mouse monoclonal antibodies generate DYSF1, a 740 bp fragment was PCR amplified from can be immunogenic when used in therapies. As an human muscle cDNA with forward primer (50-CGA GAT alternative, phage-display antibody libraries in which CTC TGA GGG TCT TCA TCC TCT ATG-30) and reverse antigen-binding domains are presented by phage particles primer (50-CTC AAG CTT AGC GGT AAC CTT GAC CAC can be screened for the presence of antibody fragments of AGG-30) and cloned into the TOPO 2.1 vector (Invitrogen, interest. As the genetic information is available, phage- Carlsbad, CA, USA). To generate DYSF2, a 375 bp fragment display antibody fragments are amenable to genetic was similarly PCR amplified with forward primer (50-GGA modification including antibody design and humanization TCC CTG GAG AAC AGG CT-30) and reverse primer to overcome immunogenicity.12 (50-GTC GAC CCA CAT CTG CAG CT-30) and also cloned The success of phage-display selections with conven- into TOPO 2.1. tional antibody repertoires strongly depends on the correct To test whether phage-display antibody fragments combination of heavy (VH) and light (VL) chains. How- against DYSF1 crossreact to myoferlin, recombinant myo- ever, construction of phage-display libraries by random ferlin protein (MYOF, aa 2–245) was produced by PCR assembly of VH and VL genes renders most of the amplification of a 740 bp fragment from cDNA clone combinations nonproductive or nonfunctional since the (Clone ID: DKFZp686C16167Q2, RZPD, Berlin, Germany) original VH and VL pairing is lost. Therefore, the with forward primer (50-GGG AAT TCC TGC GAG TGA construction of very large phage libraries is necessary. TTG T-30) and reverse primer (50-GGG AAG CTT AAA CAA An alternative phage-display approach makes use of un- CTC ATC-30) and cloned into the TOPO 2.1 vector. conventional antibody repertoire specific to Camelidae.13 Subsequently, fragments DYSF1, DYSF2 and MYOF were In addition to the conventional IgG repertoire, Camelidae digested with BglII/HindIII, EcoRI/SalI and EcoRI/SalI re- carry a heavy-chain antibody (HCAb) repertoire. HCAbs are striction, respectively, and ligated in the prokaryotic composed of two identical heavy chains and their func- expression vector pET28a (Novagen, Madison, WI, USA). tional antigen-binding domains are solely formed by their All constructs were sequence verified (LGTC, Leiden, The variable domains. This HCAb repertoire is eminently suited Netherlands). for phage-display applications since single-domain anti- Recombinant protein production was carried out in BL21 body fragments derived from the variable region (VHH) of (DE3)-RIL E. coli (Stratagene, La Jolla, CA, USA) according HCAbs represent the smallest naturally occurring intact to the manufacturer’s instructions. After 3.5 h induction, antigen-binding units (17 kDa) reported with antigen- the cells were collected by centrifugation, and lysed with binding affinities fully comparable with those reported BugBuster protein extraction reagent (Novagen) according for intact conventional antibodies.14 Moreover, these to the manufacturer’s instructions. All recombinant pro- European Journal of Human Genetics Dysferlin antibody fragments Y Huang et al 723 tein products were insoluble and purified by virtue of their Subcloning and purification of HCAb fragments hexahistidine tags using
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Functions of Vertebrate Ferlins
    cells Review Functions of Vertebrate Ferlins Anna V. Bulankina 1 and Sven Thoms 2,* 1 Department of Internal Medicine 1, Goethe University Hospital Frankfurt, 60590 Frankfurt, Germany; [email protected] 2 Department of Child and Adolescent Health, University Medical Center Göttingen, 37075 Göttingen, Germany * Correspondence: [email protected] Received: 27 January 2020; Accepted: 20 February 2020; Published: 25 February 2020 Abstract: Ferlins are multiple-C2-domain proteins involved in Ca2+-triggered membrane dynamics within the secretory, endocytic and lysosomal pathways. In bony vertebrates there are six ferlin genes encoding, in humans, dysferlin, otoferlin, myoferlin, Fer1L5 and 6 and the long noncoding RNA Fer1L4. Mutations in DYSF (dysferlin) can cause a range of muscle diseases with various clinical manifestations collectively known as dysferlinopathies, including limb-girdle muscular dystrophy type 2B (LGMD2B) and Miyoshi myopathy. A mutation in MYOF (myoferlin) was linked to a muscular dystrophy accompanied by cardiomyopathy. Mutations in OTOF (otoferlin) can be the cause of nonsyndromic deafness DFNB9. Dysregulated expression of any human ferlin may be associated with development of cancer. This review provides a detailed description of functions of the vertebrate ferlins with a focus on muscle ferlins and discusses the mechanisms leading to disease development. Keywords: dysferlin; myoferlin; otoferlin; C2 domain; calcium-sensor; muscular dystrophy; dysferlinopathy; limb girdle muscular dystrophy type 2B (LGMD2B), membrane repair; T-tubule system; DFNB9 1. Introduction Ferlins belong to the superfamily of proteins with multiple C2 domains (MC2D) that share common functions in tethering membrane-bound organelles or recruiting proteins to cellular membranes. Ferlins are described as calcium ions (Ca2+)-sensors for vesicular trafficking capable of sculpturing membranes [1–3].
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Q829X, a Novel Mutation in the Gene Encoding Otoferlin (OTOF), Is Frequently Found in Spanish Patients with Prelingual Non-Syndr
    502 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.39.7.502 on 1 July 2002. Downloaded from Q829X, a novel mutation in the gene encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic hearing loss V Migliosi, S Modamio-Høybjør, M A Moreno-Pelayo, M Rodríguez-Ballesteros, M Villamar, D Tellería, I Menéndez, F Moreno, I del Castillo ............................................................................................................................. J Med Genet 2002;39:502–506 nherited hearing impairment is a highly heterogeneous tial for the application of palliative treatment and special edu- group of disorders with an overall incidence of about 1 in cation. Hence genetic diagnosis and counselling are being I2000 newborns.1 Among them, prelingual, severe hearing increasingly demanded. loss with no other associated clinical feature (non-syndromic) Non-syndromic prelingual deafness is mainly inherited as is by far the most frequent.1 It represents a serious handicap an autosomal recessive trait. To date, 28 different loci for auto- for speech acquisition, and therefore early detection is essen- somal recessive non-syndromic hearing loss have been Table 1 Sequence of primers used for PCR amplification of human OTOF exons Exon Forward primer (5′→3′) Reverse primer (5′→3′) Size (bp) 1 GCAGAGAAGAGAGAGGCGTGTGA AGCTGGCGTCCCTCTGAGACA 203 2 CTGTTAGGACGACTCCCAGGATGA CCAGTGTGTGCCCGCAAGA 239 3 CCCCACGGCTCCTACCTGTTAT GTTGGGAGTGTAGGTCCCCTTTTTA 256 4 GAGTCCTCCCCAAGCAGTCACAG ATTCCCCAGACCACCCCATGT
    [Show full text]
  • Characterization of the Dysferlin Protein and Its Binding Partners Reveals Rational Design for Therapeutic Strategies for the Treatment of Dysferlinopathies
    Characterization of the dysferlin protein and its binding partners reveals rational design for therapeutic strategies for the treatment of dysferlinopathies Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Sabrina Di Fulvio von Montreal (CAN) Basel, 2013 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Michael Sinnreich Prof. Dr. Martin Spiess Prof. Dr. Markus Rüegg Basel, den 17. SeptemBer 2013 ___________________________________ Prof. Dr. Jörg SchiBler Dekan Acknowledgements I would like to express my gratitude to Professor Michael Sinnreich for giving me the opportunity to work on this exciting project in his lab, for his continuous support and guidance, for sharing his enthusiasm for science and for many stimulating conversations. Many thanks to Professors Martin Spiess and Markus Rüegg for their critical feedback, guidance and helpful discussions. Special thanks go to Dr Bilal Azakir for his guidance and mentorship throughout this thesis, for providing his experience, advice and support. I would also like to express my gratitude towards past and present laB members for creating a stimulating and enjoyaBle work environment, for sharing their support, discussions, technical experiences and for many great laughs: Dr Jon Ashley, Dr Bilal Azakir, Marielle Brockhoff, Dr Perrine Castets, Beat Erne, Ruben Herrendorff, Frances Kern, Dr Jochen Kinter, Dr Maddalena Lino, Dr San Pun and Dr Tatiana Wiktorowitz. A special thank you to Dr Tatiana Wiktorowicz, Dr Perrine Castets, Katherine Starr and Professor Michael Sinnreich for their untiring help during the writing of this thesis. Many thanks to all the professors, researchers, students and employees of the Pharmazentrum and Biozentrum, notaBly those of the seventh floor, and of the DBM for their willingness to impart their knowledge, ideas and technical expertise.
    [Show full text]
  • New Aspects on Patients Affected by Dysferlin Deficient Muscular Dystrophy
    JNNP Online First, published on July 26, 2010 as 10.1136/jnnp.2009.178038 J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.2009.178038 on 14 June 2009. Downloaded from Research paper New aspects on patients affected by dysferlin deficient muscular dystrophy Lars Klinge,1,2 Ahmed Aboumousa,1 Michelle Eagle,1 Judith Hudson,1 Anna Sarkozy,1 Gianluca Vita,1 Richard Charlton,1 Mark Roberts,3 Volker Straub,1 Rita Barresi,1 Hanns Lochmu¨ller,1 Kate Bushby1 1University of Newcastle, ABSTRACT distal muscle groups and vice versa.46The factors Institute of Human Genetics, Mutations in the dysferlin gene lead to limb girdle responsible for these distinct patterns of presenta- International Centre for Life, muscular dystrophy 2B, Miyoshi myopathy and distal tion are unknown. Therefore, further character- Newcastle upon Tyne, UK fi 2Department of Paediatrics and anterior compartment myopathy. A cohort of 36 patients isation of patients with dysferlin de ciency may Paediatric Neurology, University affected by dysferlinopathy is described, in the first UK help to identify possible distinct features within Medical Centre, Go¨ttingen, study of clinical, genetic, pathological and biochemical this entity and might provide clues to underlying Germany 7 3 data. The diagnosis was established by reduction of pathogenetic mechanisms. Greater Manchester fi Neurosciences Centre, Salford, dysferlin in the muscle biopsy and subsequent mutational Dysferlin de cient muscular dystrophy is UK analysis of the dysferlin gene. Seventeen mutations were inherited as an autosomal recessive trait, age of novel; the majority of mutations were small deletions/ onset has been found to be usually young adult- Correspondence to insertions, and no mutational hotspots were identified.
    [Show full text]
  • Analysis of the Dystrophin Interactome
    Analysis of the dystrophin interactome Dissertation In fulfillment of the requirements for the degree “Doctor rerum naturalium (Dr. rer. nat.)” integrated in the International Graduate School for Myology MyoGrad in the Department for Biology, Chemistry and Pharmacy at the Freie Universität Berlin in Cotutelle Agreement with the Ecole Doctorale 515 “Complexité du Vivant” at the Université Pierre et Marie Curie Paris Submitted by Matthew Thorley born in Scunthorpe, United Kingdom Berlin, 2016 Supervisor: Simone Spuler Second examiner: Sigmar Stricker Date of defense: 7th December 2016 Dedicated to My mother, Joy Thorley My father, David Thorley My sister, Alexandra Thorley My fiancée, Vera Sakhno-Cortesi Acknowledgements First and foremost, I would like to thank my supervisors William Duddy and Stephanie Duguez who gave me this research opportunity. Through their combined knowledge of computational and practical expertise within the field and constant availability for any and all assistance I required, have made the research possible. Their overarching support, approachability and upbeat nature throughout, while granting me freedom have made this year project very enjoyable. The additional guidance and supported offered by Matthias Selbach and his team whenever required along with a constant welcoming invitation within their lab has been greatly appreciated. I thank MyoGrad for the collaboration established between UPMC and Freie University, creating the collaboration within this research project possible, and offering research experience in both the Institute of Myology in Paris and the Max Delbruck Centre in Berlin. Vital to this process have been Gisele Bonne, Heike Pascal, Lidia Dolle and Susanne Wissler who have aided in the often complex processes that I am still not sure I fully understand.
    [Show full text]
  • A Cell-Based Gene Therapy Approach for Dysferlinopathy Using Sleeping Beauty Transposon
    A cell-based gene therapy approach for dysferlinopathy using Sleeping Beauty transposon Inaugural-Dissertation to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by HELENA ESCOBAR FERNÁNDEZ from León, Spain August 2015 This work was prepared from October 2011 to July 2015 under the supervision of Dr. Zsuzsanna Izsvák (Max-Delbrück Center for Molecular Medicine, Berlin, Germany) and Prof. Simone Spuler (Experimental and Clinical Research Center, Berlin, Germany). All the experiments were conducted in the laboratories of Dr. Izsvák and Prof. Spuler. 1st reviewer: Prof. Dr. med. Simone Spuler Institute for Chemistry and Biochemistry Department of Biology, Chemistry and Pharmacy Freie Universität, Berlin and Department of Muscle Sciences and University Outpatient Clinic for Muscle Disorders Experimental and Clinical Research Center, Berlin 2nd reviewer: Prof. Dr. Sigmar Stricker Institute for Chemistry and Biochemistry Department of Biology, Chemistry and Pharmacy Freie Universität, Berlin and Development and Disease Group Max Planck Institute of Molecular Genetics, Berlin Date of Defense: November 18th, 2015 Preface The experiments with human muscle fiber fragments were done in collaboration with Dr. Andreas Marg, from the laboratory of Prof. Simone Spuler. Dr. Marg performed the isolation of human fiber fragments and the full characterization of the fiber fragment culture model. I performed the mouse irradiation and transplantation of human fiber fragments into mice. Dr. Marg also performed the mouse irradiation and the analysis of all grafted muscles. i ii Acknowledgements First of all, I want to thank Dr. Zsuzsanna Izsvák for supervising this work and giving me opportunity to carry out my PhD in her laboratory.
    [Show full text]
  • Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*□S
    crossmark Research Author’s Choice © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. This paper is available on line at http://www.mcponline.org Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*□S Rolf Turk‡§¶ʈ**, Jordy J. Hsiao¶, Melinda M. Smits¶, Brandon H. Ng¶, Tyler C. Pospisil‡§¶ʈ**, Kayla S. Jones‡§¶ʈ**, Kevin P. Campbell‡§¶ʈ**, and Michael E. Wright¶‡‡ Mutations in genes encoding components of the sar- The muscular dystrophies are hereditary diseases charac- colemmal dystrophin-glycoprotein complex (DGC) are re- terized primarily by the progressive degeneration and weak- sponsible for a large number of muscular dystrophies. As ness of skeletal muscle. Most are caused by deficiencies in such, molecular dissection of the DGC is expected to both proteins associated with the cell membrane (i.e. the sarco- reveal pathological mechanisms, and provides a biologi- lemma in skeletal muscle), and typical features include insta- cal framework for validating new DGC components. Es- bility of the sarcolemma and consequent death of the myofi- tablishment of the molecular composition of plasma- ber (1). membrane protein complexes has been hampered by a One class of muscular dystrophies is caused by mutations lack of suitable biochemical approaches. Here we present in genes that encode components of the sarcolemmal dys- an analytical workflow based upon the principles of pro- tein correlation profiling that has enabled us to model the trophin-glycoprotein complex (DGC). In differentiated skeletal molecular composition of the DGC in mouse skeletal mus- muscle, this structure links the extracellular matrix to the cle. We also report our analysis of protein complexes in intracellular cytoskeleton.
    [Show full text]
  • ©Ferrata Storti Foundation
    Original Articles T-cell/histiocyte-rich large B-cell lymphoma shows transcriptional features suggestive of a tolerogenic host immune response Peter Van Loo,1,2,3 Thomas Tousseyn,4 Vera Vanhentenrijk,4 Daan Dierickx,5 Agnieszka Malecka,6 Isabelle Vanden Bempt,4 Gregor Verhoef,5 Jan Delabie,6 Peter Marynen,1,2 Patrick Matthys,7 and Chris De Wolf-Peeters4 1Department of Molecular and Developmental Genetics, VIB, Leuven, Belgium; 2Department of Human Genetics, K.U.Leuven, Leuven, Belgium; 3Bioinformatics Group, Department of Electrical Engineering, K.U.Leuven, Leuven, Belgium; 4Department of Pathology, University Hospitals K.U.Leuven, Leuven, Belgium; 5Department of Hematology, University Hospitals K.U.Leuven, Leuven, Belgium; 6Department of Pathology, The Norwegian Radium Hospital, University of Oslo, Oslo, Norway, and 7Department of Microbiology and Immunology, Rega Institute for Medical Research, K.U.Leuven, Leuven, Belgium Citation: Van Loo P, Tousseyn T, Vanhentenrijk V, Dierickx D, Malecka A, Vanden Bempt I, Verhoef G, Delabie J, Marynen P, Matthys P, and De Wolf-Peeters C. T-cell/histiocyte-rich large B-cell lymphoma shows transcriptional features suggestive of a tolero- genic host immune response. Haematologica. 2010;95:440-448. doi:10.3324/haematol.2009.009647 The Online Supplementary Tables S1-5 are in separate PDF files Supplementary Design and Methods One microgram of total RNA was reverse transcribed using random primers and SuperScript II (Invitrogen, Merelbeke, Validation of microarray results by real-time quantitative Belgium), as recommended by the manufacturer. Relative reverse transcriptase polymerase chain reaction quantification was subsequently performed using the compar- Ten genes measured by microarray gene expression profil- ative CT method (see User Bulletin #2: Relative Quantitation ing were validated by real-time quantitative reverse transcrip- of Gene Expression, Applied Biosystems).
    [Show full text]
  • Genetic Modifiers of Hereditary Neuromuscular Disorders
    cells Article Genetic Modifiers of Hereditary Neuromuscular Disorders and Cardiomyopathy Sholeh Bazrafshan 1, Hani Kushlaf 2 , Mashhood Kakroo 1, John Quinlan 2, Richard C. Becker 1 and Sakthivel Sadayappan 1,* 1 Heart, Lung and Vascular Institute, Division of Cardiovascular Health and Disease, Department of Internal Medicine, University of Cincinnati College of Medicine, Cincinnati, OH 45267, USA; [email protected] (S.B.); [email protected] (M.K.); [email protected] (R.C.B.) 2 Department of Neurology and Rehabilitation Medicine, Neuromuscular Center, University of Cincinnati Gardner Neuroscience Institute, University of Cincinnati College of Medicine, Cincinnati, OH 45267, USA; [email protected] (H.K.); [email protected] (J.Q.) * Correspondence: [email protected]; Tel.: +1-513-558-7498 Abstract: Novel genetic variants exist in patients with hereditary neuromuscular disorders (NMD), including muscular dystrophy. These patients also develop cardiac manifestations. However, the association between these gene variants and cardiac abnormalities is understudied. To determine genetic modifiers and features of cardiac disease in NMD patients, we have reviewed electronic medical records of 651 patients referred to the Muscular Dystrophy Association Care Center at the University of Cincinnati and characterized the clinical phenotype of 14 patients correlating with their next-generation sequencing data. The data were retrieved from the electronic medical records of the 14 patients included in the current study and comprised neurologic and cardiac phenotype and genetic reports which included comparative genomic hybridization array and NGS. Novel associations were uncovered in the following eight patients diagnosed with Limb-girdle Muscular Dystrophy, Bethlem Myopathy, Necrotizing Myopathy, Charcot-Marie-Tooth Disease, Peripheral Citation: Bazrafshan, S.; Kushlaf, H.; Kakroo, M.; Quinlan, J.; Becker, R.C.; Polyneuropathy, and Valosin-containing Protein-related Myopathy.
    [Show full text]
  • Fera Is a Membrane-Associating Four-Helix Bundle
    www.nature.com/scientificreports OPEN FerA is a Membrane-Associating Four-Helix Bundle Domain in the Ferlin Family of Membrane-Fusion Received: 4 March 2018 Accepted: 4 July 2018 Proteins Published: xx xx xxxx Faraz M. Harsini1, Sukanya Chebrolu1, Kerry L. Fuson1, Mark A. White 2, Anne M. Rice3 & R. Bryan Sutton 1,4 Ferlin proteins participate in such diverse biological events as vesicle fusion in C. elegans, fusion of myoblast membranes to form myotubes, Ca2+-sensing during exocytosis in the hair cells of the inner ear, and Ca2+-dependent membrane repair in skeletal muscle cells. Ferlins are Ca2+-dependent, phospholipid-binding, multi-C2 domain-containing proteins with a single transmembrane helix that spans a vesicle membrane. The overall domain composition of the ferlins resembles the proteins involved in exocytosis; therefore, it is thought that they participate in membrane fusion at some level. But if ferlins do fuse membranes, then they are distinct from other known fusion proteins. Here we show that the central FerA domain from dysferlin, myoferlin, and otoferlin is a novel four-helix bundle fold with its own Ca2+-dependent phospholipid-binding activity. Small-angle X-ray scattering (SAXS), spectroscopic, and thermodynamic analysis of the dysferlin, myoferlin, and otoferlin FerA domains, in addition to clinically-defned dysferlin FerA mutations, suggests that the FerA domain interacts with the membrane and that this interaction is enhanced by the presence of Ca2+. Ferlins are a relatively new class of large, multi-domain, type II transmembrane proteins that have been implicated in a wide variety of biological functions centered on membrane fusion events.
    [Show full text]