DOCSLIB.ORG

Development of Gastric Tumors in Apc Mice by the Activation of the B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of Gastric Tumors in Apc Mice by the Activation of the B Research Article Development of Gastric Tumors in ApcMin/+ Mice by the Activation of the B-Catenin/Tcf Signaling Pathway Hiroyuki Tomita,1,2 Yasuhiro Yamada,1 Takeru Oyama,1 Kazuya Hata,1 Yoshinobu Hirose,1 Akira Hara,1 Takahiro Kunisada,3 Yasuyuki Sugiyama,2 Yosuke Adachi,2 Heinz Linhart,4 and Hideki Mori1 Departments of 1Tumor Pathology, 2Oncologic Surgery, and 3Tissue and Organ Development, Gifu University Graduate School of Medicine, Gifu, Japan and 4Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, Massachusetts Abstract 5q21, is responsible for such phenotypes in FAP (1, 2). Therefore, inactivating APC is considered to initiate the multistep progression Although several lines of evidence suggest the involvement of of colorectal cancer (3). The knowledge about how APC acts as a the Wnt pathway in the development of gastric cancers, the tumor suppressor gene was considerably advanced by the demon- functional significance of the pathway in gastric carcinogen- stration that APC contributes to the degradation of cytosolic esis is still poorly defined. To examine the role of the Apc/B- h-catenin, thereby linking APC to the Wnt/h-catenin pathway as a catenin signaling pathway in the development of gastric Min/+ negative regulator (4–7). The critical event in the Wnt pathway cancers, we investigated the gastric mucosa of the Apc activation is the elevation of the cytoplasmic pool of h-catenin and mouse, which is a murine model for familial adenomatous its resultant transport to the nucleus (5, 8). Consequently, the polyposis, carrying a germ-line mutation at codon 850 of Apc. inactivation of APC leads to a constitutive accumulation of h- We found that aged ApcMin/+ mice spontaneously develop catenin, which triggers an aberrant transcriptional activation of the multiple tumors in the stomach, which are accompanied by h-catenin/Tcf target genes, such as Myc and Cyclin D1 (9, 10). loss of heterozygosity of Apc. Such tumors consisted of Gastric cancer is the fourth most common cancer and the adenomatous glands with strong nuclear accumulation of B- second leading cause of cancer-related death in the world (11). catenin. Even a single adenomatous gland already showed Although several lines of evidence suggest the involvement of the nuclear accumulation of B-catenin, suggesting that Apc/B- Wnt pathway in the development of sporadic gastric cancers, the catenin pathway is an initiating event in gastric tumorigenesis functional significance of the Apc/h-catenin pathway in gastric in ApcMin/+ mice. Myc and cyclin D1 expressions, which are carcinogenesis is still poorly defined in comparison with that in transcriptional targets of B-catenin/Tcf, increased in the colon carcinogenesis. The nuclear accumulation of h-catenin, a adenomatous lesions. Furthermore, B-catenin/Tcf reporter hallmark of Wnt activation, has been found in 17% to 54% of transgenic mice with ApcMin allele showed higher levels of the gastric adenocarcinomas (12–14), and mutations in APC and transcriptional activity of B-catenin/Tcf in the gastric tumors. b-catenin are found in a subset of gastric adenocarcinomas. We also treated ApcMin/+ and wild-type mice with N-methyl-N- However, the incidence of such mutations varies according to nitrosourea (MNU), an alkylating agent that induces adeno- evidence from different studies (0–60% for APC mutations and mas and adenocarcinomas in the stomach. Consequently, 0–27% for b-catenin mutations; refs. 13–18). In addition, FAP MNU-treated ApcMin/+ mice significantly enhanced the tumor patients have been reported to have an increased risk for gastric development in comparison with ApcMin/+ mice or MNU- cancer in Japan but not in Western countries (19–22). Taken treated wild-type mice. Several gastric tumors in MNU-treated together, the functional significance of the Wnt pathway in gastric ApcMin/+ mice showed invasion into the submucosal layer. B carcinogenesis therefore remains controversial. These results indicate that the Apc/ -catenin pathway may ApcMin/+ mouse is a mouse model for FAP and harbors a play an important role in at least subset of gastric carcinomas. dominant mutation at the Apc, the mouse homologue of the ApcMin/+ In addition, mice combined with MNU could be a human APC gene, resulting in the truncation of the gene product at useful short-term model to investigate multistage carcinogen- amino acid 850 (23). Originally, this lineage was established from an esis in the stomach. [Cancer Res 2007;67(9):4079–87] ethylnitrosourea-treated C57BL/6Jmale mouse, and its phenotype is an autosomal dominant trait. Although homozygous ApcMin/Min Introduction mice die as embryos, ApcMin/+ mice develop multiple neoplasias in Familial adenomatous polyposis (FAP) is regarded as an their intestinal tracts within several weeks after birth (23). It is also autosomal dominant disease in which many adenomatous polyps known that most of the intestinal tumors in the mice that are develop in the colon, thereafter progressing to colorectal carcinoma. heterozygous for a mutant allele of Apc have lost the Apc function Genetic linkage studies have shown that the inactivation of the due to a loss of heterozygosity (LOH; refs. 24, 25). Although mice adenomatous polyposis coli (APC) gene, located on chromosome generated by gene targeting with a mutation at codon 1638 of the Apc have been reported to occasionally develop gastric tumors after 30 weeks of age (26, 27), the relationship between gastric tumorigenesis and the activation of the Apc/h-catenin pathway has Note: Supplementary data for this article are available at Cancer Research Online Min/+ (http://cancerres.aacrjournals.org/). not yet been well characterized. Apc mice combined with À/À Requests for reprints: Yasuhiro Yamada, Department of Tumor Pathology, Gifu Foxl1 mice (28) or Cdx2 transgenic mice (29) have been shown University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194, Japan. Phone: 81- to develop gastric tumors. However, previous studies have 58-230-6225; Fax: 81-58-230-6226; E-mail: [email protected]. I2007 American Association for Cancer Research. indicated no evidence of a spontaneous development of gastric Min/+ doi:10.1158/0008-5472.CAN-06-4025 tumors in Apc mice. www.aacrjournals.org 4079 Cancer Res 2007; 67: (9). May 1, 2007 Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2007 American Association for Cancer Research. Cancer Research In the present study, we examined the gastric lesions of ApcMin/+ University Hospital, was examined for h-catenin expression. The experi- mice and found, for the first time, that aged ApcMin/+ mice develop ments were carried out according to the protocol approved by the Ethics multiple adenomas in the stomach, which are accompanied by Apc Committee of Gifu University. LOH and the activation of the h-catenin/Tcf signaling pathway. We Immunohistochemistry. The avidin-biotin peroxidase complex (ABC) A also treated ApcMin/+ mice with N-methyl-N-nitrosourea (MNU), an technique was used for immunohistochemical studies. Sections (5 m thick) were cut, deparaffinized, rehydrated in PBS, placed in 10 mmol/L citrate alkylating agent that induces adenomas and adenocarcinomas in the Min/+ buffer (pH 6.0), and heated in a 750-W microwave four times for 6 min. The stomach, to elucidate the mode of gastric carcinogenesis in Apc endogenous peroxidase activity was blocked by incubation for 30 min in mice. Consequently, MNU-treated ApcMin/+ mice were found to 0.3% H2O2. After washing thrice with PBS, the sections were preincubated strongly promote tumor development, and several gastric tumors with normal blocking serum for 20 min at room temperature and then showed invasive adenocarcinomas. These results indicate that the incubated with h-catenin (1:1,000; BD Biosciences PharMingen), c-myc Apc/h-catenin pathway plays a significant role in a subset of gastric (1:200; Santa Cruz Biotechnology), cyclin D1 (1:200; Santa Cruz Biotechnol- carcinogenesis, thus suggesting that this model could be a short- ogy), Ki-67 (1:200; DAKO Corp.), AE1/AE3 (1:100; DAKO), and green term model to investigate multistage carcinogenesis in the stomach. fluorescent protein (GFP) antibody (1:1,500; Molecular Probes) overnight at 4jC. Subsequently, the sections were incubated with biotinylated secondary antibodies (Vectastain ABC kit, Vector Laboratories) for 30 min followed by Materials and Methods incubation with avidin-coupled peroxidase (Vector Laboratories) for 30 min. Animals. This study was approved by the Institutional Ethics Review The sections were developed with 3,3¶-diaminobenzidine (DAB) using Committee for Animal Experiments at Gifu University. ApcMin/+ mice in the DAKO Liquid DAB Substrate-Chromogen System (DAKO) and then C57BL/6Jbackground were obtained from The Jackson Laboratory and counterstained with hematoxylin. For immunofluorescence, FITC- or maintained by breeding ApcMin/+ males to C57BL/6Jfemales. All mice were TRITC-conjugated secondary antibodies (Jackson ImmunoResearch) were maintained under specific pathogen-free conditions with isolated ventila- used and then counterstained with 4¶,6-diamidino-2-phenylindole. No tion cages in an air-conditioned room with a 12-h light/12-h dark cycle. specific staining was observed in the negative control slides prepared They were bred and maintained on a basal diet, CE-2 (CLEA Japan, Inc.), without primary antibody. until the termination of the study. Heterozygous progeny were identified by LOH analysis and laser capture microdissection. In the current study, a PCR analysis of tail DNA using allele-specific primers (24). To examine the DNA for the analysis of the Apc allelic loss was extracted from the cells gastric lesions, ApcMin/+ and age-matched wild-type littermates, 15 to 35 isolated with laser microdissected tissue sections as described previously weeks of age, were used in the present study. It is known that the life span (38, 39). For laser capturing, the slides were put into xylene for 30 min to of ApcMin/+ mice on C57BL/6Jbackground is f20 weeks (23), whereas the dissolve the paraffin that otherwise interfered with laser capture mice in our facility have a better survival as was also observed in several microdissection (LCM).
Load more

Recommended publications
  • Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements
    International Journal of Molecular Sciences Review Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements Ahmed Malki 1,*, Rasha Abu ElRuz 1, Ishita Gupta 2,3,4, Asma Allouch 1 , Semir Vranic 2,3 and Ala-Eddin Al Moustafa 2,3,4,* 1 Department of Biomedical Science, College of Health Sciences, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (R.A.E.); [email protected] (A.A.) 2 College of Medicine, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (I.G.); [email protected] (S.V.) 3 Biomedical and Pharmaceutical Research Unit, QU Health, Qatar University, Doha 2713, Qatar 4 Biomedical Research Center, QU Health, Qatar University, Doha 2713, Qatar * Correspondence: [email protected] (A.M.); [email protected] (A.-E.A.M.); Tel.: +974-4403-6557 (A.M.); +974-3097-7440 (A.-E.A.M.) Abstract: Colorectal cancer (CRC), the third most common type of cancer, is the second leading cause of cancer-related mortality rates worldwide. Although modern research was able to shed light on the pathogenesis of CRC and provide enhanced screening strategies, the prevalence of CRC is still on the rise. Studies showed several cellular signaling pathways dysregulated in CRC, leading to the onset of malignant phenotypes. Therefore, analyzing signaling pathways involved in CRC metastasis is necessary to elucidate the underlying mechanism of CRC progression and pharmacotherapy. This review focused on target genes as well as various cellular signaling pathways including Wnt/β-catenin, p53, TGF-β/SMAD, NF-κB, Notch, VEGF, and JAKs/STAT3, which are associated with CRC progression and metastasis.
    [Show full text]
  • Supplementary Figures and Tables
    Supplementary data Figure S1. Immunoblots of PRMT5, PTEN, p18, p21, p57 and p63 levels in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 (wild type)-treated or sh-PRMT5 + PRMT5 R368A (enzymatically inactive)-treated BGC823 cells. GAPDH served as a loading control. Figure S2. H4R3me2s enrichment at the proximal promoter region of p15 (-163 ~ +220) determined by ChIP analysis. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. The CAGCTG motif is shown in the promoter region of p15 (up panel). Figure S3. Relative enrichment of c-Myc at the promoters of PTEN (P4, left panel) and p57 (P5, right panel) was examined by ChIP assays in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 WT-treated or sh-PRMT5 + PRMT5 K490A-treated BGC823 cells. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. Table S1. Real-time PCR primer sequences CDKN1A forward (5’-3’) TACCCTTGTGCCTCGCTCAG CDKN1A reverse (5’-3’) CGGCGTTTGGAGTGGTAGA PRMT5 forward (5’-3’) TCAGGAAGATAACACCAACCTGG PRMT5 reverse (5’-3’) AGCCACTGCAATCCTCTTACTAT GAPDH forward (5’-3’) GAGCCACATCGCTCAGACAC GAPDH reverse (5’-3’) CATGTAGTTGAGGTCAATGAAGG TP53 forward (5’-3’) GAGGTTGGCTCTGACTGTACC TP53 reverse (5’-3’) TCCGTCCCAGTAGATTACCAC ABL1 forward (5’-3’) CCAGGTGTATGAGCTGCTAGAG ABL1 reverse (5’-3’) GTCAGAGGGATTCCACTGCCAA ANAPC2 forward (5’-3’) CAGGACAGTGAGGATGACTCAG ANAPC2 reverse (5’-3’) TTGCTGCCGTAGATGCTGACCA ANAPC4 forward (5’-3’) AAGGAGGTGACGTGTCTGGCAT ANAPC4 reverse (5’-3’) GCATACAGGAAACTGGAGCCTC DIRAS3 forward (5’-3’) CACATCACCGACAGCAAGAGTG DIRAS3 reverse
    [Show full text]
  • Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
    biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth.
    [Show full text]
  • Dysregulated Gene Expression Predicts Tumor Aggressiveness In
    www.nature.com/scientificreports OPEN Dysregulated gene expression predicts tumor aggressiveness in African-American prostate cancer Received: 8 April 2018 Accepted: 22 October 2018 patients Published: xx xx xxxx Hamdy E. A. Ali1,6, Pei-Yau Lung2, Andrew B. Sholl3, Shaimaa A. Gad1, Juan J. Bustamante1, Hamed I. Ali1, Johng S. Rhim4, Gagan Deep5, Jinfeng Zhang2 & Zakaria Y. Abd Elmageed 1 Molecular mechanisms underlying the health disparity of prostate cancer (PCa) have not been fully determined. In this study, we applied bioinformatic approach to identify and validate dysregulated genes associated with tumor aggressiveness in African American (AA) compared to Caucasian American (CA) men with PCa. We retrieved and analyzed microarray data from 619 PCa patients, 412 AA and 207 CA, and we validated these genes in tumor tissues and cell lines by Real-Time PCR, Western blot, immunocytochemistry (ICC) and immunohistochemistry (IHC) analyses. We identifed 362 diferentially expressed genes in AA men and involved in regulating signaling pathways associated with tumor aggressiveness. In PCa tissues and cells, NKX3.1, APPL2, TPD52, LTC4S, ALDH1A3 and AMD1 transcripts were signifcantly upregulated (p < 0.05) compared to normal cells. IHC confrmed the overexpression of TPD52 (p = 0.0098) and LTC4S (p < 0.0005) in AA compared to CA men. ICC and Western blot analyses additionally corroborated this observation in PCa cells. These fndings suggest that dysregulation of transcripts in PCa may drive the disparity of PCa outcomes and provide new insights into development of new therapeutic agents against aggressive tumors. More studies are warranted to investigate the clinical signifcance of these dysregulated genes in promoting the oncogenic pathways in AA men.
    [Show full text]
  • MYC Oncogene Contributions to Release of Cell Cycle Brakes
    Review MYC Oncogene Contributions to Release of Cell Cycle Brakes Lucía García-Gutiérrez 1,2, María Dolores Delgado 1 and Javier León 1* 1 Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) CSIC-Universidad de Cantabria and Department of Biología Molecular, Universidad de Cantabria, 39011 Santander, Spain; [email protected] (M.D.D.) 2 Current address: Systems Biology Ireland, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (L.G-G) * Correspondence: [email protected]; Tel: +34-942-201952 Received: 24 February 2019; Accepted: 18 March 2019; Published: 22 March 2019 Abstract: Promotion of the cell cycle is a major oncogenic mechanism of the oncogene c-MYC (MYC). MYC promotes the cell cycle by not only activating or inducing cyclins and CDKs but also through the downregulation or the impairment of the activity of a set of proteins that act as cell- cycle brakes. This review is focused on the role of MYC as a cell-cycle brake releaser i.e., how MYC stimulates the cell cycle mainly through the functional inactivation of cell cycle inhibitors. MYC antagonizes the activities and/or the expression levels of p15, ARF, p21, and p27. The mechanism involved differs for each protein. p15 (encoded by CDKN2B) and p21 (CDKN1A) are repressed by MYC at the transcriptional level. In contrast, MYC activates ARF, which contributes to the apoptosis induced by high MYC levels. At least in some cells types, MYC inhibits the transcription of the p27 gene (CDKN1B) but also enhances p27’s degradation through the upregulation of components of ubiquitin ligases complexes.
    [Show full text]
  • Functional Characterization of a Rare
    European Journal of Endocrinology (2012) 166 551–560 ISSN 0804-4643 CASE REPORT Functional characterization of a rare germline mutation in the gene encoding the cyclin-dependent kinase inhibitor p27Kip1 (CDKN1B) in a Spanish patient with multiple endocrine neoplasia-like phenotype Donatella Malanga1,2, Silvia De Gisi2, Miriam Riccardi1,2, Marianna Scrima2, Carmela De Marco1,2, Mercedes Robledo3 and Giuseppe Viglietto1,2 1Dipartimento di Medicina Sperimentale e Clinica ‘G Salvatore’, Universita` Magna Graecia, Campus Universitario Germaneto, 88100 Catanzaro, Italy, 2BIOGEM-Istituto di Ricerche Genetiche ‘G Salvatore’, 83031 Ariano Irpino (AV), Italy and 3Hereditary Endocrine Cancer Group, Human Cancer Genetics Programme, Spanish National Cancer Centre, Centro Nacional de Investigaciones Oncologicas (CNIO), Calle Melchor Fernandez Almagro 3, 28029 Madrid, Spain (Correspondence should be addressed to G Viglietto at Dipartimento di Medicina Sperimentale e Clinica ‘G Salvatore’ Universita` Magna Graecia; Email: [email protected]) Abstract Objective: The aim of this study was to investigate the presence of germline mutations in the CDKN1B gene that encodes the cyclin-dependent kinase (Cdk) inhibitor p27 in multiple endocrine neoplasia 1 (MEN1)-like Spanish index patients. The CDKN1B gene has recently been identified as a tumor susceptibility gene for MEN4, with six germline mutations reported so far in patients with a MEN-like phenotype but negative for MEN1 mutations. Design and methods: Fifteen Spanish index cases with MEN-like symptoms were screened for mutations in the CDKN1B gene and the mutant variant was studied functionally by transcription/translation assays in vitro and in transiently transfected HeLa cells. Results: We report the identification of a heterozygous GAGA deletion in the 50-UTR of CDKN1B, NM_004064.3:c.-32_-29del, in a patient affected by gastric carcinoid tumor and hyperparathyroid- ism.
    [Show full text]
  • P27 As a Transcriptional Regulator: New Roles in Development and Cancer
    Author Manuscript Published OnlineFirst on April 27, 2020; DOI: 10.1158/0008-5472.CAN-19-3663 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. p27 as a transcriptional regulator: New roles in development and cancer Seyedeh Fatemeh Razavipour1,2,*, Kuzhuvelil B.Harikumar1,3,*, and Joyce M. Slingerland1,2,4,** 1Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, 33136, USA; 2Department of Biochemistry& Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, 33136, USA; 3Cancer Research Program, Rajiv Gandhi Centre for Biotechnology (RGCB), Thiruvananthapuram, India ; 4Department of Medicine, University of Miami Miller School of Medicine, Miami, FL, 33136, USA *Co-first author **Correspondence: Dr. J Slingerland, Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, BRB708, 1501 NW 10th Avenue, Miami, FL 33136, USA. Email: [email protected] Running Title: 27 as transcriptional regulator Key Words: p27, cell cycle, cJun, EMT, metastasis, transcription The authors declare no potential conflicts of interest 1 Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 27, 2020; DOI: 10.1158/0008-5472.CAN-19-3663 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract p27 binds and inhibits cyclin-CDK to arrest the cell cycle. p27 also regulates other processes including migration and development independent of its CDK inhibitory action. p27 is an atypical tumor suppressor: deletion or mutational inactivation of the gene encoding p27, CDKN1B, is rare in human cancers.
    [Show full text]
  • The MLL Fusion Gene, MLL-AF4, Regulates Cyclin-Dependent Kinase Inhibitor CDKN1B (P27kip1) Expression
    The MLL fusion gene, MLL-AF4, regulates cyclin-dependent kinase inhibitor CDKN1B (p27kip1) expression Zhen-Biao Xia, Relja Popovic, Jing Chen, Catherine Theisler, Tara Stuart, Donna A. Santillan, Frank Erfurth, Manuel O. Diaz, and Nancy J. Zeleznik-Le* Department of Medicine, Molecular Biology Program, and Oncology Institute, Cardinal Bernardin Cancer Center, Loyola University Medical Center, Maywood, IL 60153 Communicated by Janet D. Rowley, University of Chicago Medical Center, Chicago, IL, July 29, 2005 (received for review December 2, 2004) MLL, involved in many chromosomal translocations associated Recent studies suggest some potential mechanisms of MLL with acute myeloid and lymphoid leukemia, has >50 known fusion protein leukemogenesis. For example, fusion partner partner genes with which it is able to form in-frame fusions. dimerization domains and͞or activation domains fused to MLL Characterizing important downstream target genes of MLL and of can aberrantly activate downstream targets such as HOX genes MLL fusion proteins may provide rational therapeutic strategies for and contribute to cell transformation (13, 14). This regulation is the treatment of MLL-associated leukemia. We explored down- mediated at the level of target gene transcription. There is very stream target genes of the most prevalent MLL fusion protein, strict regulation of HOX gene expression during hematopoiesis, MLL-AF4. To this end, we developed inducible MLL-AF4 fusion cell therefore misregulated expression of these genes is likely im- lines in different backgrounds. Overexpression of MLL-AF4 does portant in MLL leukemogenesis. not lead to increased proliferation in either cell line, but rather, cell During normal hematopoiesis, a tight balance is required be- growth was slowed compared with similar cell lines inducibly tween levels of mostly quiescent stem cells that can renew the expressing truncated MLL.
    [Show full text]
  • The Role of Cdks and Cdkis in Murine Development
    International Journal of Molecular Sciences Review The Role of CDKs and CDKIs in Murine Development Grace Jean Campbell , Emma Langdale Hands and Mathew Van de Pette * Epigenetic Mechanisms of Toxicology Lab, MRC Toxicology Unit, Cambridge University, Cambridge CB2 1QR, UK; [email protected] (G.J.C.); [email protected] (E.L.H.) * Correspondence: [email protected] Received: 8 July 2020; Accepted: 26 July 2020; Published: 28 July 2020 Abstract: Cyclin-dependent kinases (CDKs) and their inhibitors (CDKIs) play pivotal roles in the regulation of the cell cycle. As a result of these functions, it may be extrapolated that they are essential for appropriate embryonic development. The twenty known mouse CDKs and eight CDKIs have been studied to varying degrees in the developing mouse, but only a handful of CDKs and a single CDKI have been shown to be absolutely required for murine embryonic development. What has become apparent, as more studies have shone light on these family members, is that in addition to their primary functional role in regulating the cell cycle, many of these genes are also controlling specific cell fates by directing differentiation in various tissues. Here we review the extensive mouse models that have been generated to study the functions of CDKs and CDKIs, and discuss their varying roles in murine embryonic development, with a particular focus on the brain, pancreas and fertility. Keywords: cyclin-dependent kinase; CDK inhibitors; mouse; development; knock-out models 1. Introduction Cyclin-dependent kinases (CDKs) are proteins that, by definition, require the binding of partner cyclin proteins in order to phosphorylate a series of target proteins.
    [Show full text]
  • MEN4 and CDKN1B Mutations 24:10 T195–T208 Thematic Review
    2410 R Alrezk et al. MEN4 and CDKN1B mutations 24:10 T195–T208 Thematic Review MEN4 and CDKN1B mutations: the latest of the MEN syndromes Rami Alrezk1, Fady Hannah-Shmouni2 and Constantine A Stratakis2 1 The National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Correspondence Maryland, USA should be addressed 2 Section on Endocrinology & Genetics, the Eunice Kennedy Shriver National Institute of Child Health and Human to C A Stratakis Development, NIH, Bethesda, Maryland, USA Email [email protected] Abstract Multiple endocrine neoplasia (MEN) refers to a group of autosomal dominant disorders Key Words with generally high penetrance that lead to the development of a wide spectrum of f multiple endocrine endocrine and non-endocrine manifestations. The most frequent among these conditions neoplasia is MEN type 1 (MEN1), which is caused by germline heterozygous loss-of-function f MEN4 mutations in the tumor suppressor gene MEN1. MEN1 is characterized by primary f MEN1 hyperparathyroidism (PHPT) and functional or nonfunctional pancreatic neuroendocrine f neuroendocrine tumors tumors and pituitary adenomas. Approximately 10% of patients with familial or sporadic f CDKN1B MEN1-like phenotype do not have MEN1 mutations or deletions. A novel MEN syndrome f p27 was discovered, initially in rats (MENX), and later in humans (MEN4), which is caused by germline mutations in the putative tumor suppressor CDKN1B. The most common phenotype of the 19 established cases of MEN4 that have been described to date is PHPT Endocrine-Related Cancer Endocrine-Related followed by pituitary adenomas. Recently, somatic or germline mutations in CDKN1B were also identified in patients with sporadic PHPT, small intestinal neuroendocrine tumors, lymphoma and breast cancer, demonstrating a novel role for CDKN1B as a tumor susceptibility gene for other neoplasms.
    [Show full text]
  • Role of the CDKN1A/P21, CDKN1C/P57, and CDKN2A/P16 Genes in the Risk of Atherosclerosis and Myocardial Infarction
    [Cell Cycle 6:5, 620-625, 1 March 2007]; ©2007 Landes Bioscience Report Role of the CDKN1A/p21, CDKN1C/p57, and CDKN2A/p16 Genes in the Risk of Atherosclerosis and Myocardial Infarction Isabel Rodríguez1,* ABSTRACT Eliecer Coto1,2,* Atherosclerosis is characterized by excessive proliferation of neointimal leukocytes 1,3 and vascular smooth muscle cells (VSMCs). In mice, the manipulation of cell cycle Julián R. Reguero inhibitors such as CDKN1B (p27) and CDKN1A (p21) modifies the risk of developing Pelayo González1 atherosclerosis. In humans, CDKN1A, CDKN1B and CDKN1C (p57) are differentially 4 expressed in normal versus atherosclerotic vessels. A DNA-polymorphism within the Vicente Andrés CDKN1B promoter has been associated with myocardial infarction (MI). In the present Iñigo Lozano1 study, we analyzed the effect of CDKN1A, CDKN1C and CDKN2A (p16) polymorphisms 1 on MI-risk. María Martín A total of 316 patients (all male, < 55 years) and 434 controls were genotyped, Victoria Alvarez1 and the allele and genotype frequencies were compared between the two groups. Two CDKN1C polymorphisms, a promoter GT-repeat and a variable number of repeats of 1,3 César Morís the amino acid PAPA-motif, were associated with MI. The presence of two alleles ≤ 11-repeats (9/11, 10/11 and 11/11 genotypes) was significantly less frequent among 1Genética Molecular and Cardiología; Hospital Central de Asturias; Oviedo, Spain patients (p < 0.001). This difference was also significant when analyzing the subpopula- tion of smokers (p = 0.004), suggesting a protective role for these low-repeat genotypes 2 Instituto de Investigación Nefrológica-Fundación Renal; Spain (OR = 0.49, 95%CI = 0.32–0.73).
    [Show full text]
  • The Interplay of Proteins Encoded by CDKN1A, CDKN1B, CDKN2A and TP53 in the Prognosis of Breast Cancer
    Research Article Clinics in Oncology Published: 02 Aug, 2019 The Interplay of Proteins Encoded by CDKN1A, CDKN1B, CDKN2A and TP53 in the Prognosis of Breast Cancer Valentina Robila1*, Bryce S Hatfield1, Nitai Mukhopadhyay2 and Michael O Idowu1 1Department of Pathology, VCU School of Medicine, USA 2Department of Biostatistics, VCU School of Medicine, USA Abstract The use of palbociclib has increased the spotlight on cell cycle regulators, especially on the proteins encoded by CDKN2A (p16), CDKN1A (p21), CDKN1B (p27), cyclin D1 and TP53 (p53). Cell cycle regulators and cyclin-dependent kinases show significant promise as new breast cancer biomarkers. Expression patterns of small sets of proteins in breast carcinoma were reported, and their overall role in breast cancer progression was investigated, with mixed results. The goal of our study was to simultaneously evaluate multiple cell cycle regulators in breast carcinoma. The protein expression was assessed on Tissue Microarrays (TMA) and the intensity and percentage of positive tumor cells were quantified. Statistical analysis was performed to establish patterns of protein associations, as well as correlation with prognostic factors, including metastases/recurrence and overall survival. Non-triple negative carcinoma showed significantly increased expression of cyclin D1, marginally increased expression of p21, 27, and decreased expression of p16, p53. This is in contrast to triple negative carcinoma which expressed high levels of p16 and p53. Statistically significant dual proteins associations were demonstrated, including direct correlations of expression of cyclin D1 with p21 or 27, and indirect correlations with p16 and p53. Cyclin D1 (p=0.0001) and p21 (p=0.0049) expression imparted a favorable outcome on development of metastases and/or survival, while p16 (p=0.0048) had a negative impact, particularly on non-triple negative carcinoma.
    [Show full text]