DOCSLIB.ORG

Molecular Bases of Equine Polysaccharide Storage Myopathies a Dissertation SUBMITTED to the FACULTY of UNIVERSITY of MINNESOTA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Bases of Equine Polysaccharide Storage Myopathies a Dissertation SUBMITTED to the FACULTY of UNIVERSITY of MINNESOTA Molecular bases of equine polysaccharide storage myopathies A Dissertation SUBMITTED TO THE FACULTY OF UNIVERSITY OF MINNESOTA BY Raffaella Bertoni Cavalcanti Teixeira IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Molly McCue, James Mickelson April, 2015 © {Raffaella Bertoni Cavalcanti Teixeira, 2015} Acknowledgements First of all I am thankful to Drs McCue and Mickelson for their essential support. Without their superior knowledge and experience I would not have been able to accomplish this work. The author would also like to thank Drs Reed, Rendahl and Valberg for being part of my committee and for their support and help. I would also like to acknowledge Rob Schaefer for all his help with scripts and commands. I have learned a lot from him. I would like to thank my lab mates Sam Beeson, Elaine Norton, Annette McCoy, Felipe Avila, Nichol Schultz and Ann Kemper for their help and friendship. And last, I want to thank my dog Stella for showing me her love during good and bad times. I have met incredible people during this journey and I’m very thankful to each one of them. You have all left a mark on my life forever. i Dedication This thesis is dedicated to my adviser Dr McCue for helping me achieve my goal of completing a PhD. Dr McCue has taught me so many important lessons. I’m a better scientist, clinician and most of all, a better person because of her. Her lessons will stay with me for the rest of my life. I also dedicate this work to my co-adviser, Dr Mickelson, for being supportive, helpful, wise and very patient. I dedicate this thesis to my family (Mom, Dad, brother and sister-in-law). You are the most important thing I have in my life. Your unconditional support gives me strength to fight for my dreams. And last, I would like to dedicate this thesis to my friends, especially Fernanda Shoyama, Marina Figueiredo and Alex Draper for always being there for me. ii Table of Contents Chapter 1 ............................................................................................................................ 1 Introduction and Literature Review ..................................................................................... 1 Polysaccharide Storage Myopathy .............................................................................. 2 Clinical Signs ........................................................................................................... 2 Muscle Histopathology ............................................................................................ 2 Prevalence ............................................................................................................... 3 Biochemistry and metabolic findings related to the energy deficit ......................... 4 Discovery of the GYS1 mutation – Type 1 PSSM ....................................................... 4 Variable phenotypic expression in type 1 PSSM horses ......................................... 7 Prevalence of the GYS1 mutation ............................................................................ 9 Hypothesized link between GYS1, glycogen accumulation and rhabdomyolysis .. 12 Research questions to be addressed for PSSM1 .................................................... 14 Hypothesis and Specific Aims: PSSM1 .................................................................... 14 Type 2 PSSM ............................................................................................................. 16 Clinical signs ......................................................................................................... 16 Prevalence ............................................................................................................. 16 Biopsy findings ...................................................................................................... 16 Preliminary GWAS analysis .................................................................................. 17 Limitations to the initial GWAS ............................................................................. 20 Hypothesis and Specific Aims PSSM2 ..................................................................... 20 Genotype Imputation and GWAS ............................................................................... 22 Chapter 2 .......................................................................................................................... 23 Normal equine skeletal muscle gene expression profiles prior to and after a standardized submaximal exercise trial .................................................................................................. 23 Summary ........................................................................................................................ 24 Introduction ................................................................................................................... 26 Material and Methods .................................................................................................... 27 Results ........................................................................................................................... 34 Discussion ...................................................................................................................... 36 Chapter 3 .......................................................................................................................... 75 Gene Expression Profile in Type 1 Polysaccharide Storage Myopathy ............................ 75 Summary ........................................................................................................................ 76 Introduction ................................................................................................................... 77 Material and Methods .................................................................................................... 81 Results ........................................................................................................................... 89 Discussion ...................................................................................................................... 92 Chapter 4 ........................................................................................................................ 148 iii Evaluation of a potential PSSM 2 locus on equine chromosome 18 ............................... 148 Summary ...................................................................................................................... 149 Introduction ................................................................................................................. 150 Material and Methods .................................................................................................. 151 Results ......................................................................................................................... 155 Discussion .................................................................................................................... 159 Chapter 5 ........................................................................................................................ 169 Enhancing the PSSM2 GWAS by Genotype Imputation ................................................ 169 Summary ...................................................................................................................... 170 Introduction ................................................................................................................. 172 Material and Methods .................................................................................................. 173 Results ......................................................................................................................... 177 Discussion .................................................................................................................... 179 Chapter 6 ........................................................................................................................ 185 Final Considerations and Future Directions .................................................................... 185 Type 1 Polysaccharide Storage Myopathy .................................................................. 186 Type 2 Polysaccharide Storage Myopathy .................................................................. 188 Reference List ................................................................................................................ 192 iv List of Tables Table 1. Output from Cufflinks. ............................................................................................................................................ 43 Table 2. Output from Cufflinks. ............................................................................................................................................. 45 Table 3. Output from Cufflinks. ............................................................................................................................................. 48 Table 4. Comparisons performed between time point t1 and t2. Training effect within group. ....................... 51 Table 5. Comparisons performed between time point t2 and t3. Exercise effect within group. ....................... 53 Table 6. DAVID clusters based on biological function for all of the comparisons. ............................................. 56 Table 7. Summary of pathways used by GSEA and their keywords ........................................................................
Load more

Recommended publications
  • RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition After Olanzapine Infusion in Rats
    RESEARCH ARTICLE RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats Christopher J. Lynch1*, Yuping Xu1, Andras Hajnal2, Anna C. Salzberg3, Yuka Imamura Kawasawa4,5,6 1 Department of Cellular and Molecular Physiology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 2 Department of Neural and Behavioral Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 3 Department a11111 of Public Health Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 4 Department of Pharmacology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 5 Department of Biochemistry and Molecular Biology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 6 The Institute for Personalized Medicine, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America * [email protected] OPEN ACCESS Citation: Lynch CJ, Xu Y, Hajnal A, Salzberg AC, Kawasawa YI (2015) RNA Sequencing Reveals a Abstract Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats. PLoS ONE 10(4): Second generation antipsychotics (SGAs), like olanzapine, exhibit acute metabolic side ef- e0123966. doi:10.1371/journal.pone.0123966 fects leading to metabolic inflexibility, hyperglycemia, adiposity and diabetes. Understand- Academic Editor: Guillermo López Lluch, ing how SGAs affect the skeletal muscle transcriptome could elucidate approaches for Universidad Pablo de Olavide, Centro Andaluz de mitigating these side effects. Male Sprague-Dawley rats were infused intravenously with ve- Biología del Desarrollo-CSIC, SPAIN hicle or olanzapine for 24h using a dose leading to a mild hyperglycemia.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Diseasespecific and Inflammationindependent Stromal
    Full Length Arthritis & Rheumatism DOI 10.1002/art.37704 Disease-specific and inflammation-independent stromal alterations in spondyloarthritis synovitis Nataliya Yeremenko1,2, Troy Noordenbos1,2, Tineke Cantaert1,3, Melissa van Tok1,2, Marleen van de Sande1, Juan D. Cañete4, Paul P. Tak1,5*, Dominique Baeten1,2 1Department of Clinical Immunology and Rheumatology and 2Department of Experimental Immunology, Academic Medical Center/University of Amsterdam, the Netherlands. 3Department of Immunobiology, Yale University School of Medicine, New Haven, CT, USA. 4Department of Rheumatology, Hospital Clinic de Barcelona and IDIBAPS, Spain. 5Arthrogen B.V., Amsterdam, the Netherlands. *Currently also: GlaxoSmithKline, Stevenage, U.K. Corresponding author: Dominique Baeten, MD, PhD, Department of Clinical Immunology and Rheumatology, F4-105, Academic Medical Center/University of Amsterdam, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail: [email protected] This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/art.37704 © 2012 American College of Rheumatology Received: Apr 11, 2012; Revised: Jul 25, 2012; Accepted: Sep 06, 2012 Arthritis & Rheumatism Page 2 of 36 Abstract Objective: The molecular processes driving the distinct patterns of synovial inflammation and tissue remodelling in spondyloarthritis (SpA) versus rheumatoid arthritis (RA) remain largely unknown. Therefore, we aimed to identify novel and unsuspected disease- specific pathways in SpA by a systematic and unbiased synovial gene expression analysis. Methods: Differentially expressed genes were identified by pan-genomic microarray and confirmed by quantitative PCR and immunohistochemistry using synovial tissue biopsies of SpA (n=63), RA (n=28) and gout (n=9) patients.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • The Role of Translocator Protein TSPO in Hallmarks of Glioblastoma
    cancers Review The Role of Translocator Protein TSPO in Hallmarks of Glioblastoma Laura-Marie Ammer 1, Arabel Vollmann-Zwerenz 1, Viktoria Ruf 2, Christian H. Wetzel 3 , Markus J. Riemenschneider 4, Nathalie L. Albert 5, Philipp Beckhove 6 and Peter Hau 1,* 1 Wilhelm Sander-NeuroOncology Unit and Department of Neurology, University Hospital Regensburg, 93053 Regensburg, Germany; [email protected] (L.-M.A.); [email protected] (A.V.-Z.) 2 Center for Neuropathology and Prion Research, Ludwig Maximilians University of Munich, 81377 Munich, Germany; [email protected] 3 Molecular Neurosciences, Department of Psychiatry and Psychotherapy, University of Regensburg, 93053 Regensburg, Germany; [email protected] 4 Department of Neuropathology, Regensburg University Hospital, 93053 Regensburg, Germany; [email protected] 5 Department of Nuclear Medicine, Ludwig-Maximilians-University Munich, 81377 Munich, Germany; [email protected] 6 Regensburg Center for Interventional Immunology (RCI) and Department Internal Medicine III, University Hospital Regensburg, 93053 Regensburg, Germany; [email protected] * Correspondence: [email protected] Received: 14 September 2020; Accepted: 9 October 2020; Published: 14 October 2020 Simple Summary: The translocator protein (TSPO) has been under extensive investigation as a specific marker in positron emission tomography (PET) to visualize brain lesions following injury or disease. In recent years, TSPO is increasingly appreciated as a potential novel therapeutic target in cancer. In Glioblastoma (GBM), the most malignant primary brain tumor, TSPO expression levels are strongly elevated and scientific evidence accumulates, hinting at a pivotal role of TSPO in tumorigenesis and glioma progression. The aim of this review is to summarize the current literature on TSPO with respect to its role both in diagnostics and especially with regard to the critical hallmarks of cancer postulated by Hanahan and Weinberg.
    [Show full text]
  • Updates on Myopia
    Updates on Myopia A Clinical Perspective Marcus Ang Tien Y. Wong Editors Updates on Myopia Marcus Ang • Tien Y. Wong Editors Updates on Myopia A Clinical Perspective Editors Marcus Ang Tien Y. Wong Singapore National Eye Center Singapore National Eye Center Duke-NUS Medical School Duke-NUS Medical School National University of Singapore National University of Singapore Singapore Singapore This book is an open access publication. ISBN 978-981-13-8490-5 ISBN 978-981-13-8491-2 (eBook) https://doi.org/10.1007/978-981-13-8491-2 © The Editor(s) (if applicable) and The Author(s) 2020, corrected publication 2020 Open Access This book is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made. The images or other third party material in this book are included in the book's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the book's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specifc statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use.
    [Show full text]
  • (TSPO) in Mitochondrial Bioenergetics and Immune Processes
    cells Review The Translocator Protein (TSPO) in Mitochondrial Bioenergetics and Immune Processes Calina Betlazar 1,2,* , Ryan J. Middleton 1 , Richard Banati 1,2 and Guo-Jun Liu 1,2,* 1 Human Health, Australian Nuclear Science and Technology Organisation, New Illawarra Road, Lucas Heights, NSW 2234, Australia; [email protected] (R.J.M.); [email protected] (R.B.) 2 Discipline of Medical Imaging & Radiation Sciences, Faculty of Medicine and Health, Brain and Mind Centre, University of Sydney, 94 Mallett Street, Camperdown, NSW 2050, Australia * Correspondence: [email protected] (C.B.); [email protected] (G-J.L.) Received: 11 January 2020; Accepted: 19 February 2020; Published: 24 February 2020 Abstract: The translocator protein (TSPO) is an outer mitochondrial membrane protein that is widely used as a biomarker of neuroinflammation, being markedly upregulated in activated microglia in a range of brain pathologies. Despite its extensive use as a target in molecular imaging studies, the exact cellular functions of this protein remain in question. The long-held view that TSPO plays a fundamental role in the translocation of cholesterol through the mitochondrial membranes, and thus, steroidogenesis, has been disputed by several groups with the advent of TSPO knockout mouse models. Instead, much evidence is emerging that TSPO plays a fundamental role in cellular bioenergetics and associated mitochondrial functions, also part of a greater role in the innate immune processes of microglia. In this review, we examine the more direct experimental literature surrounding the immunomodulatory effects of TSPO. We also review studies which highlight a more central role for TSPO in mitochondrial processes, from energy metabolism, to the propagation of inflammatory responses through reactive oxygen species (ROS) modulation.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • De Novo Neurosteroidogenesis in Human Microglia: Involvement of the 18 Kda Translocator Protein
    International Journal of Molecular Sciences Article De novo Neurosteroidogenesis in Human Microglia: Involvement of the 18 kDa Translocator Protein Lorenzo Germelli 1,† , Eleonora Da Pozzo 1,† , Chiara Giacomelli 1 , Chiara Tremolanti 1 , Laura Marchetti 1, Christian H. Wetzel 2 , Elisabetta Barresi 1 , Sabrina Taliani 1 , Federico Da Settimo 1 , Claudia Martini 1,* and Barbara Costa 1 1 Department of Pharmacy, University of Pisa, 56126 Pisa, Italy; [email protected] (L.G.); [email protected] (E.D.P.); [email protected] (C.G.); [email protected] (C.T.); [email protected] (L.M.); [email protected] (E.B.); [email protected] (S.T.); [email protected] (F.D.S.); [email protected] (B.C.) 2 Department of Psychiatry and Psychotherapy, Molecular Neurosciences, University of Regensburg, 93053 Regensburg, Germany; [email protected] * Correspondence: [email protected]; Tel.: +3905-0221-9523 † These authors contributed equally to this work. Abstract: Neuroactive steroids are potent modulators of microglial functions and are capable of counteracting their excessive reactivity. This action has mainly been ascribed to neuroactive steroids released from other sources, as microglia have been defined unable to produce neurosteroids de novo. Unexpectedly, immortalized murine microglia recently exhibited this de novo biosynthesis; herein, de novo neurosteroidogenesis was characterized in immortalized human microglia. The results demonstrated that C20 and HMC3 microglial cells constitutively express members of the Citation: Germelli, L.; Da Pozzo, E.; neurosteroidogenesis multiprotein machinery—in particular, the transduceosome members StAR Giacomelli, C.; Tremolanti, C.; and TSPO, and the enzyme CYP11A1. Moreover, both cell lines produce pregnenolone and transcrip- Marchetti, L.; Wetzel, C.H.; Barresi, E.; tionally express the enzymes involved in neurosteroidogenesis.
    [Show full text]