DOCSLIB.ORG

WO 2011/084768 Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2011/084768 Al (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date _ . ... _ . 14 July 2011 (14.07.2011) WO 2011/084768 Al (51) International Patent Classification: Ridge, Loveland, OH 45 140 (US). ARONHALT, Tay¬ A61B 17/00 (2006.01) A61B 19/10 (2006.01) lor, W. [US/US]; 306 Beech Road, Loveland, OH 45140 (US). (21) International Application Number: PCT/US20 10/06 1422 (74) Agents: JOHNSON, Philip, S. et al; Johnson & John son, 1 Johnson & Johnson Plaza, New Brunswick, NJ (22) International Filing Date: 08933 (US). 2 1 December 2010 (21 .12.2010) (81) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of national protection available): AE, AG, AL, AM, (26) Publication Langi English AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (30) Priority Data: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, 61/288,375 2 1 December 2009 (21 .12.2009) US HN, HR, HU, ID, JL, IN, IS, JP, KE, KG, KM, KN, KP, 12/971,249 17 December 2010 (17.12.2010) US KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (71) Applicant (for all designated States except US): ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, ETHICON ENDO-SURGERY, INC. [US/US]; 4545 NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, Creek Road, Cincinnati, OH 45242 (US). SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (72) Inventors; and (75) Inventors/ Applicants (for US only): CLYMER, Jeffrey, (84) Designated States (unless otherwise indicated, for every W. [US/US]; 4354 Hyacinth Drive, Mason, OH 45040 kind of regional protection available): ARIPO (BW, GH, (US). MALAVIYA, Prasanna [US/US]; 5840 Maxfli GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, Lane, Mason, OH 45040 (US). KORVICK, Donna, L. ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, [US/US]; 8158 Worcester Drive, Maineville, OH 45309 TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (US). HOUSER, Kevin, L. [US/US]; 570 Foliage Lane, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Springboro, OH 45066 (US). KIMBALL, Cory, G. [US/ SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, US]; 6136 Lagrange Lane, Cincinnati, OH 45239 (US). GW, ML, MR, NE, SN, TD, TG). STULEN, Foster, B. [US/US]; 6245 Bridgewater Court, Mason, OH 45040 (US). SHELTON, Frederick, E., IV Declarations under Rule 4.17 : [US/US]; 245 E. Main Street, Hillsboro, OH 45 153 (US). — as to the identity of the inventor (Rule 4.17(i)) BAXTER, Chester, O., Ill [US/US]; 6375 Pawnee [Continued on next page] (54) Title: SURGICAL DEVICE USING BIOMARKERS 00 0 o0 (57) Abstract: Biomarkers are collected and used to determine biological propensities of a patient, to determine the efficacy of medical devices, to select and administer therapeutic agents, to select medical devices, to make adjustments to medical devices, and/or to adjust surgical techniques. An apparatus includes a port to draw a biological fluid (e.g., a mist) from a surgical site. The o apparatus includes a sensor having a cantilevered beam. The beam includes substances selected to attract certain biomarkers as the fluid is communicated across the beam. The same apparatus or another apparatus is used to administer a therapeutic agent based at least in part on collected biomarker data. The therapeutic agent delivery apparatus may include a device that is also used to create a wound at a surgical site. For instance, a harmonic surgical instrument may be used to both collect biomarkers and administer a therapeutic agent (e.g., gene therapy using sonoporation). w o 2011/084768 Al III III II II III I I1 1 lll l II llll 11III II I II Published: as to applicant's entitlement to apply for and be granted a patent (Rule 4.1 7( )) — with international search report (Art. 21(3)) as to the applicant's entitlement to claim the priority of — before the expiration of the time limit for amending the the earlier application (Rule 4.17(Hi)) claims and to be republished in the event of receipt of amendments (Rule 48.2(h)) SURGICAL DEVICE USING BIOMARKERS Jeffrey W. Clymer Prasanna Malaviya Donna L. Korvick Kevin L. Houser Cory G. Kimball Foster B. Stulen Frederick E Shelton IV Chester O. Baxter III Taylor W. Aronhalt PRIORITY [0001] This application claims priority to U.S. Provisional Patent Application Serial No. 61/288,375, entitled "Method of Developing Surgical Devices Using Biomarkers," filed December 21, 2009, and to U.S. Nonprovisional Patent Application Serial No. 12/971,249, entitled "Use of Biomarkers and Therapeutic Agents with Surgical Devices," filed December 17, 2010, the disclosures of which are incorporated by reference herein. BACKGROUND [0002] Tissue trauma resulting in a wound may be an unavoidable consequence of accidental or intentional injury (e.g., from surgery, etc.). The process of wound healing is thought by some to take place in four stages. The first stage is hemostasis which may begin immediately after the cutting occurs. In hemostasis, clotting may occur by natural means of platelet degranulation. Hemostasis may also be induced by artificial means to affect protein denaturation. The second stage is inflammation. In this stage, the immune system may provide a response to the threat of possible infection via signaling to defensive immune cells such as neutrophils and macrophages. The third stage is the proliferation stage. In this stage, fibroblasts may enter the wound area and produce large amounts of collagen that result in scar formation. A prolonged hemostatic or inflammatory stage may result in additional scar formation that delays both this third stage and the final stage of wound healing. The final stage of wound healing is remodeling. This may occur once a scar has formed and the breaking strength of the wound begins to increase. In this stage, the temporary collagen may be replaced by permanent tissue and the scar slowly fades. The duration of this final stage may depend upon how much scar tissue was formed in the previous stage. [0003] While a variety of methods for monitoring the progress of wound healing have been made and used, it is believed that no one prior to the inventor(s) has made or used the technology as described herein. BRIEF DESCRIPTION OF THE DRAWINGS [0004] While the specification concludes with claims which particularly point out and distinctly claim this technology, it is believed this technology will be better understood from the following description of certain examples taken in conjunction with the accompanying drawings, in which like reference numerals identify the same elements and in which: [0005] FIG. 1 depicts a flow diagram of an exemplary method of processing biomarkers; [0006] FIG. 2 depicts a side view of an exemplary harmonic surgical instrument having a biomarker collection feature; [0007] FIG. 3 depicts a partial view of the end effector of the harmonic surgical instrument of FIG. 2; [0008] FIG. 4 depicts a schematic view of an exemplary biomarker collection and processing system; [0009] FIG. 5 depicts a schematic view of biomarker processing components of the system of FIG. 4; [00010] FIG. 6 depicts a partial perspective view of a biomarker sensor of the system of FIG. 4, during a biomarker collection phase; [00011] FIG. 7 depicts a partial perspective view of the biomarker sensor of FIG. 6, during a sensor cleansing phase; [00012] FIG. 8 depicts a schematic view of an exemplary surgical instrument system including biomarker sensor feedback, where the biomarker sensor feedback is used to automatically control or adjust a surgical instrument; [00013] FIG. 9 depicts a schematic view of another exemplary surgical instrument system including biomarker sensor feedback, where the biomarker sensor feedback is used to control an agent administration device; [00014] FIG. 10 depicts a schematic view of another exemplary surgical instrument system including biomarker sensor feedback, where biomarker sensor feedback is provided to the user through a user feedback feature of a surgical instrument; [00015] FIG. 11 depicts a schematic view of another exemplary surgical instrument system including biomarker sensor feedback, where biomarker sensor feedback is provided to the user through a dedicated user feedback device; [00016] FIG. 12 depicts a schematic view of an exemplary gastric band system including biomarker sensor feedback, where biomarker sensor feedback is used to automatically adjust a gastric band; [00017] FIG. 13 depicts a schematic view of another exemplary gastric band system including biomarker sensor feedback, where biomarker sensor feedback is used to provide implant-originated feedback to a patient or clinician; [00018] FIG. 14 depicts a schematic view of an exemplary drug infusion system including biomarker sensor feedback, where biomarker sensor feedback is used to provide automatic adjustment of drug delivery by a drug infusion device; [00019] FIG. 15 depicts a partial perspective view of the distal end of an exemplary harmonic surgical instrument with a harmonic blade having a therapeutic agent delivery feature; [00020] FIG. 16 depicts a partial perspective view of the distal end of another exemplary harmonic surgical instrument with a harmonic blade having a therapeutic agent delivery feature; [00021] FIG. 17 depicts a partial perspective view of the distal end of another exemplary harmonic surgical instrument with a harmonic blade having a therapeutic agent delivery feature; [00022] FIG.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Updates on Myopia
    Updates on Myopia A Clinical Perspective Marcus Ang Tien Y. Wong Editors Updates on Myopia Marcus Ang • Tien Y. Wong Editors Updates on Myopia A Clinical Perspective Editors Marcus Ang Tien Y. Wong Singapore National Eye Center Singapore National Eye Center Duke-NUS Medical School Duke-NUS Medical School National University of Singapore National University of Singapore Singapore Singapore This book is an open access publication. ISBN 978-981-13-8490-5 ISBN 978-981-13-8491-2 (eBook) https://doi.org/10.1007/978-981-13-8491-2 © The Editor(s) (if applicable) and The Author(s) 2020, corrected publication 2020 Open Access This book is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made. The images or other third party material in this book are included in the book's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the book's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specifc statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use.
    [Show full text]
  • SYMPOSIUM References 1
    J Orthopaed Traumatol (2008): 24 November 2008 DOI 10.1007/s10195-008-0030-6 24 NOVEMBER 2008 SYMPOSIUM References 1. Pola E, Lattanzi W, Pecorini G, Logroscino CA, Robbins PD (2005) Gene therapy for in vivo bone formation: recent TISSUE ENGINEERING advances. Eur Rev Med Pharmacol Sci 9(3):167–174 2. Pola E, Gao W, Zhou Y, Pola R, Lattanzi W, Sfeir C, et al (2004) A CLINICALLY RELEVANT GENE THERAPY APPROACH Efficient bone formation by gene transfer of human LIM miner- TO INDUCE OSTEOGENESIS: STUDY OF THE NEW alization protein-3. Gene Ther 11(8):683 –693 GROWTH FACTOR LIM MINERALIZAZION PROTEIN-3 3. Lattanzi W, Parrilla C, Fetoni A, Logroscino G, Straface G, Pecorini G, Tampieri A, Bedini R, Pecci R, Michetti F, E. Pola Gambotto A, Robbins PD, Pola E (2008) Ex-vivo transduced autologous skin fibroblasts expressing human Lim Minera - Department of Orthopaedics and Traumatology, Università lization Protein-3 efficiently form new bone in animal models. Cattolica del Sacro Cuore, School of Medicine (Rome-IT) Gene Therapy [Epub ahead of print] Recombinant proteins, such as the bone morphogenetic proteins have been used to enhance repair of non-union fractures and facil- TYPE-I COLLAGEN MEMBRANE AS A SCAFFOLD FOR itate new bone formation in animal models as well as in clinical TENDON REPAIR: AN IN VITRO AND IN VIVO STUDY applications. However, a significant amount of recombinant BMP is required to promote osteogenesis and frequently the extent of A. Gigante, E. Cesari, A. Busilacchi, S. Manzotti, F. Greco new bone formation is low. In contrast, local gene transfer of BMPs has been shown to be more efficient in promoting osteogenesis in Department of Orthopaedics, Polytechnic University of Marche rodents than the use of recombinant proteins.
    [Show full text]
  • Individual Protomers of a G Protein-Coupled Receptor Dimer Integrate Distinct Functional Modules
    OPEN Citation: Cell Discovery (2015) 1, 15011; doi:10.1038/celldisc.2015.11 © 2015 SIBS, CAS All rights reserved 2056-5968/15 ARTICLE www.nature.com/celldisc Individual protomers of a G protein-coupled receptor dimer integrate distinct functional modules Nathan D Camp1, Kyung-Soon Lee2, Jennifer L Wacker-Mhyre2, Timothy S Kountz2, Ji-Min Park2, Dorathy-Ann Harris2, Marianne Estrada2, Aaron Stewart2, Alejandro Wolf-Yadlin1, Chris Hague2 1Department of Genome Sciences, University of Washington School of Medicine, Seattle, WA, USA; 2Department of Pharmacology, University of Washington School of Medicine, Seattle, WA, USA Recent advances in proteomic technology reveal G-protein-coupled receptors (GPCRs) are organized as large, macromolecular protein complexes in cell membranes, adding a new layer of intricacy to GPCR signaling. We previously reported the α1D-adrenergic receptor (ADRA1D)—a key regulator of cardiovascular, urinary and CNS function—binds the syntrophin family of PDZ domain proteins (SNTA, SNTB1, and SNTB2) through a C-terminal PDZ ligand inter- action, ensuring receptor plasma membrane localization and G-protein coupling. To assess the uniqueness of this novel GPCR complex, 23 human GPCRs containing Type I PDZ ligands were subjected to TAP/MS proteomic analysis. Syntrophins did not interact with any other GPCRs. Unexpectedly, a second PDZ domain protein, scribble (SCRIB), was detected in ADRA1D complexes. Biochemical, proteomic, and dynamic mass redistribution analyses indicate syntrophins and SCRIB compete for the PDZ ligand, simultaneously exist within an ADRA1D multimer, and impart divergent pharmacological properties to the complex. Our results reveal an unprecedented modular dimeric architecture for the ADRA1D in the cell membrane, providing unexpected opportunities for fine-tuning receptor function through novel protein interactions in vivo, and for intervening in signal transduction with small molecules that can stabilize or disrupt unique GPCR:PDZ protein interfaces.
    [Show full text]
  • Human Stem Cell Models Identify Targets of Healthy
    HUMAN STEM CELL MODELS IDENTIFY TARGETS OF HEALTHY AND MALIGNANT HEMATOPOIETIC REGULATION BY JENNIFER C REID, BSc A Thesis Submitted to the School of Graduate Studies In Partial Fulfillment of the Requirements For the Degree Doctor of Philosophy McMaster University ÓCopyright by Jennifer C Reid, April 2020 JC Reid <- PhD Thesis ❖ McMaster University $ Biochemistry Descriptive Note McMaster University BACHELOR OF SCIENCE (2015) Hamilton, Ontario (Biomedical Research Specialization, Co-op) Title: Use of human stem cell models to identify targets of healthy and malignant hematopoietic regulation Author: Jennifer C. Reid Supervisor: Dr. Mickie Bhatia Number of pages: xii, 163 ii JC Reid <- PhD Thesis ❖ McMaster University $ Biochemistry AbstrAct Hematopoiesis is the highly regenerative process of producing billions of blood cells each day, including white blood cells, red blood cells, and platelets. Given the relatively short life span of these mature cells, hematopoiesis is dependent on stem and progenitor cells to generate renewed progeny, which represents a tightly regulated process. This includes cell intrinsic and external factors, and where dysregulation can lead to anemia and cancer. As such, the hematopoietic hierarchy has been intensely studied for nearly a century and represents a gold standard model of cell fate and developmental biology, in research and clinical applications. Cellular models, such as in vitro culture and human-mouse xenografts in vivo, have been developed to explain complex phenomena pertaining to hematopoiesis and also interrogate processes which are too invasive to study in humans. Hematopoietic generation is required beyond sustaining homeostasis, and progenitors can be damaged through cytotoxic injuries such as radiation and standard chemotherapy, and also undergo leukemic transformation.
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Functional Significance of Gain-Of-Function H19 Lncrna in Skeletal Muscle Differentiation and Anti-Obesity Effects Yajuan Li1†, Yaohua Zhang1†, Qingsong Hu1, Sergey D
    Li et al. Genome Medicine (2021) 13:137 https://doi.org/10.1186/s13073-021-00937-4 RESEARCH Open Access Functional significance of gain-of-function H19 lncRNA in skeletal muscle differentiation and anti-obesity effects Yajuan Li1†, Yaohua Zhang1†, Qingsong Hu1, Sergey D. Egranov1, Zhen Xing1,2, Zhao Zhang3, Ke Liang1, Youqiong Ye3, Yinghong Pan4,5, Sujash S. Chatterjee4, Brandon Mistretta4, Tina K. Nguyen1, David H. Hawke6, Preethi H. Gunaratne4, Mien-Chie Hung7,8, Leng Han3,9, Liuqing Yang1,10,11* and Chunru Lin1,10* Abstract Background: Exercise training is well established as the most effective way to enhance muscle performance and muscle building. The composition of skeletal muscle fiber type affects systemic energy expenditures, and perturbations in metabolic homeostasis contribute to the onset of obesity and other metabolic dysfunctions. Long noncoding RNAs (lncRNAs) have been demonstrated to play critical roles in diverse cellular processes and diseases, including human cancers; however, the functional importance of lncRNAs in muscle performance, energy balance, and obesity remains elusive. We previously reported that the lncRNA H19 regulates the poly-ubiquitination and protein stability of dystrophin (DMD) in muscular dystrophy. Methods: Here, we identified mouse/human H19-interacting proteins using mouse/human skeletal muscle tissues and liquid chromatography–mass spectrometry (LC-MS). Human induced pluripotent stem-derived skeletal muscle cells (iPSC-SkMC) from a healthy donor and Becker Muscular Dystrophy (BMD) patients were utilized to study DMD post-translational modifications and associated proteins. We identified a gain-of-function (GOF) mutant of H19 and characterized the effects on myoblast differentiation and fusion to myotubes using iPSCs.
    [Show full text]
  • S1 Table Protein
    S1 Table dFSHD12_TE dFSHD12_NE aFSHD51_TE aFSHD51_NE Accession Gene Protein H/L SD # bold H/L SD # bold H/L SD # bold H/L SD # bold Intermediate filament (or associated proteins) P17661 DES Desmin 0.91 N.D. 37 1.06 1.35 19 0.89 1,13 33 * 1.20 1.21 17 * P02545 LMNA Prelamin-A/C 0.90 1.25 30 * 1.07 1.26 20 0.96 1.23 34 1.21 1.24 19 * P48681 NES Nestin 0.91 N.D. 60 0.94 1.25 27 0.72 1.20 50 * 0.89 1.27 31 * P08670 VIM Vimentin 1.04 N.D. 35 1.24 1.24 14 * 1.21 1.18 36 * 1.39 1.17 16 * Q15149 PLEC Plectin-1 1.10 1.28 19 1.05 1.10 3 1.07 1.23 26 1.25 1.27 7 * P02511 CRYAB Alpha-crystallin B chain (HspB5) 1.47 1.17 2 1.17 2 1.14 1.12 2 Tubulin (or associated proteins) P62158 CALM1 Calmodulin (CaM) 0.83 0.00 1 0.93 0.00 1 Programmed cell death 6- Q8WUM4 PDCD6IP 1.34 0.00 1 interacting protein Q71U36 TUBA1A Tubulin α-1A chain (α-tubulin 3) 1.44 1.12 3 * Tubulin β chain (Tubulin β-5 P07437 TUBB 1.52 0.00 1 chain) Nuclear mitotic apparatus Q14980 NUMA1 0.68 0.00 1 0.75 0.00 1 protein 1 Microtubule-associated protein P27816 MAP4 1.10 1 4 Microtubule-associated protein P78559 MAP1A 0.76 0.00 1 1A Q6PEY2 TUBA3E Tubulin α-3E chain (α-tubulin 3E) 0.91 0.00 1 1.12 0.00 1 0.98 1.12 3 Tubulin β-2C chain (Tubulin β-2 P68371 TUBB2C 0.93 1.13 7 chain) Q3ZCM7 TUBB8 Tubulin β-8 chain 0.97 1.09 4 Serine P34897 SHMT2 hydroxymethyltransferase 0.93 0.00 1 (serine methylase) Cytoskeleton-associated protein Q07065 CKAP4 0.98 1.24 5 0.96 0.00 1 1.08 1.28 6 0.75 0.00 1 4 (p63) Centrosomal protein of 135 kDa Q66GS9 CEP135 0.84 0.00 1 (Centrosomal protein 4) Pre-B cell leukemia transcription Q96AQ6 PBXIP1 0.74 0.00 1 0.80 1 factor-interacting protein 1 T-complex protein 1 subunit P17897 TCP1 0.84 0.00 1 alpha (CCT-alpha) Cytoplasmic dynein Q13409 DYNC1I2 1.01 0.00 1 intermediate chain 2 (DH IC-2) Dynein heavy chain 3 (Dnahc3- Q8TD57 DNAH3 b) Microtubule-actin cross- linking Q9UPN3 MACF1 factor 1 (Trabeculin-alpha) Actin (or associated including myofibril-associated porteins) P60709 ACTB Actin, cytoplasmic 1 (β-actin) 1.11 N.D.
    [Show full text]
  • Biological Models of Colorectal Cancer Metastasis and Tumor Suppression
    BIOLOGICAL MODELS OF COLORECTAL CANCER METASTASIS AND TUMOR SUPPRESSION PROVIDE MECHANISTIC INSIGHTS TO GUIDE PERSONALIZED CARE OF THE COLORECTAL CANCER PATIENT By Jesse Joshua Smith Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University In partial fulfillment of the requirements For the degree of DOCTOR OF PHILOSOPHY In Cell and Developmental Biology May, 2010 Nashville, Tennessee Approved: Professor R. Daniel Beauchamp Professor Robert J. Coffey Professor Mark deCaestecker Professor Ethan Lee Professor Steven K. Hanks Copyright 2010 by Jesse Joshua Smith All Rights Reserved To my grandparents, Gladys and A.L. Lyth and Juanda Ruth and J.E. Smith, fully supportive and never in doubt. To my amazing and enduring parents, Rebecca Lyth and Jesse E. Smith, Jr., always there for me. .my sure foundation. To Jeannine, Bill and Reagan for encouragement, patience, love, trust and a solid backing. To Granny George and Shawn for loving support and care. And To my beautiful wife, Kelly, My heart, soul and great love, Infinitely supportive, patient and graceful. ii ACKNOWLEDGEMENTS This work would not have been possible without the financial support of the Vanderbilt Medical Scientist Training Program through the Clinical and Translational Science Award (Clinical Investigator Track), the Society of University Surgeons-Ethicon Scholarship Fund and the Surgical Oncology T32 grant and the Vanderbilt Medical Center Section of Surgical Sciences and the Department of Surgical Oncology. I am especially indebted to Drs. R. Daniel Beauchamp, Chairman of the Section of Surgical Sciences, Dr. James R. Goldenring, Vice Chairman of Research of the Department of Surgery, Dr. Naji N.
    [Show full text]
  • Arnau Soler2019.Pdf
    This thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Genetic responses to environmental stress underlying major depressive disorder Aleix Arnau Soler Doctor of Philosophy The University of Edinburgh 2019 Declaration I hereby declare that this thesis has been composed by myself and that the work presented within has not been submitted for any other degree or professional qualification. I confirm that the work submitted is my own, except where work which has formed part of jointly-authored publications has been included. My contribution and those of the other authors to this work are indicated below. I confirm that appropriate credit has been given within this thesis where reference has been made to the work of others. I composed this thesis under guidance of Dr. Pippa Thomson. Chapter 2 has been published in PLOS ONE and is attached in the Appendix A, chapter 4 and chapter 5 are published in Translational Psychiatry and are attached in the Appendix C and D, and I expect to submit chapter 6 as a manuscript for publication.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]