DOCSLIB.ORG

United States Patent (19) 11 Patent Number: 6,100,453 Aldwinckle Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
United States Patent (19) 11 Patent Number: 6,100,453 Aldwinckle Et Al USOO6100453A United States Patent (19) 11 Patent Number: 6,100,453 Aldwinckle et al. (45) Date of Patent: Aug. 8, 2000 54) TRANSGENIC POMACEOUS FRUIT WITH Jaynes, J.M., et al. “Expression of a Cecropin B Lytic FIRE BLIGHT RESISTANCE Peptide Analog in Transgenic Tobacco ConferS Enhanced Resistance to Bacterial Wilt Caused by Pseudomonas Solan 75 Inventors: Herbert S. Aldwinckle, Geneva; John acearum," Plant Science 89:43-53 (1993). L. Norelli, Ithaca, both of N.Y. Jaynes, J.M., et al., “Increasing Bacterial Resistance to 73 Assignee: Cornell Research Foundation, Inc., Plants Utilizing Antibacterial Genes from Insects,” Bioas Ithaca, N.Y. says 6:263–70 (1987). James, D.J., et al., “Genetic Transformation of Apple (Malus pumila Mill.) Using a Disarmed Ti-binary Vector.” Plant 21 Appl. No.: 09/021,520 Cell Reports 7:658–61 (1989). 22 Filed: Feb. 10, 1998 Destéfano-Beltrán, L., et al., “Enhancing Bacterial and Fungal Disease Resistance in Plants: Application to Potato.” Related U.S. Application Data The Molecular and Cellular Biology of the Potato, Vayda et al. (eds.), C.A.B. International, Wallingford, U.K., pp. 63 Continuation of application No. 08/385,590, Jul. 8, 1995, Pat. No. 5,824,861, which is a continuation-in-part of appli 205–221 (1990). cation No. 07/954,347, Sep. 30, 1992, abandoned. Jaynes, J., et al., “Synthetic Genes Make Better Potatoes,” 51 Int.nt. Cl.C.7 ............................... A01H 1700; AO1H 5/00 New Scientist vol. 17 (1987). C12N 15/82; C12N 15/87 Jia, S., et al., “Genetic Engineering of Chinese Potato 52 U.S. Cl. .......................... 800/301; 800/279; 800/288; Cultivars by Introducing Antibacterial Polypeptide Gene,” 800/293; 800/294; 435/469; 435/470 Proceeding of the Asia-Pacific Conference on Agricultural 58 Field of Search ..................................... 800/279, 288, Biotechnology (1992). 800/293, 294, 301; 435/468, 469, 470 Van Der Swet, T., et al., “Fire Blight-A Bacterial Disease of Rosaceous Plants,” Agricultural Handbook No. 510 56) References Cited (1979). U.S. PATENT DOCUMENTS Aldwinckle, H.S., et al., “Fire Blights and Its Control.” Horticultural Reviews, vol. 1 (1978). 7/1990 Sanford et al. ...................... 435/172.1 4,945,050 5,036,006 7/1991 Sanford et al. ... ... 435/170.1 Destéfano-Beltrán, et al., “The Introduction into Tobacco Plants of Genes Which Encode Some of the Humoral 5,100,792 3/1992 Sanford et al. ...................... 435/172.1 Immune Response of Hyalophora cecropia,” (1992). FOREIGN PATENT DOCUMENTS Denecke, J., et al., “Protein Secretion in Plant Cells Can 1321157 8/1993 Canada. Occur via a Default Pathway,” The Plant Cell 2:51–9 (1990). 182106 10/1985 European Pat. Off.. 219009 10/1986 European Pat. Off.. Primary Examiner Bruce R. Campbell 299828 6/1988 European Pat. Off.. WO 89/04371 5/1989 European Pat. Off.. Attorney, Agent, or Firm Nixon Peabody LLP 237387 7/1992 New Zealand. 57 ABSTRACT OTHER PUBLICATIONS The present invention relates to a method of conferring F Mourgues et al Plant Science B9: 83-91, 1998. resistance against fire blight to pomaceous fruit Scion or Diiring, K., et al., “Antibacterial Resistance of Transgenic rootstock cultivars by transforming Such cultivars with a Potato Plants Producing T4 Lysozyme,” Dev. Plant Pathol. gene which encodes for lytic proteins. Such transformation 2:437:40 (1993). can be effected by bacterial infection or propulsion of James, D.J., et al., “Progress in the Introduction of Trans particles into cell interiors. Once transformation has taken genes for Pest Resistance in Apples and Strawberries,” place, the cultivar is regenerated to a transgenic pomaceous Phytoparasitica 20:83S-87S (1992). fruit tree. This technique is particularly useful in treating Dandekar, A.M., “Engineering for Apple and Walnut Resis apple and pear cultivars. tance to Codling Moth,” Brighton Crop Prot. Conf-Pest Dis. 2:741–7 (1992). 22 Claims, 15 Drawing Sheets U.S. Patent Aug. 8, 2000 Sheet 1 of 15 6,100,453 AGTCCCGCTGTGTGTACGACACTGGCAACATGAGGTCTTTGCTAATCTTG dMet Arg Ser Le u Le u l l ele a a B GTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGGAAAGTCTTTGGACGATG Val Lea Cys Phele a Pro Let A1 na) alie Giy Lys Val Ph eC1 y Arg Cy - O sel TGAGCTGGCAGCGGCTATGAAGCGTCACGGACTTGATAACTATCGGGGAT s G 1 a L en A a A a A1 ame t Ly A r H is G y Let A SpA a Tyr Arg GlyT O 20 ACAGCCTGGGAAACTGGGTGTGTGTTGCAAAATTCGAGAGTAACTTCAAC by r Ser Lea Gly. As nTr pVn 1 Cy Wa Al aly is Phe G a Ser A n Ph e A so 30 ACCCAGGCTACAAACCGTAACACCGATGGGAGTACCGACTACGGAATCCT d Thr G nA a Thr A Sn Arg As a Thr A s p C1 y Ser Thr A s p Tyr Gly 1 e Le 40 50 ACAGATCAACAGCCGCTGGTGGTGCAACGATGGCAGGACCCCAGGCTCCA du G1 n l l e As n Ser Arg Tr p Trp Cy S. As nA s p Gly Arg Thr ProG 1 y Ser A 60 70 GGAACCTGTGCAACATCCCGTGCTCAGCCCTGCTGAGCTCAGACATAACA - rg As n Le u Cys As n l l e ProCy S. Ser A1 a Leu Leu Ser Ser Asp I le Thr 80 GCGAGCGTGAACTGCGCGAAGAAGATCGTCAGCGATGGAAACGGCATGAG A a Ser Val As n Cy SA ) a Lys Lys 1 eV al Ser As pCly A Sn Gly Met Se 90 100 CGCGTGGGTCGCCTGGCGCAACCGCTGCAAGGGTACCGACGTCCAGGCGT r A 1 a Trp V a A a Trp Arg As in Arg Cys Lys GlyTh r A s p Val G1 n Al a T 10 l2O GGATCAGAGGCTGCCGGCTGTGAGGAGCTGCCGCACCCGGCCCGCCCGCT Tp l l e Arg Gly Cys Arg Leu 29 STOP GCACAGCCGGCCGCTTTGCGAGCGCGACGCTACCCGCTTGGCAGTTTTAA ACGCATCCCTCATAAAACGACTATACGCAAACGCC FIG. I. U.S. Patent Aug. 8, 2000 Sheet 2 of 15 6,100,453 3.‘OICH S98AWDO ?JELOVNO}{c} Oud-SON £8 U.S. Patent Aug. 8, 2000 Sheet 3 of 15 6,100,453 ESPN // Bam H. ECORV Sall NOS-NPT II'-NOS 2s Nils 4. (2034) 8000 4000 6000 N pBR322 OR Bonn HI S 21 N t NOPALNE SYNTHASE Right Border pTT37 FIG. 3 U.S. Patent Aug. 8, 2000 Sheet 4 of 15 6,100,453 35S-Att-NOS FIG. 4 RIGHT BORDER 35S-Chly -NOS Bom HI Hind III Bom HI RIGHT BORDER 35S-Att-NOS FIG. 6 RIGHT BORDER U.S. Patent Aug. 8, 2000 Sheet 5 of 15 6,100,453 35S-Chly-NOS HindIII FIG. 7 RIGHT BORDER FIG. 8 HindIII. SS ECOc RI ? HindindIII Ca2MV35s Att E NOS3' SUBCLONE HindIII FRAGMENT INTO p)2 AND SELECT FOR CLOCK WISEORIENTATION WITH RESPECT TO NPTII AND GUS GENESTOYLELDplDB) Re-GNRITNPT HindIIl Y CUSUS NS-NOS 3' LB NOS 5' NOS3' CoMV35S FIG. 9 Hindi EcoRV Hind III C. : CITILLIE Ca2MV35S CHICKEN NOS 3' EGG WHTE LYSOZYME SUBCLONE HindII FRAGMENT INTO p 312 AND SELECT FORCLOCK WISE ORIENTATION WITH RESPECT ONPT I AND GUS GENESTO YIELD plobl2 NP HindIII GUS RB (...) DC. .) Ot LB NOS5' NOS3' CoMV35S NOS 3. U.S. Patent Aug. 8, 2000 Sheet 6 of 15 6,100,453 SIX OVERLAPPING OLGO NUCLEOTDES ENCODE THE Bill GENE FOR SB-37 Fl Eco R. BORDER DIGEST WITH Bgll /EcoRI TREAT WITH CAP —ligate TO AN EXCESS OF THE ASSEMBLED I2Obp FRAGMENT. 35S-SB37-NOS HindIII Bst El Born Hl RIGHT BORDER DIGEST WITH DIGEST WTH BSt. WHindIII BSt E/Hind PURFY 6.5 kb FRAGMENT PURFY 3.7kb FRAGMENT LGATE V 35S-SB37 B-NOS RIGHT BORDER FIG. 10 U.S. Patent Aug. 8, 2000 Sheet 7 of 15 6,100,453 35S-SB37-NOS SB-37 EcoRV HindII --NS:SENBgll EcoRI\Sacl (90) 35s NOS3 SUBCLONE EcoRV/ pLDB 102 RIGHT BORDER Hindltl INTO plb)76 48kb GEL-PURIFY EcoRV/SOC FRAGMENT AND LIGATE INTO HindIII pLDB 103 3.8 kb HindIII Bgll ECOR Hind III SESCa2MV35S SB-37 NOS3' SUBCLONE HindIII FRAGMENT INTO pe12 AND SELECT FOR CLOCKWISE ORIENTATION WITH RESPECT TO NPT AND GUS GENES TO YIELD plDB)0 Hindi alapas a-me NPTI GUS RB--CD OCED--LB NOS 5 NOS3 CMV35S NOS 3' FIG. 11 U.S. Patent Aug. 8, 2000 Sheet 8 of 15 6,100,453 35S-SB37-NOS Bolm H. Bgll Eco RI. DIGEST WITH Hinch DIGEST WITH Bgll/EcoRI TREAT WITH Clp FLL-NWTHKLENOW LGAE Hinc Xbol/Pst Hindl SUBCLONE SB-37 AS BamH / 7.4 kb Pst INTO plG CASSETTE Hind Bom H. P.St. ECO RI Pill 5 Hind Pi3' pLDB 14 7.55 kb SUBCLONE -1.8 kb Hind III FRAGMENT INTO pet 2) AND SELECT FOR CLOCKWISE ORIENTATION WITH RESPECT TO NPTI) AND GUS GENES TO YIELD plp B 14 RB NPT find ill GUS B NOS 5' NOS3' OdMV35S NOS 3. FIG. 12 U.S. Patent Aug. 8, 2000 Sheet 9 of 15 6,100,453 GACGCGCACGGAGCCCTTACGCTCAACTCCGATGGTACCTCTGGTGCTGTGGTTAAA ASPAl a his Gly Ala Le uThrle (As nSer AspGlyThrSerGlyAlava 1 Via Lys O 2O GTACCCTTGCTGGTAACGACAAGAATATAGTAAGCGCTATCGGTTCCGTAGACTTA Val Prophe Al agly As nAs plys As a eval Scrat a leg lyse rva Asple u 3O & O ACTGATAGGCAGAAACTAGGCGCTGCAACCGCTGGAGTGGCACTGGAAATATAAAC Thr Asp ArgCl ally S. Le uGlyAla Al alth ral a GlyVal Al al-e Aspas a c As in SO SO GGTCACGGACTAAGTCTCACGGATACACACATCCCCGGGTTCGGAGACAAGATGACA Glyhis Glyle uSer Le uThrAs pThr His I le ProGlypheglyAs ply sMe Thr 70 8O GCAGCCGGCAAAGTGAATGTCTTCCACAATGATAACCACGACATCACAGCGAAGGCT Ala Al a Glyly SVal As nVal Phe His As nAs pas nh is Asp eThr Al a Lys Al a 9 O OO TTCGCCACCAGAAACATGCCGGATATTGCTAATGTACCTAATTTCA ACACTGTCGGT Phe Al a Thr ArgAs nMet ProAs p 1 e Ala As nVal ProAs nPhc As nThr Val Gly O GGCGGAATAGACTATATGTTCAAAGATA AGATTGGTGCATCTGCGAGCGCCGCT CAC GlyGly l l e As pTyrMet Phe Lys As plys l l eGlyAlaser Al as er Ala Al a His l2O 30 ACGGACTTATCAATCGCAACGACTACTCTCTTGACGGGAAACTGAACCTCTTCAAG ThrAs pp he l l e As nArgAs nAs pTyr Ser Le uAs pCly Lys Le uAS nLe up he Lys 40 50 ACTCCTGAACCTCGATTGATTTCAACGCCGGTTTCAAGAAGTTCGATACACCTTTC d ThrProAs pThr Ser l l e AspPhc As nAlaCl yPhe Lys Lys Phe As pThr ProP he SO O ATGAAGTCCTCTTGGGAGCCTAACTTCGGATTCT CACTTTCAAATATTTCTGATTA MetLys Ser SerTr pGlu ProAs nP he Glyphe Ser Le uSer Lys Tyr Phe 8O 88 STOP GTATTTTAATTTTAATTCTATATATATAAATTTAGATGTATATGTATATATATATAT TTTTTTTTTATTAATATGATATCACTAAATGTATTTACTCCTTCGATTATTATTACT TTTTTTGTTTAAAGAAGTCCGCCTAATAAAGATAATTTG Bon 0.
Load more

Recommended publications
  • United States Patent (19) Log 10 Cfu/Ml
    USOO58248.61A United States Patent (19) 11 Patent Number: 5,824,861 Aldwinckle et al. (45) Date of Patent: Oct. 20, 1998 54) TRANSGENIC POMACEOUS FRUIT WITH D.J. James, et al., “Progress in the Introduction of Trans FIRE BLIGHT RESISTANCE genes for Pest Resistance in Apples and Strawberries,” Phytoparasitica 20:83S-87S (1992). 75 Inventors: Herbert S. Aldwinckle, Geneva; John A.M. Dandekar, “Engineering for Apple and Walnut Resis L. Norelli, Ithaca, both of N.Y. tance to Codling Moth,” Brighton Crop Prot. Conf-Pest 73 Assignee: Cornell Research Foundation, Inc., Dis. 2:741–7 (1992). Ithaca, N.Y. J. James, et al., “Synthetic Genes Make Better Potatoes,” New Scientist, vol. 17, (1987). 21 Appl. No.: 385,590 J. James, et al., “Increasing Bacterial Disease Resistance in Plants Utilizing Antibacterial Genes From Insects,” BioES 22 Filed: Feb. 8, 1995 says 6:263-270 (1987). Related U.S. Application Data S. Jia, et al., “Genetic Engineering of Chinese Potato Cul tivars by Introducing Antibacterial Polypeptide Gene,” Pro 63 Continuation of Ser. No. 33,772, Mar. 18, 1993, abandoned, ceeding of the Asia-Pacific Conference on Agricultural which is a continuation-in-part of Ser. No. 954,347, Sep. 30, Biotechnology, 1992. 1992, abandoned. L. Destefano-Beltran, et al., “Enhancing Bacterial and Fun 51) Int. Cl. ............................... A01H 1/04; C12N 5/00; gal Disease Resistance in Plants: Application to Potato,” The C12N 15/00 Molecular and Cellular Biology of the Potato Vayda, M.E. 52 U.S. Cl. ................................... 800/205; 800/DIG. 65; and Park, W.D. (eds.) CAB International, Wallingford, U.K.
    [Show full text]
  • Apple Fruiting
    Apple Fruiting ________________________________________________________________________ Spur and Semi-spur Apple Varieties – Over 1000 spur and semi-spur varieties listed. Apple trees that have fruit on spurs or semi-spurs are more dwarfing. They also require special pruning techniques. Tip and Partial-tip Apple Varieties – Over 350 varieties listed. Fruit are borne on the tip of the branches, and are weeping and require little to no pruning. ________________________________________________________________________ Apple Fruiting 1 12/8/06 SPUR-TYPE FRUITING APPLES FOR THE HOME ORCHARD For home orchardists there are several advantages in growing spur–type trees. As the name indicates, the fruit is borne on spurs. Spurs are slow growing leafy shoots and have a mixed terminal bud. A mixed terminal bud will produce shoot and flowers. In apples, spurs develop on two–year old shoots from axillary buds located at the base of each leaf. Axillary buds on a spur can give rise to shoots or new spurs. A branched spur system forms after several years when new spur form on old spurs. Spur–type strains are more dwarfing than the standard stain. When spur and standard strains were compared in Washington rootstock trials, the spurs were 25% smaller than standard stains. Spur–type apples have a growing and fruiting characteristic in which lateral (axillary) buds on two year old wood gives rise to a higher portion of spurs and fewer lateral shoots than occur with standard growth habits. This gives the tree a more open canopy and compact growth habit than standard trees. Research indicates that they have approximately half the canopy volume of standard strains.
    [Show full text]
  • Response of Several Apple Varieties to Apple Scab
    ORIGINAL ARTICLE RESPONSE OF SEVERAL APPLE VARIETIES TO APPLE SCAB (VENTURIA INAEQUALIS) ATTACK IN CENTRAL TRANSYLVANIA CONDITIONS COMPORTAREA UNOR SOIURI DE MĂR LA ATACUL DE RAPĂN (VENTURIA INAEQUALIS), ÎN CONDIŢIILE DIN CENTRUL TRANSILVANIEI SESTRAŞ R. REZUMAT La Staţiunea de Cercetare Dezvoltare pentru Pomicultură Cluj-Napoca, România, a fost studiată comportarea unor soiuri de măr la atacul de rapăn − Venturia inaequalis (Cke.) Wint. Au fost analizate în acest scop 75 de soiuri, privind intensitatea, frecvenţa şi gradul de atac pe frunze şi fructe, într-o perioadă de şapte ani (1990- 1996). Dintre cele 75 de soiuri, 38 au fost înregistrate cu diferite nivele de atac, cele mai sensibile dovedindu- se cultivarurile de origine japoneză (ex. Fuji Aki-fu, Nebuta, Sekai ichi). În unii ani, în funcţie şi de condiţiile climatice, au fost puternic atacate, îndeosebi pe fructe, şi soiuri cunoscute şi răspândite în cultură, cum sunt: Kaltherer Böhmer, Starkrimson, Red Delicious, Mutzu, Wellspur, Jersey Mac. Din totalul soiurilor studiate, 31 (reprezentând 41,3%) nu au fost atacate de rapăn, nici pe frunze şi nici pe lăstari, printre acestea situându- se şi soiurile cu rezistenţă genetică la rapăn Prima, Priscilla, Sir Prize, Liberty, Florina, Priam, Pionier, Voinea, Generos. ABSTRACT Among 75 varieties of apple, verified at the Fruit Research Station in Cluj-Napoca, Central Transylvania, Romania, during seven years (between 1990-1996), 38 registered with certain attack degree with apple scab on leaves and fruits. Susceptible on apple scab – Venturia inaequalis (Cke.) Wint. – were the varieties with Japanese origin (i.e. Fuji Aki-fu, Nebuta, Sekai ichi), and in certain years even well known cultivars, as Kaltherer Böhmer, Starkrimson, Red Delicious, Mutzu, Wellspur, Jersey Mac which were strongly infected, especially on leaves.
    [Show full text]
  • "Register of New Fruit and Nut Varieties"
    Register of New Fruit and Nut Varieties Brooks and Olmo List 35 Edited by James N. Cummins1 Department of Horticultural Sciences, New York State Agricultural Experiment Station, Cornell University, Geneva, NY 14456 ADDENDA AND REVISIONS Redglobe.-Described in List 32. Plant pat. 4787, 10 Nov. 1981. Symphony. -Described in List32. Plantpat. 5013, 29 Mar. 1983. APPLE Freedom. -Described in List 34. Plant pat. 5723, 22 Apr. 1986. NECTARINE Jonalicious (Daniel). -Synonym added; plant pat. 1777, 9 Dec. 1958. Stark GulfPride (Zaipride). -Described in List 34. Plant pat. Nured® Jonathan (Improved Red Jonathan) -Synonym added; 5461, 7 May 1985. plant pat. 2650, 5 July 1966. Stark HoneyGlo (Anderhone). -Described in List 32. Plant pat. Paulared (Summer Mac). -Synonym added; plant pat. 2800, 12 4789, 10 Nov. 1981. Mar. 1968. Stark® Blushing Golden™ (Griffith Gold) -Synonym added; plant pat. 2835, 1 Oct. 1968. PEACH Starkspur Compact Red Delicious (Cascade Compact Red Delicious).-Described in List 32. Plant pat. 4811, 26 Jan. 1982. Eldorado. -Described in List 32. Plant pat. 4780, 20 Oct. 1981. Starkspur Dixired Delicious (Hared). -Described in List 32. Plant Stark® Finale. Described in List34. Plant pat. 5655, 4 Feb. 1986. pat. 5547, 3 Sept. 1985. Stark® Gulf Queen (Zaiqueen). -Described in List34. Plantpat. Starkspur Law Rome (PeaceValley) -Described in List 32. Plant 5463, 7 May 1985. pat. 4793. 24 Nov. 1981. Starkspur UltraStripe Delicious (Jenred) -Described in List 32. Plant pat. 5472, 21 May 1985. RASPBERRY Starkspur Winter Banana (Frecon). -Described in List33. Plant pat. 4901, 26 Oct. 1982. Royalty. Described in List 33. Plant pat. 5405, 12 Feb.
    [Show full text]
  • Market Report January 30, 2012 Market Report
    Market Report Outlook for the Week of January 30, 2012 Tomatillos are higher and are going to stay there for Market Report a while. Jalapenos are steady, Sugar Snaps are steady, If anybody forgot, last year at this time Chicago was and Pea Pods are steady. Asparagus took a sharp turn in the middle of one of the worst winter blizzards in downward; prices fell very quickly which is not good history. This year things have been a lot different. We for growers. When prices fall or rise quickly, grow- can say we have scored most of the winter so far, and ers have a tendency to panic and either hold back or its already February. What I am concerned about is pay dump product, which causes all kinds of problems with back from Mother Nature. You know of course she is prices. You don’t know whether to buy or wait and going to get even at some point and it’s going to be that indecision can cause a loss on product your selling some week we least expect it. The weather guys will because you didn’t buy when it was cheap. Markets are say we have a 30% chance of snow and we will get hit turning around so fast you cannot keep up with how with 10+ inches of snow and 40+ mph winds at at the quickly the prices can change. This is the major reason same time. Of course there will be dozens of reasons why sometimes contracts are good but the same fast why we missed the right forecast but in the end Mother changing markets can kill a contract.
    [Show full text]
  • Paper 45 QUALITY IMPROVEMENT in APPLE BREEDING in JAPAN
    N.Z. Agronomy Society Paper 45 Special Publication No. 5 QUALITY IMPROVEMENT IN APPLE BREEDING IN JAPAN Y. Yoshida Morioka Branch, Fruit Tree Research Station Shimokuriyagawa, Morioka Japan ABSTRACT Fuji is round-oblate or oblong, resembles Delicious in colour but is not as attractive. The flesh is very firm, very In 1939, a systematic apple breeding programme began juicy, has a pleasant aroma, and like the Delicious is low in at the Morioka Branch, Fruit Tree Research Station from acid. The quality is excellent for dessert. Fuji matures in which the cultivars Fuji, Akane, Hatsuaki, Kitakami, early or mid-November and often has a water core. It keeps Himekami and Iwakami have been produced. Fuji is much well until late April in cool storage. Fuji has been widely improved over Rails Janet and has been widely planted in planted in place of Rails J an et and covers the greatest area place of Rails. It now occupies about 400Jo of the fruit (Fig. 1). growing area of Japan. Akane is of much better quality Akane was selected from the hybrid seedlings of than Mclntosh Red and has been renamed Primrouge in Jonathan x Worcester Pearmain in 1970 (Sadamori, 1973). France and Prime Red in the USA. The average weight of Akane fruit is 180-200 g and the In 1969, a cooperative project was initiated between shape varies from round oblate to oblate. The colour is an DSIR in New Zealand and the Morioka Branch. Dr D.W. attractive solid, bright red and the flesh is white, firm, juicy McKenzie made 13 cross combinations and 2439 seedlings and sub-acid.
    [Show full text]
  • Enclosed Is a Copy of Our Apple Or Tart-Cherry Catalog and a Disclaimer Stating Some of Our Conditions
    United States Department of Agriculture Research, Education, and Economics Agricultural Research Service August 4, 2005 Dear Requestor: Enclosed is a copy of our apple or tart-cherry catalog and a disclaimer stating some of our conditions. Most accessions in the catalog are available, depending upon stage of propagation. If items are not available this year, you will need to request them again another year. When selecting your order, the following conditions apply: 1. Orders for dormant scions must be received by January 10 in order to ship by March 20. 2. Orders for summer budwood must be received by July 15 in order to ship by August 20. 3. ALL FOREIGN ORDERS MUST INCLUDE AN IMPORT PERMIT, WHERE APPROPRIATE. PLEASE CHECK WITH YOUR COUNTRY=S PLANT INSPECTION AND QUARANTINE CENTER. *A COPY OF THE IMPORT PERMIT TRANSLATED INTO ENGLISH MUST BE ENCLOSED WITH THE REQUEST. WE CANNOT CERTIFY THAT OUR PLANTS ARE VIRUS AND/OR PEST FREE. *YOUR PERMIT MUST GRANT YOU A RESEARCH EXEMPTION FROM THIS REQUIREMENT. *If these guidelines are not adhered to, your order cannot be completed! 4. Orders for pollen, seed, fruit, and other plant tissues may also be requested. If you have an email address, please include it on the order form so you can receive electronic copies of the catalog and order form in the future. This catalog can be found may be ordered in a single year. If a specific project has requirements that exceed these numbers, I should be contacted directly so that special arrangements can be made. Thank you for your interest in our program.
    [Show full text]
  • Home Orchard Society 2020 Spring Plant Sale Plant Sales Are Available
    Home Orchard Society 2020 Spring Plant Sale Availability List 5/14/2020 Plant sales are available for PICK UP only. We cannot ship plants. We will set up an appointment once the order is received via email. Payment is due at pick-up check or cash only. Scientific Common Size Quantity Cost Fragaria ‘Benton’ Strawberry spring crop 3-4” 24 $2.50 Fragaria ‘Earliglow’ Strawberry everbearing 3-4” 19 $2.50 Fragaria ‘Eversweet’ Strawberry everbearing 3-4” 24 $2.50 Fragaria ‘Hood’ Strawberry spring crop 3-4” 15 $2.50 Fragaria ‘Seascape’ Strawberry everbearing 3-4” 16 $2.50 Lonicera caerulea ‘Taka’ Haskap ‘Taka’ 1 gallon 4 $15 Lonicera caerulea ‘Tana’ Haskap ‘Tana’ 1 gallon 4 $15 Ribes rubrum Red Currant ‘Wilder’ 1 gallon 5 $7 Ribes rubrum Red Currant ‘Cherry Red’ 1 gallon 5 $7 Rubus fruiticosa x R. idaeus Tayberry trailing 1 gallon 6 $8 Rubus L. ‘Prime Ark Traveler’ Thornless Blackberry ‘Prime Ark Traveler’ primo-cane fruiting semi erect 1 gallon 7 $8 Rubus ‘Olallie’ Olallieberry trailing 1 gallon 2 $8 Vitis lambrusca Buffalo Black Seeded Grape 1 gallon 9 $10 Vitis lambrusca Catawba Red Seeded Grape 1 gallon 10 $10 Vitis lambrusca Canadice Red Seedless Grape 1 gallon 8 $10 Vitis lambrusca Glenora Black Seedless Grape 1 gallon 9 $10 Vitis lambrusca Vanessa Red Seedless Grape 1 gallon 8 $10 GRAFTED FRUIT TREE SPECIES VARIETY ROOTSTOCK QUANTITY PRICE Home Orchard Society 2020 Spring Plant Sale Availability List 5/14/2020 Quince Bobev’s Triumph quince 1 $15 Quince Limon quince 1 $15 Quince Van Damen quince 1 $15 Asian pear Huhoot Li Betulifolia (Bet)
    [Show full text]
  • Cold Hardy, Disease Resistant Fruit Trees, Shrubs, Vines & Canes
    519.669.1349 2016 COLD HARDY, DISEASE RESISTANT FRUIT TREES, SHRUBS, VINES & CANES 6987 8th Line West, Elora, ON N0B 1S0 Dear Friends, Welcome to our latest catalog of food producing plants. A brief introduction to those who are unfamiliar to us. Whiffletree Farm & Nursery is a family owned and operated nursery near Elora. We are part of a sizeable Mennonite community in what is some- times referred to as "St. Jacob's Country". We believe nobody should have to settle for the bland flavourless fruit at the supermarket but should have the opportunity to experience the anticipation and the "wow" of tasting luscious homegrown fruit. With that in mind our goal is to provide the best-tasting varieties of a broad range of common and uncommon fruits, as well as the knowledge and tools to give you the best shot at realizing your dreams. We are constantly on the look-out for superior and unique varieties with an emphasis on cold-hardiness and disease resistance. We strive to integrate sustainable practices in tree growing and care, based on an abiding respect for the Creator of the earth with all its resources. Mail service is our primary and preferred method for you to place your order. Please fill out the order form and include your cheque or money order payment. If anything is incorrect, we will make the needed adjustments or refunds. Thank you for choosing us as your source for plants. Your success is important to Whiffletree and enables us to continue in our business as your plant supplier now and in the future.
    [Show full text]
  • Comparison of Antiproliferative and Antioxidant Properties Among
    HORTSCIENCE 40(5):1204–1207. 2005. propandiol (Tris), 2,6-di-tert-butyl-4-methyl- phenol (BHT), DPPH, Folin-Ciocalteu reagent, catechin, chlorogenic acid, epicatechin, gallic Comparison of Antiproliferative acid, kaempferol, phloretin, quercetin, and quercitrin were purchased from Wako Pure and Antioxidant Properties among Chemicals Industry (Osaka, Japan). Phlorizdin dihydrate was from MP Biomedicals, Inc. Nineteen Apple Cultivars (Irvine, Calif.). Apple extracts. All apple cultivars were Yuko Yoshizawa1 maintained in the fi eld of the Department of Laboratory of Bio-organic Chemistry, Akita Prefectural University, Akita, Apple Research, National Institute of Fruit Tree 010-0195, Japan Science (Iwate, Japan). Apples were harvested ripen (suitable for picking) on September to Kenji Sakurai November 2001 from the same growing block. Faculty of Biological Sciences, Akita Prefectural University, Akita, 010- The harvested dates for each cultivar are listed in Table 1. In total, 300 g of fresh fruit (two 0195, Japan to three fruit from each cultivar) were ho- Satoru Kawaii mogenized in 300 mL of ethanol. The ethanol extract was fi ltrated, concentrated in vacuo to Laboratory of Bio-organic Chemistry, Tokyo Denki University, Hatoyama, remove ethanol, and dissolved in distilled water Saitama, 350-0394, Japan to give 100 mL of apple extract, which was Masayoshi Asari used as stock solution (the concentration was 3 g fresh fruit equivalent/mL H2O). Kazuno Branch, Akita Fruit-tree Experiment Station, Kazuno, Akita, 018- Cells. HL-60 cells were obtained from 5201, Japan the Riken Gene Bank (Tsukuba, Japan), and were maintained in RPMI1640 medium Junichi Soejima supplemented with 10% fetal bovine serum National Institute of Fruit Tree Science, Tsukuba, Ibaraki, 305-8605 Japan (FBS).
    [Show full text]
  • New Japanese Woman : Modernity, Media, and Women in Interwar Japan / Barbara Sato
    The New Japanese Woman ASIA-PACIFIC: CULTURE, POLITICS, AND SOCIETY Editors: Rey Chow, H. D. Harootunian, and Masao Miyoshi Barbara Sato The New Japanese Woman MODERNITY, MEDIA, AND WOMEN IN INTERWAR JAPAN Duke University Press Durham and London 2003 © 2003 Duke University Press All rights reserved Printed in the United States of America on acid-free paper Designed by C. H. Westmoreland Typeset in Palatino by Tseng Information Systems, Inc. Library of Congress Cataloging-in-Publication Data appear on the last printed page of this book. FOR KAZI AND SHO Contents LIST OF ILLUSTRATIONS ix ACKNOWLEDGMENTS xi Prologue: Women and the Reality of the Everyday 1 1 The Emergence of Agency: Women and Consumerism 13 2 The Modern Girl as a Representation of Consumer Culture 45 3 Housewives as Reading Women 78 4 Work for Life, for Marriage, for Love 114 5 Hard Days Ahead: Women on the Move 152 NOTES 165 BIBLIOGRAPHY 213 INDEX 233 List of Illustrations 1. "Bluestocking" 15 2. "Longing to Be a New Woman" 18 3. Women's higher-school students, early 1920s 26 4. Mitsukoshi Department Store in downtown Tokyo, early 1920s 29 5. Matsuya Department Store on the Ginza in Tokyo, early 1920s 29 6. The height of fashion for modern girls, circa 1925 47 7. Modern girls on the Ginza, circa 1928 47 8. Images of modern girls, circa 1928 50 9. A view of the Ginza in the 1920s 50 10. "A Modern Girl's Belongings" 52 11. Dance-hall dancers waiting for customers, circa 1929 62 12. Sapporo beer hall on the Ginza, circa 1929 63 13.
    [Show full text]
  • Life and Economy in Tsugaru, Japan. Ann D
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1999 Apples and Regional Change: Life and Economy in Tsugaru, Japan. Ann D. Brucklacher Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Brucklacher, Ann D., "Apples and Regional Change: Life and Economy in Tsugaru, Japan." (1999). LSU Historical Dissertations and Theses. 6978. https://digitalcommons.lsu.edu/gradschool_disstheses/6978 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy subm itted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. in the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.
    [Show full text]