MYC Oncogene Contributions to Release of Cell Cycle Brakes
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements
International Journal of Molecular Sciences Review Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements Ahmed Malki 1,*, Rasha Abu ElRuz 1, Ishita Gupta 2,3,4, Asma Allouch 1 , Semir Vranic 2,3 and Ala-Eddin Al Moustafa 2,3,4,* 1 Department of Biomedical Science, College of Health Sciences, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (R.A.E.); [email protected] (A.A.) 2 College of Medicine, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (I.G.); [email protected] (S.V.) 3 Biomedical and Pharmaceutical Research Unit, QU Health, Qatar University, Doha 2713, Qatar 4 Biomedical Research Center, QU Health, Qatar University, Doha 2713, Qatar * Correspondence: [email protected] (A.M.); [email protected] (A.-E.A.M.); Tel.: +974-4403-6557 (A.M.); +974-3097-7440 (A.-E.A.M.) Abstract: Colorectal cancer (CRC), the third most common type of cancer, is the second leading cause of cancer-related mortality rates worldwide. Although modern research was able to shed light on the pathogenesis of CRC and provide enhanced screening strategies, the prevalence of CRC is still on the rise. Studies showed several cellular signaling pathways dysregulated in CRC, leading to the onset of malignant phenotypes. Therefore, analyzing signaling pathways involved in CRC metastasis is necessary to elucidate the underlying mechanism of CRC progression and pharmacotherapy. This review focused on target genes as well as various cellular signaling pathways including Wnt/β-catenin, p53, TGF-β/SMAD, NF-κB, Notch, VEGF, and JAKs/STAT3, which are associated with CRC progression and metastasis. -
The P16 (Cdkn2a/Ink4a) Tumor-Suppressor Gene in Head
The p16 (CDKN2a/INK4a) Tumor-Suppressor Gene in Head and Neck Squamous Cell Carcinoma: A Promoter Methylation and Protein Expression Study in 100 Cases Lingbao Ai, M.D., Krystal K. Stephenson, Wenhua Ling, M.D., Chunlai Zuo, M.D., Perkins Mukunyadzi, M.D., James Y. Suen, M.D., Ehab Hanna, M.D., Chun-Yang Fan, M.D., Ph.D. Departments of Pathology (LA, KKS, CZ, PM, CYF) and Otolaryngology-Head and Neck Surgery (CYF, JYS, EH), University of Arkansas for Medical Sciences; and School of Public Health (LA, WL), Sun-Yat Sen University, Guangzhou, China apparent loss of p16 protein expression appears to The p16 (CDKN2a/INK4a) gene is an important be an independent prognostic factor, although loss tumor-suppressor gene, involved in the p16/cyclin- of p16 protein may be used to predict overall pa- dependent kinase/retinoblastoma gene pathway of tient survival in early-stage head and neck squa- cell cycle control. The p16 protein is considered to mous cell carcinoma. be a negative regulator of the pathway. The gene encodes an inhibitor of cyclin-dependent kinases 4 KEY WORDS: Gene inactivation, Head and and 6, which regulate the phosphorylation of reti- neck squamous cell carcinoma, p16, Promoter noblastoma gene and the G1 to S phase transition of hypermethylation. the cell cycle. In the present study, p16 gene pro- Mod Pathol 2003;16(9):944–950 moter hypermethylation patterns and p16 protein expression were analyzed in 100 consecutive un- The development of head and neck squamous cell treated cases of primary head and neck squamous carcinoma is believed to be a multistep process, in cell carcinoma by methylation-specific PCR and im- which genetic and epigenetic events accumulate as munohistochemical staining. -
Involvement of the Cyclin-Dependent Kinase Inhibitor P16 (Ink4a) in Replicative Senescence of Normal Human Fibroblasts
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 13742–13747, November 1996 Biochemistry Involvement of the cyclin-dependent kinase inhibitor p16 (INK4a) in replicative senescence of normal human fibroblasts DAVID A. ALCORTA*†,YUE XIONG‡,DAWN PHELPS‡,GREG HANNON§,DAVID BEACH§, AND J. CARL BARRETT* *Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709; ‡Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599; and §Howard Hughes Medical Institute, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY 11724 Communicated by Raymond L. Erickson, Harvard University, Cambridge, MA, September 19, 1996 (received for review on May 15, 1996) ABSTRACT Human diploid fibroblasts (HDFs) can be viewed in ref. 5). In senescent fibroblasts, CDK2 is catalytically grown in culture for a finite number of population doublings inactive and the protein down-regulated (7). CDK4 is also before they cease proliferation and enter a growth-arrest state reported to be down-regulated in senescent cells (8), while the termed replicative senescence. The retinoblastoma gene prod- status of CDK6 has not been previously addressed. The uct, Rb, expressed in these cells is hypophosphorylated. To activating cyclins for these CDKs, cyclins D1 and E, are present determine a possible mechanism by which senescent human in senescent cells at similar or elevated levels relative to early fibroblasts maintain a hypophosphorylated Rb, we examined passage cells (8). A role of the CDK inhibitors in senescence the expression levels and interaction of the Rb kinases, CDK4 was revealed by the isolation of a cDNA of a highly expressed and CDK6, and the cyclin-dependent kinase inhibitors p21 message in senescent cells that encoded the CDK inhibitor, p21 and p16 in senescent HDFs. -
Transcriptional Regulation of the P16 Tumor Suppressor Gene
ANTICANCER RESEARCH 35: 4397-4402 (2015) Review Transcriptional Regulation of the p16 Tumor Suppressor Gene YOJIRO KOTAKE, MADOKA NAEMURA, CHIHIRO MURASAKI, YASUTOSHI INOUE and HARUNA OKAMOTO Department of Biological and Environmental Chemistry, Faculty of Humanity-Oriented Science and Engineering, Kinki University, Fukuoka, Japan Abstract. The p16 tumor suppressor gene encodes a specifically bind to and inhibit the activity of cyclin-CDK specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 complexes, thus preventing G1-to-S progression (4, 5). and is found altered in a wide range of human cancers. p16 Among these CKIs, p16 plays a pivotal role in the regulation plays a pivotal role in tumor suppressor networks through of cellular senescence through inhibition of CDK4/6 activity inducing cellular senescence that acts as a barrier to (6, 7). Cellular senescence acts as a barrier to oncogenic cellular transformation by oncogenic signals. p16 protein is transformation induced by oncogenic signals, such as relatively stable and its expression is primary regulated by activating RAS mutations, and is achieved by accumulation transcriptional control. Polycomb group (PcG) proteins of p16 (Figure 1) (8-10). The loss of p16 function is, associate with the p16 locus in a long non-coding RNA, therefore, thought to lead to carcinogenesis. Indeed, many ANRIL-dependent manner, leading to repression of p16 studies have shown that the p16 gene is frequently mutated transcription. YB1, a transcription factor, also represses the or silenced in various human cancers (11-14). p16 transcription through direct association with its Although many studies have led to a deeper understanding promoter region. -
The P16 Status of Tumor Cell Lines Identifies Small Molecule Inhibitors Specific for Cyclin-Dependent Kinase 41
Vol. 5, 4279–4286, December 1999 Clinical Cancer Research 4279 The p16 Status of Tumor Cell Lines Identifies Small Molecule Inhibitors Specific for Cyclin-dependent Kinase 41 Akihito Kubo,2 Kazuhiko Nakagawa,2, 3 CDK4 kinase inhibitors that may selectively induce growth Ravi K. Varma, Nicholas K. Conrad, inhibition of p16-altered tumors. Jin Quan Cheng, Wen-Ching Lee, INTRODUCTION Joseph R. Testa, Bruce E. Johnson, INK4A 4 The p16 gene (also known as CDKN2A) encodes p16 , Frederic J. Kaye, and Michael J. Kelley which inhibits the CDK45:cyclin D and CDK6:cyclin D com- Medicine Branch [A. K., K. N., N. K. C., F. J. K., B. E. J.] and plexes (1). These complexes mediate phosphorylation of the Rb Developmental Therapeutics Program [R. K. V.], National Cancer Institute, Bethesda, Maryland 20889; Department of Medical protein and allow cell cycle progression beyond the G1-S-phase Oncology, Fox Chase Cancer Center, Philadelphia, Pennsylvania checkpoint (2). Alterations of p16 have been described in a wide 19111 [J. Q. C., W-C. L., J. R. T.]; and Department of Medicine, variety of histological types of human cancers including astro- Duke University Medical Center, Durham, North Carolina 27710 cytoma, melanoma, leukemia, breast cancer, head and neck [M. J. K.] squamous cell carcinoma, malignant mesothelioma, and lung cancer. Alterations of p16 can occur through homozygous de- ABSTRACT letion, point mutation, and transcriptional suppression associ- ated with hypermethylation in cancer cell lines and primary Loss of p16 functional activity leading to disruption of tumors (reviewed in Refs. 3–5). the p16/cyclin-dependent kinase (CDK) 4:cyclin D/retino- Whereas the Rb gene is inactivated in a narrow range of blastoma pathway is the most common event in human tumor cells, the pattern of mutational inactivation of Rb is tumorigenesis, suggesting that compounds with CDK4 ki- inversely correlated with p16 alterations (6–8), suggesting that nase inhibitory activity may be useful to regulate cancer cell a single defect in the p16/CDK4:cyclin D/Rb pathway is suffi- growth. -
AP-1 in Cell Proliferation and Survival
Oncogene (2001) 20, 2390 ± 2400 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc AP-1 in cell proliferation and survival Eitan Shaulian1 and Michael Karin*,1 1Laboratory of Gene Regulation and Signal Transduction, Department of Pharmacology, University of California San Diego, 9500 Gilman Drive, La Jolla, California, CA 92093-0636, USA A plethora of physiological and pathological stimuli extensively discussed previously (Angel and Karin, induce and activate a group of DNA binding proteins 1991; Karin, 1995). that form AP-1 dimers. These proteins include the Jun, The mammalian AP-1 proteins are homodimers and Fos and ATF subgroups of transcription factors. Recent heterodimers composed of basic region-leucine zipper studies using cells and mice de®cient in individual AP-1 (bZIP) proteins that belong to the Jun (c-Jun, JunB proteins have begun to shed light on their physiological and JunD), Fos (c-Fos, FosB, Fra-1 and Fra-2), Jun functions in the control of cell proliferation, neoplastic dimerization partners (JDP1 and JDP2) and the closely transformation and apoptosis. Above all such studies related activating transcription factors (ATF2, LRF1/ have identi®ed some of the target genes that mediate the ATF3 and B-ATF) subfamilies (reviewed by (Angel eects of AP-1 proteins on cell proliferation and death. and Karin, 1991; Aronheim et al., 1997; Karin et al., There is evidence that AP-1 proteins, mostly those that 1997; Liebermann et al., 1998; Wisdom, 1999). In belong to the Jun group, control cell life and death addition, some of the Maf proteins (v-Maf, c-Maf and through their ability to regulate the expression and Nrl) can heterodimerize with c-Jun or c-Fos (Nishiza- function of cell cycle regulators such as Cyclin D1, p53, wa et al., 1989; Swaroop et al., 1992), whereas other p21cip1/waf1, p19ARF and p16. -
Supplementary Figures and Tables
Supplementary data Figure S1. Immunoblots of PRMT5, PTEN, p18, p21, p57 and p63 levels in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 (wild type)-treated or sh-PRMT5 + PRMT5 R368A (enzymatically inactive)-treated BGC823 cells. GAPDH served as a loading control. Figure S2. H4R3me2s enrichment at the proximal promoter region of p15 (-163 ~ +220) determined by ChIP analysis. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. The CAGCTG motif is shown in the promoter region of p15 (up panel). Figure S3. Relative enrichment of c-Myc at the promoters of PTEN (P4, left panel) and p57 (P5, right panel) was examined by ChIP assays in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 WT-treated or sh-PRMT5 + PRMT5 K490A-treated BGC823 cells. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. Table S1. Real-time PCR primer sequences CDKN1A forward (5’-3’) TACCCTTGTGCCTCGCTCAG CDKN1A reverse (5’-3’) CGGCGTTTGGAGTGGTAGA PRMT5 forward (5’-3’) TCAGGAAGATAACACCAACCTGG PRMT5 reverse (5’-3’) AGCCACTGCAATCCTCTTACTAT GAPDH forward (5’-3’) GAGCCACATCGCTCAGACAC GAPDH reverse (5’-3’) CATGTAGTTGAGGTCAATGAAGG TP53 forward (5’-3’) GAGGTTGGCTCTGACTGTACC TP53 reverse (5’-3’) TCCGTCCCAGTAGATTACCAC ABL1 forward (5’-3’) CCAGGTGTATGAGCTGCTAGAG ABL1 reverse (5’-3’) GTCAGAGGGATTCCACTGCCAA ANAPC2 forward (5’-3’) CAGGACAGTGAGGATGACTCAG ANAPC2 reverse (5’-3’) TTGCTGCCGTAGATGCTGACCA ANAPC4 forward (5’-3’) AAGGAGGTGACGTGTCTGGCAT ANAPC4 reverse (5’-3’) GCATACAGGAAACTGGAGCCTC DIRAS3 forward (5’-3’) CACATCACCGACAGCAAGAGTG DIRAS3 reverse -
Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth. -
Expression of P16 INK4A and P14 ARF in Hematological Malignancies
Leukemia (1999) 13, 1760–1769 1999 Stockton Press All rights reserved 0887-6924/99 $15.00 http://www.stockton-press.co.uk/leu Expression of p16INK4A and p14ARF in hematological malignancies T Taniguchi1, N Chikatsu1, S Takahashi2, A Fujita3, K Uchimaru4, S Asano5, T Fujita1 and T Motokura1 1Fourth Department of Internal Medicine, University of Tokyo, School of Medicine; 2Division of Clinical Oncology, Cancer Chemotherapy Center, Cancer Institute Hospital; 3Department of Hematology, Showa General Hospital; 4Third Department of Internal Medicine, Teikyo University, School of Medicine; and 5Department of Hematology/Oncology, Institute of Medical Science, University of Tokyo, Tokyo, Japan The INK4A/ARF locus yields two tumor suppressors, p16INK4A tumor suppressor genes.10,11 In human hematological malig- ARF and p14 , and is frequently deleted in human tumors. We nancies, their inactivation occurs mainly by means of homo- studied their mRNA expressions in 41 hematopoietic cell lines and in 137 patients with hematological malignancies; we used zygous deletion or promoter region hypermethylation a quantitative reverse transcription-PCR assay. Normal periph- (reviewed in Ref. 12). In tumors such as pancreatic adenocar- eral bloods, bone marrow and lymph nodes expressed little or cinomas, esophageal squamous cell carcinomas and familial undetectable p16INK4A and p14ARF mRNAs, which were readily melanomas, p16INK4A is often inactivated by point mutation, detected in 12 and 17 of 41 cell lines, respectively. Patients with 12 INK4A which is not the case in hematological malignancies. On hematological malignancies frequently lacked p16 INK4C INK4D ARF the other hand, genetic aberrations of p18 or p19 expression (60/137) and lost p14 expression less frequently 12 (19/137, 13.9%). -
Uncommon Association of Germline Mutations of RET Proto-Oncogene
European Journal of Endocrinology (2008) 158 417–422 ISSN 0804-4643 CASE REPORT Uncommon association of germline mutations of RET proto-oncogene and CDKN2A gene L Foppiani1, F Forzano2, I Ceccherini3, W Bruno4, P Ghiorzo4, F Caroli3, P Quilici5, R Bandelloni5, A Arlandini6, G Sartini6, M Cabria7 and P Del Monte1 1Endocrinology 2Genetics Laboratory, Galliera Hospital, 16128 Genova, Italy, 3Laboratory of Molecular Genetics, G Gaslini Institute, 16148 Genova, Italy, 4Department of Oncology, Biology and Genetics/Medical Genetics Service, University of Genova, 1632 Genova, Italy, 5Pathology Unit, 6Division of Surgery and 7Nuclear Medicine, Galliera Hospital, 16128 Genova, Italy (Correspondence should be addressed to L Foppiani who is now at S S D Endocrinologia, Mura delle Cappuccine 14, 16128 Genova, Italy; Email: [email protected]) Abstract Introduction: Calcitonin measurement is advised in the diagnosis of thyroid nodules, as it is an accurate marker of medullary thyroid carcinoma (MTC). C-cell hyperplasia (CCH)-induced hypercalcitoninemia cannot be distinguished from that induced by MTC, unless surgery is performed. Case: We report the clinical and biological features of a patient with a family history of cancer, including melanoma and pancreatic cancer, who had previously undergone surgery for melanoma. He presented the unusual association of papillary thyroid carcinoma (PTC), normocalcemic hyperpara- thyroidism, and hypercalcitoninemia with a pathological response to pentagastrin, which was histologically deemed secondary to CCH. Multiple endocrine neoplasia (MEN) 2A was diagnosed. RET gene analysis showed a p.V804M missense mutation in exon 14, a low- but variably penetrant defect found in both sporadic and MEN2A-associated MTC/CCH, and a p.G691S polymorphism in exon 11. -
Dysregulated Gene Expression Predicts Tumor Aggressiveness In
www.nature.com/scientificreports OPEN Dysregulated gene expression predicts tumor aggressiveness in African-American prostate cancer Received: 8 April 2018 Accepted: 22 October 2018 patients Published: xx xx xxxx Hamdy E. A. Ali1,6, Pei-Yau Lung2, Andrew B. Sholl3, Shaimaa A. Gad1, Juan J. Bustamante1, Hamed I. Ali1, Johng S. Rhim4, Gagan Deep5, Jinfeng Zhang2 & Zakaria Y. Abd Elmageed 1 Molecular mechanisms underlying the health disparity of prostate cancer (PCa) have not been fully determined. In this study, we applied bioinformatic approach to identify and validate dysregulated genes associated with tumor aggressiveness in African American (AA) compared to Caucasian American (CA) men with PCa. We retrieved and analyzed microarray data from 619 PCa patients, 412 AA and 207 CA, and we validated these genes in tumor tissues and cell lines by Real-Time PCR, Western blot, immunocytochemistry (ICC) and immunohistochemistry (IHC) analyses. We identifed 362 diferentially expressed genes in AA men and involved in regulating signaling pathways associated with tumor aggressiveness. In PCa tissues and cells, NKX3.1, APPL2, TPD52, LTC4S, ALDH1A3 and AMD1 transcripts were signifcantly upregulated (p < 0.05) compared to normal cells. IHC confrmed the overexpression of TPD52 (p = 0.0098) and LTC4S (p < 0.0005) in AA compared to CA men. ICC and Western blot analyses additionally corroborated this observation in PCa cells. These fndings suggest that dysregulation of transcripts in PCa may drive the disparity of PCa outcomes and provide new insights into development of new therapeutic agents against aggressive tumors. More studies are warranted to investigate the clinical signifcance of these dysregulated genes in promoting the oncogenic pathways in AA men. -
Development of Gastric Tumors in Apc Mice by the Activation of the B
Research Article Development of Gastric Tumors in ApcMin/+ Mice by the Activation of the B-Catenin/Tcf Signaling Pathway Hiroyuki Tomita,1,2 Yasuhiro Yamada,1 Takeru Oyama,1 Kazuya Hata,1 Yoshinobu Hirose,1 Akira Hara,1 Takahiro Kunisada,3 Yasuyuki Sugiyama,2 Yosuke Adachi,2 Heinz Linhart,4 and Hideki Mori1 Departments of 1Tumor Pathology, 2Oncologic Surgery, and 3Tissue and Organ Development, Gifu University Graduate School of Medicine, Gifu, Japan and 4Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, Massachusetts Abstract 5q21, is responsible for such phenotypes in FAP (1, 2). Therefore, inactivating APC is considered to initiate the multistep progression Although several lines of evidence suggest the involvement of of colorectal cancer (3). The knowledge about how APC acts as a the Wnt pathway in the development of gastric cancers, the tumor suppressor gene was considerably advanced by the demon- functional significance of the pathway in gastric carcinogen- stration that APC contributes to the degradation of cytosolic esis is still poorly defined. To examine the role of the Apc/B- h-catenin, thereby linking APC to the Wnt/h-catenin pathway as a catenin signaling pathway in the development of gastric Min/+ negative regulator (4–7). The critical event in the Wnt pathway cancers, we investigated the gastric mucosa of the Apc activation is the elevation of the cytoplasmic pool of h-catenin and mouse, which is a murine model for familial adenomatous its resultant transport to the nucleus (5, 8). Consequently, the polyposis, carrying a germ-line mutation at codon 850 of Apc. inactivation of APC leads to a constitutive accumulation of h- We found that aged ApcMin/+ mice spontaneously develop catenin, which triggers an aberrant transcriptional activation of the multiple tumors in the stomach, which are accompanied by h-catenin/Tcf target genes, such as Myc and Cyclin D1 (9, 10).