DOCSLIB.ORG

Multiple Endocrine Neoplasia Type 2A Patient with Metastatic Medullary

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Case Report iMedPub Journals Journal of Neoplasm 2018 www.imedpub.com ISSN 2576-3903 Vol.3 No.2:32 DOI: 10.21767/2576-3903.100032 Multiple Endocrine Neoplasia Type 2A Harrison D Martin1, Preeti Behl1, Abida Kadi1, Patient with Metastatic Medullary Thyroid Rachna Jetly-Shridhar2, Carcinoma and Unilateral Multicentric Emad Kandil3 and Pheochromocytoma: A Case Report and Nadja K Falk1* Literature Review 1 Department of Pathology and Laboratory Medicine, Tulane School of Medicine, New Orleans, USA 2 Department of Pathology, Louisiana Abstract State University School of Medicine, New Orleans, USA Introduction: Multiple endocrine neoplasia 2A (MEN2A) is an autosomal dominant 3 Division of Endocrine and Oncological syndrome associated with germline mutations in the RET proto-oncogene that Surgery, Tulane School of Medicine, New may lead to medullary thyroid carcinomas (MTC), pheochromocytomas, and Orleans, USA parathyroid adenomas. Patients generally present between the ages of 20 and 30 years. MEN2 patients are stratified for risk based upon the RET mutation, and a genotype-phenotype correlation exists. *Corresponding author: Falk NK Case Report: We describe a 36-year-old male recently diagnosed with MEN2A syndrome and RET oncogene mutation [c.1900T>C;p.Cys634Arg], which is a high [email protected] risk category. He had elevated calcitonin, calcium, parathyroid hormone, and alkaline phosphatase levels with decreased ionized calcium. 24-hour urine testing Department of Pathology and Laboratory showed elevated metanephrines and catecholamines. Imaging studies showed a Medicine, Tulane School of Medicine, 1430 right adrenal mass and multicentric thyroid nodules with a mass adherent to the Tulane Ave., New Orleans, LA 70112 USA. right inferior posterior thyroid lobe. Right adrenalectomy histologic evaluation revealed multicentric pheochromocytomas in the right adrenal gland. Total Tel: 504-988-2972 thyroidectomy with bilateral central and lateral neck dissections confirmed multicentric MTC metastatic to one right lateral neck lymph node. Although only one parathyroid gland was removed, the findings were suggestive of parathyroid adenoma. Citation: Martin HD, Behl P, Kadi A, Shridhar RJ, Kandil E, et al. (2018) Multiple Endocrine Discussion and Conclusion: This case is remarkable for the relatively advanced Neoplasia Type 2A Patient with Metastatic patient age for presentation with this syndrome given the high-risk category as Medullary Thyroid Carcinoma and Unilateral well as multifocality of the associated neoplasms. The general pathologist should Multicentric Pheochromocytoma: A Case be aware of the MEN2 risk stratification categories based on molecular profiling Report and Literature Review. J Neoplasm. and the implications on patient care. Vol.3 No.2:32 Keywords: Multiple endocrine neoplasia; Multiple endocrine neoplasia type 2A; RET; Medullary thyroid carcinoma; Pheochromocytoma Received: May 18, 2018; Accepted: June 06, 2018; Published: June 10, 2018 Abbreviations: FMTC - familial medullary thyroid 1968 Steiner et al. described MEN type 1 (MEN1) and MEN type carcinoma; HD - Hirschsprung disease; MEN - Multiple endocrine 2 (MEN 2) [2]. In 1973 MEN types 2A (MEN2A) and MEN type 2B neoplasia syndrome; MTC - medullary thyroid carcinoma. (MEN2B) were described [3,4]. MEN1 (Wermer syndrome) is associated with parathyroid Introduction adenomas, pancreatoenteric neuroendocrine tumors, anterior Multiple endocrine neoplasia syndromes (MEN) exhibit pituitary tumors, and adrenal cortical tumors. MEN1 patients neoplasms in various organs due to different genetic mutations. generally present at a mean age of 16 years, most commonly Jacob Erdheim described the first case of MEN in 1903 [1]. In with hyperparathyroidism. MEN2 has an estimated prevalence © Under License of Creative Commons Attribution 3.0 License | This article is available in: http://neoplasm.imedpub.com/archive.php 1 ARCHIVOSJournal of DE Neoplasm MEDICINA 2018 ISSNISSN 2576-3903 1698-9465 Vol.3 No.2:32 of 2.5 per 100,000 in the general population [5]. MEN2 includes paragangliomas have a 50% penetrance in MEN2A patients and MEN2A (Sipple’s syndrome), of which familial medullary thyroid can cause hypertension, headaches, sweating and palpitations carcinoma (FMTC) is a category, and MEN2B. MEN2A is the due to catecholamine production. Pheochromocytomas develop most common MEN2 syndrome and comprises 55% of cases. in the medulla of the adrenal gland and are commonly bilateral MEN2A is associated with medullary thyroid carcinomas, in MEN2. Paragangliomas develop in the paraganglia. Both show pheochromocytomas, and parathyroid adenomas. MEN2 nests of cells (“Zellballen”) surrounded by spindled sustentacular patients have a 70% to 100% risk of MTC by age 70-years [6]. cells. MEN2 patients with unilateral pheochromocytoma generally MEN2 patients have pheochromocytoma as the first clinical develop contralateral pheochromocytoma within 10 years [9]. presentation in only 10% to 30% of patients [7]. FMTC is the Non-endocrine findings in MEN2A may include Hirschsprung mildest variant of MEN2 and is seen in 10% to 20% of cases. FMTC disease (HD) and cutaneous lichen amyloidosis [10]. HD presents should be considered when four family members have MTC only. in the first few days of life and is diagnosed by a lack of ganglion MEN2B, which is more aggressive and associated with an earlier cells in the distal intestinal wall. HD is associated with RET codon presentation, comprises 5-10% of MEN2 cases and is associated 10 mutations and may exist without other MEN2A symptoms. with MTC, pheochromocytomas, mucosal ganglioneuromas, Cutaneous lichen amyloidosis presents with itching, papules, and and marfanoid body habitus. MEN4 patients present similarly to hyperpigmentation in the upper mid back; histologically amyloid MEN1 patients but appear to have a different genetic mechanism. is present [5,8,9,11]. These patients are often diagnosed later in life (30 to 74 years) and usually have hyperthyroidism and may have parathyroid We present a MEN2A patient of advanced age (for this syndrome). adenomas. A variety of endocrine and nonendocrine neoplasms The general pathologist should be aware of the manifold may be seen in Table 1 [5,8]. presentations of MEN syndromes. The genetic mutation results are of particular interest in regard to genotype-phenotype MEN2A generally first manifests with MTC between the ages correlation and risk group stratification. of 20-30 years of age. MTC, which accounts for 1-2% of thyroid cancers in the United States, has a 90% penetrance in MEN2A Case Presentation patients. MTC originates from thyroid C-cells, which secrete the 32-amino-acid glycoprotein calcitonin and are more predominant A 36-year-old male presented normotensive with occasional in the upper poles of the right and left lobes. Calcitonin is a sharp headaches and slight weight loss. The patient’s sister was serologic tumor marker for MTC. The nests of tumor cells, diagnosed five years prior with MEN2A syndrome. Laboratory which may be spindled, have neuroendocrine features (“salt testing showed elevated calcitonin (123.0 pg/mL), calcium (11.2 and pepper” chromatin) and a fibrous background which may MG/DL), parathyroid hormone level (2035 PG/ML), and alkaline contain amyloid. MTC metastases are most commonly found in phosphatase (1221 U/L). 24-hour urine testing showed elevated the cervical lymph nodes, however metastases have also been metanephrines (291 ug/d) and catecholamines (630 ug/24 hr). identified in lung, liver and bone. Pheochromocytomas and Ionized calcium was decreased (3.2 mg/dL). Table 1 Clinical characteristics of MEN syndrome types. Characteristics MEN1 MEN2A MEN2B MEN4 Parathyroid adenomas (90%) MTC (90%) MTC (100%) Pheochromocytomas (50%) Pheochromocytomas (50%) Parathyroid adenomas (majority) Pancreatoenteric NETs (30-70%) Small cell neuroendocrine cervical Anterior pituitary tumors (30-40%) Paragangliomas (50%) Types of carcinoma endocrine Parathyroid adenomas (20- Adrenal masses neoplasms 30%) Bronchial carcinoid Adrenal cortical tumors (40%) Papillary thyroid carcinoma FMTC Variant: MTC 95% Gastric carcinoid Pancreatoenteric masses Lipomas Cutaneous lichenoid Angiomyolipoma Mucosal ganglioneuromas amyloidosis Schwannoma angiofibromas Meningioma collagenomas Liver hemangioma Non-endocrine Prostate cancer findings Hirschsprung disease Marfanoid body habitus Breast cancer ependymomas Lipoma Uterine fibroids Note: MEN- Multiple endocrine neoplasia, NET-Neuroendocrine tumor, MTC-Medullary thyroid carcinoma, FMTC-Familial medullary thyroid carcinoma This article is available in: http://neoplasm.imedpub.com/archive.php 2 ARCHIVOSJournal of DE Neoplasm MEDICINA 2018 ISSNISSN 2576-3903 1698-9465 Vol.3 No.2:32 Neck ultrasound revealed bilateral thyroid nodules (right – 1.2 cm One month following his right adrenalectomy, the patient and left – 1.4 cm in greatest dimension) and a 3.5 cm mass at the underwent total thyroidectomy with bilateral central and lateral posterior inferior aspect of the right thyroid gland. A computed neck dissections. The thyroid lobes were submitted separately tomography of the abdomen revealed a hyperdense 1.2 cm and were enlarged. The right thyroid lobe weighed 25 g and nodule of the right adrenal gland and ill-defined nodularity of measured 5.4 × 3.4 × 1.6 cm. The left thyroid lobe weighed 9 g the left adrenal gland. Metaiodobenzylguanidine scan indicated and measured 4.9 × 2.5 × 1.3 cm. Grossly, bilateral gray-yellow increased radiotracer uptake in the adrenal
Recommended publications
  • Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements

    Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements

    International Journal of Molecular Sciences Review Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements Ahmed Malki 1,*, Rasha Abu ElRuz 1, Ishita Gupta 2,3,4, Asma Allouch 1 , Semir Vranic 2,3 and Ala-Eddin Al Moustafa 2,3,4,* 1 Department of Biomedical Science, College of Health Sciences, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (R.A.E.); [email protected] (A.A.) 2 College of Medicine, QU Health, Qatar University, Doha 2713, Qatar; [email protected] (I.G.); [email protected] (S.V.) 3 Biomedical and Pharmaceutical Research Unit, QU Health, Qatar University, Doha 2713, Qatar 4 Biomedical Research Center, QU Health, Qatar University, Doha 2713, Qatar * Correspondence: [email protected] (A.M.); [email protected] (A.-E.A.M.); Tel.: +974-4403-6557 (A.M.); +974-3097-7440 (A.-E.A.M.) Abstract: Colorectal cancer (CRC), the third most common type of cancer, is the second leading cause of cancer-related mortality rates worldwide. Although modern research was able to shed light on the pathogenesis of CRC and provide enhanced screening strategies, the prevalence of CRC is still on the rise. Studies showed several cellular signaling pathways dysregulated in CRC, leading to the onset of malignant phenotypes. Therefore, analyzing signaling pathways involved in CRC metastasis is necessary to elucidate the underlying mechanism of CRC progression and pharmacotherapy. This review focused on target genes as well as various cellular signaling pathways including Wnt/β-catenin, p53, TGF-β/SMAD, NF-κB, Notch, VEGF, and JAKs/STAT3, which are associated with CRC progression and metastasis.
  • Supplementary Figures and Tables

    Supplementary Figures and Tables

    Supplementary data Figure S1. Immunoblots of PRMT5, PTEN, p18, p21, p57 and p63 levels in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 (wild type)-treated or sh-PRMT5 + PRMT5 R368A (enzymatically inactive)-treated BGC823 cells. GAPDH served as a loading control. Figure S2. H4R3me2s enrichment at the proximal promoter region of p15 (-163 ~ +220) determined by ChIP analysis. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. The CAGCTG motif is shown in the promoter region of p15 (up panel). Figure S3. Relative enrichment of c-Myc at the promoters of PTEN (P4, left panel) and p57 (P5, right panel) was examined by ChIP assays in Scr, sh-PRMT5-treated, sh-PRMT5 + PRMT5 WT-treated or sh-PRMT5 + PRMT5 K490A-treated BGC823 cells. IgG was used as a negative control. Data shown are mean ± SD (n = 3). #P > 0.05. Table S1. Real-time PCR primer sequences CDKN1A forward (5’-3’) TACCCTTGTGCCTCGCTCAG CDKN1A reverse (5’-3’) CGGCGTTTGGAGTGGTAGA PRMT5 forward (5’-3’) TCAGGAAGATAACACCAACCTGG PRMT5 reverse (5’-3’) AGCCACTGCAATCCTCTTACTAT GAPDH forward (5’-3’) GAGCCACATCGCTCAGACAC GAPDH reverse (5’-3’) CATGTAGTTGAGGTCAATGAAGG TP53 forward (5’-3’) GAGGTTGGCTCTGACTGTACC TP53 reverse (5’-3’) TCCGTCCCAGTAGATTACCAC ABL1 forward (5’-3’) CCAGGTGTATGAGCTGCTAGAG ABL1 reverse (5’-3’) GTCAGAGGGATTCCACTGCCAA ANAPC2 forward (5’-3’) CAGGACAGTGAGGATGACTCAG ANAPC2 reverse (5’-3’) TTGCTGCCGTAGATGCTGACCA ANAPC4 forward (5’-3’) AAGGAGGTGACGTGTCTGGCAT ANAPC4 reverse (5’-3’) GCATACAGGAAACTGGAGCCTC DIRAS3 forward (5’-3’) CACATCACCGACAGCAAGAGTG DIRAS3 reverse
  • Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols

    Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols

    biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth.
  • Thyroid Cancer in Gardner's Syndrome: Case Report and Review of Literature

    Thyroid Cancer in Gardner's Syndrome: Case Report and Review of Literature

    Published online: 2020-11-09 Case Report Thyroid cancer in Gardner’s syndrome: Case report and review of literature Sachin B. Punatar, Vanita Noronha, Amit Joshi, Kumar Prabhash Abstract Gardner’s syndrome is a variant of familial adenomatous polyposis. A multitude of extra-colonic manifestations including various endocrine tumors have been associated with this syndrome, the commonest of which is thyroid cancer. Majority of the patients with thyroid cancer and Gardner’s syndrome are females. Here we describe a male patient with Gardner’s syndrome who subsequently developed thyroid cancer. Key words: Gardner’s syndrome, thyroid cancer, polyposis, osetoma Introduction lymph nodes were negative [Figure 1]. Fifteen months later, he had a swelling around the stoma site. CT scan Following the original description of Gardner’s syndrome showed a 9.5x5.6x7.5 cm peritoneal mass at the site of consisting of a classic triad of colonic polyps, osteomas ileostomy with multiple smaller similar lesions throughout and soft tissue tumors, various other extraintestinal the abdomen. The tumor was excised (R1 resection) with manifestations and endocrine tumors have been reported reconstruction of the abdominal wall, histologically to be associated with Gardner’s syndrome, thyroid cancer showing it to be a desmoid tumor The patient was given being the most common. Here we report one such case and weekly systemic therapy with vinblastine, methotrexate briefly review the literature. and tamoxifen (methotrexate 30 mg/m2 weekly intravenously, vinblastine 6 mg/m2 weekly intravenously Case Report and tamoxifen 20 mg/m2 twice a day orally daily) for 6 cycles. Six months later (21 months following the A 40-year-old gentleman with no previous medical or diagnosis of colon carcinoma), CT scan showed a partial family history was referred to our hospital with a diagnosis response of the desmoid tumors.
  • Medullary Carcinoma of the Pancreas: Case Reports and Literature Review

    Medullary Carcinoma of the Pancreas: Case Reports and Literature Review

    www.journalofcancerology.com PERMANYER J Cancerol. 2015;2:80-3 www.permanyer.com JOURNAL OF CANCEROLOGY CLINICAL CASE Medullary Carcinoma of the Pancreas: Case Reports and Literature Review ALEJANDRO RAMÍREZ-DEL VAL*, HERIBERTO MEDINA-FRANCO AND CARLOS ChaN © Permanyer Publications 2015 .rehsilbup eht fo noissimrep nettirw roirp eht tuohtiw gniypocotohp ro decudorper eb yam noitacilbup siht fo trap oN trap fo siht noitacilbup yam eb decudorper ro gniypocotohp tuohtiw eht roirp nettirw noissimrep fo eht .rehsilbup Surgery Department, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), Mexico City, Mexico ABSTRACT This two-case report of medullary carcinoma of the pancreas adds to the limited experience published in the literature. Both patients initially presented with epigastric pain with an unremarkable physical exam. After an extensive diagnostic workup, they were both submitted to surgical resection. The histopathological report revealed a distinct entity with a medullary pattern, for which no current guidelines exist. However, this entity is known to have a better prognosis than pancreatic adenocarcinoma. (J CANCEROL. 2015;2:80-3) Corresponding author: Alejandro Ramírez-Del Val, [email protected] Key words: Medullary carcinoma of the pancreas. Pancreatic cancer. Pancreatectomy. Correspondence to: *Alejandro Ramírez-Del Val Surgery Department Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ) Vasco de Quiroga 15 Col. Sección XVI, Del. Tlalpan C.P. 14000, México D.F. México Received for publication: 22-01-2015 E-mail: [email protected] Accepted for publication: 03-08-2015 A. Ramírez-Del Val, et al.: Medullary Carcinoma of the Pancreas: Case Reports and Literature Review INTRODUCTION Medullary carcinoma of the pancreas is somewhat of a new entity.
  • Dysregulated Gene Expression Predicts Tumor Aggressiveness In

    Dysregulated Gene Expression Predicts Tumor Aggressiveness In

    www.nature.com/scientificreports OPEN Dysregulated gene expression predicts tumor aggressiveness in African-American prostate cancer Received: 8 April 2018 Accepted: 22 October 2018 patients Published: xx xx xxxx Hamdy E. A. Ali1,6, Pei-Yau Lung2, Andrew B. Sholl3, Shaimaa A. Gad1, Juan J. Bustamante1, Hamed I. Ali1, Johng S. Rhim4, Gagan Deep5, Jinfeng Zhang2 & Zakaria Y. Abd Elmageed 1 Molecular mechanisms underlying the health disparity of prostate cancer (PCa) have not been fully determined. In this study, we applied bioinformatic approach to identify and validate dysregulated genes associated with tumor aggressiveness in African American (AA) compared to Caucasian American (CA) men with PCa. We retrieved and analyzed microarray data from 619 PCa patients, 412 AA and 207 CA, and we validated these genes in tumor tissues and cell lines by Real-Time PCR, Western blot, immunocytochemistry (ICC) and immunohistochemistry (IHC) analyses. We identifed 362 diferentially expressed genes in AA men and involved in regulating signaling pathways associated with tumor aggressiveness. In PCa tissues and cells, NKX3.1, APPL2, TPD52, LTC4S, ALDH1A3 and AMD1 transcripts were signifcantly upregulated (p < 0.05) compared to normal cells. IHC confrmed the overexpression of TPD52 (p = 0.0098) and LTC4S (p < 0.0005) in AA compared to CA men. ICC and Western blot analyses additionally corroborated this observation in PCa cells. These fndings suggest that dysregulation of transcripts in PCa may drive the disparity of PCa outcomes and provide new insights into development of new therapeutic agents against aggressive tumors. More studies are warranted to investigate the clinical signifcance of these dysregulated genes in promoting the oncogenic pathways in AA men.
  • Development of Gastric Tumors in Apc Mice by the Activation of the B

    Development of Gastric Tumors in Apc Mice by the Activation of the B

    Research Article Development of Gastric Tumors in ApcMin/+ Mice by the Activation of the B-Catenin/Tcf Signaling Pathway Hiroyuki Tomita,1,2 Yasuhiro Yamada,1 Takeru Oyama,1 Kazuya Hata,1 Yoshinobu Hirose,1 Akira Hara,1 Takahiro Kunisada,3 Yasuyuki Sugiyama,2 Yosuke Adachi,2 Heinz Linhart,4 and Hideki Mori1 Departments of 1Tumor Pathology, 2Oncologic Surgery, and 3Tissue and Organ Development, Gifu University Graduate School of Medicine, Gifu, Japan and 4Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, Massachusetts Abstract 5q21, is responsible for such phenotypes in FAP (1, 2). Therefore, inactivating APC is considered to initiate the multistep progression Although several lines of evidence suggest the involvement of of colorectal cancer (3). The knowledge about how APC acts as a the Wnt pathway in the development of gastric cancers, the tumor suppressor gene was considerably advanced by the demon- functional significance of the pathway in gastric carcinogen- stration that APC contributes to the degradation of cytosolic esis is still poorly defined. To examine the role of the Apc/B- h-catenin, thereby linking APC to the Wnt/h-catenin pathway as a catenin signaling pathway in the development of gastric Min/+ negative regulator (4–7). The critical event in the Wnt pathway cancers, we investigated the gastric mucosa of the Apc activation is the elevation of the cytoplasmic pool of h-catenin and mouse, which is a murine model for familial adenomatous its resultant transport to the nucleus (5, 8). Consequently, the polyposis, carrying a germ-line mutation at codon 850 of Apc. inactivation of APC leads to a constitutive accumulation of h- We found that aged ApcMin/+ mice spontaneously develop catenin, which triggers an aberrant transcriptional activation of the multiple tumors in the stomach, which are accompanied by h-catenin/Tcf target genes, such as Myc and Cyclin D1 (9, 10).
  • Revised American Thyroid Association Guidelines

    Revised American Thyroid Association Guidelines

    THYROID SPECIAL ARTICLE Volume 25, Number 6, 2015 ª American Thyroid Association DOI: 10.1089/thy.2014.0335 Revised American Thyroid Association Guidelines for the Management of Medullary Thyroid Carcinoma The American Thyroid Association Guidelines Task Force on Medullary Thyroid Carcinoma Samuel A. Wells, Jr.,1,* Sylvia L. Asa,2 Henning Dralle,3 Rossella Elisei,4 Douglas B. Evans,5 Robert F. Gagel,6 Nancy Lee,7 Andreas Machens,3 Jeffrey F. Moley,8 Furio Pacini,9 Friedhelm Raue,10 Karin Frank-Raue,10 Bruce Robinson,11 M. Sara Rosenthal,12 Massimo Santoro,13 Martin Schlumberger,14 Manisha Shah,15 and Steven G. Waguespack6 Introduction: The American Thyroid Association appointed a Task Force of experts to revise the original Medullary Thyroid Carcinoma: Management Guidelines of the American Thyroid Association. Methods: The Task Force identified relevant articles using a systematic PubMed search, supplemented with additional published materials, and then created evidence-based recommendations, which were set in categories using criteria adapted from the United States Preventive Services Task Force Agency for Healthcare Research and Quality. The original guidelines provided abundant source material and an excellent organizational structure that served as the basis for the current revised document. Results: The revised guidelines are focused primarily on the diagnosis and treatment of patients with sporadic medullary thyroid carcinoma (MTC) and hereditary MTC. Conclusions: The Task Force developed 67 evidence-based recommendations to assist
  • MYC Oncogene Contributions to Release of Cell Cycle Brakes

    MYC Oncogene Contributions to Release of Cell Cycle Brakes

    Review MYC Oncogene Contributions to Release of Cell Cycle Brakes Lucía García-Gutiérrez 1,2, María Dolores Delgado 1 and Javier León 1* 1 Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) CSIC-Universidad de Cantabria and Department of Biología Molecular, Universidad de Cantabria, 39011 Santander, Spain; [email protected] (M.D.D.) 2 Current address: Systems Biology Ireland, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (L.G-G) * Correspondence: [email protected]; Tel: +34-942-201952 Received: 24 February 2019; Accepted: 18 March 2019; Published: 22 March 2019 Abstract: Promotion of the cell cycle is a major oncogenic mechanism of the oncogene c-MYC (MYC). MYC promotes the cell cycle by not only activating or inducing cyclins and CDKs but also through the downregulation or the impairment of the activity of a set of proteins that act as cell- cycle brakes. This review is focused on the role of MYC as a cell-cycle brake releaser i.e., how MYC stimulates the cell cycle mainly through the functional inactivation of cell cycle inhibitors. MYC antagonizes the activities and/or the expression levels of p15, ARF, p21, and p27. The mechanism involved differs for each protein. p15 (encoded by CDKN2B) and p21 (CDKN1A) are repressed by MYC at the transcriptional level. In contrast, MYC activates ARF, which contributes to the apoptosis induced by high MYC levels. At least in some cells types, MYC inhibits the transcription of the p27 gene (CDKN1B) but also enhances p27’s degradation through the upregulation of components of ubiquitin ligases complexes.
  • Functional Characterization of a Rare

    Functional Characterization of a Rare

    European Journal of Endocrinology (2012) 166 551–560 ISSN 0804-4643 CASE REPORT Functional characterization of a rare germline mutation in the gene encoding the cyclin-dependent kinase inhibitor p27Kip1 (CDKN1B) in a Spanish patient with multiple endocrine neoplasia-like phenotype Donatella Malanga1,2, Silvia De Gisi2, Miriam Riccardi1,2, Marianna Scrima2, Carmela De Marco1,2, Mercedes Robledo3 and Giuseppe Viglietto1,2 1Dipartimento di Medicina Sperimentale e Clinica ‘G Salvatore’, Universita` Magna Graecia, Campus Universitario Germaneto, 88100 Catanzaro, Italy, 2BIOGEM-Istituto di Ricerche Genetiche ‘G Salvatore’, 83031 Ariano Irpino (AV), Italy and 3Hereditary Endocrine Cancer Group, Human Cancer Genetics Programme, Spanish National Cancer Centre, Centro Nacional de Investigaciones Oncologicas (CNIO), Calle Melchor Fernandez Almagro 3, 28029 Madrid, Spain (Correspondence should be addressed to G Viglietto at Dipartimento di Medicina Sperimentale e Clinica ‘G Salvatore’ Universita` Magna Graecia; Email: [email protected]) Abstract Objective: The aim of this study was to investigate the presence of germline mutations in the CDKN1B gene that encodes the cyclin-dependent kinase (Cdk) inhibitor p27 in multiple endocrine neoplasia 1 (MEN1)-like Spanish index patients. The CDKN1B gene has recently been identified as a tumor susceptibility gene for MEN4, with six germline mutations reported so far in patients with a MEN-like phenotype but negative for MEN1 mutations. Design and methods: Fifteen Spanish index cases with MEN-like symptoms were screened for mutations in the CDKN1B gene and the mutant variant was studied functionally by transcription/translation assays in vitro and in transiently transfected HeLa cells. Results: We report the identification of a heterozygous GAGA deletion in the 50-UTR of CDKN1B, NM_004064.3:c.-32_-29del, in a patient affected by gastric carcinoid tumor and hyperparathyroid- ism.
  • P27 As a Transcriptional Regulator: New Roles in Development and Cancer

    P27 As a Transcriptional Regulator: New Roles in Development and Cancer

    Author Manuscript Published OnlineFirst on April 27, 2020; DOI: 10.1158/0008-5472.CAN-19-3663 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. p27 as a transcriptional regulator: New roles in development and cancer Seyedeh Fatemeh Razavipour1,2,*, Kuzhuvelil B.Harikumar1,3,*, and Joyce M. Slingerland1,2,4,** 1Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, 33136, USA; 2Department of Biochemistry& Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, 33136, USA; 3Cancer Research Program, Rajiv Gandhi Centre for Biotechnology (RGCB), Thiruvananthapuram, India ; 4Department of Medicine, University of Miami Miller School of Medicine, Miami, FL, 33136, USA *Co-first author **Correspondence: Dr. J Slingerland, Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, BRB708, 1501 NW 10th Avenue, Miami, FL 33136, USA. Email: [email protected] Running Title: 27 as transcriptional regulator Key Words: p27, cell cycle, cJun, EMT, metastasis, transcription The authors declare no potential conflicts of interest 1 Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 27, 2020; DOI: 10.1158/0008-5472.CAN-19-3663 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract p27 binds and inhibits cyclin-CDK to arrest the cell cycle. p27 also regulates other processes including migration and development independent of its CDK inhibitory action. p27 is an atypical tumor suppressor: deletion or mutational inactivation of the gene encoding p27, CDKN1B, is rare in human cancers.
  • The MLL Fusion Gene, MLL-AF4, Regulates Cyclin-Dependent Kinase Inhibitor CDKN1B (P27kip1) Expression

    The MLL Fusion Gene, MLL-AF4, Regulates Cyclin-Dependent Kinase Inhibitor CDKN1B (P27kip1) Expression

    The MLL fusion gene, MLL-AF4, regulates cyclin-dependent kinase inhibitor CDKN1B (p27kip1) expression Zhen-Biao Xia, Relja Popovic, Jing Chen, Catherine Theisler, Tara Stuart, Donna A. Santillan, Frank Erfurth, Manuel O. Diaz, and Nancy J. Zeleznik-Le* Department of Medicine, Molecular Biology Program, and Oncology Institute, Cardinal Bernardin Cancer Center, Loyola University Medical Center, Maywood, IL 60153 Communicated by Janet D. Rowley, University of Chicago Medical Center, Chicago, IL, July 29, 2005 (received for review December 2, 2004) MLL, involved in many chromosomal translocations associated Recent studies suggest some potential mechanisms of MLL with acute myeloid and lymphoid leukemia, has >50 known fusion protein leukemogenesis. For example, fusion partner partner genes with which it is able to form in-frame fusions. dimerization domains and͞or activation domains fused to MLL Characterizing important downstream target genes of MLL and of can aberrantly activate downstream targets such as HOX genes MLL fusion proteins may provide rational therapeutic strategies for and contribute to cell transformation (13, 14). This regulation is the treatment of MLL-associated leukemia. We explored down- mediated at the level of target gene transcription. There is very stream target genes of the most prevalent MLL fusion protein, strict regulation of HOX gene expression during hematopoiesis, MLL-AF4. To this end, we developed inducible MLL-AF4 fusion cell therefore misregulated expression of these genes is likely im- lines in different backgrounds. Overexpression of MLL-AF4 does portant in MLL leukemogenesis. not lead to increased proliferation in either cell line, but rather, cell During normal hematopoiesis, a tight balance is required be- growth was slowed compared with similar cell lines inducibly tween levels of mostly quiescent stem cells that can renew the expressing truncated MLL.