Genetic Variants of Β-Casein in Cattle and Buffalo Breeding Bulls in Karnataka State of India

Indian Journal of Biotechnology Vol 15, April 2016, pp 178-181 Genetic variants of β-casein in cattle and buffalo breeding bulls in Karnataka state of India K P Ramesha1*, Akhila Rao1, M Basavaraju1, Rani Alex2, M A Kataktalware1, S Jeyakumar 1 and S Varalakshmi1 1ICAR-National Dairy Research Institute (NDRI), Southern Regional Station, Bengaluru 560 030, India 2ICAR-Central Institute for Research on Cattle, Meerut 250 001, India Received 4 October 2014; revised 25 February 2015; accepted 17 April 2015 Among the genetic variants of bovine β-casein gene (CSN2), A1 and A2 are the most common. β-Casein contains 209 amino acids and A1 and A2 variants differ only at position 67 in the amino acid chain CAT, which is histidine in A1, and CCT, which is proline in case of A2. Various studies suggest that A1 casein present in milk is likely to cause health problems. The present study involved screening of 391 bulls belonging to seven breeds of cattle and two breeds of buffaloes from different regions of Karnataka for genetic variants A1 and A2 in β-casein gene using ACRS (amplification created restriction sites) method with TaqI restriction enzyme. The results indicated that A2 allele is fixed in Deoni and Khillar breed of cattle and both the buffalo breeds (Murrah & Surti). It was observed that the frequency of A1 allele was very low in Malnad Gidda (0.014), Kasargod variety (0.042) and Jersey (0.077), while the frequency of A1 allele in Holstein Friesian and Holstein Friesian crossbred males was 0.169 and 0.294, respectively. Keywords: A1 and A2 allele, ACRS, breeding bulls, β-casein, PCR-RFLP 4 Introduction mature protein . Of all the genetic variants, A1 and Casein and whey proteins are two major protein A2 are the most commonly known genetic variants. groups present in the milk. Casein makes up around β-Casein consists of 209 amino acids. The difference 80% of the milk proteins. The caseins are a family of in A1 and A2 β-casein is the amino acid at position 5 phosphoproteins synthesized in the mammary gland 67, which is histidine in A1 and proline in A2 . In the in response to lactogenic hormones and other gene coding bovine A1 β-casein, G is substituted by stimuli and secreted as large colloidal aggregates A at 8101 position (GenBank M55158). Histidine termed micelles, which are responsible for many of 1 found in A1 milk is a weak bond, which is easily the unique physical properties of milk . β-casein broken to release bioactive peptide β-casomorphin 7; composition of milk and milk products has become an while proline found in A2 milk is a strong bond and important economic trait of dairy animals. Four casein did not break during digestion. Thus polymorphism at genes are known, which are alpha s1, alpha s2, beta codon 67 leads to the release of bioactive peptide and kappa, and among these β-casein is the second 2 β-casomorphin 7 upon digestion of A1 but not most abundant protein in the cow’s milk . Bovine 6 of A2 . Some reports suggest that the A1 present in β-casein gene (CSN2) is located on the sixth milk is likely to cause type 1 diabetes (DM-1), chromosome and twelve different genetic variants are 3 coronary heart disease (CHD), arteriosclerosis and known in coding sequence of the gene . CSN2 is 8.5 6,7 sudden infant death syndrome . The effect of the A1 kb in length and consists of nine exons and eight allele on human health is yet to be conclusively introns. Genetic variants, such as, A1, A2, A3 and B, studied. Therefore, it is necessary to take are found in Bos taurus and B. indicus populations precautionary principle, and is of practical value to and the base change encoding the amino acid use A2A2 genotype bulls in dairy animal breeding differences between these variants is known to be programmes. located in exon 7, which encodes the major part of Amplification Created Restriction Sites (ACRS) —————— method mainly involves differentiating restriction *Author for correspondence: enzyme sites those are created artificially by allele Mobile: +91-9916499636 [email protected] specific site directed mutagenesis in the amplification RAMESHA et al: GENETIC VARIANTS OF β-CASEIN IN BULLS 179 step to identify different genotypes among breeding between 1.8 and 2.0 were stored at –20°C, and diluted bulls. The ACRS method involves primers those to 100 ng µL-1 and used for further analysis. The function even with mismatch at their 3′ ends. The technique involved in the study was restriction fragment primers were mismatched at their 3′ end and designed length polymorphism (RFLP) method. Primers used to end just before the point mutation in the β-casein were those reported in earlier studies, CASB122L- 5′ (CASB) gene. CASB122 primer had a mismatch of GAGTCGACTGCAGATTTTCAACATCAGTGAGAG C-A in the fourth last position and CASB67 primer TCA GGCCCTG 3′ and CASB67R- 5′CCTGCAGAATTCTA 8 had a G-G mismatch in the last position of the 3′ end . GTCTATCCCTTCCCTGGGCCCATCG 3′, which was Earlier researchers have reported varying frequency used to amplify a 251 bp fragment in case of exon 7 of A1 allele ranging from 0 in different breeds of zebu 8 9 10,11 in β-casein gene .The primers had the amplification cattle to as high as 0.60 in Holstein Friesian bulls . created restriction sites. PCR parameter consisted of The present study aimed at screening of 7 breeds of total volume of 25 µL consisting of 20 pmol/µL each cattle and 2 breeds of buffalo reared in Karnataka of forward and reverse primer, 10× PCR incomplete state in India for A1 and A2 variants in milk in order buffer, 25 mM magnesium chloride, 2.5 mM dNTPs, to apply the precautionary principle and to reduce 1 U of Taq DNA polymerase and 100 ng genomic A1 allele from the population. DNA. PCR conditions involved an initial denaturation at 94°C for 5 mins, final denaturation at 94°C for Materials and Methods 1 min, followed by 35 cycles with an annealing Animals temperature of 65°C for 1 min, initial extension at The breeding bulls and males intended for breeding 72°C for 1 min, followed by a final extension of 72°C purpose maintained at organized frozen semen for 10 mins. After PCR, the samples were analyzed stations, dairy farms and farmers' field were included by loading on 1.5% agarose gel along with a 100 bp in the present study. A total of 391 breeding bulls DNA marker. The gels were visualized and documented from different regions of Karnataka were screened for using Gel documentation system (Gel doc 1000, genetic variants A1 and A2 in β-casein gene. Holstein Bio-Rad, USA). The PCR products were then Friesian (HF) (n=59), HF crossbred (n=17), Jersey digested by making use of TaqI enzyme at 65°C for (n=39), indigenous breeds, viz., Khillar (n=12) and 5 h in the incubator to liberate the restriction Deoni (n=40), males maintained at different farms fragments. After incubation, the digested products and State Frozen Semen stations located in Karnataka, along with 6× gel loading dye were mixed and loaded and Malnad Gidda (n=104) males reared by farmers on 3% agarose gel in 1× TBE buffer along with 100 of Malnad and coastal region of Karnataka, Kasargod bp DNA marker. The gels were examined for different band patterns. cattle (n=48) reared in Kasargod district in Kerala, which is an adjoining district to coastal region in Results and Discussion Karnataka, and buffalo bulls Murrah (n=47) and Surti Breeding bulls and males intended for breeding (n=25) reared in Semen stations in Karnataka were purposes (n=391) belonging to seven cattle breeds and utilized for the study. two buffalo breeds were screened for genotyping of the β-casein gene for A and A variants at position Sample Collection 1 2 Blood sample (8-10 mL) from each animal was 8101 (GenBank M55158). A2A2 genotype showed the collected aseptically by jugular vein-puncture into product size of 251 bp, while A1A2 genotype showed vacutainer tubes containing EDTA and was stored at the product size of 251 bp and 213 bp. The A1A1 4°C prior to DNA isolation. genotype, which is expected to show the product size of 213 and 38 bp, were absent in the present study. PCR-RFLP Technique Genetic variants of β-casein observed in different After collection of blood, within 24 h, genomic breeds of cattle are shown in Fig. 1. Among the DNA was isolated by the high salt method as 391 bulls screened, 348 animals were of A2A2 and described by previous researchers with minor 43 animals were of A1A2 genotypes, while none of 12 modifications . Agarose gel electrophoresis and the animal was of A1A1 genotype. The genotypic spectrophotometric methods were used to determine frequency and allelic frequency of A1 and A2 variants quality and quantity of DNA. The samples showing among different breeds of cattle and buffalo are an optical density (OD) ratio (260 nm/280 nm) of presented in Table 1. It was observed that A2 allele is 180 INDIAN J BIOTECHNOL, APRIL 2016 fixed in case of Deoni and Khillar breeds of cattle as Malnad Gidda cattle showed allelic frequency of 9 well as in both the breeds of buffalo. In Malnad Gidda 0.096 for A1 allele . In the present study, Malnad and Kasargod variety of dwarf cattle very low Gidda males showed the frequency of A1 allele to be frequency of A1 allele was observed, which could be 0.014.

Load more