DOCSLIB.ORG

Snapshot: Mtorc1 Signaling at the Lysosomal Surface Liron Bar-Peled and David M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Snapshot: Mtorc1 Signaling at the Lysosomal Surface Liron Bar-Peled and David M 1390 Cell SnapShot: mTORC1 Signaling at the 151 , December 7,2012©2012 ElsevierInc. DOI http://dx.doi.org/10.1016/j.cell.2012.11.038 Lysosomal Surface Liron Bar-Peled and David M. Sabatini Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, MA 02142, USA Nutrient signaling Wnt Growth Leu signaling factor signaling TNF signaling Amino Gln Wnt Tyrosine acids Frizzled IGF kinase TNFD receptor TNF receptor DNA Energy levels O levels SLC1A5 SLC7A5 2 damage ATP/AMP PIP2 Pten Amino acid mTORC1 Dsh1 IRS1 transporter Gln (inactive) GRB2 SOS PI3K PIP3 Gln Redd1 p53 LKB1 GEF GSK3 activity Leu GTP Ras NF1 PDK1 GAP Sestrin Movement to the activity RagAGTP lysosomal surface Movement AMPK Raf GDP away from Rapamycin RagA the lysosomal surface FKBP12 Mek Erk1/2 Rsk1 Akt1 IKK` v-ATPase GEF activity CYTOPLASM RagAGTP mTORC1 Ragulator GTP GAP activity GDP TSC complex RagC (active) Rheb Tumor suppressor Oncogene mTORC1 substrate ? Growth DOWNSTREAM CELLULAR PROGRAMS REGULATED BY mTORC1 ACTIVITY See online version for legend and references. S6K1 Amino acids LYSOSOME Protein synthesis 4EBP1 COMPLEXES AT THE LYSOSOMAL SURFACE HIF1_ Energy metabolism A B A E E G G pras40 deptor Lysosome biogenesis A BB MP1 HBXIP TSC1 TBC1D7 TFEB p14 C7orf59 raptor H mLST8 Lipin-1 D C Lipid p18 biosynthesis a d F mTOR TSC2 SREBP1/2 c cc ATG13 FIP200 Autophagy Lysosomal v-ATPase Ragulator complex mTORC1 TSC complex ULK1 SnapShot: mTORC1 Signaling at the Lysosomal Surface Liron Bar-Peled and David M. Sabatini Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, MA 02142, USA In mammals, the mTOR complex 1 (mTORC1) ser/thr kinase regulates cellular and organismal growth in response to a variety of environmental and intracellular stimuli. Amino acid levels mediate the first step in the bipartite activation of mTORC1 by promoting its translocation from a cytosolic compartment to the lysosomal surface. By a poorly understood mechanism, amino acid sensing initiates from within the lysomal lumen and, in a process requiring the v-ATPase, activates the GEF activity of the Ragulator complex toward RagA within the heterodimeric Rag GTPases. Upon GTP binding, RagA recruits mTORC1 to the lysosomal surface, allowing it to interact with the small GTPase Rheb, a potent stimulator of mTORC1 kinase activity. Regulation of nucleotide binding state of Rheb by the tumor suppressor TSC, which is found at the lysosomal surface, is the second step in the activation of mTORC1. Many of the environmental and intracellular cues that impinge on mTORC1 funnel through TSC and regulate its GAP activity toward Rheb. Among them, growth factor signaling through the PI3K or Ras pathways leads to the activation of the protein kinases Akt and Rsk1, respectively, which phosphorylate and inhibit TSC function. The AMPK pathway becomes activated upon low energy levels and in a p53-dependent manner by DNA damage, leading to phosphorylation and activation of TSC and phosphorylation and inactivation of mTORC1. Reduction in oxygen levels induces Redd1 expression, which by an ill-defined process maintains TSC function. Once activated, mTORC1 enables growth by promoting anabolic programs while repressing catabolic processes. mTORC1 phosphorylates key effectors such as z1 and 4EBP1 to activate translation and inhibits autophagy by phosphorylating and inactivating ATG13 and ULK1. As a master regulator of cell metabolism, deregulation of the mTORC1 pathway is common in many human diseases. Cancers with aberrant mTORC1 activity, such as tuberous sclerosis and advanced renal cell carcinoma, are increasingly treated with analogs of the mTORC1 inhibitor Rapamycin. Furthermore, overactivation of this pathway leads to the downregulation of IRS1 and progression of type 2 diabetes. Although the mTORC1 pathway is absolutely required for mammalian development, reduction of mTORC1 activity in mice models through pharmacological inhibition not only enhances adult stem cell numbers, function, or both, but also extends murine life span. Abbreviations mTOR, mechanistic target of rapamycin; raptor, regulatory associated protein of mTOR; mLST8, mammalian lethal with SEC13 protein 8; pras40, proline-rich Akt substrate 40 kDa; Rheb, ras homolog enriched in brain; TSC, tuberous sclerosis complex; Rag, ras-related GTP binding; MP1, MAPK scaffold protein 1; HBXIP, hepatitis B virus X-interacting protein; v-ATPase, vacuolar H+-adenosine triphosphatase ATPase; GEF, guanine nucleotide exchange factor; GAP, GTPase-activating protein; ULK1, unc-51-like kinase 1; ATG13, autophagy-related protein 13; FIP200, FAK family kinase-interacting protein of 200 kDA; S6K1, p70 ribosomal S6 kinase 1; 4EBP1, 4E-binding protein 1; Redd, protein regulated in development and DNA damage response 1; TFEB, transcription factor EB; HIF1a, hypoxia-inducible factor 1a; LKB1, serine/threonine-protein kinase STK11; SREBP1, sterol regulatory element binding protein-1; AMPK, 5´-AMP-activated protein kinase; PIP2, phosphatidylinositol 4,5-bisphosphate; PIP3, phosphatidylinositol 3,4,5-trisphosphate; PTEN, phosphatase and tensin homolog; PI3K, phosphatidylinositol 3-kinase; GRB2, growth factor receptor-bound protein 2; SOS, son-of-sevenless; NF1, neurofibromin 1; PDK1, phosphoinositide dependent kinase 1; IRS1, insulin receptor substrate 1; IGF, insulin-like growth factor; TNFa, tumor necrosis factor a; IKKB, inhibitor of nuclear factor k-B kinase subunit b; WNT, wingless; Dsh1, dishevelled 1; GSK3, glycogen synthase kinase 3; TK, tyrosine kinase; SLC1A5, solute carrier family 1 member 5; SLC7A5, solute carrier family 7 member 5; FKBP12, FK506-binding protein 12 KDa. REFERENCES Bar-Peled, L., Schweitzer, L.D., Zoncu, R., and Sabatini, D.M. (2012). Ragulator is a GEF for the rag GTPases that signal amino acid levels to mTORC1. Cell 150, 1196–1208. Dibble, C.C., Elis, W., Menon, S., Qin, W., Klekota, J., Asara, J.M., Finan, P.M., Kwiatkowski, D.J., Murphy, L.O., and Manning, B.D. (2012). TBC1D7 is a third subunit of the TSC1-TSC2 complex upstream of mTORC1. Mol. Cell 47, 535–546. Harrison, D.E., Strong, R., Sharp, Z.D., Nelson, J.F., Astle, C.M., Flurkey, K., Nadon, N.L., Wilkinson, J.E., Frenkel, K., Carter, C.S., et al. (2009). Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. Nature 460, 392–395. Laplante, M., and Sabatini, D.M. (2012). mTOR signaling in growth control and disease. Cell 149, 274–293. Loewith, R., and Hall, M.N. (2011). Target of rapamycin (TOR) in nutrient signaling and growth control. Genetics 189, 1177–1201. Ma, X.M., and Blenis, J. (2009). Molecular mechanisms of mTOR-mediated translational control. Nat. Rev. Mol. Cell Biol. 10, 307–318. Mihaylova, M.M., and Shaw, R.J. (2011). The AMPK signalling pathway coordinates cell growth, autophagy and metabolism. Nat. Cell Biol. 13, 1016–1023. Nobukuni, T., Joaquin, M., Roccio, M., Dann, S.G., Kim, S.Y., Gulati, P., Byfield, M.P., Backer, J.M., Natt, F., Bos, J.L., et al. (2005). Amino acids mediate mTOR/raptor signaling through activation of class 3 phosphatidylinositol 3OH-kinase. Proc. Natl. Acad. Sci. USA 102, 14238–14243. Reiling, J.H., and Hafen, E. (2004). The hypoxia-induced paralogs Scylla and Charybdis inhibit growth by down-regulating S6K activity upstream of TSC in Drosophila. Genes Dev. 18, 2879–2892. Russell, R.C., Fang, C., and Guan, K.L. (2011). An emerging role for TOR signaling in mammalian tissue and stem cell physiology. Development 138, 3343–3356. 1390.e1 Cell 151, December 7, 2012 ©2012 Elsevier Inc. DOI http://dx.doi.org/10.1016/j.cell.2012.11.038.
Load more

Recommended publications
  • Adaptive Stress Signaling in Targeted Cancer Therapy Resistance
    Oncogene (2015) 34, 5599–5606 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Adaptive stress signaling in targeted cancer therapy resistance E Pazarentzos1,2 and TG Bivona1,2 The identification of specific genetic alterations that drive the initiation and progression of cancer and the development of targeted drugs that act against these driver alterations has revolutionized the treatment of many human cancers. Although substantial progress has been achieved with the use of such targeted cancer therapies, resistance remains a major challenge that limits the overall clinical impact. Hence, despite progress, new strategies are needed to enhance response and eliminate resistance to targeted cancer therapies in order to achieve durable or curative responses in patients. To date, efforts to characterize mechanisms of resistance have primarily focused on molecular events that mediate primary or secondary resistance in patients. Less is known about the initial molecular response and adaptation that may occur in tumor cells early upon exposure to a targeted agent. Although understudied, emerging evidence indicates that the early adaptive changes by which tumor cells respond to the stress of a targeted therapy may be crucial for tumo r cell survival during treatment and the development of resistance. Here we review recent data illuminating the molecular architecture underlying adaptive stress signaling in tumor cells. We highlight how leveraging this knowledge could catalyze novel strategies to minimize
    [Show full text]
  • Regulation of the Mammalian Target of Rapamycin Complex 2 (Mtorc2)
    Regulation of the Mammalian Target Of Rapamycin Complex 2 (mTORC2) Inauguraldissertation Zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Klaus-Dieter Molle aus Heilbronn, Deutschland Basel, 2006 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät Auf Antrag von Prof. Michael N. Hall und Prof. Markus Affolter. Basel, den 21.11.2006 Prof. Hans-Peter Hauri Dekan Summary The growth controlling mammalian Target of Rapamycin (mTOR) is a conserved Ser/Thr kinase found in two structurally and functionally distinct complexes, mTORC1 and mTORC2. The tumor suppressor TSC1-TSC2 complex inhibits mTORC1 by acting on the small GTPase Rheb, but the role of TSC1-TSC2 and Rheb in the regulation of mTORC2 is unclear. Here we examined the role of TSC1-TSC2 in the regulation of mTORC2 in human embryonic kidney 293 cells. Induced knockdown of TSC1 and TSC2 (TSC1/2) stimulated mTORC2-dependent actin cytoskeleton organization and Paxillin phosphorylation. Furthermore, TSC1/2 siRNA increased mTORC2-dependent Ser473 phosphorylation of plasma membrane bound, myristoylated Akt/PKB. This suggests that loss of Akt/PKB Ser473 phosphorylation in TSC mutant cells, as reported previously, is due to inhibition of Akt/PKB localization rather than inhibition of mTORC2 activity. Amino acids and overexpression of Rheb failed to stimulate mTORC2 signaling. Thus, TSC1-TSC2 also inhibits mTORC2, but possibly independently of Rheb. Our results suggest that mTORC2 hyperactivation may contribute to the pathophysiology of diseases such as cancer and Tuberous Sclerosis Complex. i Acknowledgement During my PhD studies in the Biozentrum I received a lot of support from many people around me who I mention here to express my gratefulness.
    [Show full text]
  • Lymphocyte/WBC-Based Comprehensive Testing Via Next-Gen Sequencing NF1/SPRED1 and Other Rasopathy Related Conditions on Blood/Saliva
    Last Updated October 2019 Institutional Price TAT Genetic Test CPT Codes Z codes Specimen Requirements (USD$) (working days) Lymphocyte/WBC-based Comprehensive Testing via Next-Gen Sequencing NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for the NF1 gene (NF1-NG) This testing includes an average coverage of >1600x to allow for the identification of (1) 3-6ml whole blood in EDTA (purple topped) tubes mosaicism as low as 3-5% of the alleles. In addition, novel variants identified in the $1,000 81408 25 (2) Oragene 575 saliva kit (provided by the MGL) ZB6A9 NF1 gene will be confirmed via RNA-based analysis at no additional charge. RNA- $1,600 (RUSH) 81479 15 (RUSH) (3) DNA sample (25ul volume at 3ug, O.D. value at based testing will also be provided to non-founder, multigenerational families with 260:280 ≥1.8) “classic” NF1 at no additional charge if next-generation sequencing is found negative. (1) 3-6ml whole blood in EDTA (purple topped) tubes SPRED1-only NGS testing and copy number analysis for SPRED1 (SPD1-NG) $800 81405 25 (2) Oragene 575 saliva kit (provided by the MGL) This testing includes an average coverage of >1600x to allow for the identification of ZB6AC $1,400 (RUSH) 81479 15 (RUSH) (3) DNA sample (25ul volume at 3ug, O.D. value at mosaicism as low as 3-5% of the alleles after comprehensive NF1 analysis. 260:280 ≥1.8) NF1/SPRED1 NGS testing and copy number analysis for NF1 and SPRED1 (NFSP-NG) (1) 3-6ml whole blood in EDTA (purple topped) tubes 81408 This testing includes an average coverage of >1600x to allow for the identification of $1,100 25 (2) Oragene 575 saliva kit (provided by the MGL) 81405 ZB6A8 mosaicism as low as 3-5% of the alleles.
    [Show full text]
  • TSC1/TSC2 Signaling in the CNS ⇑ Juliette M
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 585 (2011) 973–980 journal homepage: www.FEBSLetters.org Review TSC1/TSC2 signaling in the CNS ⇑ Juliette M. Han, Mustafa Sahin The F.M. Kirby Neurobiology Center, Department of Neurology, Children’s Hospital Boston, Harvard Medical School, Boston, MA 02115, USA article info abstract Article history: Over the past several years, the study of a hereditary tumor syndrome, tuberous sclerosis complex Received 5 January 2011 (TSC), has shed light on the regulation of cellular proliferation and growth. TSC is an autosomal Revised 1 February 2011 dominant disorder that is due to inactivating mutations in TSC1 or TSC2 and characterized by benign Accepted 1 February 2011 tumors (hamartomas) involving multiple organ systems. The TSC1/2 complex has been found to play Available online 15 February 2011 a crucial role in an evolutionarily-conserved signaling pathway that regulates cell growth: the Edited by Wilhelm Just mTORC1 pathway. This pathway promotes anabolic processes and inhibits catabolic processes in response to extracellular and intracellular factors. Findings in cancer biology have reinforced the critical role for TSC1/2 in cell growth and proliferation. In contrast to cancer cells, in the CNS, the Keywords: mTOR TSC1/2 complex not only regulates cell growth/proliferation, but also orchestrates an intricate and Autism finely tuned system that has distinctive roles under different conditions, depending on cell type, Translation stage of development, and subcellular localization. Overall, TSC1/2 signaling in the CNS, via its multi-faceted roles, contributes to proper neural connectivity.
    [Show full text]
  • Mtor: a Pharmacologic Target for Autophagy Regulation
    mTOR: a pharmacologic target for autophagy regulation Young Chul Kim, Kun-Liang Guan J Clin Invest. 2015;125(1):25-32. https://doi.org/10.1172/JCI73939. Review mTOR, a serine/threonine kinase, is a master regulator of cellular metabolism. mTOR regulates cell growth and proliferation in response to a wide range of cues, and its signaling pathway is deregulated in many human diseases. mTOR also plays a crucial role in regulating autophagy. This Review provides an overview of the mTOR signaling pathway, the mechanisms of mTOR in autophagy regulation, and the clinical implications of mTOR inhibitors in disease treatment. Find the latest version: https://jci.me/73939/pdf The Journal of Clinical Investigation REVIEW SERIES: AUTOPHAGY Series Editor: Guido Kroemer mTOR: a pharmacologic target for autophagy regulation Young Chul Kim and Kun-Liang Guan Department of Pharmacology and Moores Cancer Center, UCSD, La Jolla, California, USA. mTOR, a serine/threonine kinase, is a master regulator of cellular metabolism. mTOR regulates cell growth and proliferation in response to a wide range of cues, and its signaling pathway is deregulated in many human diseases. mTOR also plays a crucial role in regulating autophagy. This Review provides an overview of the mTOR signaling pathway, the mechanisms of mTOR in autophagy regulation, and the clinical implications of mTOR inhibitors in disease treatment. Overview of mTOR signaling pathway such as insulin and IGF activate their cognate receptors (recep- Nutrients, growth factors, and cellular energy levels are key deter- tor tyrosine kinases [RTKs]) and subsequently activate the PI3K/ minants of cell growth and proliferation. mTOR, a serine/threon- AKT signaling axis.
    [Show full text]
  • Mutational Spectrum of the TSC1 Gene in a Cohort of 225 Tuberous Sclerosis Complex Patients: J Med Genet: First Published As 10.1136/Jmg.36.4.285 on 1 April 1999
    J Med Genet 1999;36:285–289 285 Mutational spectrum of the TSC1 gene in a cohort of 225 tuberous sclerosis complex patients: J Med Genet: first published as 10.1136/jmg.36.4.285 on 1 April 1999. Downloaded from no evidence for genotype-phenotype correlation Marjon van Slegtenhorst, Senno Verhoef, Anita Tempelaars, Lida Bakker, Qi Wang, Marja Wessels, Remco Bakker, Mark Nellist, Dick Lindhout, Dicky Halley, Ans van den Ouweland Abstract TSC1 locus on chromosome 9q34 and the Tuberous sclerosis complex is an inherited other half to the TSC2 locus on chromosome tumour suppressor syndrome, caused by a 16p13.67 The TSC1 and TSC2 genes were mutation in either the TSC1 or TSC2 identified by positional cloning89 and there is gene. The disease is characterised by a abundant evidence that both genes act as broad phenotypic spectrum that can in- tumour suppressor genes.10–13 clude seizures, mental retardation, renal The TSC2 gene consists of 41 exons, dysfunction, and dermatological abnor- spanning 43 kb of genomic DNA.14 It encodes malities. The TSC1 gene was recently a 200 kDa protein, tuberin, which has a identified and has 23 exons, spanning 45 putative GAP activity for rab515 and rap1,16 two kb of genomic DNA, and encoding an 8.6 members of the ras superfamily of small kb mRNA. After screening all 21 coding GTPases. The mutational spectrum of TSC2 exons in our collection of 225 unrelated includes a number of large deletions often dis- 17 18 patients, only 29 small mutations were rupting the PKD1 gene as well, but also 19–27 detected, suggesting that TSC1 mutations point mutations and a number of missense 28 are under-represented among TSC pa- changes.
    [Show full text]
  • Mutation Analysis of Son of Sevenless in Juvenile Myelomonocytic Leukemia
    Letters to the Editor 1108 3 Licht JD. Reconstructing a disease: what essential features of the the development of acute promyelocytic leukemia in transgenic retinoic acid receptor fusion oncoproteins generate acute promye- mice. Proc Natl Acad Sci USA 2000; 97: 13306–13311. locytic leukemia? Cancer Cell 2006; 9: 73–74. 10 Sternsdorf T, Phan VT, Maunakea ML, Ocampo CB, Sohal J, 4 Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J et al. Silletto A et al. Forced retinoic acid receptor alpha homodimers A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 prime mice for APL-like leukemia. Cancer Cell 2006; 9: 81–94. genes as a therapeutic target of imatinib in idiopathic hypereosino- 11 Kwok C, Zeisig BB, Dong S, So CW. Forced homo-oligomerization philic syndrome. N Engl J Med 2003; 348: 1201–1214. of RARalpha leads to transformation of primary hematopoietic 5 Kaufmann I, Martin G, Friedlein A, Langen H, Keller W. Human cells. Cancer Cell 2006; 9: 95–108. Fip1 is a subunit of CPSF that binds to U-rich RNA elements and 12 Palaniswamy V, Moraes KC, Wilusz CJ, Wilusz J. Nucleophosmin stimulates poly(A) polymerase. EMBO J 2004; 23: 616–626. is selectively deposited on mRNA during polyadenylation. Nat 6 Sainty D, Liso V, Cantu-Rajnoldi A, Head D, Mozziconacci MJ, Struct Mol Biol 2006; 13: 429–435. Arnoulet C et al. A new morphologic classification system for acute 13 Rego EM, Ruggero D, Tribioli C, Cattoretti G, Kogan S, Redner RL promyelocytic leukemia distinguishes cases with underlying PLZF/ et al.
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Immersion Course Lecture Kelly
    Genomic Counseling in the research setting Kelly East, MS CGC Genetic Counselor HudsonAlpha Institute for Biotechnology single gene disorders • mutation in a single gene leads to disease • often has characteristic family inheritance patterns J Neurol Neurosurg Psychiatry 2002;73:ii5-ii11 Genes that code for hemoglobin 1 2 3 4 5 HBB 6 7 8 9 10 11 12 HBA2 13 14 15 16 17 18 19 20 21 22 X Y http://www.genome.gov/glossary/resources/karyotype.pdf TARDBP Genes associated ALS2 with ALS 1 2 3 4 5 C9ORF72 OPTN FIG4 ATXN2 SETX 6 7 8 9 10 11 12 ANG SPG11 FUS 13 14 15 16 17 18 VAPB UBQLN2 SOD1 19 20 21 22 X Y http://www.genome.gov/glossary/resources/karyotype.pdf complex traits • most common traits and diseases have a complex etiology • causative risks can include genetic changes (both large and small scale) environmental factors (head injury, nutrition, exposure to toxins) societal factors (death of family member, abuse, hardships) • in most cases - not triggered by a change in a single gene but rather by the interaction of several genetic, environmental and societal risks spectrum of human genetic conditions CGTATACCGGGTCATGCACGTGTAGAGCGAGTTAGCTCGCTGGCTAAAGAGGGTCGAC ATCCGCGAGTTTATGAGGAAGAATCGGCAGCTTGACCGAAGAGGCGTGGTAAGACCCG TTAGGGATCGTATACCGGGTCATGCACGTGTAGAGCGAGTTAGCTCGCTGGCTAAAGA GGGTCGACATCCGCGAGTTTATGAGGAAGAATCGGCAGCTTGACCGAAGAGGCGTGGT AAGACCCGTTAGGGATCGTATACCGGGTCATGCACGTGTAGAGCGAGTTAGCTCGCTG GCTAAAGAGGGTCGACATCCGCGAGTTTATGAGGAAGAATCGGCAGCTTGACCGAAGA GGCGTGGTAAGACCCGTTAGGGATCGTATACCGGGTCATGCACGTGTAGAGCGAGTTA in patients with a suspected genetic
    [Show full text]
  • Tuberous Sclerosis Complex: Molecular Pathogenesis and Animal Models
    Neurosurg Focus 20 (1):E4, 2006 Tuberous sclerosis complex: molecular pathogenesis and animal models LEANDRO R. PIEDIMONTE, M.D., IAN K. WAILES, M.D., AND HOWARD L. WEINER, M.D. Division of Pediatric Neurosurgery, Department of Neurosurgery, New York University School of Medicine, New York, New York Mutations in one of two genes, TSC1 and TSC2, result in a similar disease phenotype by disrupting the normal inter- action of their protein products, hamartin and tuberin, which form a functional signaling complex. Disruption of these genes in the brain results in abnormal cellular differentiation, migration, and proliferation, giving rise to the charac- teristic brain lesions of tuberous sclerosis complex (TSC) called cortical tubers. The most devastating complications of TSC affect the central nervous system and include epilepsy, mental retardation, autism, and glial tumors. Relevant animal models, including conventional and conditional knockout mice, are valuable tools for studying the normal func- tions of tuberin and hamartin and the way in which disruption of their expression gives rise to the variety of clinical features that characterize TSC. In the future, these animals will be invaluable preclinical models for the development of highly specific and efficacious treatments for children affected with TSC. KEY WORDS • tuberous sclerosis • pathogenesis • animal model Tuberous sclerosis complex is an autosomal-dominant zures, mental retardation, and autism.1,51 The number and tumor predisposition syndrome that affects approximately location of cortical tubers and the patient’s age at seizure 1 in 7500 individuals worldwide.19 The TSC is character- onset are highly correlated with neurological outcomes.1,30 ized by benign hamartomatous growths in multiple organs, Epilepsy occurs in approximately 80% of affected indi- including the kidney, skin, retina, lung, and brain.
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]