A Novel Germline CDKN1B Mutation Causing Multiple Endocrine Tumors: Clinical, Genetic And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Cyclins, Cdks, E2f, Skp2, and More at the First International RB Tumor Suppressor Meeting
Published OnlineFirst July 7, 2010; DOI: 10.1158/0008-5472.CAN-10-0358 Published OnlineFirst on July 7, 2010 as 10.1158/0008-5472.CAN-10-0358 Meeting Report Cancer Research Cyclins, Cdks, E2f, Skp2, and More at the First International RB Tumor Suppressor Meeting Rod Bremner1,3,4 and Eldad Zacksenhaus2,4,5,6 Abstract The RB1 gene was cloned because its inactivation causes the childhood ocular tumor, retinoblastoma. It is widely expressed, inactivated in most human malignancies, and present in diverse organisms from mammals to plants. Initially, retinoblastoma protein (pRB) was linked to cell cycle regulation, but it also regulates se- nescence, apoptosis, autophagy, differentiation, genome stability, immunity, telomere function, stem cell bi- ology, and embryonic development. In the 23 years since the gene was cloned, a formal international symposium focused on the RB pathway has not been held. The “First International RB Tumor Suppressor Meeting” (Toronto, Canada, November 19-21, 2009) established a biennial event to bring experts in the field together to discuss how the RB family (“pocket proteins”), as well as its regulators and effectors, influence biology and human disease. We summarize major new breakthroughs and emerging trends presented at the meeting. Cancer Res; 70(15); OF1–5. ©2010 AACR. Introduction critical for growth, thus their prominent expression could sensitize human cone precursors to RB1 mutation and un- Twenty speakers gave presentations on an astonishingly derlie a cone precursor origin of retinoblastoma (3). Studies diverse array of topics, underscoring the central role of reti- to date do not rule out an alternative possibility, that tumors noblastoma protein (pRB) in human biology (1). -
Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its
Published OnlineFirst January 21, 2015; DOI: 10.1158/1078-0432.CCR-14-1950 Biology of Human Tumors Clinical Cancer Research Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its Nuclear Accumulation Suppresses Gastric Tumorigenesis Longlong Cao1,2, Jiechao Zhou2, Junrong Zhang1,2, Sijin Wu3, Xintao Yang1,2, Xin Zhao2, Huifang Li2, Ming Luo1, Qian Yu1, Guangtan Lin1, Huizhong Lin1, Jianwei Xie1, Ping Li1, Xiaoqing Hu3, Chaohui Zheng1, Guojun Bu2, Yun-wu Zhang2,4, Huaxi Xu2,4,5, Yongliang Yang3, Changming Huang1, and Jie Zhang2,4 Abstract Purpose: As a cyclin-independent atypical CDK, the role of correlated with the severity of gastric cancer based on tumor CDK5 in regulating cell proliferation in gastric cancer remains and lymph node metastasis and patient 5-year fatality rate. unknown. Nuclear localization of CDK5 was found to be significantly Experimental Design: Expression of CDK5 in gastric tumor decreased in tumor tissues and gastric cancer cell lines, and paired adjacent noncancerous tissues from 437 patients was whereas exogenously expression of nucleus-targeted CDK5 measured by Western blotting, immunohistochemistry, and real- inhibited the proliferation and xenograft implantation of time PCR. The subcellular translocation of CDK5 was monitored gastric cancer cells. Treatment with the small molecule during gastric cancer cell proliferation. The role of nuclear CDK5 NS-0011, which increases CDK5 accumulation in the nucleus, in gastric cancer tumorigenic proliferation and ex vivo xenografts suppressed both cancer cell proliferation and xenograft was explored. Furthermore, by screening for compounds in the tumorigenesis. PubChem database that disrupt CDK5 association with its nu- Conclusions: Our results suggest that low CDK5 expression is clear export facilitator, we identified a small molecular (NS-0011) associated with poor overall survival in patients with gastric that inhibits gastric cancer cell growth. -
Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements
International Journal of Molecular Sciences Review Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements Ahmed Malki 1,*, Rasha Abu ElRuz 1, Ishita Gupta 2,3,4, Asma Allouch 1 , Semir Vranic 2,3 and Ala-Eddin Al Moustafa 2,3,4,* 1 Department of Biomedical Science, College of Health Sciences, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (R.A.E.); [email protected] (A.A.) 2 College of Medicine, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (I.G.); [email protected] (S.V.) 3 Biomedical and Pharmaceutical Research Unit, QU Health, Qatar University, Doha 2713, Qatar 4 Biomedical Research Center, QU Health, Qatar University, Doha 2713, Qatar * Correspondence: [email protected] (A.M.); [email protected] (A.-E.A.M.); Tel.: +974-4403-6557 (A.M.); +974-3097-7440 (A.-E.A.M.) Abstract: Colorectal cancer (CRC), the third most common type of cancer, is the second leading cause of cancer-related mortality rates worldwide. Although modern research was able to shed light on the pathogenesis of CRC and provide enhanced screening strategies, the prevalence of CRC is still on the rise. Studies showed several cellular signaling pathways dysregulated in CRC, leading to the onset of malignant phenotypes. Therefore, analyzing signaling pathways involved in CRC metastasis is necessary to elucidate the underlying mechanism of CRC progression and pharmacotherapy. This review focused on target genes as well as various cellular signaling pathways including Wnt/β-catenin, p53, TGF-β/SMAD, NF-κB, Notch, VEGF, and JAKs/STAT3, which are associated with CRC progression and metastasis. -
The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression
International Journal of Molecular Sciences Review The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression Tingting Zou and Zhenghong Lin * School of Life Sciences, Chongqing University, Chongqing 401331, China; [email protected] * Correspondence: [email protected] Abstract: The cell cycle is a collection of events by which cellular components such as genetic materials and cytoplasmic components are accurately divided into two daughter cells. The cell cycle transition is primarily driven by the activation of cyclin-dependent kinases (CDKs), which activities are regulated by the ubiquitin-mediated proteolysis of key regulators such as cyclins, CDK inhibitors (CKIs), other kinases and phosphatases. Thus, the ubiquitin-proteasome system (UPS) plays a pivotal role in the regulation of the cell cycle progression via recognition, interaction, and ubiquitination or deubiquitination of key proteins. The illegitimate degradation of tumor suppressor or abnormally high accumulation of oncoproteins often results in deregulation of cell proliferation, genomic instability, and cancer occurrence. In this review, we demonstrate the diversity and complexity of the regulation of UPS machinery of the cell cycle. A profound understanding of the ubiquitination machinery will provide new insights into the regulation of the cell cycle transition, cancer treatment, and the development of anti-cancer drugs. Keywords: cell cycle regulation; CDKs; cyclins; CKIs; UPS; E3 ubiquitin ligases; Deubiquitinases (DUBs) Citation: Zou, T.; Lin, Z. The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression. 1. Introduction Int. J. Mol. Sci. 2021, 22, 5754. https://doi.org/10.3390/ijms22115754 The cell cycle is a ubiquitous, complex, and highly regulated process that is involved in the sequential events during which a cell duplicates its genetic materials, grows, and di- Academic Editors: Kwang-Hyun Bae vides into two daughter cells. -
Foxo3a Transcription Factor Is a Negative Regulator of Skp2 and Skp2 SCF Complex
Oncogene (2013) 32, 78 --85 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE Foxo3a transcription factor is a negative regulator of Skp2 and Skp2 SCF complex JWu1,2,4,5, S-W Lee2,3,5, X Zhang2,3, F Han2,3, S-Y Kwan2,3, X Yuan2, W-L Yang2,3, YS Jeong2,3, AH Rezaeian2, Y Gao2,3, Y-X Zeng1 and H-K Lin,2,3 Skp2 (S-phase kinase-associated protein-2) SCF complex displays E3 ligase activity and oncogenic activity by regulating protein ubiquitination and degradation, in turn regulating cell cycle entry, senescence and tumorigenesis. The maintenance of the integrity of Skp2 SCF complex is critical for its E3 ligase activity. The Skp2 F-box protein is a rate-limiting step and key factor in this complex, which binds to its protein substrates and triggers ubiquitination and degradation of its substrates. Skp2 is found to be overexpressed in numerous human cancers, which has an important role in tumorigenesis. The molecular mechanism by which the function of Skp2 and Skp2 SCF complex is regulated remains largely unknown. Here we show that Foxo3a transcription factor is a novel and negative regulator of Skp2 SCF complex. Foxo3a is found to be a transcriptional repressor of Skp2 gene expression by directly binding to the Skp2 promoter, thereby inhibiting Skp2 protein expression. Surprisingly, we found for the first time that Foxo3a also displays a transcription-independent activity by directly interacting with Skp2 and disrupting Skp2 SCF complex formation, in turn inhibiting Skp2 SCF E3 ligase activity and promoting p27 stability. -
Coordinate Phosphorylation of Multiple Residues on Single AKT1 and AKT2 Molecules
Oncogene (2014) 33, 3463–3472 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE Coordinate phosphorylation of multiple residues on single AKT1 and AKT2 molecules H Guo1,6, M Gao1,6,YLu1, J Liang1, PL Lorenzi2, S Bai3, DH Hawke4,JLi1, T Dogruluk5, KL Scott5, E Jonasch3, GB Mills1 and Z Ding1 Aberrant AKT activation is prevalent across multiple human cancer lineages providing an important new target for therapy. Twenty- two independent phosphorylation sites have been identified on specific AKT isoforms likely contributing to differential isoform regulation. However, the mechanisms regulating phosphorylation of individual AKT isoform molecules have not been elucidated because of the lack of robust approaches able to assess phosphorylation of multiple sites on a single AKT molecule. Using a nanofluidic proteomic immunoassay (NIA), consisting of isoelectric focusing followed by sensitive chemiluminescence detection, we demonstrate that under basal and ligand-induced conditions that the pattern of phosphorylation events is markedly different between AKT1 and AKT2. Indeed, there are at least 12 AKT1 peaks and at least 5 AKT2 peaks consistent with complex combinations of phosphorylation of different sites on individual AKT molecules. Following insulin stimulation, AKT1 was phosphorylated at Thr308 in the T-loop and Ser473 in the hydrophobic domain. In contrast, AKT2 was only phosphorylated at the equivalent sites (Thr309 and Ser474) at low levels. Further, Thr308 and Ser473 phosphorylation occurred predominantly on the same AKT1 molecules, whereas Thr309 and Ser474 were phosphorylated primarily on different AKT2 molecules. Although basal AKT2 phosphorylation was sensitive to inhibition of phosphatidylinositol 3-kinase (PI3K), basal AKT1 phosphorylation was essentially resistant. -
The P16 Status of Tumor Cell Lines Identifies Small Molecule Inhibitors Specific for Cyclin-Dependent Kinase 41
Vol. 5, 4279–4286, December 1999 Clinical Cancer Research 4279 The p16 Status of Tumor Cell Lines Identifies Small Molecule Inhibitors Specific for Cyclin-dependent Kinase 41 Akihito Kubo,2 Kazuhiko Nakagawa,2, 3 CDK4 kinase inhibitors that may selectively induce growth Ravi K. Varma, Nicholas K. Conrad, inhibition of p16-altered tumors. Jin Quan Cheng, Wen-Ching Lee, INTRODUCTION Joseph R. Testa, Bruce E. Johnson, INK4A 4 The p16 gene (also known as CDKN2A) encodes p16 , Frederic J. Kaye, and Michael J. Kelley which inhibits the CDK45:cyclin D and CDK6:cyclin D com- Medicine Branch [A. K., K. N., N. K. C., F. J. K., B. E. J.] and plexes (1). These complexes mediate phosphorylation of the Rb Developmental Therapeutics Program [R. K. V.], National Cancer Institute, Bethesda, Maryland 20889; Department of Medical protein and allow cell cycle progression beyond the G1-S-phase Oncology, Fox Chase Cancer Center, Philadelphia, Pennsylvania checkpoint (2). Alterations of p16 have been described in a wide 19111 [J. Q. C., W-C. L., J. R. T.]; and Department of Medicine, variety of histological types of human cancers including astro- Duke University Medical Center, Durham, North Carolina 27710 cytoma, melanoma, leukemia, breast cancer, head and neck [M. J. K.] squamous cell carcinoma, malignant mesothelioma, and lung cancer. Alterations of p16 can occur through homozygous de- ABSTRACT letion, point mutation, and transcriptional suppression associ- ated with hypermethylation in cancer cell lines and primary Loss of p16 functional activity leading to disruption of tumors (reviewed in Refs. 3–5). the p16/cyclin-dependent kinase (CDK) 4:cyclin D/retino- Whereas the Rb gene is inactivated in a narrow range of blastoma pathway is the most common event in human tumor cells, the pattern of mutational inactivation of Rb is tumorigenesis, suggesting that compounds with CDK4 ki- inversely correlated with p16 alterations (6–8), suggesting that nase inhibitory activity may be useful to regulate cancer cell a single defect in the p16/CDK4:cyclin D/Rb pathway is suffi- growth. -
Cyclin E-CDK2 Is a Regulator of P27 Kip1
Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Cyclin E-CDK2 is a regulator of p27 Kip1 Robert J. Sheaff, 1 Mark Groudine, 1'4 Matthew Gordon, 1 James M. Roberts, 1's and Bruce E. Clurman 1-3,5 Divisions of 1Basic Sciences and 2Clinical Research, Fred Hutchinson Cancer Research Center (FHCRC), Seattle, Washington 98104; Departments of 3Medicine and 4Radiation Oncology, University of Washington, Seattle, Washington 98104 CDK inhibitors are thought to prevent cell proliferation by negatively regulating cyclin-CDK complexes. We propose that the opposite is also true, that cyclin-CDK complexes in mammmalian cells can promote cell cycle progression by directly down-regulating CDK inhibitors. We show that expression of cyclin E-CDK2 in murine fibroblasts causes phosphorylation of the CDK inhibitor p27 Kip1 on T187, and that cyclin E-CDK2 can directly phosphorylate p27 T187 in vitro. We further show that cyclin E-CDK2-dependent phosphorylation of p27 results in elimination of p27 from the cell, allowing cells to transit from G1 to S phase. Moreover, mutation of T187 in p27 to alanine creates a p27 protein that causes a G1 block resistant to cyclin E and whose level of expression is not modulated by cyclin E. A kinetic analysis of the interaction between p27 and cyclin E-CDK2 explains how p27 can be regulated by the same enzyme it targets for inhibition. We show that p27 interacts with cyclin E-CDK2 in at least two distinct ways: one resulting in p27 phosphorylation and release, the other in tight binding and cyclin E-CDK2 inhibition. -
Cyclin E2, a Novel Human G1 Cyclin and Activating Partner of CDK2 and CDK3, Is Induced by Viral Oncoproteins
Oncogene (1998) 17, 2787 ± 2798 ã 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc Cyclin E2, a novel human G1 cyclin and activating partner of CDK2 and CDK3, is induced by viral oncoproteins Maimoona Zariwala1, Jidong Liu2 and Yue Xiong*,1,2,3 1Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3280; 2Department of Biochemistry and Biophysics; University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599- 3280; 3Program in Molecular Biology and Biotechnology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3280, USA G1 cyclin E controls the initiation of DNA synthesis by complexes with CDK4 or CDK6 to prevent the CDKs activating CDK2, and abnormally high levels of cyclin E from binding with and becoming activated by D-type expression have frequently been observed in human cyclins. The main function of CDK inhibitors is cancers. We have isolated a novel human cyclin, cyclin believed to couple diversi®ed growth inhibitory signals E2, that contains signi®cant homology to cyclin E. to the cell cycle clock. Cyclin E2 speci®cally interacts with CDK inhibitors of The decision to enter the replicative DNA synthesis the CIP/KIP family and activates both CDK2 and (S) phase or arrest in G1 is linked to diverse cellular CDK3. The expression of cyclin E2 mRNA oscillates processes such as signal transduction, cell differentia- periodically throughout the cell cycle, peaking at the tion, senescence, and oncogenic transformation G1/S transition, and exhibits a pattern of tissue (Hunter and Pines, 1994). -
Supplementary Figures and Tables
Supplementary data Figure S1. Immunoblots of PRMT5, PTEN, p18, p21, p57 and p63 levels in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 (wild type)-treated or sh-PRMT5 + PRMT5 R368A (enzymatically inactive)-treated BGC823 cells. GAPDH served as a loading control. Figure S2. H4R3me2s enrichment at the proximal promoter region of p15 (-163 ~ +220) determined by ChIP analysis. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. The CAGCTG motif is shown in the promoter region of p15 (up panel). Figure S3. Relative enrichment of c-Myc at the promoters of PTEN (P4, left panel) and p57 (P5, right panel) was examined by ChIP assays in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 WT-treated or sh-PRMT5 + PRMT5 K490A-treated BGC823 cells. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. Table S1. Real-time PCR primer sequences CDKN1A forward (5’-3’) TACCCTTGTGCCTCGCTCAG CDKN1A reverse (5’-3’) CGGCGTTTGGAGTGGTAGA PRMT5 forward (5’-3’) TCAGGAAGATAACACCAACCTGG PRMT5 reverse (5’-3’) AGCCACTGCAATCCTCTTACTAT GAPDH forward (5’-3’) GAGCCACATCGCTCAGACAC GAPDH reverse (5’-3’) CATGTAGTTGAGGTCAATGAAGG TP53 forward (5’-3’) GAGGTTGGCTCTGACTGTACC TP53 reverse (5’-3’) TCCGTCCCAGTAGATTACCAC ABL1 forward (5’-3’) CCAGGTGTATGAGCTGCTAGAG ABL1 reverse (5’-3’) GTCAGAGGGATTCCACTGCCAA ANAPC2 forward (5’-3’) CAGGACAGTGAGGATGACTCAG ANAPC2 reverse (5’-3’) TTGCTGCCGTAGATGCTGACCA ANAPC4 forward (5’-3’) AAGGAGGTGACGTGTCTGGCAT ANAPC4 reverse (5’-3’) GCATACAGGAAACTGGAGCCTC DIRAS3 forward (5’-3’) CACATCACCGACAGCAAGAGTG DIRAS3 reverse -
Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth. -
Cyclin E Provides a Link Between Cell Cycle, Dna
CYCLIN E PROVIDES A LINK BETWEEN CELL CYCLE, DNA REPAIR AND APOPTOSIS A dissertation submitted to Kent State University in collaboration with the Lerner Research Institute, Cleveland Clinic in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Dragos Costin Plesca May, 2008 Dissertation written by Dragos Costin Plesca Pharm.D., University of Medicine and Pharmacy “Carol Davila”, Romania, 2002 Ph.D., Kent State University, 2008 Approved by ____________________, Chair, Doctoral Dissertation Committee Alexandru Almasan, Ph.D ____________________, Member, Doctoral Dissertation Committee James Blank, Ph.D ____________________, Member, Doctoral Dissertation Committee Gail Fraizer, Ph.D ____________________, Member, Doctoral Dissertation Committee Olena Piontkivska, Ph.D ____________________, Graduate Faculty Representative Jennifer Marcinkiewicz, Ph.D Accepted by ____________________, Director, School of Biomedical Sciences Robert V. Dorman, Ph.D ____________________, Dean, College of Arts and Sciences John R. D. Stalvey, Ph.D ii TABLE OF CONTENTS List of Figures.................................................................................................................vi List of Tables ..................................................................................................................ix Acknowledgments ............................................................................................................x Chapter I. Introduction ................................................................................................1