Supporting Information

Barquilla et al. 10.1073/pnas.0802668105 SI Materials and Methods The purification of recombinant GST proteins using glutathione Bioinformatics, Plasmids Constructs, and Cell Lines. Searches for T. Sepharose 4B (Amersham) was performed according to the brucei TOR, raptor, AVO3, and FKBP12 orthologues were manufacturer’s instructions and the proteins were dialyzed performed using GeneDB (www.genedb.org) and NCBI Blast against PBS. (www.ncbi.nlm.nih.gov/BLAST/). Motif analyses were carried out using InterPro and Prosite. Antibodies. Mouse anti-TbFKBP12 monoclonal antibodies and GeneDB database accession numbers of these orthologues rabbit polyclonal anti-TOR antibodies were produced by inject- are: TbTOR1 (Tb10.6k15.2060), TbTOR2 (Tb927.4.420), ing the recombinant proteins into a BALB-C mouse or rabbit TbTOR-like 1 (Tb927.4.800), TbTOR-like 2 (Tb927.1.1930), using standard immunization protocols. Experiments involving TbRaptor (Tb11.03.0460), TbAVO3 (Tb927.8.3200), animals were approved by the National Animal Research Com- TbFKBP12 (Tb927.7.3420), and TbRaptor-like (Tb927.1.2190). mittee. Anti-TbFKBP12 antibodies were raised against the DNA fragments (400–700 bp) of the TbTOR1, TbTOR2, whole protein fused to GST, and hybridomes F12–3C7H11 and TbTOR-like 1, TbRaptor, TbAVO3, TbFKBP12, and TbRaptor- F12–7D10 H8 were selected by standard monoclonal selection like were amplified by PCR using pairs of specific primers (Table procedures as anti-TbFKBP12 monoclonal antibody producers. S1) and cloned into pGEM-T (Promega). All constructs were Anti-TbTOR antibodies were raised against nonhomologous sequenced to confirm that the subcloned DNA fragments had no TbTOR CЈ-terminal regions between the kinase domain and the mutations. The sequence corresponding to the entire ORF was FATC domain (TbTOR1: amino acid 2292–2412; TbTOR2: taken from the T.brucei genome database at the Institute for amino acid 2302–2432; TbTOR-like 1: amino acid 2443–2571) Genomic Research Trypanosoma brucei Genome Project. fused to GST. Polyclonal sera were affinity purified by coupling For RNAi experiments, p2T7 Bla vector (kindly donated by A. the recombinant proteins to a solid resin (AminoLink Plus Este´vez, Granada, Spain) was used to generate stable blood- Immobilization Kit; Pierce Chemical). Affinity-purified antibod- stream cell lines for the Tet-inducible expression of a double- ies were incubated with glutathione sephadex coupled to GST to stranded RNA (1, 2) of TbTOR1, TbTOR2, TbAVO3 and adsorb anti-GST antibodies. TbRaptor. The ‘‘single-marker’’ cell line (3) was transfected with linearized p2T7 Bla constructs targeted for integration into the Immunofluorescence. Three-dimensional immunofluorescence ribosomal spacer and grown in HMI-9 supplemented with and the deconvolution of the 3D data are described before (5). ␮ blasticidin (5 g/ml). Several cloned cell lines from each con- Cells were permeabilized with 1% Nonidet P-40 (TbRPA1 IF) struction were analyzed and each exhibited the same phenotype or 0.1% Nonidet P-40 (TbTOR1, TbTOR2, and TbBiP IF) for upon RNAi induction with doxicycline. Depletion of the 20 min. Rabbit polyclonal antibodies anti-TbTOR1 (1:800), TbTOR1 and TbTOR2 proteins was assessed by Western blot. anti-TbTOR2 (1:500), anti-TbRPA1 (1:800), anti-TbBiP For expression of carboxi-terminal myc-tagged proteins, we (1:5,000) (6), anti-TbActin (1:500) (7) were diluted as indicated used p2myc3Hyg plasmid, which contains the sequence coding in 0.5% blocking reagent (Roche). For colocalization studies, for two myc epitopes and pHD1146 backbone (4) (kindly anti-TbTOR1, anti-TbTOR2, and anti-TbBiP were conjugated donated by A. Estevez and C. Clayton, Heidelberg, Germany) using the Zenon Tricolor Labeling Kit (Molecular Probes) lacking of both procyclin and ribosomal promoters. A 500-bp according to the manufacturer’s instructions. fragment corresponding to the 3Ј region of each one of the TbRaptor, TbAVO3 or TbRaptor-like genes was cloned into Electron Microscopy. About 108 bloodstream forms of T. brucei p2myc3Hyg plasmid (details and sequence of p2myc3Hyg are were harvested and washed twice with cold PBS. The parasites available upon request). Targeted integration by homologous recombination of p2myc3Hyg-derived constructs was achieved were fixed on ice for1hwith2.5% glutaraldehyde, 4% para- by linearization within the ORF 3Ј region of each gene. The formaldehyde, in 0.1-M sodium cacodylate buffer (pH 7.3) and single marker cell line was transfected with linearized p2myc- then embedded in epoxy resin, sectioned, and stained using 3HYG constructs and clones were selected with hygromycin (2.5 standard methods. Images were acquired on a Zeiss EM 902 or ␮g/ml) (Invivogen). Expression of genes coding for myc-tagged Philips CM-10 transmission electron microscope. proteins was driven by endogenous transcription and confirmed by immunoblotting with anti-myc antibody clone 9E10 (Sigma), In Vitro Rapamycin Sensitivity Assays. Trypanosomes were cultured which detected proteins of 150, 170, and 180 KD corresponding for 72 h in the presence of the indicated concentrations of to TbRaptor, TbAVO3, and TbRaptor-like respectively. rapamycin. After this growth period, cells were counted using a Trypanosoma brucei bloodstream (Molteno Institute Trypano- Coulter particle counter (Beckman Coulter). Assays were per- zoon antigenic type 1.2, MITat 1.2, clone 221a), culture medium, formed at least three times. EC50 values were determined by DNA transfections, and selection procedures were described using Sigma Plot for Windows, Version 8.0 (Systat Software). previously in (3). Endocytosis Assay. To follow receptor-mediated endocytosis, Al- Expression of Recombinant Proteins. DNA sequences were sub- exa 488-ConA (Molecular Probes) uptake was performed basi- cloned into the pGEX-4T-2 expression vector (Amersham) and cally as described before (8). Samples (1.5 ϫ 106 cells) were transformed into the E. coli strain BL21(DE3) pLysS (Strat- collected, centrifuged (1,400 ϫ g at 4°C for 5 min), and washed agene). Bacteria were grown at 36°C to an OD600 of 0.6, shifted in Voorheis’ modifies PBS (VPBS). Parasites were preincubated to 16°C, and induced with 0.1-mM isopropyl-␤-d-thiogalactopy- at 4°C or 37°C for 30 min in 1 ml of serum-free HMI9 ranoside for 16 h. Cells were lysed in 1ϫ PBS, 1-mM DTT, 1-mM supplemented with 1% BSA. Alexa 488-Con A was then added EGTA, 1-mM PMSF, EDTA-free protease inhibitor mixture for another 30 min at a final concentration of 10 ␮g/ml at the (Roche), and 0.5% N-lauroyl sarcosil (for rabbit immunization) appropriate temperature. The parasites were washed once in or 0.05% Tween-20 (for the FKBP12-rapamycin binding assay). ice-cold VBPS and then fixed in 3% PFA/VPBS at 4°C for 1 h.

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 1of10 Cell fluorescence was analyzed using a Leica SP5 inverted Cellquest software (BD Biosciences). Gating was determined confocal microscope and by FACS analysis (see below). with control cells for each experiment and the same values were used for all treated cells. Percentage of cells in each phase of the FACS Analysis. For cell cycle analysis, samples (1.5 ϫ 106 cells) cell cycle was determined according to the procedure described were collected, centrifuged (1,400 ϫ g at 4°C for 5 min), and previously (9). The same cell samples were fixed in 4% para- washed in trypanosome dilution buffer (TDB). The cell pellets formaldehyde, stained with DAPI, and examined under a Zeiss were gently suspended in 50 ␮l of TDB and permeabilized by fluorescence microscope for a tabulation of numbers of nuclei adding 1 ␮l of saponin (25 mg/ml) for 3 min. It was then mixed and kinetoplasts in individual cells and a count of cells with with another 450 ␮l of TDB. RNase and propidium iodide (PI) different morphologies from a population of 200 cells. were added to the suspension to the final concentrations of 10 For Con A endocytosis analysis, ConA-Alexa 488 fluores- and 20 ␮g/ml, respectively and incubated at room temperature cence intensity was measured in 5,000 cells per sample. Only cells for 30 min. Then, cells were stored at 4°C before the FACS below the FSC mean peak were sorted and analyzed to exclude analysis. The DNA content of PI-stained cells (10,000 cells per abnormal, large, multinucleated cells. Same region for gathering sample) was analyzed with a FACScan flow cytometer using the was used for all samples.

1. Wang Z, Morris JC, Drew ME, Englund PT (2000) Inhibition of Trypanosoma brucei gene 7. Garcia-Salcedo JA, et al. (2004) A differential role for actin during the life cycle of expression by RNA interference using an integratable vector with opposing T7 pro- Trypanosoma brucei. EMBO J 23:780–789. moters. J Biol Chem 275:40174–40179. 8. Jeffries TR, Morgan GW, Field MC (2001) A developmentally regulated rab11 homo- 2. Shi H, et al. (2000) Genetic interference in Trypanosoma brucei by heritable and logue in Trypanosoma brucei is involved in recycling processes. J Cell Sci 114:2617– inducible double-stranded RNA. Rna 6:1069–1076. 2626. 3. Wirtz E, Leal S, Ochatt C, Cross GA (1999) A tightly regulated inducible expression 9. Ormerod MG (1996) Flow Cytometry, a Practical Approach (Oxford Univ Press, Oxford), system for conditional gene knock-outs and dominant-negative genetics in Trypano- 2nd Ed. soma brucei. Mol Biochem Parasitol 99:89–101. 10. Sarbassov DD, et al. (2004) Rictor, a novel binding partner of mTOR, deﬁnes a rapa- 4. Estevez AM, Kempf T, Clayton C (2001) The exosome of Trypanosoma brucei. EMBO J mycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. 20:3831–3839. Curr Biol 14:1296–1302. 5. Landeira D, Navarro M (2007) Nuclear repositioning of the VSG promoter during developmental silencing in Trypanosoma brucei. J Cell Biol 176:133–139. 11. Choi J, et al. (1996) Structure of the FKBP12-rapamycin complex interacting with the 6. Bangs JD, Uyetake L, Brickman MJ, Balber AE, Boothroyd JC (1993) Molecular cloning binding domain of human FRAP. Science 273:239–242. and cellular localization of a BiP homologue in Trypanosoma brucei divergent ER retention signals in a lower eukaryote. J Cell Sci 105(Pt 4):1101–1113.

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 2of10 Total (%) HEAT HEAT FAT FRB Kinase FATC aa Protein 100 2549 mTOR 100 100 100 100 29 2432 TbTOR1 25 25 55 58 31 2412 TbTOR2 25 37 50 42 34 PDZ 2595 TbTOR-like 1 20 14 45 42 27 2903 TbTOR-like 2 21 43 40

Fig. S1. Schematic representation of the structural features of trypanosome TOR orthologues and mTOR. Underlined values indicate the percentage of identity with mTOR. Each value below the FAT/FATC, FRB, and kinase domains represents the identity of the domain compared with that of mTOR. The PDZ domain in TbTOR-like 1 is shown between the HEAT and FAT domains. No FRB domain was detected in TbTOR-like 2.

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 3of10 TbTOR1 TbTOR2 TbTOR-like 1 BS PC BS PC BS PC Af. P. antiserum

Tubulin

Preserum

Tubulin

Fig. S2. Western blot analysis of the expression of TbTOR1, TbTOR2, and TbTOR-like 1 in T. brucei bloodstream (BS) and procyclic (PC) forms using afﬁnity puriﬁed antisera (Af. P. Antiserum).

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 4of10 A)

Identity (%) RNC HEAT WD40 WD40 repeat HEAT repeat H. sapiens 100 1335 aa

S. cerevisiae 37 1557 aa

S. pombe 40 1312 aa

T. brucei 20 1319 aa

T. brucei-like 16 1747 aa

Identity (%)

H. sapiens 100 1324567 5 55 1708 aa

S. cerevisiae 17 1324567 5 55 1430 aa

S. pombe 211324567 5 55 1309 aa

T. brucei 131 24565 55 1405 aa

Fig. S3. Schematic representation of the structural features of putative trypanosome raptor and AVO3 orthologues. (A) Putative raptor orthologues in T. brucei. The raptor N-terminal conserved (RNC) regions are shown in blue. No conserved HEAT domains were detected in TbRaptor-like protein using Pfam. The seven HEAT repeats found in H. sapiens, S. cerevisiae, and S. pombe are not detected in putative trypanosome orthologues. (B) Characteristic domain architecture of AVO3 homologs is present in TbAVO3. Five of the seven domains with sequence conservation in AVO3 orthologues proposed by Sarbassov and colleagues (10) are found in the TbAVO3 sequence.

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 5of10 A

TbTOR1 RNAi Tbraptor RNAi 80 80 C ontrol (Unind.) C ontrol (Unind.) TbTOR1 RNAi (Ind.) Tbraptor RNAi (ind.) 70 Control (Unind.) 70 Control (Unind.) Tbraptor RNAi (Ind.) TbTOR1 RNAi (ind.) 60 60 50 50

40 40 %cells % cells 30 30 20 20

10 10 0 G2/M G2/M

TbTOR2 RNAi TbAVO3 RNAi

80 C ontrol (Unind.) 80 C ontrol (Unind.) TbTOR2 RNAi (Ind.) TbAVO3 RNAi (Induc.) 70 70 Control (Unind) Control (Unind.) TbTOR2 RNAi (Ind.) 60 TbAVO3 RNAi (Ind.) 60 50 50

40 40 % cells %cells 30 30 20 20

10 10 0 0 G2/M G2/M

B TbTOR2 RNAi TbAVO3 RNAi

70 70 C ontrol (Unind.) C ontrol (Unind.) TbTOR1 RNAi (Ind.) TbAVO3 RNAi (Ind.) 60 60

50 50

40 40

%cells 30 % cells

20 20

10 10

0 0 1K1N 1K(V )1N 2K1N 2K2N 0K1N 1K0N >2K2N 1K2N 1K1N 1K(V)1N 2K1N 2K2N 0K1N 1K0N >2K2N 1K2N

40 C Rapamycin treatment 35 Control (Drug carrier) 30 Rapamycin 100 µM C ontrol (E thanol) Rapamycin 1 µM 25 Rapamycin0,1 µM Rapamycin1 µM 20 % cells

0 G2/M

Fig. S4. TbTOR1/TbRaptor (TORC1) depletion inhibits cell cycle progression at G1 phase whereas TbTOR2/TbAVO3 (TORC2) depletion affects cytokinesis. (A) FACS analysis for relative DNA content of TbTOR1, TbRaptor, TbTOR2, and TbAVO3-depleted cell lines after 48 h upon induction with doxicycline (1 ␮g/ml) and their respective uninduced control. (Left) Flow citometry profiles. (Right) Percentage of cells in different cell cycle stages (see SI Materials and Methods). (B) Histograms showing the percentage of cells with different configurations of nuclei and kinetoplast. Forty-eight hours after the addition of 1 ␮g/ml doxicycline for RNAi induction, both induced and uniduced RNAi cell lines were fixed with paraformaldehide and stained with DAPI. Cells were scored for the number of kinetoplast (K) and nuclei (N). The experiment was repeated at least three times, and 200 cells were counted per experiment. Trypanosome cell cycle phases can be detected by DAPI staining because kinetoplast DNA is divided before nuclear DNA. Therefore, cells at G1 show 1K and 1N, compared to S-G2-M cells that display 2K 1N. Cells where the kinetoplast is under division, named 1K(V)1N (V-shape kinetoplast), are at nuclear synthesis phase. TbTOR2/TbAVO3-depleted cells displayed defects in kinetoplast segregation and are compromised in their ability to correctly complete cytokinesis. (C) Rapamycin treatment is similar to the TbTOR2 or TbAVO3 knockdown phenotype. FACS analysis for relative DNA content of rapamycin-treated cells revealed that rapamycin affects cell cytokinesis.

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 6of10 A) TbTOR2 RNAi TbAVO3 RNAi Control (unind.) RNAi (ind.) Control (unind.) RNAi (ind.)

N K

Nomarski

TbTOR2 RNAi TbAVO3 RNAi B) Control (unind.) RNAi (ind.)

TbTOR2 RNAi unind. TbAVO3 RNAi unind. TbTOR2 RNAi ind. TbAVO3 RNAi ind. TbTOR2 RNAi TbTOR2 TbAVO3 RNAi TbAVO3

Fig. S5. TORC2 signaling regulates actin polarization and endocytosis in T. brucei.(A) Actin localization toward the endocytic pathway is affected in TbTOR2- and TbAVO3-depleted cells. The DAPI staining reveals the position of the nucleus (N) and kinetoplast (K). Arrowheads indicate localization of actin in RNAi uninduced cells, versus incorrect actin localization in induced cells. (B) Effects of TbTOR2 or TbAVO3 depletion on endocytosis. Endocytosis was analyzed by monitoring the uptake of Alexa488-labeled ConA (Mol. Probes) in TbTOR1, TbAVO3 knockdown cells, by confocal microscopy. Cells were incubated with ConA-Alexa488 at 37°C for 30 min to permit lysosomal ConA accumulation, as described before (8). Arrowheads indicate localization of ConA-Alexa488 at the lysosome in RNAi uninduced cells, versus lack of ConA-Alexa488 uptake in induced cells. (C) ConA-Alexa488 ﬂuorescence intensity in TbTOR2 and TbAVO3 KD cell lines is reduced upon RNAi induction. Endocytosis of ConA-Alexa488 was analyzed by FACS in 5,000 cells per sample. The same region for gathering was used for all samples. (Scale bars, 5 ␮.)

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 7of10 Fig. S6. The amino acid sequence of T. brucei FKBP12 compared to the FKBP12 protein from other representative organisms. Residues that are identical in at least 9 of the 13 sequences are shaded in gray. Those residues conserved in all sequences are shaded in dark gray. Asterisks indicate residues from human FKBP12 that interact with rapamycin (11).

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 8of10 A B 10

8 Control RNAi induction (unind.) Days: 0 1234 6 TbTOR2 5 4 Tubulin 2 TbTOR2 RNAi (ind.) 0 01234 Days

10 cells/ml C

Control(Unind.) RNAi TbTOR2 RBS (24h induc.) RNAi TbTOR2 RBS (48h induc.) 50

40 s 30 %cell

0 G 2/M

D Control (unind.) TbTOR2 RNAi (ind.)

AB C D

Fig. S7. RNA interference of TbTOR2 showed a severe defect in cell proliferation. To exclude a possible off-targeting effect we generated an additional TbTOR2 RNAi cell line. A 550 bp DNA fragment corresponding to the rapamycin binding site was used to generate RNAi cell line with a different fragment to the one described in Fig. 2. (A) RNAi knockdown of TbTOR2 affects cell proliferation. Growth of bloodstream trypanosome cell line containing inducible RNAi construct was measured after RNAi induction with doxycycline. (B) Western blot analysis of TbTOR1 and TbTOR2 in total cell extracts (5 ϫ 106 cells per lane) upon RNAi induction and during the following 4 days. Tubulin was used as a loading control. (C) FACS analysis upon TbTOR2 (RBS fragment) RNA interference revealed an increase in the number of cells with a DNA content inferior to G1 and superior to G2/M phases. (D) Analysis of the cellular morphology in bloodstream trypanosome living cells in control and TbTOR2 depleted cells. As shown in Figure 4F, knockdown cells display cytokinesis defects leading to the formation of large abnormal cells. Cells were examined using Normaski optics after2dofRNAi induction (Scale bar: 5 ␮m).

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 9of10 Table S1. Oligonucleotides used for PCR Oligonucleotide Sequence, 5Ј–3Ј

TOR2-U (NЈ) AGTGGATCCTACGATGCGCGGAAAGTGGAGG TOR2-L (NЈ) GATAAGCTTAGTCTACCGTTTTCTTCCTGTT TORlike1-U (NЈ) CTCAAGCTTGGATCCCCCCGTCGTGTAGAGGAGTGC TORlike1-L (NЈ) GCTCTCGAGAGGAGACGTGTTAGTGCTTGG TOR1-U (NЈ) GGATCCCGGATTGTTGCGGTGAAAAC TOR1-L (NЈ) ATGCTTTATGCTTGCCTTCC TbTOR2-U (CЈ) GGATCCAAGCTTTTATTGAACCACATGAAAA TbTOR2-L (CЈ) GTTAACCCAGAACGGATACCAACCC TbTORlike1-U (CЈ) GGATCCAAGCTTTTTGCTGAACCAGATGGCCTC TbTORlike1-L (CЈ) GTTAACCCAGAACGGTGCCCAACCAG TbTOR1-U (CЈ) GGATCCAAGCTTGTGTCTTGGTGGCGTGATGAG TbTOR1-L (CЈ) GTTAACCCAGAAAGGGCACCACCCGAG TbFKBP12-U GGATCCATGTCGCGAAATGACTGCGTT TbFKBP12-L CTCGAGTCAAACAACATCCAACAGCGT TbRaptor-U (CЈ) GACTAGTGAGCTCTACGAGGAATGGTACACG TbRaptor-L (CЈ) CCCAAGCTTGTGCACAACTAAAATCTC TbRaptor-like U GGGGATCCGGAACTTTTGGACAGTGCCG TbRaptor-like L CCCAAGCTTATCATACACACATGTCGTGCT TbAVO3-U (CЈ) CCATCGATGAGCTCAGCTAAAGGACGCCATACTTT TbAVO3-L (CЈ) CCCAAGCTTGCCACGCTGTGGTTCCGGCAC TbTOR1 FRB-U GGGGGATCCGAAGACTCCGCACTTGTTTGC TbTOR1 FRB-L CCCGAATTCTCATGCCAACGATGACATTCCACT TbTOR2 FRB-U GGGGGATCCAATCAGGGGCGAATCCTTGTA TbTOR2 FRB-L CCCGAATTCTCAGTGCAACTTACTTTGAGACCT TbTOR-like 1 FRB-U CCCGGATCCGAGGAGGCTTCACTAATCAGC TbTOR-like 1 FRB-L GGGGAATTCTCACATCTGAAGCCGTCGTTCTCC

Barquilla et al. www.pnas.org/cgi/content/short/0802668105 10 of 10