Functional Characterization of a Rare
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Restoring MLL Reactivates Latent Tumor Suppression-Mediated Vulnerability to Proteasome Inhibitors
Oncogene (2020) 39:5888–5901 https://doi.org/10.1038/s41388-020-01408-7 ARTICLE Restoring MLL reactivates latent tumor suppression-mediated vulnerability to proteasome inhibitors 1 1 2 1 3 1 4 2 Maolin Ge ● Dan Li ● Zhi Qiao ● Yan Sun ● Ting Kang ● Shouhai Zhu ● Shifen Wang ● Hua Xiao ● 1 5 4 1 Chunjun Zhao ● Shuhong Shen ● Zhenshu Xu ● Han Liu Received: 12 March 2020 / Revised: 16 July 2020 / Accepted: 23 July 2020 / Published online: 30 July 2020 © The Author(s) 2020. This article is published with open access Abstract MLL undergoes multiple distinct chromosomal translocations to yield aggressive leukemia with dismal outcomes. Besides their well-established role in leukemogenesis, MLL fusions also possess latent tumor-suppressive activity, which can be exploited as effective cancer treatment strategies using pharmacological means such as proteasome inhibitors (PIs). Here, using MLL-rearranged xenografts and MLL leukemic cells as models, we show that wild-type MLL is indispensable for the latent tumor-suppressive activity of MLL fusions. MLL dysfunction, shown as loss of the chromatin accumulation and subsequent degradation of MLL, compromises the latent tumor suppression of MLL-AF4 and is instrumental for the 1234567890();,: 1234567890();,: acquired PI resistance. Mechanistically, MLL dysfunction is caused by chronic PI treatment-induced epigenetic reprogramming through the H2Bub-ASH2L-MLL axis and can be specifically restored by histone deacetylase (HDAC) inhibitors, which induce histone acetylation and recruits MLL on chromatin to promote cell cycle gene expression. Our findings not only demonstrate the mechanism underlying the inevitable acquisition of PI resistance in MLL leukemic cells, but also illustrate that preventing the emergence of PI-resistant cells constitutes a novel rationale for combination therapy with PIs and HDAC inhibitors in MLL leukemias. -
Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its
Published OnlineFirst January 21, 2015; DOI: 10.1158/1078-0432.CCR-14-1950 Biology of Human Tumors Clinical Cancer Research Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its Nuclear Accumulation Suppresses Gastric Tumorigenesis Longlong Cao1,2, Jiechao Zhou2, Junrong Zhang1,2, Sijin Wu3, Xintao Yang1,2, Xin Zhao2, Huifang Li2, Ming Luo1, Qian Yu1, Guangtan Lin1, Huizhong Lin1, Jianwei Xie1, Ping Li1, Xiaoqing Hu3, Chaohui Zheng1, Guojun Bu2, Yun-wu Zhang2,4, Huaxi Xu2,4,5, Yongliang Yang3, Changming Huang1, and Jie Zhang2,4 Abstract Purpose: As a cyclin-independent atypical CDK, the role of correlated with the severity of gastric cancer based on tumor CDK5 in regulating cell proliferation in gastric cancer remains and lymph node metastasis and patient 5-year fatality rate. unknown. Nuclear localization of CDK5 was found to be significantly Experimental Design: Expression of CDK5 in gastric tumor decreased in tumor tissues and gastric cancer cell lines, and paired adjacent noncancerous tissues from 437 patients was whereas exogenously expression of nucleus-targeted CDK5 measured by Western blotting, immunohistochemistry, and real- inhibited the proliferation and xenograft implantation of time PCR. The subcellular translocation of CDK5 was monitored gastric cancer cells. Treatment with the small molecule during gastric cancer cell proliferation. The role of nuclear CDK5 NS-0011, which increases CDK5 accumulation in the nucleus, in gastric cancer tumorigenic proliferation and ex vivo xenografts suppressed both cancer cell proliferation and xenograft was explored. Furthermore, by screening for compounds in the tumorigenesis. PubChem database that disrupt CDK5 association with its nu- Conclusions: Our results suggest that low CDK5 expression is clear export facilitator, we identified a small molecular (NS-0011) associated with poor overall survival in patients with gastric that inhibits gastric cancer cell growth. -
Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements
International Journal of Molecular Sciences Review Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements Ahmed Malki 1,*, Rasha Abu ElRuz 1, Ishita Gupta 2,3,4, Asma Allouch 1 , Semir Vranic 2,3 and Ala-Eddin Al Moustafa 2,3,4,* 1 Department of Biomedical Science, College of Health Sciences, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (R.A.E.); [email protected] (A.A.) 2 College of Medicine, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (I.G.); [email protected] (S.V.) 3 Biomedical and Pharmaceutical Research Unit, QU Health, Qatar University, Doha 2713, Qatar 4 Biomedical Research Center, QU Health, Qatar University, Doha 2713, Qatar * Correspondence: [email protected] (A.M.); [email protected] (A.-E.A.M.); Tel.: +974-4403-6557 (A.M.); +974-3097-7440 (A.-E.A.M.) Abstract: Colorectal cancer (CRC), the third most common type of cancer, is the second leading cause of cancer-related mortality rates worldwide. Although modern research was able to shed light on the pathogenesis of CRC and provide enhanced screening strategies, the prevalence of CRC is still on the rise. Studies showed several cellular signaling pathways dysregulated in CRC, leading to the onset of malignant phenotypes. Therefore, analyzing signaling pathways involved in CRC metastasis is necessary to elucidate the underlying mechanism of CRC progression and pharmacotherapy. This review focused on target genes as well as various cellular signaling pathways including Wnt/β-catenin, p53, TGF-β/SMAD, NF-κB, Notch, VEGF, and JAKs/STAT3, which are associated with CRC progression and metastasis. -
Cyclin-Dependent Kinases and P53 Pathways Are Activated Independently and Mediate Bax Activation in Neurons After DNA Damage
The Journal of Neuroscience, July 15, 2001, 21(14):5017–5026 Cyclin-Dependent Kinases and P53 Pathways Are Activated Independently and Mediate Bax Activation in Neurons after DNA Damage Erick J. Morris,1 Elizabeth Keramaris,2 Hardy J. Rideout,3 Ruth S. Slack,2 Nicholas J. Dyson,1 Leonidas Stefanis,3 and David S. Park2 1Massachusetts General Hospital Cancer Center, Laboratory of Molecular Oncology, Charlestown, Massachusetts 02129, 2Neuroscience Research Institute, University of Ottawa, Ottawa, Ontario K1H 8M5, Canada, and 3Columbia University, New York, New York 10032 DNA damage has been implicated as one important initiator of ization, and DNA binding that result from DNA damage are not cell death in neuropathological conditions such as stroke. Ac- affected by the inhibition of CDK activity. Conversely, no de- cordingly, it is important to understand the signaling processes crease in retinoblastoma protein (pRb) phosphorylation was that control neuronal death induced by this stimulus. Previous observed in p53-deficient neurons that were treated with camp- evidence has shown that the death of embryonic cortical neu- tothecin. However, either p53 deficiency or the inhibition of rons treated with the DNA-damaging agent camptothecin is CDK activity alone inhibited Bax translocation, cytochrome c dependent on the tumor suppressor p53 and cyclin-dependent release, and caspase-3-like activation. Taken together, our re- kinase (CDK) activity and that the inhibition of either pathway sults indicate that p53 and CDK are activated independently alone leads to enhanced and prolonged survival. We presently and then act in concert to control Bax-mediated apoptosis. show that p53 and CDKs are activated independently on par- allel pathways. -
Caspase-Dependent Activation of Cyclin-Dependent Kinases During Fas-Induced Apoptosis in Jurkat Cells
Proc. Natl. Acad. Sci. USA Vol. 95, pp. 6785–6790, June 1998 Cell Biology Caspase-dependent activation of cyclin-dependent kinases during Fas-induced apoptosis in Jurkat cells BIN-BING ZHOU,HONGLIN LI,JUNYING YUAN, AND MARC W. KIRSCHNER Department of Cell Biology, Harvard Medical School, Boston, MA 02115 Contributed by Marc W. Kirschner, April 7, 1998 ABSTRACT The activation of cyclin-dependent kinases To study the mechanism of cdc2 and cdk2 activation in (cdks) has been implicated in apoptosis induced by various apoptotic cells, we examined cyclin synthesis, cyclin degrada- stimuli. We find that the Fas-induced activation of cdc2 and tion, and posttranslational modifications of cdc2 and cdk2 cdk2 in Jurkat cells is not dependent on protein synthesis, during Fas-induced apoptosis in Jurkat cells. We find that Fas which is shut down very early during apoptosis before induction activates cdc2 and cdk2, despite a potential loss of caspase-3 activation. Instead, activation of these kinases these proteins caused by the very rapid drop in the capacity for seems to result from both a rapid cleavage of Wee1 (an protein synthesis. Activation of these kinases seems to result inhibitory kinase of cdc2 and cdk2) and inactivation of from the maintenance of cyclin levels by rapid inactivation of anaphase-promoting complex (the specific system for cyclin APC, through a caspase-dependent cleavage of one of its degradation), in which CDC27 homolog is cleaved during subunits, and tyrosine dephosphorylation of cdks caused by a apoptosis. Both Wee1 and CDC27 are shown to be substrates cleavage of the inhibitory kinase Wee1. -
Epithelial Cell Death Analysis of Cell Cycle by Flow Cytometry White Paper
Epithelial Cell Death Analysis of Cell Cycle by Flow Cytometry White Paper Authors: Savithri Balasubramanian, John Tigges, Vasilis Toxavidis, Heidi Mariani. Affiliation: Beth Israel Deaconess Medical Center Harvard Stem Cell Institute a Beckman Coulter Life Sciences: Epithelial Cell Death Analysis of Cell Cycle by Flow Cytometry PRINCIPAL OF TECHNIQUE Background: Cell cycle, or cell-division cycle, is the series of events that takes place in a cell leading to its division and duplication (replication). In cells without a nucleus (prokaryotic), cell cycle occurs via a process termed binary fission. In cells with a nucleus (eukaryotes), cell cycle can be divided in two brief periods: interphase—during which the cell grows, accumulating nutrients needed for mitosis and duplicating its DNA—and the mitosis (M) phase, during which the cell splits itself into two distinct cells, often called «daughter cells». Cell-division cycle is a vital process by which a single-celled fertilized egg develops into a mature organism, as well as the process by which hair, skin, blood cells, and some internal organs are renewed. Cell cycle consists of four distinct phases: G1 phase, S phase (synthesis), G2 phase (collectively known as interphase) and M phase (mitosis). M phase is itself composed of two tightly coupled processes: mitosis, in which the cell’s chromosomes are divided between the two daughter cells, and cytokinesis, in which the cell’s cytoplasm divides in half forming distinct cells. Activation of each phase is dependent on the proper progression and completion of the previous one. Cells that have temporarily or reversibly stopped dividing are said to have entered a state of quiescence called G0 phase. -
Transcriptional Regulation of the P16 Tumor Suppressor Gene
ANTICANCER RESEARCH 35: 4397-4402 (2015) Review Transcriptional Regulation of the p16 Tumor Suppressor Gene YOJIRO KOTAKE, MADOKA NAEMURA, CHIHIRO MURASAKI, YASUTOSHI INOUE and HARUNA OKAMOTO Department of Biological and Environmental Chemistry, Faculty of Humanity-Oriented Science and Engineering, Kinki University, Fukuoka, Japan Abstract. The p16 tumor suppressor gene encodes a specifically bind to and inhibit the activity of cyclin-CDK specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 complexes, thus preventing G1-to-S progression (4, 5). and is found altered in a wide range of human cancers. p16 Among these CKIs, p16 plays a pivotal role in the regulation plays a pivotal role in tumor suppressor networks through of cellular senescence through inhibition of CDK4/6 activity inducing cellular senescence that acts as a barrier to (6, 7). Cellular senescence acts as a barrier to oncogenic cellular transformation by oncogenic signals. p16 protein is transformation induced by oncogenic signals, such as relatively stable and its expression is primary regulated by activating RAS mutations, and is achieved by accumulation transcriptional control. Polycomb group (PcG) proteins of p16 (Figure 1) (8-10). The loss of p16 function is, associate with the p16 locus in a long non-coding RNA, therefore, thought to lead to carcinogenesis. Indeed, many ANRIL-dependent manner, leading to repression of p16 studies have shown that the p16 gene is frequently mutated transcription. YB1, a transcription factor, also represses the or silenced in various human cancers (11-14). p16 transcription through direct association with its Although many studies have led to a deeper understanding promoter region. -
P14arf Induces G2 Arrest and Apoptosis Independently of P53
Oncogene (2003) 22, 1822–1835 & 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc ARF p14 induces G2 arrest and apoptosis independently of p53 leading to regression of tumours established in nude mice Be´ atrice Eymin, Camille Leduc, Jean-Luc Coll, Elisabeth Brambilla and Sylvie Gazzeri Groupe de Recherche sur le Cancer du Poumon, EA 2021, Equipe INSERM 9924, Institut Albert Bonniot, 38706 La Tronche Cedex, France Until recently, the ability of ARF (human p14ARF, murine kinases (Serrano et al., 1993). On the other hand, ARF p19ARF) tumour-suppressor protein, encoded by the protects against cellular transformation and immortali- INK4A/ARF locus, to inhibit cell growth in response to zation by activating the p53tumour suppressive protein various stimuli was related to its ability to stabilize p53 (Sherr, 1998). Expression of ARF is induced in response through the so-called ARF/MDM2/p53 pathway. How- to activated oncogenes such as Ras (Serrano et al., 1997; ever, recent data have demonstrated that ARF is not Palmero et al., 1998), c-myc (Zindy et al., 1998), E1A (de implicated in this unique p53-dependent pathway. By use Stanchina et al., 1998), Abl (Radfar et al., 1998; Cong of transient and stable expression, we show here that et al., 1999) and E2F-1 (Bates et al., 1998; Dimri et al., human p14ARF inhibits the growth of human tumoral cells 2000) as well as during replicative senescence (Sherr, lacking functional p53 by inducing a transient G2 arrest 1998). Since ARF-null mice are highly tumour prone ARF and subsequently apoptosis. -
Correction1 4784..4785
Correction Correction: PCI-24781 Induces Caspase and Reactive Oxygen Species-Dependent Apoptosis In the article on PCI-24781 induces caspase and reactive oxygen species-dependent apoptosis published in the May 15, 2009 issue of Clinical Cancer Research, there was an error in Table 1. Down-regulated genes were incorrectly labeled as up-regulated genes. The correct table appears here. Bhalla S, Balasubramanian S, David K, et al. PCI-24781 induces caspase and reactive oxygen species-dependent apoptosis through NF-nB mechanisms and is synergistic with bortezomib in lymphoma cells. Clin Cancer Res 2009;15:3354–65. Table 1. Selected genes from expression analysis following 24-h treatment with PCI-24781, bortezomib, or the combination (in Ramos cells) Accn # Down-regulated genes 0.25 Mmol/L PCI/3 nmol/L Bor Name PCI-24781 Bortezomib Combination* Cell cycle-related NM_000075 Cyclin-dependent kinase 4 (CDK4) 0.49 0.83 0.37 NM_001237 Cyclin A2 (CCNA2) 0.43 0.87 0.37 NM_001950 E2F transcription factor 4, p107/p130-binding (E2F4) 0.48 0.79 0.40 NM_001951 E2F transcription factor 5, p130-binding (E2F5) 0.46 0.98 0.43 NM_003903 CDC16 cell division cycle 16 homolog (S cerevisiae) (CDC16) 0.61 0.78 0.43 NM_031966 Cyclin B1 (CCNB1) 0.55 0.90 0.43 NM_001760 Cyclin D3 (CCND3) 0.48 1.02 0.46 NM_001255 CDC20 cell division cycle 20 homolog (S cerevisiae; CDC20) 0.61 0.82 0.46 NM_001262 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4; CDKN2C) 0.61 1.15 0.56 NM_001238 Cyclin E1 (CCNE1) 0.56 1.05 0.60 NM_001239 Cyclin H (CCNH) 0.74 0.90 0.64 NM_004701 -
Supplementary Figures and Tables
Supplementary data Figure S1. Immunoblots of PRMT5, PTEN, p18, p21, p57 and p63 levels in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 (wild type)-treated or sh-PRMT5 + PRMT5 R368A (enzymatically inactive)-treated BGC823 cells. GAPDH served as a loading control. Figure S2. H4R3me2s enrichment at the proximal promoter region of p15 (-163 ~ +220) determined by ChIP analysis. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. The CAGCTG motif is shown in the promoter region of p15 (up panel). Figure S3. Relative enrichment of c-Myc at the promoters of PTEN (P4, left panel) and p57 (P5, right panel) was examined by ChIP assays in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 WT-treated or sh-PRMT5 + PRMT5 K490A-treated BGC823 cells. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. Table S1. Real-time PCR primer sequences CDKN1A forward (5’-3’) TACCCTTGTGCCTCGCTCAG CDKN1A reverse (5’-3’) CGGCGTTTGGAGTGGTAGA PRMT5 forward (5’-3’) TCAGGAAGATAACACCAACCTGG PRMT5 reverse (5’-3’) AGCCACTGCAATCCTCTTACTAT GAPDH forward (5’-3’) GAGCCACATCGCTCAGACAC GAPDH reverse (5’-3’) CATGTAGTTGAGGTCAATGAAGG TP53 forward (5’-3’) GAGGTTGGCTCTGACTGTACC TP53 reverse (5’-3’) TCCGTCCCAGTAGATTACCAC ABL1 forward (5’-3’) CCAGGTGTATGAGCTGCTAGAG ABL1 reverse (5’-3’) GTCAGAGGGATTCCACTGCCAA ANAPC2 forward (5’-3’) CAGGACAGTGAGGATGACTCAG ANAPC2 reverse (5’-3’) TTGCTGCCGTAGATGCTGACCA ANAPC4 forward (5’-3’) AAGGAGGTGACGTGTCTGGCAT ANAPC4 reverse (5’-3’) GCATACAGGAAACTGGAGCCTC DIRAS3 forward (5’-3’) CACATCACCGACAGCAAGAGTG DIRAS3 reverse -
Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth. -
Apoptosis: Programmed Cell Death
BASIC SCIENCE FOR SURGEONS Apoptosis: Programmed Cell Death Nai-Kang Kuan BS; Edward Passaro, Jr, MD urrently there is much interest and excitement in the understanding of how cells un- dergo the process of apoptosis or programmed cell death. Understanding how, why, and when cells are instructed to die may provide insight into the aging process, au- toimmune syndromes, degenerative diseases, and malignant transformation. This re- viewC focuses on the development of apoptosis and describes the process of programmed cell death, some of the factors that incite or prevent its occurrence, and finally some of the diseases in which it may play a role. The hope is that in the not too distant future we may be able to modify or thwart the apoptotic process for therapeutic benefit. The notion that cells are eliminated or ab- tact with that target cell. In experiments, the sorbed in an orderly manner is not new. death or survival of neurons could be modu- What is new is the recognition that this is lated by the loss of NGF, by antibodies, or an important physiologic process.1 More by the addition of exogenous NGF. During than 40 years ago embryologists noted that development and maturation, many types during morphogenesis cells and tissues ofneuronsarebeingproducedinexcess.This were being deleted in a predictable fash- seemingly extravagant waste of excessive ion. During human development as on- neurons has several survival advantages for togeny recapitulates phylogeny, there is the theorganism.Forexampleneuronsthathave loss of branchial arches, the tail, the cloaca, found their way to the wrong target cell do and webbing between fingers.