DOCSLIB.ORG

United States Patent (19) Log 10 Cfu/Ml

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
United States Patent (19) Log 10 Cfu/Ml USOO58248.61A United States Patent (19) 11 Patent Number: 5,824,861 Aldwinckle et al. (45) Date of Patent: Oct. 20, 1998 54) TRANSGENIC POMACEOUS FRUIT WITH D.J. James, et al., “Progress in the Introduction of Trans FIRE BLIGHT RESISTANCE genes for Pest Resistance in Apples and Strawberries,” Phytoparasitica 20:83S-87S (1992). 75 Inventors: Herbert S. Aldwinckle, Geneva; John A.M. Dandekar, “Engineering for Apple and Walnut Resis L. Norelli, Ithaca, both of N.Y. tance to Codling Moth,” Brighton Crop Prot. Conf-Pest 73 Assignee: Cornell Research Foundation, Inc., Dis. 2:741–7 (1992). Ithaca, N.Y. J. James, et al., “Synthetic Genes Make Better Potatoes,” New Scientist, vol. 17, (1987). 21 Appl. No.: 385,590 J. James, et al., “Increasing Bacterial Disease Resistance in Plants Utilizing Antibacterial Genes From Insects,” BioES 22 Filed: Feb. 8, 1995 says 6:263-270 (1987). Related U.S. Application Data S. Jia, et al., “Genetic Engineering of Chinese Potato Cul tivars by Introducing Antibacterial Polypeptide Gene,” Pro 63 Continuation of Ser. No. 33,772, Mar. 18, 1993, abandoned, ceeding of the Asia-Pacific Conference on Agricultural which is a continuation-in-part of Ser. No. 954,347, Sep. 30, Biotechnology, 1992. 1992, abandoned. L. Destefano-Beltran, et al., “Enhancing Bacterial and Fun 51) Int. Cl. ............................... A01H 1/04; C12N 5/00; gal Disease Resistance in Plants: Application to Potato,” The C12N 15/00 Molecular and Cellular Biology of the Potato Vayda, M.E. 52 U.S. Cl. ................................... 800/205; 800/DIG. 65; and Park, W.D. (eds.) CAB International, Wallingford, U.K. 435/172.3 pp. 205–221 (1990). 58 Field of Search ............................ 800/205, DIG. 65; D.J. James, et al., “Genetic Transformation of Apple 435/1723, 240.4, 320.1; 536/23.2, 23.5, Malus-Pumila Mill.) Using a Disarmed Ti-Binary-Vector.” 24.1; 935/52, 55, 67 Plant Cell Reports, 7:658–61 (1989). 56) References Cited (List continued on next page.) U.S. PATENT DOCUMENTS 4,945,050 7/1990 Sanford et al. ...................... 435/172.1 Primary Examiner Bruce R. Campbell 5,036,006 7/1991 Sanford et al. .. ... 435/170.1 Attorney, Agent, or Firm-Nixon, Hargrave, Devans & 5,100,792 3/1992 Sanford et al. ...................... 435/172.1 Doyle FOREIGN PATENT DOCUMENTS 57 ABSTRACT 1321157 8/1993 Canada. The present invention relates to a method of conferring 182106 10/1985 European Pat. Off.. 219009 10/1986 European Pat. Off.. resistance against fire blight to pomaceous fruit Scion or 299828 6/1988 European Pat. Off.. rootstock cultivars by transforming Such cultivars with a WO 89/04371 5/1989 European Pat. Off.. gene which encodes for lytic proteins. Such transformation 237387 7/1992 New Zealand. can be effected by bacterial infection or propulsion of 89/04371 5/1989 WIPO. particles into cell interiors. Once transformation has taken place, the cultivar is regenerated to a transgenic pomaceous OTHER PUBLICATIONS fruit tree. This technique is particularly useful in treating K. Diiring, et al., “Antibacterial Resistance of Transgenic apple and pear cultivars. Potato Plants Producing T4 Lysozyme,” Dev. Plant Pathol. 25 Claims, 15 Drawing Sheets S 4.0 4.5 5.0 5.5 6.0 mean ID50 log 10 cfu/ml 5,824,861 Page 2 OTHER PUBLICATIONS Jurgen Denecke, et al., “Protein Secretion in Plant Cells Can T. Van Der Swet, et al., “Fire Blight-A Bacterial Disease of Occur via a Default Pathway,” The Plant Cell, vol. 2, pp. Rosaceous Plants,” Agricultural Hanbook No. 510, (1979). 51–59, (1990). H.S. Aldwinckle, et al., “Fire Blight and Its Control.” Horticultural Reviews, vol. 1, (1978). J.M. Jaynes, et al., Expression of a Cecropin B Lytic Peptide Destafano-Beltran, et al., “The introduction into tobacco Analog in Transgenic Tobacco ConferS Enhanced Resis plants of genes which encode Some of the humoral immune tance to Bacterial Wilt Caused by Pseudomonas Solan response of Hyalophora cecropia,” (1992). acearum, Plant Science 89:43–53 (Apr. 1993). U.S. Patent Oct. 20, 1998 Sheet 1 of 15 5,824,861 AGTCCCGCTGTGTGTACGACACTGGCAACATGAGGTCTTTGCTAATCTTG Met Arg Ser Le u Le u li e Le u - 8 - GTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGGAAAGTCTTTGGACGATG d V a Leu Cy Phe Le u Pro Leu Al aa 1 a Let G y Lly swal Ph eG y Arg Cy - O - TGAGCTGGCAGCGGCTATGAAGCGTCACGGACTTGATAACTATCGGGGAT s G 1 u L. eu A a A a A ame t Lys Arg H is Gl y Lets A SPA to Tyr Arg GlyT O 20 ACAGCCTGGGAAACTGGGTGTGTGTTGCAAAATTCGAGAGTAACTTCAAC by r Ser Le u G1 y As nTr PV a 1 Cy sv a 1A1 a Lys Ph eG 1 use r A is a Ph e A so 30 ACCCAGGCTACAAACCGTAACACCGATGGGAGTACCGACTACGGAATCCT · Thr G n Al a Thr A Sn Arg As in Th r A is PG 1 y Ser Thr A s p Tyr Gly 1 1 e Le 40 50 ACAGATCAACAGCCGCTGGTGGTGCAACGATGGCAGGACCCCAGGCTCCA uG 1 n l l e As n Ser Arg Trp Trp Cy SA is nA s p G y Arg Thr Pro G 1 y Ser A 60 70 GGAACCTGTGCAACATCCCGTGCTCAGCCCTGCTGAGCTCAGACATAACA rg As n Le uCys As n l l e ProCy S. Ser Al a Leu Leu Ser Ser Asp l l e Thr 80 GCGAGCGTGAACTGCGCGAAGAAGATCGTCAGCGATGGAAACGGCATGAG Al a Ser Val As n Cy SA 1 a Lys Lys 1 eV al Ser A s p GlyA sin G 1 y Met Se 90 100 CGCGTGGGTCGCCTGGCGCAACCGCTGCAAGGGTACCGACGTCCAGGCGT r A 1 a Trp V a A 1 a Trp Arg As n Arg Cys Lys GlyTh r A s p Val G n Al a T 10 l2O GGATCAGAGGCTGCCGGCTGTGAGGAGCTGCCGCACCCGGCCCGCCCGCT rp l l e Arg Gly Cys Arg L. eu l29 STOP GCACAGCCGGCCGCTTTGCGAGCGCGACGCTACCCGCTTGGCAGTTTTAA ACGCATCCCTCATAAAACGACTATACGCAAACGCC U.S. Patent Oct. 20, 1998 Sheet 2 of 15 5,824,861 87] uò!–SON (SnO)ESVGINOHnOnT9-8 S98AWNDO &{BLOWNO}}d (8upX!)11ldN €8 U.S. Patent Oct. 20, 1998 Sheet 3 of 15 5,824,861 O (2O34) 6000 N pBR322 OR ors NOPALNE SYNTHASE pTiT37 U.S. Patent Oct. 20, 1998 Sheet 4 of 15 5,824,861 35S-Att-NOS FG, 4. RIGHT BORDER 35S-Chly -NOS F.G. 5 RIGHT BORDER 35S-AttE-NOS F.G. 6 RIGHT BORDER U.S. Patent Oct. 20, 1998 Sheet 5 of 15 5,824,861 FG.7 RIGHT BORDER FG.8 HindIIIs S. EcoRI.critin HindIII Ca2MV35s Att E NOS3' SUBCLONE HindIII FRAGMENT INTO pl2 AND SELECT FOR CLOCK WISEORIENTATION WITH RESPECT TO NPTII AND GUS GENESTOYLELDplDB)) NPT Hindilly GUS NOS 3' RB G.) C. H. LB NOS 5' NOS3' CoMV35S FG.9 HindII EcoRV Hind III C CITILLMI) Ca2MV35S CHICKEN NOS 3' EGG WHITE LYSOZYME SUBCLONE Hindll FRAGMENT INTO p3| 12 AND SELECT FORCLOCK WISE ORIENTATION WITH RESPECT TO NPT II AND GUS GENESTO YIELD plDB2 NOS5' NOS3' CoMV35S NOS 3. U.S. Patent Oct. 20, 1998 Sheet 6 of 15 5,824,861 35S - NOS SEREES O-GO Bamhy HindIII0. in 3ENENU fossé-3,DES ENCODE THE pMON530 === BSE - 2.0 kb ECOR Bolm H. SEER DIGEST WITH Bgll / EcoRI TREAT WITH CAP —ligate TO AN EXCESS OF THE ASSEMBLED 12 Obp FRAGMENT. 35S-SB37-NOS Sn-Hind BstEl- f BamHI-\\\ RIGHT BORDER DIGEST WITH DIGEST WTH BSt E/HindIII BSt E/Hindl PURIFY 6.5 kb FRAGMENT PURIFY 3.7k b FRAGMENT LIGATE 35S- SB37 B-NOS RIGHT BORDER FGO mammadangarorewotors U.S. Patent Oct. 20, 1998 Sheet 7 of 15 5,824,861 35S-SB37-NOS SUBCLONE EcoRV/ pLDB 102 RIGHT Hind Ill INTO plb176 4.8kb BORDER GEL- PURIFY EcoRV/SOC FRAGMENT AND LIGATE INTO pCO2 HindIII S. pLDB)03 Pst HindIII 8gtll ECOR HindIII SESCa2MV35S SB-37 NOS3' SUBCLONE HindIII FRAGMENT INTO pe12 AND SELECT FOR CLOCKWISE ORIENTATION WITH RESPECT TO NPT I AND GUS GENES TO YIELD plb)0 Hind NPTI GUS RB--GDDC) OD--LB NOS 5' NOS3' COMV35S NOS 3' FG. U.S. Patent Oct. 20, 1998 Sheet 8 of 15 5,824,861 35S-SB37-NOS Bonn H. Bglly EcoRI RIGHT BORDER DIGEST WITH Hincli DIGEST WITH Bgll /EcoRI TREAT WITH CIP FLL-N WITH KLENOW. GATE Hinc Hind Ill Xbol / Pst EcoRI BcmH Hind I A-C C3 Bam H. Pil 5' Pill 3' Pst / P. Sm/sp R SUBCLONE, SB-37 AS BdmH / 7.4 kb Pstl INTO piG CASSETTE Hind t Bolm H. P.St. EcoRI Pill 5' Hindl Pi3' pLDB 14 7.55 kb SUBCLONE - 1.8 kb Hind III FRAGMENT INTO p32 AND SELECT FOR CLOCKWISE ORIENTATION WITH RESPECT TO NPTll AND GUS GENES TO YIELD plDB 14 RB NPT find ill GUS LB NOS 5' NOS3' COMV35S NOS 3" FG 2 U.S. Patent Oct. 20, 1998 Sheet 9 of 15 5,824,861 GACGCGCACGGAGCCCTTACGCTCAACTCCGATGGTACCTCTGGTGCTGTGGTTAAA As pala His GlyA a Le Thrle (As nSer AspGlyThrSerGlyAlaval Va Lys O 2O GTACCCTTGCTGGTAACGACAAGAATATAGTAAGCGCTATCGGTTCCGTAGACTTA Wa ProPhe-AlaGlyAs a As plys As n eVa Scra a legly.Sc rVa As pleu 3O & O ACTGATAGGCAGAAACTAGGCGCTGCAACCGCTGGAGGGCACTGGATAAATAAAC Thr AS PArgG1 alys Le uGlyAlaal alth r Al aglyVal Al alc usas pas a e As a SO SO GGTCACGGACTAAGTCTCACGGATACACACATCCCCGGGTTCGGAGACAAGATGACA Glyhis Glyle uSer Le uThr As pThr His I le ProGlypheGlyAs plys Me Thr 70 8O GCAGCCGGCAAAGTGAATGTCTTCCACAATGATAACCACGACATCACAGCGAAGGCT Ala Al a GlyLys Val AS nVal Phe His As nAs pas nh is Asp I cThr Al a Lys Al a SO OO TTCGCCACCAGAAACATGCCGGATATTGCTAATGTACCTAATTTCAACACTGTCGGT Phe Al a Thr ArgAs nMetro Asp l l e Ala As nVal ProAs nPhc As nThr Val Gly lO GGCGGAATAGACTATATGTTCAAAGATAAGATTGGTGCATCTGCGAGCGCCGCTCAC GlyGly l l e As pTyrMet Phe Lys As ply S I le GlyAlaser Alaser Ala Al a His l2O 30 ACGGACTTACAATCGCAACGACTACTCTCTTGACGGGAAACTGAACCTCTTCAAG Thr AS pp he l l e AS in ArgAs nas pTyr Ser Le uAs pGlyLys Le uAS in Le up he Lys 40 50 ACTCCTGAACCTCGATTGATTTCAACGCCGGTTTCAAGAAGTCGATACACCTTTC ThrProAs pThrSeri le AspPhe As nAi aGlyPhe Lys Lys Phe As pThr Prophe 60 O ATGAAGTCCCTTGGGAGCCTAACTTCGGATTCTCACTTCTAAVATATTTCTGATTA Me tLys SerSc rTrpGlu-ProAs nP he Glyphe Ser Le uScrly sTyr Phe 8O 88 STOP GTATTTTAATTTTAATTCTATATATATAAATTTAGATGTATATGTATATATATATAT TTTTTTTTTATTAATATGATATCACTAAATGTATTTACTCCTTCGATTATTATTACT TTTTTTGTTTAAAGAAGTCCGCCTAAAAAGATAATTTG Bon 0.
Load more

Recommended publications
  • Epigenome-Wide Exploratory Study of Monozygotic Twins Suggests Differentially Methylated Regions to Associate with Hand Grip Strength
    Biogerontology (2019) 20:627–647 https://doi.org/10.1007/s10522-019-09818-1 (0123456789().,-volV)( 0123456789().,-volV) RESEARCH ARTICLE Epigenome-wide exploratory study of monozygotic twins suggests differentially methylated regions to associate with hand grip strength Mette Soerensen . Weilong Li . Birgit Debrabant . Marianne Nygaard . Jonas Mengel-From . Morten Frost . Kaare Christensen . Lene Christiansen . Qihua Tan Received: 15 April 2019 / Accepted: 24 June 2019 / Published online: 28 June 2019 Ó The Author(s) 2019 Abstract Hand grip strength is a measure of mus- significant CpG sites or pathways were found, how- cular strength and is used to study age-related loss of ever two of the suggestive top CpG sites were mapped physical capacity. In order to explore the biological to the COL6A1 and CACNA1B genes, known to be mechanisms that influence hand grip strength varia- related to muscular dysfunction. By investigating tion, an epigenome-wide association study (EWAS) of genomic regions using the comb-p algorithm, several hand grip strength in 672 middle-aged and elderly differentially methylated regions in regulatory monozygotic twins (age 55–90 years) was performed, domains were identified as significantly associated to using both individual and twin pair level analyses, the hand grip strength, and pathway analyses of these latter controlling the influence of genetic variation. regions revealed significant pathways related to the Moreover, as measurements of hand grip strength immune system, autoimmune disorders, including performed over 8 years were available in the elderly diabetes type 1 and viral myocarditis, as well as twins (age 73–90 at intake), a longitudinal EWAS was negative regulation of cell differentiation.
    [Show full text]
  • Seven Novel and Stable Translocations Associated with Oncogenic Gene Expression in Malignant Melanoma1
    BRIEF ARTICLE Neoplasia . Vol. 7, No. 4, April 2005, pp. 303 – 311 303 www.neoplasia.com Seven Novel and Stable Translocations Associated with Oncogenic Gene Expression in Malignant Melanoma1 Ichiro Okamoto*, Christine Pirker y, Martin Bilban z, Walter Berger y, Doris Losert §, Christine Marosi b, Oskar A. Haas #, Klaus Wolff* and Hubert Pehamberger* *Division of General Dermatology, Department of Dermatology, Center of Excellence and the Ludwig Boltzmann Institut for Clinical and Experimental Oncology, Medical University of Vienna, Wa¨hringer Gu¨rtel 18-20, Vienna A-1090, Austria; y Institute of Cancer Research, Divisions of Applied and Experimental Oncology, Medical University of Vienna, Borschkegasse 8a, Vienna A-1090, Austria; z Department of Medical and Chemical Diagnostics, Medical University of Vienna, Wa¨hringer Gu¨rtel 18-20, Vienna A-1090, Austria; §Section of Experimental Oncology/Molecular Pharmacology, Department of Clinical Pharmacology, Medical University of Vienna, Wa¨hringer Gu¨rtel 18-20, Vienna A-1090, Austria; b Department of Internal Medicine I, Division of Oncology, Medical University of Vienna, Wa¨hringer Gu¨rtel 18-20, Vienna A-1090, Austria; # Children’s Cancer Research Institute (CCRI), Kinderspitalgasse 6, Vienna A-1090, Austria Abstract Cytogenetics has not only precipitated the discovery of Introduction several oncogenes, but has also led to the molecular Malignant melanoma (MM) is a fatal disease once metastasis classification of numerous malignancies. The correct has occurred and a dramatic increase in incidence has been identification of aberrations in many tumors has, how- recorded [1]. Despite successful identification of molecular ever, been hindered by extensive tumor complexity and mechanisms in many malignancies using cytogenetic data, the limitations of molecular cytogenetic techniques.
    [Show full text]
  • Downloaded 10 April 2020)
    Breeze et al. Genome Medicine (2021) 13:74 https://doi.org/10.1186/s13073-021-00877-z RESEARCH Open Access Epigenome-wide association study of kidney function identifies trans-ethnic and ethnic-specific loci Charles E. Breeze1,2,3* , Anna Batorsky4, Mi Kyeong Lee5, Mindy D. Szeto6, Xiaoguang Xu7, Daniel L. McCartney8, Rong Jiang9, Amit Patki10, Holly J. Kramer11,12, James M. Eales7, Laura Raffield13, Leslie Lange6, Ethan Lange6, Peter Durda14, Yongmei Liu15, Russ P. Tracy14,16, David Van Den Berg17, NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium, TOPMed MESA Multi-Omics Working Group, Kathryn L. Evans8, William E. Kraus15,18, Svati Shah15,18, Hermant K. Tiwari10, Lifang Hou19,20, Eric A. Whitsel21,22, Xiao Jiang7, Fadi J. Charchar23,24,25, Andrea A. Baccarelli26, Stephen S. Rich27, Andrew P. Morris28, Marguerite R. Irvin29, Donna K. Arnett30, Elizabeth R. Hauser15,31, Jerome I. Rotter32, Adolfo Correa33, Caroline Hayward34, Steve Horvath35,36, Riccardo E. Marioni8, Maciej Tomaszewski7,37, Stephan Beck2, Sonja I. Berndt1, Stephanie J. London5, Josyf C. Mychaleckyj27 and Nora Franceschini21* Abstract Background: DNA methylation (DNAm) is associated with gene regulation and estimated glomerular filtration rate (eGFR), a measure of kidney function. Decreased eGFR is more common among US Hispanics and African Americans. The causes for this are poorly understood. We aimed to identify trans-ethnic and ethnic-specific differentially methylated positions (DMPs) associated with eGFR using an agnostic, genome-wide approach. Methods: The study included up to 5428 participants from multi-ethnic studies for discovery and 8109 participants for replication. We tested the associations between whole blood DNAm and eGFR using beta values from Illumina 450K or EPIC arrays.
    [Show full text]
  • LDB2 Locus Disruption on 4P16.1 As a Risk Factor for Schizophrenia And
    Horiuchi et al. Human Genome Variation (2020) 7:31 https://doi.org/10.1038/s41439-020-00117-7 Human Genome Variation DATA REPORT Open Access LDB2 locus disruption on 4p16.1 as a risk factor for schizophrenia and bipolar disorder Yasue Horiuchi 1, Tomoe Ichikawa1,2, Tetsuo Ohnishi3, Yoshimi Iwayama3,KazuyaToriumi1, Mitsuhiro Miyashita1, Izumi Nohara1, Nanako Obata1, Tomoko Toyota3, Takeo Yoshikawa3, Masanari Itokawa1 and Makoto Arai1 Abstract We had previously reported the case of a male patient with schizophrenia, having de-novo balanced translocation. Here, we determined the exact breakpoints in chromosomes 4 and 13. The breakpoint within chromosome 4 was mapped to a region 32.6 kbp upstream of the LDB2 gene encoding Lim domain binding 2. Variant screening in LDB2 revealed a rare novel missense variant in patients with psychiatric disorder. Schizophrenia is a chronic and disabling brain disorder on the patient. The estimated breakpoints were confirmed that affects approximately 1% of the population. Although by FISH using the BAC clone (RP11-141E13), which was the disease mechanism is still unknown, its genetic pre- selected from the UCSC genome browser (GRCh38/hg38) disposition is clearly evidenced. Genome-wide association (Fig. 1b). According to the database, the breakpoint on studies have identified over 100 independent loci defined chromosome (chr) 13 was within the so-called ‘gene by common single-nucleotide variants (SNVs)1. A num- desert’ interval, where no known gene has yet been map- fi 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; ber of rare variants have been identi ed till date, with far ped. The breakpoint on chr 4 was mapped to the upstream larger effects on individual risk; de-novo mutations have region of a gene encoding a putative transcription reg- also been reported to confer substantial individual risk2,3.
    [Show full text]
  • United States Patent (19) 11 Patent Number: 6,100,453 Aldwinckle Et Al
    USOO6100453A United States Patent (19) 11 Patent Number: 6,100,453 Aldwinckle et al. (45) Date of Patent: Aug. 8, 2000 54) TRANSGENIC POMACEOUS FRUIT WITH Jaynes, J.M., et al. “Expression of a Cecropin B Lytic FIRE BLIGHT RESISTANCE Peptide Analog in Transgenic Tobacco ConferS Enhanced Resistance to Bacterial Wilt Caused by Pseudomonas Solan 75 Inventors: Herbert S. Aldwinckle, Geneva; John acearum," Plant Science 89:43-53 (1993). L. Norelli, Ithaca, both of N.Y. Jaynes, J.M., et al., “Increasing Bacterial Resistance to 73 Assignee: Cornell Research Foundation, Inc., Plants Utilizing Antibacterial Genes from Insects,” Bioas Ithaca, N.Y. says 6:263–70 (1987). James, D.J., et al., “Genetic Transformation of Apple (Malus pumila Mill.) Using a Disarmed Ti-binary Vector.” Plant 21 Appl. No.: 09/021,520 Cell Reports 7:658–61 (1989). 22 Filed: Feb. 10, 1998 Destéfano-Beltrán, L., et al., “Enhancing Bacterial and Fungal Disease Resistance in Plants: Application to Potato.” Related U.S. Application Data The Molecular and Cellular Biology of the Potato, Vayda et al. (eds.), C.A.B. International, Wallingford, U.K., pp. 63 Continuation of application No. 08/385,590, Jul. 8, 1995, Pat. No. 5,824,861, which is a continuation-in-part of appli 205–221 (1990). cation No. 07/954,347, Sep. 30, 1992, abandoned. Jaynes, J., et al., “Synthetic Genes Make Better Potatoes,” 51 Int.nt. Cl.C.7 ............................... A01H 1700; AO1H 5/00 New Scientist vol. 17 (1987). C12N 15/82; C12N 15/87 Jia, S., et al., “Genetic Engineering of Chinese Potato 52 U.S.
    [Show full text]
  • Endocrine System Local Gene Expression
    Copyright 2008 By Nathan G. Salomonis ii Acknowledgments Publication Reprints The text in chapter 2 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Hanspers K, Zambon AC, Vranizan K, Lawlor SC, Dahlquist KD, Doniger SW, Stuart J, Conklin BR, Pico AR. GenMAPP 2: new features and resources for pathway analysis. BMC Bioinformatics. 2007 Jun 24;8:218. The co-authors listed in this publication co-wrote the manuscript (AP and KH) and provided critical feedback (see detailed contributions at the end of chapter 2). The text in chapter 3 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Cotte N, Zambon AC, Pollard KS, Vranizan K, Doniger SW, Dolganov G, Conklin BR. Identifying genetic networks underlying myometrial transition to labor. Genome Biol. 2005;6(2):R12. Epub 2005 Jan 28. The co-authors listed in this publication developed the hierarchical clustering method (KP), co-designed the study (NC, AZ, BC), provided statistical guidance (KV), co- contributed to GenMAPP 2.0 (SD) and performed quantitative mRNA analyses (GD). The text of this dissertation contains a reproduction of a figure from: Yeo G, Holste D, Kreiman G, Burge CB. Variation in alternative splicing across human tissues. Genome Biol. 2004;5(10):R74. Epub 2004 Sep 13. The reproduction was taken without permission (chapter 1), figure 1.3. iii Personal Acknowledgments The achievements of this doctoral degree are to a large degree possible due to the contribution, feedback and support of many individuals. To all of you that helped, I am extremely grateful for your support.
    [Show full text]
  • Apple Fruiting
    Apple Fruiting ________________________________________________________________________ Spur and Semi-spur Apple Varieties – Over 1000 spur and semi-spur varieties listed. Apple trees that have fruit on spurs or semi-spurs are more dwarfing. They also require special pruning techniques. Tip and Partial-tip Apple Varieties – Over 350 varieties listed. Fruit are borne on the tip of the branches, and are weeping and require little to no pruning. ________________________________________________________________________ Apple Fruiting 1 12/8/06 SPUR-TYPE FRUITING APPLES FOR THE HOME ORCHARD For home orchardists there are several advantages in growing spur–type trees. As the name indicates, the fruit is borne on spurs. Spurs are slow growing leafy shoots and have a mixed terminal bud. A mixed terminal bud will produce shoot and flowers. In apples, spurs develop on two–year old shoots from axillary buds located at the base of each leaf. Axillary buds on a spur can give rise to shoots or new spurs. A branched spur system forms after several years when new spur form on old spurs. Spur–type strains are more dwarfing than the standard stain. When spur and standard strains were compared in Washington rootstock trials, the spurs were 25% smaller than standard stains. Spur–type apples have a growing and fruiting characteristic in which lateral (axillary) buds on two year old wood gives rise to a higher portion of spurs and fewer lateral shoots than occur with standard growth habits. This gives the tree a more open canopy and compact growth habit than standard trees. Research indicates that they have approximately half the canopy volume of standard strains.
    [Show full text]
  • A Radiation Hybrid Map of Chicken Chromosome 4
    A radiation hybrid map of chicken Chromosome 4 Tarik S.K.M. Rabie,1* Richard P.M.A. Crooijmans,1 Mireille Morisson,2 Joanna Andryszkiewicz,1 Jan J. van der Poel,1 Alain Vignal,2 Martien A.M. Groenen1 1Wageningen Institute of Animal Sciences, Animal Breeding and Genetics Group, Wageningen University, Marijkeweg 40, 6709 PG Wageningen, The Netherlands 2Laboratoire de ge´ne´tique cellulaire, Institut national de la recherche agronomique, 31326 Castanet-Tolosan, France Received: 15 December 2003 / Accepted: 16 March 2004 Comparative genomics plays an important role in Abstract the understanding of genome dynamics during ev- The mapping resolution of the physical map for olution and as a tool for the transfer of mapping chicken Chromosome 4 (GGA4) was improved by a information from species with gene-dense maps to combination of radiation hybrid (RH) mapping and species whose maps are less well developed (O‘Bri- bacterial artificial chromosome (BAC) mapping. The en et al. 1993, 1999). For farm animals, therefore, ChickRH6 hybrid panel was used to construct an RH the human and mouse have been the logical choice map of GGA4. Eleven microsatellites known to be as the model species used for this comparison. located on GGA4 were included as anchors to the Medium-resolution comparative maps have been genetic linkage map for this chromosome. Based on published for many of the livestock species, in- the known conserved synteny between GGA4 and cluding pig, cattle, sheep, and horse, identifying human Chromosomes 4 and X, sequences were large regions of conserved synteny between these identified for the orthologous chicken genes from species and man and mouse.
    [Show full text]
  • Response of Several Apple Varieties to Apple Scab
    ORIGINAL ARTICLE RESPONSE OF SEVERAL APPLE VARIETIES TO APPLE SCAB (VENTURIA INAEQUALIS) ATTACK IN CENTRAL TRANSYLVANIA CONDITIONS COMPORTAREA UNOR SOIURI DE MĂR LA ATACUL DE RAPĂN (VENTURIA INAEQUALIS), ÎN CONDIŢIILE DIN CENTRUL TRANSILVANIEI SESTRAŞ R. REZUMAT La Staţiunea de Cercetare Dezvoltare pentru Pomicultură Cluj-Napoca, România, a fost studiată comportarea unor soiuri de măr la atacul de rapăn − Venturia inaequalis (Cke.) Wint. Au fost analizate în acest scop 75 de soiuri, privind intensitatea, frecvenţa şi gradul de atac pe frunze şi fructe, într-o perioadă de şapte ani (1990- 1996). Dintre cele 75 de soiuri, 38 au fost înregistrate cu diferite nivele de atac, cele mai sensibile dovedindu- se cultivarurile de origine japoneză (ex. Fuji Aki-fu, Nebuta, Sekai ichi). În unii ani, în funcţie şi de condiţiile climatice, au fost puternic atacate, îndeosebi pe fructe, şi soiuri cunoscute şi răspândite în cultură, cum sunt: Kaltherer Böhmer, Starkrimson, Red Delicious, Mutzu, Wellspur, Jersey Mac. Din totalul soiurilor studiate, 31 (reprezentând 41,3%) nu au fost atacate de rapăn, nici pe frunze şi nici pe lăstari, printre acestea situându- se şi soiurile cu rezistenţă genetică la rapăn Prima, Priscilla, Sir Prize, Liberty, Florina, Priam, Pionier, Voinea, Generos. ABSTRACT Among 75 varieties of apple, verified at the Fruit Research Station in Cluj-Napoca, Central Transylvania, Romania, during seven years (between 1990-1996), 38 registered with certain attack degree with apple scab on leaves and fruits. Susceptible on apple scab – Venturia inaequalis (Cke.) Wint. – were the varieties with Japanese origin (i.e. Fuji Aki-fu, Nebuta, Sekai ichi), and in certain years even well known cultivars, as Kaltherer Böhmer, Starkrimson, Red Delicious, Mutzu, Wellspur, Jersey Mac which were strongly infected, especially on leaves.
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]
  • "Register of New Fruit and Nut Varieties"
    Register of New Fruit and Nut Varieties Brooks and Olmo List 35 Edited by James N. Cummins1 Department of Horticultural Sciences, New York State Agricultural Experiment Station, Cornell University, Geneva, NY 14456 ADDENDA AND REVISIONS Redglobe.-Described in List 32. Plant pat. 4787, 10 Nov. 1981. Symphony. -Described in List32. Plantpat. 5013, 29 Mar. 1983. APPLE Freedom. -Described in List 34. Plant pat. 5723, 22 Apr. 1986. NECTARINE Jonalicious (Daniel). -Synonym added; plant pat. 1777, 9 Dec. 1958. Stark GulfPride (Zaipride). -Described in List 34. Plant pat. Nured® Jonathan (Improved Red Jonathan) -Synonym added; 5461, 7 May 1985. plant pat. 2650, 5 July 1966. Stark HoneyGlo (Anderhone). -Described in List 32. Plant pat. Paulared (Summer Mac). -Synonym added; plant pat. 2800, 12 4789, 10 Nov. 1981. Mar. 1968. Stark® Blushing Golden™ (Griffith Gold) -Synonym added; plant pat. 2835, 1 Oct. 1968. PEACH Starkspur Compact Red Delicious (Cascade Compact Red Delicious).-Described in List 32. Plant pat. 4811, 26 Jan. 1982. Eldorado. -Described in List 32. Plant pat. 4780, 20 Oct. 1981. Starkspur Dixired Delicious (Hared). -Described in List 32. Plant Stark® Finale. Described in List34. Plant pat. 5655, 4 Feb. 1986. pat. 5547, 3 Sept. 1985. Stark® Gulf Queen (Zaiqueen). -Described in List34. Plantpat. Starkspur Law Rome (PeaceValley) -Described in List 32. Plant 5463, 7 May 1985. pat. 4793. 24 Nov. 1981. Starkspur UltraStripe Delicious (Jenred) -Described in List 32. Plant pat. 5472, 21 May 1985. RASPBERRY Starkspur Winter Banana (Frecon). -Described in List33. Plant pat. 4901, 26 Oct. 1982. Royalty. Described in List 33. Plant pat. 5405, 12 Feb.
    [Show full text]
  • Market Report January 30, 2012 Market Report
    Market Report Outlook for the Week of January 30, 2012 Tomatillos are higher and are going to stay there for Market Report a while. Jalapenos are steady, Sugar Snaps are steady, If anybody forgot, last year at this time Chicago was and Pea Pods are steady. Asparagus took a sharp turn in the middle of one of the worst winter blizzards in downward; prices fell very quickly which is not good history. This year things have been a lot different. We for growers. When prices fall or rise quickly, grow- can say we have scored most of the winter so far, and ers have a tendency to panic and either hold back or its already February. What I am concerned about is pay dump product, which causes all kinds of problems with back from Mother Nature. You know of course she is prices. You don’t know whether to buy or wait and going to get even at some point and it’s going to be that indecision can cause a loss on product your selling some week we least expect it. The weather guys will because you didn’t buy when it was cheap. Markets are say we have a 30% chance of snow and we will get hit turning around so fast you cannot keep up with how with 10+ inches of snow and 40+ mph winds at at the quickly the prices can change. This is the major reason same time. Of course there will be dozens of reasons why sometimes contracts are good but the same fast why we missed the right forecast but in the end Mother changing markets can kill a contract.
    [Show full text]