DOCSLIB.ORG

Characterization of the Dysferlin Protein and Its Binding Partners Reveals Rational Design for Therapeutic Strategies for the Treatment of Dysferlinopathies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of the Dysferlin Protein and Its Binding Partners Reveals Rational Design for Therapeutic Strategies for the Treatment of Dysferlinopathies Characterization of the dysferlin protein and its binding partners reveals rational design for therapeutic strategies for the treatment of dysferlinopathies Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Sabrina Di Fulvio von Montreal (CAN) Basel, 2013 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Michael Sinnreich Prof. Dr. Martin Spiess Prof. Dr. Markus Rüegg Basel, den 17. SeptemBer 2013 ___________________________________ Prof. Dr. Jörg SchiBler Dekan Acknowledgements I would like to express my gratitude to Professor Michael Sinnreich for giving me the opportunity to work on this exciting project in his lab, for his continuous support and guidance, for sharing his enthusiasm for science and for many stimulating conversations. Many thanks to Professors Martin Spiess and Markus Rüegg for their critical feedback, guidance and helpful discussions. Special thanks go to Dr Bilal Azakir for his guidance and mentorship throughout this thesis, for providing his experience, advice and support. I would also like to express my gratitude towards past and present laB members for creating a stimulating and enjoyaBle work environment, for sharing their support, discussions, technical experiences and for many great laughs: Dr Jon Ashley, Dr Bilal Azakir, Marielle Brockhoff, Dr Perrine Castets, Beat Erne, Ruben Herrendorff, Frances Kern, Dr Jochen Kinter, Dr Maddalena Lino, Dr San Pun and Dr Tatiana Wiktorowitz. A special thank you to Dr Tatiana Wiktorowicz, Dr Perrine Castets, Katherine Starr and Professor Michael Sinnreich for their untiring help during the writing of this thesis. Many thanks to all the professors, researchers, students and employees of the Pharmazentrum and Biozentrum, notaBly those of the seventh floor, and of the DBM for their willingness to impart their knowledge, ideas and technical expertise. Many thanks to Dr Patrick Matthias and Gabriele Matthias at the FMI for their assistance with the HDAC6 project, as well as to Dr Eric ShouBridge, Tim Johns, Steven Salomon and Christian Therrien at McGill University, Montreal for their generous technical assistance. Special thanks to Beat Erne and Michael Abanto for sharing their confocal microscopy expertise with me. A huge thank you to my family and friends for their endless love, support and patience throughout my studies. I am especially grateful to my parents for their daily encouragement and unwavering confidence in me. i Summary Dysferlinopathies are incuraBle recessively inherited muscular dystrophies caused By loss of the dysferlin protein. Dysferlin is essential for the plasma membrane repair of skeletal muscle cells and is required for myotuBe formation. To design treatment strategies for dysferlinopathies, we studied dysferlin’s molecular Biology and characterized the functionality of dysferlin’s seven C2 domains, its degradation pathway and its interaction with a novel protein, histone deacetylase 6. The results indicate that dysferlin and histone deacetylase 6 form a triad interaction with alpha-tuBulin to modulate the acetylated alpha-tuBulin levels of muscle cells, which may play a regulatory role during myotuBe formation. Furthermore, the characterization of dysferlin’s C2 domains revealed that there is functional redundancy in their aBility to localize dysferlin to, and effect repair of, the plasma membrane. Taking these results into consideration, we designed shorter, functional dysferlin molecules for usage in gene therapy. To find a novel pharmacological therapy for patients with dysferlin deficiency, we investigated the inhibition of dysferlin’s degradation pathway. We demonstrated that when salvaged from proteasomal degradation, missense mutated dysferlin retained its Biological activities for plasmalemmal localization, plasmalemmal repair and myotuBe formation. Further studies using recombinant missense mutated dysferlin constructs showed that certain missense mutants are intrinsically Biologically active; whereas others lack functionality even when their levels are increased by transient transfection or By inhibiting their proteasomal degradation. Proteasomal inhiBition represents a novel potential pharmacological treatment strategy for patients with dysferlin deficiency. ii Table of Contents Acknowledgements ......................................................................................................................... i Summary ........................................................................................................................................... ii List of Abbreviations ...................................................................................................................... v List of Figures ................................................................................................................................. vi List of Tables .................................................................................................................................. vii Preface ............................................................................................................................................... 1 CHAPTER 1 ....................................................................................................................................... 5 1. Literature Review .................................................................................................................. 5 1.1 The Dystrophin-Glycoprotein Complex (DGC) .................................................................... 5 1.2 Muscular Dystrophies caused by defective muscle membrane integrity ................... 7 1.3 Limb Girdle Muscular Dystrophies caused by defective muscle membrane repair 10 1.4 Dysferlinopathies ....................................................................................................................... 10 1.4.1 Dysferlin discovery and phylogeny .................................................................................. 13 1.4.1 Mammalian Ferlin Proteins and Disease ........................................................................ 13 1.4.2 Dysferlin structure ................................................................................................................. 17 1.4.3 Dysferlin function ................................................................................................................... 19 1.5 Current treatments for dysferlinopathies ......................................................................... 20 1.5.1 Gene therapy strategies for dysferlinopathies ............................................................. 20 1.5.1.1 Full-length protein reconstitution ................................................................................. 20 1.5.1.2 Adeno-associated virus-mediated gene transfer ..................................................... 21 1.5.1.3 Exon skipping strategies ................................................................................................... 22 1.6 Objectives ...................................................................................................................................... 24 CHAPTER 2 ..................................................................................................................................... 25 2 Dysferlin interacts with histone deacetylase 6 and increases alpha-tubulin acetylation ............................................................................................................................................... 25 2.1 Preface ............................................................................................................................................ 26 2.2 Abstract .......................................................................................................................................... 27 2.3 Introduction ................................................................................................................................. 28 2.4 Results ............................................................................................................................................ 29 2.5 Discussion ..................................................................................................................................... 35 2.6 Experimental Procedures ........................................................................................................ 38 2.7 Acknowledgements .................................................................................................................... 41 2.8 Figures and Figure Legends .................................................................................................... 42 CHAPTER 3 ..................................................................................................................................... 57 3 Modular dispensability of dysferlin C2 domains reveals rational design for mini- dysferlin molecules .............................................................................................................................. 57 3.1 Preface ............................................................................................................................................ 58 3.2 Abstract .......................................................................................................................................... 59 3.3 Introduction ................................................................................................................................
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Phylogenetic Analysis Reveals an Ancient Gene Duplication As The
    1 Phylogenetic analysis reveals an ancient gene duplication as 2 the origin of the MdtABC efflux pump. 3 4 Kamil Górecki1, Megan M. McEvoy1,2,3 5 1Institute for Society & Genetics, 2Department of MicroBiology, Immunology & Molecular 6 Genetics, and 3Molecular Biology Institute, University of California, Los Angeles, CA 90095, 7 United States of America 8 Corresponding author: [email protected] (M.M.M.) 9 1 10 Abstract 11 The efflux pumps from the Resistance-Nodulation-Division family, RND, are main 12 contributors to intrinsic antibiotic resistance in Gram-negative bacteria. Among this family, the 13 MdtABC pump is unusual by having two inner membrane components. The two components, 14 MdtB and MdtC are homologs, therefore it is evident that the two components arose by gene 15 duplication. In this paper, we describe the results obtained from a phylogenetic analysis of the 16 MdtBC pumps in the context of other RNDs. We show that the individual inner membrane 17 components (MdtB and MdtC) are conserved throughout the Proteobacterial species and that their 18 existence is a result of a single gene duplication. We argue that this gene duplication was an ancient 19 event which occurred before the split of Proteobacteria into Alpha-, Beta- and Gamma- classes. 20 Moreover, we find that the MdtABC pumps and the MexMN pump from Pseudomonas aeruginosa 21 share a close common ancestor, suggesting the MexMN pump arose by another gene duplication 22 event of the original Mdt ancestor. Taken together, these results shed light on the evolution of the 23 RND efflux pumps and demonstrate the ancient origin of the Mdt pumps and suggest that the core 24 bacterial efflux pump repertoires have been generally stable throughout the course of evolution.
    [Show full text]
  • The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
    International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts.
    [Show full text]
  • Treatment of Aged Mice and Long-Term Durability of AAV-Mediated Gene Therapy in Two Mouse Models of LGMD Eric R
    P.137 Treatment of Aged Mice and Long-term Durability of AAV-Mediated Gene Therapy in Two Mouse Models of LGMD Eric R. Pozsgai, Danielle A. Griffin, Ellyn L. Peterson, Amber Kempton, Oliver Rogers, Young-Eun Seo, Louise R. Rodino-Klapac Sarepta Therapeutics, Inc., Cambridge, Massachusetts, USA BACKGROUND RESULTS RESULTS (CONT’D) • The sarcoglycanopathies are a subset of autosomal recessive limb-girdle muscular dystrophies (LGMD) Figure 1. Expression analysis: Immunofluorescence staining and western blot on skeletal • Functional improvement was observed with significantly increased resistance to contraction-induced injury resulting from mutations in the sarcoglycans (α, β, γ, and δ-SG) leading to protein deficiency, loss of in the TA muscle (Figure 3). formation of the sarcoglycan complex, and loss of stabilization of the dystrophin-associated protein muscle indicating biomarker expression in aged, severely diseased muscle complex (DAPC). Figure 3. Functional analysis: Protection of force output following long-term treatment of • Sarcoglycanopathies present as progressive muscular dystrophies starting in the girdle muscles before aged SGCA-/- mice with severely diseased muscle extending to lower and upper extremity muscles, and can also present in the diaphragm and heart, resulting in respiratory and cardiac failure in specific patient subtypes. SKELETAL MUSCLE • Adeno-associated virus (AAV)-mediated gene transfer therapy has shown early signs of potential to treat sarcoglycanopathies. Key considerations include a systematic and stepwise
    [Show full text]
  • 2.04.132 Genetic Testing for Limb-Girdle Muscular Dystrophies
    Medical Policy MP 2.04.132 Genetic Testing for Limb-Girdle Muscular Dystrophies BCBSA Ref. Policy: 2.04.132 Related Policies Last Review: 05/27/2021 2.04.86 Genetic Testing for Duchenne and Becker Effective Date: 05/27/2021 Muscular Dystrophy Section: Medicine 2.04.105 Genetic Testing for Facioscapulohumeral Muscular Dystrophy 2.04.570 Genetic Counseling DISCLAIMER/INSTRUCTIONS FOR USE Medical policy provides general guidance for applying Blue Cross of Idaho benefit plans (for purposes of medical policy, the terms “benefit plan” and “member contract” are used interchangeably). Coverage decisions must reference the member specific benefit plan document. The terms of the member specific benefit plan document may be different than the standard benefit plan upon which this medical policy is based. If there is a conflict between a member specific benefit plan and the Blue Cross of Idaho’s standard benefit plan, the member specific benefit plan supersedes this medical policy. Any person applying this medical policy must identify member eligibility, the member specific benefit plan, and any related policies or guidelines prior to applying this medical policy, including the existence of any state or federal guidance that may be specific to a line of business. Blue Cross of Idaho medical policies are designed for informational purposes only and are not an authorization, explanation of benefits or a contract. Receipt of benefits is subject to satisfaction of all terms and conditions of the member specific benefit plan coverage. Blue Cross of Idaho reserves the sole discretionary right to modify all its policies and guidelines at any time.
    [Show full text]
  • The Protein Import Machinery of Mitochondria-A Regulatory Hub In
    Cell Metabolism Perspective The Protein Import Machinery of Mitochondria—A Regulatory Hub in Metabolism, Stress, and Disease Angelika B. Harbauer,1,2,3,4 Rene´ P. Zahedi,5 Albert Sickmann,5,6 Nikolaus Pfanner,1,4,* and Chris Meisinger1,4,* 1Institut fu¨ r Biochemie und Molekularbiologie, ZBMZ 2Trinationales Graduiertenkolleg 1478 3Faculty of Biology 4BIOSS Centre for Biological Signalling Studies Universita¨ t Freiburg, 79104 Freiburg, Germany 5Leibniz-Institute for Analytical Sciences–ISAS–e.V., 44139 Dortmund, Germany 6Medizinisches Proteom-Center, Ruhr-Universita¨ t Bochum, 44801 Bochum, Germany *Correspondence: [email protected] (N.P.), [email protected] (C.M.) http://dx.doi.org/10.1016/j.cmet.2014.01.010 Mitochondria fulfill central functions in bioenergetics, metabolism, and apoptosis. They import more than 1,000 different proteins from the cytosol. It had been assumed that the protein import machinery is constitu- tively active and not subject to detailed regulation. However, recent studies indicate that mitochondrial protein import is regulated at multiple levels connected to cellular metabolism, signaling, stress, and patho- genesis of diseases. Here, we discuss the molecular mechanisms of import regulation and their implications for mitochondrial homeostasis. The protein import activity can function as a sensor of mitochondrial fitness and provides a direct means of regulating biogenesis, composition, and turnover of the organelle. Introduction machinery is essential for the viability
    [Show full text]
  • Beta Sarcoglycan (SGCB) (NM 000232) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC120022 beta Sarcoglycan (SGCB) (NM_000232) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: beta Sarcoglycan (SGCB) (NM_000232) Human Untagged Clone Tag: Tag Free Symbol: SGCB Synonyms: A3b; LGMD2E; LGMDR4; SGC Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_000232, the custom clone sequence may differ by one or more nucleotides ATGGCGGCAGCGGCGGCGGCGGCTGCAGAACAGCAAAGTTCCAATGGTCCTGTAAAGAAGTCCATGCGTG AGAAGGCTGTTGAGAGAAGGAGTGTCAATAAAGAGCACAACAGTAACTTTAAAGCTGGATACATTCCGAT TGATGAAGATCGTCTCCACAAAACAGGGTTGAGAGGAAGAAAGGGCAATTTAGCCATCTGTGTGATTATC CTCTTGTTTATCCTGGCTGTCATCAATTTAATAATAACACTTGTTATTTGGGCCGTGATTCGCATTGGAC CAAATGGCTGTGATAGTATGGAGTTTCATGAAAGTGGCCTGCTTCGATTTAAGCAAGTATCTGACATGGG AGTGATCCACCCTCTTTATAAAAGCACAGTAGGAGGAAGGCGAAATGAAAATTTGGTCATCACTGGCAAC AACCAGCCTATTGTTTTTCAGCAAGGGACAACAAAGCTCAGTGTAGAAAACAACAAAACTTCTATTACAA GTGACATCGGCATGCAGTTTTTTGACCCGAGGACTCAAAATATCTTATTCAGCACAGACTATGAAACTCA TGAGTTTCATTTGCCAAGTGGAGTGAAAAGTTTGAATGTTCAAAAGGCATCTACTGAAAGGATTACCAGC AATGCTACCAGTGATTTAAATATAAAAGTTGATGGGCGTGCTATTGTGCGTGGAAATGAAGGTGTATTCA TTATGGGCAAAACCATTGAATTTCACATGGGTGGTAATATGGAGTTAAAGGCGGAAAACAGTATCATCCT AAATGGATCTGTGATGGTCAGCACCACCCGCCTACCCAGTTCCTCCAGTGGAGACCAGTTGGGTAGTGGT GACTGGGTACGCTACAAGCTCTGCATGTGTGCTGATGGGACGCTCTTCAAGGTGCAAGTAACCAGCCAGA
    [Show full text]
  • Altered Ca2+ Handling and Oxidative Stress Underlie Mitochondrial Damage and Skeletal Muscle Dysfunction in Aging and Disease
    H OH metabolites OH Review Altered Ca2+ Handling and Oxidative Stress Underlie Mitochondrial Damage and Skeletal Muscle Dysfunction in Aging and Disease Antonio Michelucci 1,*, Chen Liang 2 , Feliciano Protasi 3 and Robert T. Dirksen 2 1 DNICS, Department of Neuroscience, Imaging, and Clinical Sciences, University G. d’Annunzio of Chieti-Pescara, I-66100 Chieti, Italy 2 Department of Pharmacology and Physiology, School of Medicine and Dentistry, University of Rochester Medical Center, Rochester, NY 14642, USA; [email protected] (C.L.); [email protected] (R.T.D.) 3 CAST, Center for Advanced Studies and Technology, DMSI, Department of Medicine and Aging Sciences, University G. d’Annunzio of Chieti-Pescara, I-66100 Chieti, Italy; [email protected] * Correspondence: [email protected] Abstract: Skeletal muscle contraction relies on both high-fidelity calcium (Ca2+) signals and robust capacity for adenosine triphosphate (ATP) generation. Ca2+ release units (CRUs) are highly organized junctions between the terminal cisternae of the sarcoplasmic reticulum (SR) and the transverse tubule (T-tubule). CRUs provide the structural framework for rapid elevations in myoplasmic Ca2+ during excitation–contraction (EC) coupling, the process whereby depolarization of the T-tubule membrane triggers SR Ca2+ release through ryanodine receptor-1 (RyR1) channels. Under conditions of local Citation: Michelucci, A.; Liang, C.; or global depletion of SR Ca2+ stores, store-operated Ca2+ entry (SOCE) provides an additional 2+ Protasi, F.; Dirksen, R.T. Altered Ca source of Ca2+ that originates from the extracellular space. In addition to Ca2+, skeletal muscle also Handling and Oxidative Stress requires ATP to both produce force and to replenish SR Ca2+ stores.
    [Show full text]
  • Limb-Girdle Muscular Dystrophy
    www.ChildLab.com 800-934-6575 LIMB-GIRDLE MUSCULAR DYSTROPHY What is Limb-Girdle Muscular Dystrophy? Limb-Girdle Muscular Dystrophy (LGMD) is a group of hereditary disorders that cause progressive muscle weakness and wasting of the shoulders and pelvis (hips). There are at least 13 different genes that cause LGMD, each associated with a different subtype. Depending on the subtype of LGMD, the age of onset is variable (childhood, adolescence, or early adulthood) and can affect other muscles of the body. Many persons with LGMD eventually need the assistance of a wheelchair, and currently there is no cure. How is LGMD inherited? LGMD can be inherited by autosomal dominant (AD) or autosomal recessive (AR) modes. The AR subtypes are much more common than the AD types. Of the AR subtypes, LGMD2A (calpain-3) is the most common (30% of cases). LGMD2B (dysferlin) accounts for 20% of cases and the sarcoglycans (LGMD2C-2F) as a group comprise 25%-30% of cases. The various subtypes represent the different protein deficiencies that can cause LGMD. What testing is available for LGMD? Diagnosis of the LGMD subtypes requires biochemical and genetic testing. This information is critical, given that management of the disease is tailored to each individual and each specific subtype. Establishing the specific LGMD subtype is also important for determining inheritance and recurrence risks for the family. The first step in diagnosis for muscular dystrophy is usually a muscle biopsy. Microscopic and protein analysis of the biopsy can often predict the type of muscular dystrophy by analyzing which protein(s) is absent. A muscle biopsy will allow for targeted analysis of the appropriate LGMD gene(s) and can rule out the diagnosis of the more common dystrophinopathies (Duchenne and Becker muscular dystrophies).
    [Show full text]
  • Sudden Cardiac Death: Use of Genetics in the Diagnosis
    Sudden Cardiac Death: Use of Genetics in the diagnosis Ramon Brugada MD PhD [email protected] “Genetic testing is expensive; the system can not afford it” However, the real question is can we, physicians, afford not doing it? CORONARY ARTERY DISEASE CAUSES 80% OF SUDDEN CARDIAC DEATHS What do young people die from? From the patient to the research laboratory BRUGADA SYNDROME SHORT QT SCN5A SYNDROME KCNH2 HYPERTROPHIC LONG QT CARDIOMYOPATHY SYNDROME MYOSIN HEAVY CHAIN KCNQ1 DILATED CARDIOMYOPATHY MARFAN SYNDROME LAMIN A/C FIBRILLIN-1 Genetics of Sudden Cardiac Death Hypertrophic Cardiomyopathy Assymetric hypertrophy of the left ventricle. Most common cause of sudden cardiac death in the athlete. Steve R. Ommen, and Bernard J. Gersh Eur Heart J 2009 Dilated Cardiomyopathy Gene Symbol Gene Symbol Cardiac α-actin ACTC Telethonin (T-cap) TCAP β-Myosin heavy chain MYH α-Sarcoglycan SGCA Cardiac troponin T TNNT2 β-Sarcoglycan SGCB α-Tropomyosin TPM1 δ-Sarcoglycan SGCD Titin TTN Dystrophin DMD Arrhythmogenic Right Ventricular Dysplasia Right ventricular dilatation Fibro adipose myocardial substitution Sudden death often the first symptom Sudden Cardiac Death: Electrical Short QT syndrome Brugada syndrome CPVT Long QT syndrome Long QT syndrome: Diagnosis Short QT syndrome: Diagnosis Gollob MH et al. J Am Coll Cardiol 2011 Catecholaminergic polymorphic ventricular tachycardia Brugada Syndrome Diagnosis Genetic diseases associated with sudden cardiac death CARDIOMYOPATHIES CHANNELOPATHIES Sudden Death: Monogenic diseases Diseases associated with
    [Show full text]
  • Anti-SGCA Picoband Antibody Catalog # ABO12191
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Anti-SGCA Picoband Antibody Catalog # ABO12191 Specification Anti-SGCA Picoband Antibody - Product Information Application WB Primary Accession Q16586 Host Rabbit Reactivity Human, Mouse, Rat Clonality Polyclonal Format Lyophilized Description Rabbit IgG polyclonal antibody for Alpha-sarcoglycan(SGCA) detection. Tested with WB in Human;Mouse;Rat. Reconstitution Add 0.2ml of distilled water will yield a Anti- SGCA Picoband antibody, ABO12191, concentration of 500ug/ml. Western blottingAll lanes: Anti SGCA (ABO12191) at 0.5ug/mlLane 1: Rat Skeletal Muscle Tissue Lysate at 50ugLane 2: Mouse Anti-SGCA Picoband Antibody - Additional Skeletal Muscle Tissue Lysate at Information 50ugPredicted bind size: 43KDObserved bind size: 43KD Gene ID 6442 Other Names Anti-SGCA Picoband Antibody - Alpha-sarcoglycan, Alpha-SG, 50 kDa Background dystrophin-associated glycoprotein, 50DAG, Adhalin, Dystroglycan-2, SGCA, ADL, DAG2 Alpha-sarcoglycan is a protein that in humans is encoded by the SGCA gene. This gene Calculated MW encodes a component of the 42875 MW KDa dystrophin-glycoprotein complex (DGC), which is critical to the stability of muscle fiber Application Details membranes and to the linking of the actin Western blot, 0.1-0.5 µg/ml, Mouse, Rat, cytoskeleton to the extracellular matrix. Its Human<br> expression is thought to be restricted to striated muscle. Mutations in this gene result in Subcellular Localization type 2D autosomal recessive limb-girdle Cell membrane, sarcolemma ; Single-pass muscular dystrophy. Multiple transcript type I membrane protein . Cytoplasm, variants encoding different isoforms have been cytoskeleton . found for this gene.
    [Show full text]
  • Functional Significance of Gain-Of-Function H19 Lncrna in Skeletal Muscle Differentiation and Anti-Obesity Effects Yajuan Li1†, Yaohua Zhang1†, Qingsong Hu1, Sergey D
    Li et al. Genome Medicine (2021) 13:137 https://doi.org/10.1186/s13073-021-00937-4 RESEARCH Open Access Functional significance of gain-of-function H19 lncRNA in skeletal muscle differentiation and anti-obesity effects Yajuan Li1†, Yaohua Zhang1†, Qingsong Hu1, Sergey D. Egranov1, Zhen Xing1,2, Zhao Zhang3, Ke Liang1, Youqiong Ye3, Yinghong Pan4,5, Sujash S. Chatterjee4, Brandon Mistretta4, Tina K. Nguyen1, David H. Hawke6, Preethi H. Gunaratne4, Mien-Chie Hung7,8, Leng Han3,9, Liuqing Yang1,10,11* and Chunru Lin1,10* Abstract Background: Exercise training is well established as the most effective way to enhance muscle performance and muscle building. The composition of skeletal muscle fiber type affects systemic energy expenditures, and perturbations in metabolic homeostasis contribute to the onset of obesity and other metabolic dysfunctions. Long noncoding RNAs (lncRNAs) have been demonstrated to play critical roles in diverse cellular processes and diseases, including human cancers; however, the functional importance of lncRNAs in muscle performance, energy balance, and obesity remains elusive. We previously reported that the lncRNA H19 regulates the poly-ubiquitination and protein stability of dystrophin (DMD) in muscular dystrophy. Methods: Here, we identified mouse/human H19-interacting proteins using mouse/human skeletal muscle tissues and liquid chromatography–mass spectrometry (LC-MS). Human induced pluripotent stem-derived skeletal muscle cells (iPSC-SkMC) from a healthy donor and Becker Muscular Dystrophy (BMD) patients were utilized to study DMD post-translational modifications and associated proteins. We identified a gain-of-function (GOF) mutant of H19 and characterized the effects on myoblast differentiation and fusion to myotubes using iPSCs.
    [Show full text]