DOCSLIB.ORG

Genetic Relationship of Asiatic Hard Clam Populations Collected in Northern Coastal Provinces in Vietnam Based on Mtdna Sequence Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Relationship of Asiatic Hard Clam Populations Collected in Northern Coastal Provinces in Vietnam Based on Mtdna Sequence Analysis Journal of Aquaculture & Marine Biology Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam based on mtDNA sequence analysis Abstract Research Article The genetic relationship of some Asiatic hard clam (Meretrix meretrix) based on mtDNA Volume 7 Issue 1 - 2018 COI sequence analysis was investigated for populations collected in Thai Binh, Nam Dinh, Nghe An provinces in Vietnam. In addition, this research also targets at species Vu Thi Trang,1 Le Thi Quynh Chi,3 Chu Chi identification based on COI sequences. In total of 59 sequences analyzed, 19 sequences Thiet,2 Nguyen Huu Duc,3 Tran Thi Thuy Ha1 belonged to Meretrix meretrix species with Gen Bank accession number DQ399399.1. 17 1Centre of Aquaculture Biotechnology, Research Institute for sequences of M. meretrix were used for genetic relationship analysis among 3 populations. Aquaculture No.1, Vietnam In which, 6 polymorphic sites, 3 parsimony informative sites and 4 haplotypes observed 2Aquaculture Research Sub-Institute for North Central for the COI gene. Moderately genetic population diversity was observed, overall haplotype (ARSINC), Research Institute for Aquaculture No.1, Vietnam and nucleotide diversity were 0.476±0.233 and 0.00151±0.00069, respectively. Generally, 3Faculty of Biotechnology, Vietnam National University of Agriculture, Vietnam genetic differentiation (FST) (FST < 0.15) was moderate. The genetic distance was rather low, which ranged from 0.001 (Thai Binh–NgheAn, Thai Binh–Nam Dinh populations) to 0.002 (Nam Dinh – Nghe An populations). The result of haplotype network constructing Correspondence: Vu Thi Trang, Centre of Aquaculture indicated that populations shared common haplotype and there was no specific isolation Biotechnology, Research Institute for Aquaculture No.1, Vietnam, of the haplotypes of the populations. Hence, it showed M. meretrix populations had Tel +84 972103043, Fax +84 243-827-3070, intimate genetic relationship. The result of phylogenic tree indicated that three M. meretrix Email [email protected] populations (Thai Binh, Nam Dinh, Nghe An) had a very small or no genetic variation Received: January 19, 2018 | Published: February 27, 2018 among populations. Keywords: Population, genetic diversity, genetic relationship, meretrixmertrix, phylogenetic analysis Introduction containing 37 genes, in which 12 protein-coding genes, 2 ribosomal RNAs, and 23 tRNAs.6 In general, the genetic studies of M. Meretrix in Asiatic hard clams (Meretrix meretrix), genus Meretrix (Veneridae), Asia focus primarily on analyzing the genetic relationship of them to are commercially important species in coastal areas of South and closely related species. However, in Vietnam, studies have focused on 1 Southeast Asia. In Vietnam, the northern coastal provinces is the resource assessment and reproductive biology, meanwhile, research 2 main distributor for the total production of this species. These clams on genetic of Asiatic hard clam has not paid much attention. The were considered to be one of the indigenous mollusks in this region. understanding of genetic structure and information about M. meretrix However, recently, in the coastal areas of some Northern provinces, genetic diversity is necessary for the conservation, restoration, and White clams (Meretrix lyrata) or Ben Tre clams were entered from development of this clam resource in Northern part of Vietnam. Southern provinces and produced artificially. As the consequences of rapid development, White clams dominate in number compared Mitochondrial DNA (mtDNA) has been widely studied in almost to indigenous clams with 85-90% of the mollusk yield. This has led marine and freshwater fish species, mainly for taxonomic and to the changes in the structure of coastal organism communities in phylogenetic purposes. The advantages of using mtDNA include its general and decrease rapidly the resource of M. meretrix in particular.3 simple maternal inheritance, absence of recombination, and high substitution rates.7 The mitochondrial COI gene is often used to There was a considerable number of studies about genetic of M. distinguish species in animals because of faciliating in amplification 4 meretrix in Asia. Chen et al. present phylogenetic relationships of by using PCR method and universal primers.8 This sequence of genes the genus Meretrix by using COI gene sequences. Thereafter, Chen et is always conserved among individuals in the same species and the 5 al. built phylogenetic tree for 106 individuals belonging to Veneridae rate of mutation is fast enough to distinguish between species with 6 family including M. meretrix. In 2011, He et al. used clam specimens close genetic relationships.9 In this study, the mitochondrial COI collected from the coast of Panjin, Liaoning province, China for gene sequence was used to identify species and genetic relationship complete mitochondrial genome sequencing. The results showed that analysis in Meretrix genus that were collected in some Northern mitochondrial genome sequence of M. meretrix is 19,826 bp in length, coastal provinces in Vietnam. Submit Manuscript | http://medcraveonline.com J Aquac Mar Biol. 2018;7(1): 00184 Copyright: Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam 56 based on mtDNA sequence analysis ©2018 Trang et al. Materials and methods local community (with the Latin name is Meretrix meretrix). Based on morphological characteristics, collected samples were preliminarily Samples collection identified as belonging to the M. meretrix. They are large clams In total, 60 samples were collected in six locations, including with thick shell covered by thin, delicate, straw-coloured or grey HaiPhong (HP), Thai Binh (TB), Nam Dinh (ND), ThanhHoa (TH), periostracum, and a greyish-blue or bluish-brown band on its postero- NgheAn (NA) and Ha Tinh (HT) with 10 samples per province (Table dorsal margin. The length is greater than the height. The muscle tissue 1) (Figure 1). The name Asiatic hard clam is called according to the 1-2g/sample was cut and preserved in 96% alcohol at 4°C. Table 1 Collection details for Asiatic hard clam samples Sample location Collection Geographic populations (longitude and latitude) time (abbreviation used) HP HaiPhong (20°51′59″N, 106°40′57″E) August, 2017 TB Thai Binh (20°32′20″N, 106°23′40″E) August, 2017 ND Nam Dinh (20°25′13″N, 106°10′05″E) September, 2017 TH ThanhHoa (20°08′28″N, 105°18′34″E) June, 2017 NA NgheAn (19°10′35″N, 104°58′38″E) May, 2017 HT Ha Tinh (18°20′28″N, 105°54′26″E) June, 2017 annealing at 45oC for 45s and an extension of 72oC for 50s. After the completion of 30 cycles, a final extension step of 10 min at 72oC was performed. The PCR product was then kept at 4oC until removed from the machine. The amplified product was tested in 1.5% agarose gel and visualized using the Uvitec system. The appropriate PCR products then were purified and sequenced. Data analysis Sequences of COIwaschecked by Finch TV 1.4.0sofware.11 Then, they were aligned and cut into the same length with BioEdit 7.2.512 using Clustal W under default settings. The BioEdit software was also used to check and determine the similarity degree of sequences and to create the consensus sequence of each population. The program DnaSP 5.013 was used to analyze molecular diversity indices including haplotype diversity (Hd), nucleotide diversity (π). Hierarchical analyses of molecular variance (AMOVA) were performed using 14 Figure 1 Map showing sample locations. Arlequin 3.5 to evaluate population structure. Haplotype network was constructed by using Network 4.6.1.15 DNA extraction, PCR amplification and sequencing Analysis of genetic distance between populations was used MEGA Total DNA of 60 clam samples was extracted according to the 6.0.16 The evolutionary history was inferred using the Neighbor- alcohol precipitation method [10]. DNA quality was checked by 0.8% Joining method.17 The evolutionary distances were computed using agarose gel electrophoresis and the absorbance at 260nm was measured the Kimura 2-parameter method18 and are in the units of the number using Nanodrop and cuvette spectrophotometer (NanoDrop™ 2000C) of base substitutions per site. Venerupis/Ruditapes philippinarum to determine DNA concentration. (EU266378.1) and Meretrix petachialis (KY318134.1) were used as The fragments of COI gene of 60 samples were amplified by PCR out group. reaction with primers according to Folmer et al.8 The primer sequence is as follows: Fw – 5’GGTCAACAAATCATAAAGATATTGG3’ and Results and Discussion Rw – 5’TAAACTTCAGGGTGACCAAAAAATCA3’. PCR was M. meretrix identification based on COI region carried out in a 37μl volume containing 1U/μlTaq DNA polymerase, 100ng/μl template DNA, 10μM each primer (1μl), 5mM (0.5μl) of The Blast results from National Center for Biotechnology Information (NCBI) showed that in total of 59 samples, there are 19 each dNTPs, 100mM TrisHCl (pH 8.3), 25mM MgCl2 (2.5μl), 500mM KCl (pH 8.3). The PCR was employed with initial denaturation of 2 samples (32.2%) of M. meretrix with 99-100% identity (Table 2). min at 94oC followed by 30 cycles of denaturation for 30s at 94oC, Citation: Trang VT, Chi T, Thiet CC, et al. Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam based on mtDNA sequence analysis. J Aquac Mar Biol. 2018;7(1): 00184. DOI: 10.15406/jamb.2018.07.00184 Copyright: Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam 57 based on mtDNA sequence analysis ©2018 Trang et al. These results illustrated that species identification by morphology the group of bivalves. Because of shades of shells and shell colors, it and molecular biology produced different results. By morphology was wrongly identified with other species.19 The results obtained in method, 100% of the samples were classified as M. meretrix. this study do not support the present taxonomic status of M. meretrix However, by molecular biology method, only 32.2% of samples were and M.
Load more

Recommended publications
  • Mollusca: Veneridae) in the Western Pacific Ocean1
    Genetic Relationships among Species of Meretrix (Mollusca: Veneridae) in the Western Pacific Ocean1 Ayako Yashiki Yamakawa,2,3,6 Masashi Yamaguchi,4,5 and Hideyuki Imai4 Abstract: We compared allozymes at 12 loci in 12 populations of six species of Meretrix: M. lusoria ( Japan, Korea, and Taiwan), M. petechialis (China and Ko- rea), M. ovum (Thailand and Mozambique), M. lyrata (China), M. lamarckii ( Ja- pan), and Meretrix sp. A (Okinawa, Japan). Our allozyme results were generally consistent with the major groupings currently recognized within the genus based on morphological characters. However, we found two cryptic or un- described species: Meretrix sp. A from Okinawa and M. cf. lusoria from Taiwan. The shell characters of Meretrix sp. A were similar to those of M. lamarckii, but the species was genetically distinct (Nei’s genetic distance D > 0.845) from all other species examined. The Taiwanese Meretrix population was morphologi- cally indistinguishable from Japanese M. lusoria, although the genetic distance between the Taiwanese and Japanese populations showed a high degree of ge- netic differentiation (D > 0.386). Meretrix lusoria seedlings were introduced into Taiwan from Japan in the 1920s, and Japanese M. lusoria was previously thought to be established as a cultured stock. However, our results suggest that the Taiwanese population may represent a sibling or cryptic species of M. lusoria. Asianhardclams, genus Meretrix (Vener- (Yoosukh and Matsukuma 2001). These idae), are commercially important bivalves clams inhabit the tidal flats, estuaries, and in East and Southeast Asia and East Africa sandy beaches of the Indian Ocean, including East Africa and Southeast Asia, and the west- ern Pacific along the Chinese coast, Korean 1 Financial support was provided from the 21st Peninsula, and Japanese Archipelago.
    [Show full text]
  • Meretrix Lyrata, Reared Downstream of a Developing Megacity, the Saigon-Dongnai River Estuary, Vietnam Viet Tuan, Phuoc-Dan Nguyen, Emilie Strady
    Bioaccumulation of trace elements in the hard clam, Meretrix lyrata, reared downstream of a developing megacity, the Saigon-Dongnai River Estuary, Vietnam Viet Tuan, Phuoc-Dan Nguyen, Emilie Strady To cite this version: Viet Tuan, Phuoc-Dan Nguyen, Emilie Strady. Bioaccumulation of trace elements in the hard clam, Meretrix lyrata, reared downstream of a developing megacity, the Saigon-Dongnai River Estuary, Vietnam. Environmental Monitoring and Assessment, Springer Verlag (Germany), 2020, 192 (9), pp.566. 10.1007/s10661-020-08502-z. hal-02925838 HAL Id: hal-02925838 https://hal.archives-ouvertes.fr/hal-02925838 Submitted on 1 Sep 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Bioaccumulation of trace elements in the hard clam, Meretrix lyrata, reared downstream of a developing megacity, the Saigon-Dongnai River Estuary, Vietnam Viet Tuan Tran &Phuoc-Dan Nguyen &Emilie Strady Abstract A large number of white hard clam farms are from the environment into the whole tissues of the hard in the estuary shoreline of Saigon-Dongnai Rivers, clam as well as its different organs. The samples were which flow through Ho Chi Minh City, a megacity, collected monthly in dry, transition, and wet seasons of and numerous industrial zones in the basin catchment the southern part of Vietnam from March to September area.
    [Show full text]
  • Rebuilding Biodiversity of Patagonian Marine Molluscs After the End-Cretaceous Mass Extinction
    Rebuilding Biodiversity of Patagonian Marine Molluscs after the End-Cretaceous Mass Extinction Martin Aberhan1*, Wolfgang Kiessling1,2 1 Museum fu¨r Naturkunde, Leibniz Institute for Evolution and Biodiversity Science, Berlin, Germany, 2 GeoZentrum Nordbayern, Pala¨oumwelt, Universita¨t Erlangen2 Nu¨rnberg, Erlangen, Germany Abstract We analysed field-collected quantitative data of benthic marine molluscs across the Cretaceous–Palaeogene boundary in Patagonia to identify patterns and processes of biodiversity reconstruction after the end-Cretaceous mass extinction. We contrast diversity dynamics from nearshore environments with those from offshore environments. In both settings, Early Palaeogene (Danian) assemblages are strongly dominated by surviving lineages, many of which changed their relative abundance from being rare before the extinction event to becoming the new dominant forms. Only a few of the species in the Danian assemblages were newly evolved. In offshore environments, however, two newly evolved Danian bivalve species attained ecological dominance by replacing two ecologically equivalent species that disappeared at the end of the Cretaceous. In both settings, the total number of Danian genera at a locality remained below the total number of late Cretaceous (Maastrichtian) genera at that locality. We suggest that biotic interactions, in particular incumbency effects, suppressed post-extinction diversity and prevented the compensation of diversity loss by originating and invading taxa. Contrary to the total number of genera at localities, diversity at the level of individual fossiliferous horizons before and after the boundary is indistinguishable in offshore environments. This indicates an evolutionary rapid rebound to pre-extinction values within less than ca 0.5 million years. In nearshore environments, by contrast, diversity of fossiliferous horizons was reduced in the Danian, and this lowered diversity lasted for the entire studied post-extinction interval.
    [Show full text]
  • Geology of the Tarim Basin with Special Emphasis on Petroleum Deposits, Xinjiang Uygur Zizhiqu, Northwest China
    Geology of the Tarim Basin with special emphasis on petroleum deposits, Xinjiang Uygur Zizhiqu, Northwest China By K. Y. Lee U.S. Geological Survey Reston, Virginia Open-File Report 85-616 This report is preliminary and has not been reviewed for conformity with U.S. Geological Survey editorial standards and stratigraphic nomenclature. 1985 CONTENTS Page Abstract 1 Introduction 2 Regional setting 6 Purpose, scope, and method of report 6 S t rat igraphy 6 Jr r e""D inian Q Sinian 8 Paleozoic 10 Lower Paleozoic 11 Upper Paleozoic 12 Mesozoic 15 Tr ias s i c 15 Jurassi c 16 Cretaceous 17 Cenozoic 18 Tertiary 18 Quat e rnar y 2 0 Structure 21 Kuqa Foredeep 21 Northern Tarim Uplift 21 Eastern Tarim Depression 24 Central Uplift 24 Southwestern Depression 26 Kalpin Uplift 26 Southeastern Faulted Blocks 27 Evolution of the basin 27 Petroleum and coal deposits 36 Petroleum 36 Source rocks 36 Reservoir rocks 44 Cap rocks 45 Types of trap 47 Potential and description of known oil and gas fields 47 Occurrence 50 Potential 50 Summary and conclusions 52 References cited 54 ILLUSTRATIONS Page Figure 1. Index map of China 3 2. Geologic map of the Tarim (Talimu) basin, Xinjiang, northwest China 4 3. Airborne magnetic anomaly contours in Ta 9 4. Principal structural units 22 5. Sketch isopachs of the earth's crust 23 6. Depth to the magnetic basement rocks 25 7. Isopachs of the Paleozoic and Sinian strata 29 8. Isopachs of the Cenozoic and Mesozoic strata 30 9. Isopachs of the Jurassic strata 32 10.
    [Show full text]
  • Bivalves Composition and Ecological Aspects of the Ba Lai River, an Estuary of the Mekong Delta, Vietnam
    Korean J. Malacol. 34(3): 169-178 2018 https://doi.org/10.9710/kjm.2018.34.3.169 Bivalves composition and ecological aspects of the Ba Lai River, an estuary of the Mekong Delta, Vietnam Quang Xuan Ngo1, Elena M. Sayenko2 and Konstantin A. Lutaenko3 1Institute of Tropical Biology, Vietnam Academy of Science and Technology, Ho Chi Minh City, Vietnam 2Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch, Russian Academy of Sciences (FSCEATB FEB RAS), Vladivostok, Russia 3National Scientific Center of Marine Biology Far Eastern Branch, Russian Academy of Sciences (NSCMB FEB RAS), Vladivostok, Russia ABSTRACT Benthic mollusk communities in the upper part of the Ba Lai River (the Mekong Delta), located upstream an irrigation dam, were investigated with respect to species composition, densities, biodiversity and some ecological aspects in 5 sampling stations. Densities of bivalve communities ranged from 21.5 ± 8.2 inds/10 cm2 to 28.5 ± 3.3 inds/10 cm2. In summary, 12 species from six Bivalvia families were recognised. Preliminary investigation on reproductivity of Corbicula blandiana showed the species is dioecious (specimens with separately female or male gonads were indicated), perhaps non-incubatory. Find of Meretrix lyrata, the most abundant commercial species in southern Vietnam, brings up a necessity on suitable policy and exploration in the Ba Lai to conserve valuable species for economic development and scientific purpose. Key words: Bivalvia, ecology, distribution, Ba Lai River, Mekong Delta, Vietnam INTRODUCTION Vietnam) and Bassac (Hau) of Mekong River, tributaries and the interacting canal network The Mekong Delta is located in southwestern connecting with Vam Co and Dong Nai river systems.
    [Show full text]
  • The Complete Mitochondrial Genomes of Six Heterodont Bivalves (Tellinoidea and Solenoidea): Variable Gene Arrangements and Phylogenetic Implications
    The Complete Mitochondrial Genomes of Six Heterodont Bivalves (Tellinoidea and Solenoidea): Variable Gene Arrangements and Phylogenetic Implications Yang Yuan, Qi Li*, Hong Yu, Lingfeng Kong Fisheries College, Ocean University of China, Qingdao, Shandong, China Abstract Background: Taxonomy and phylogeny of subclass Heterodonta including Tellinoidea are long-debated issues and a complete agreement has not been reached yet. Mitochondrial (mt) genomes have been proved to be a powerful tool in resolving phylogenetic relationship. However, to date, only ten complete mitochondrial genomes of Heterodonta, which is by far the most diverse major group of Bivalvia, have been determined. In this paper, we newly sequenced the complete mt genomes of six species belonging to Heterodonta in order to resolve some problematical relationships among this subclass. Principal Findings: The complete mt genomes of six species vary in size from 16,352 bp to 18,182. Hairpin-like secondary structures are found in the largest non-coding regions of six freshly sequenced mt genomes, five of which contain tandem repeats. It is noteworthy that two species belonging to the same genus show different gene arrangements with three translocations. The phylogenetic analysis of Heterodonta indicates that Sinonovacula constricta, distant from the Solecurtidae belonging to Tellinoidea, is as a sister group with Solen grandis of family Solenidae. Besides, all five species of Tellinoidea cluster together, while Sanguinolaria diphos has closer relationship with Solecurtus divaricatus, Moerella iridescens and Semele scaba rather than with Sanguinolaria olivacea. Conclusions/Significance: By comparative study of gene order rearrangements and phylogenetic relationships of the five species belonging to Tellinoidea, our results support that comparisons of mt gene order rearrangements, to some extent, are a useful tool for phylogenetic studies.
    [Show full text]
  • DNA Barcoding Reveal Patterns of Species Diversity Among
    www.nature.com/scientificreports OPEN DNA barcoding reveal patterns of species diversity among northwestern Pacific molluscs Received: 04 April 2016 Shao’e Sun, Qi Li, Lingfeng Kong, Hong Yu, Xiaodong Zheng, Ruihai Yu, Lina Dai, Yan Sun, Accepted: 25 August 2016 Jun Chen, Jun Liu, Lehai Ni, Yanwei Feng, Zhenzhen Yu, Shanmei Zou & Jiping Lin Published: 19 September 2016 This study represents the first comprehensive molecular assessment of northwestern Pacific molluscs. In total, 2801 DNA barcodes belonging to 569 species from China, Japan and Korea were analyzed. An overlap between intra- and interspecific genetic distances was present in 71 species. We tested the efficacy of this library by simulating a sequence-based specimen identification scenario using Best Match (BM), Best Close Match (BCM) and All Species Barcode (ASB) criteria with three threshold values. BM approach returned 89.15% true identifications (95.27% when excluding singletons). The highest success rate of congruent identifications was obtained with BCM at 0.053 threshold. The analysis of our barcode library together with public data resulted in 582 Barcode Index Numbers (BINs), 72.2% of which was found to be concordantly with morphology-based identifications. The discrepancies were divided in two groups: sequences from different species clustered in a single BIN and conspecific sequences divided in one more BINs. In Neighbour-Joining phenogram, 2,320 (83.0%) queries fromed 355 (62.4%) species-specific barcode clusters allowing their successful identification. 33 species showed paraphyletic and haplotype sharing. 62 cases are represented by deeply diverged lineages. This study suggest an increased species diversity in this region, highlighting taxonomic revision and conservation strategy for the cryptic complexes.
    [Show full text]
  • The Comparison of Shell Morphology and Genetic Relationship Between Meretrix Lusoria and M. Petechialis in Japan and Korea
    Plankton Benthos Res 5(Suppl.): 231–241, 2010 Plankton & Benthos Research © The Japanese Association of Benthology The comparison of shell morphology and genetic relationship between Meretrix lusoria and M. petechialis in Japan and Korea HIROSHI TORII1, SHIN’ICHI SATO2,*, MASAMI HAMAGUCHI3, YASUHISA HENMI4 & HIROYOSHI YAMASHITA5 1 Department of Earth Sciences, Graduate School of Science, Tohoku University, Aoba 6–3, Aramaki, Aoba-ku, Sendai 980–8578, Japan 2 The Tohoku University Museum, Aoba 6–3, Aramaki, Aoba-ku, Sendai 980–8578, Japan 3 Fishery Research Agency, Research Institute of Seto Inland Sea, Tidal Zone Environment Section, Maruishi 2–17–5, Hatsukaichi, Hiroshima 739–0452, Japan 4 Center for Marine Environment Studies, Kumamoto University, Aidu 6061, Matsushima, Kami-amakusa 861–6102, Japan 5 Association of Conservation Malacology, Mastugaoka 3–1–26–03, Kugenuma, Fujisawa 251–0038, Japan Received 17 May 2010; Accepted 8 August 2010 Abstract: Morphological and genetic traits of Meretrix lusoria and M. petechialis were compared among individuals from Japan and Korea. Multivariate analysis of shell morphology revealed that M. lusoria from all localities of Japan (Aomori to Kyushu) and from the southern and southwestern coasts of Korea (Sacheon Bay and Gangjin Bay) have some common characters, namely more linear shape in posterior-dorsal margin, smaller width of socket and larger shell breadth rather than M. petechialis from the western coasts of Korea (Baeksu and Saemangeum). Among M. lusoria, in- dividuals from the Japan/East Sea coasts (Yuya Bay, Aso Sea and Mutsu Bay) have more linear shape in posterior-dor- sal margin than those from other localities. The distribution border between M.
    [Show full text]
  • Foraminíferos Y Bioestratigrafía Del Cretácico Superior Y Terciario Inferior Del Sur De Argentina
    Tesis de Posgrado Foraminíferos y bioestratigrafía del cretácico superior y terciario inferior del sur de Argentina Caramés, Andrea Alejandra 1993 Tesis presentada para obtener el grado de Doctor en Ciencias Geológicas de la Universidad de Buenos Aires Este documento forma parte de la colección de tesis doctorales y de maestría de la Biblioteca Central Dr. Luis Federico Leloir, disponible en digital.bl.fcen.uba.ar. Su utilización debe ser acompañada por la cita bibliográfica con reconocimiento de la fuente. This document is part of the doctoral theses collection of the Central Library Dr. Luis Federico Leloir, available in digital.bl.fcen.uba.ar. It should be used accompanied by the corresponding citation acknowledging the source. Cita tipo APA: Caramés, Andrea Alejandra. (1993). Foraminíferos y bioestratigrafía del cretácico superior y terciario inferior del sur de Argentina. Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires. http://digital.bl.fcen.uba.ar/Download/Tesis/Tesis_2582_Carames.pdf Cita tipo Chicago: Caramés, Andrea Alejandra. "Foraminíferos y bioestratigrafía del cretácico superior y terciario inferior del sur de Argentina". Tesis de Doctor. Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires. 1993. http://digital.bl.fcen.uba.ar/Download/Tesis/Tesis_2582_Carames.pdf Dirección: Biblioteca Central Dr. Luis F. Leloir, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Contacto: [email protected] Intendente Güiraldes 2160 - C1428EGA - Tel. (++54 +11) 4789-9293 UNIVERSIDAD DE BUENOS AIRES FACULTAD DE CIENCIAS EXACTAS Y NATURALES Tema de Tesis FORAMINIFEROS Y BIOESTRATIGRAFIA DEL CRETACICO SUPERIOR Y TERCIARIO INFERIOR DEL SUR DE ARGENTINA TOMO I Autor Andrea A.
    [Show full text]
  • Cnn,'Rr'ffivne
    Vne cnn,'rr'ffi 1N1 .' DEPARTMENT OF CONSERVATION AND ECONOMIC DEVELOPMENT DIVISION OF MINERAL RESOURCES Box 3667, University Station Charlottesville, Virginia Jarnes L. Calver, Cornrnissioner of Mineral Resources and State Geoloeist Inforrnation Circular 6 GUiDEBOOK to THE COASTAL PLAIN OF VIRGINIA NORTH OF THE JAMES RIVER Charlottesville, Virginia 19 62 ERRATA trnforrnation Circular 6 Page vi', ?t , o. Fredricksburg,. " should read, ". Fredericksburg,. " and., " Potornic should read, " . Potornac. " . Page 4, in caption: ... Forrnati.on, " " sholrJ.d read" ". forrnations",, Page 15, Clark and MiLler (l9llj: should read. Tur::itel1a" Turitella... " " " " Page I8; Turn Left on U, S" Highway 360 at Wansaw. " " should read" ", Turn right on U. S. Highway 360 at Warsaw, " " Page t'one l9: Turn right onrrone way" dirt road." " " shouLd read". " Turn right or., park road to battl.efield" ,way'r " " Page 21: Proceed onrrone way" dirt road and turn right on State Highway 238". " should read. ". Proceed on "one way" park road and turn right on State Highway 23B" . Page ZZ; .. ' Straight ahead on State Road l00l at intersection of State Highway 238 and State Road 1001 (about one block) ".. should read". " Stay on State Highway 238 past the entrance of Vi.sitor Center of Yorktown Battlefield to the inter- section with State Road 1001" " . Turn right on U. S" Highway L7 and cz'osc George P" Colernan Mernori.al Bridge" ". should read... Strai.ght ahead orr State Road 1001 for approxirnately Z blocks and turn right on U. S" Flighway l? to cross George P. Colernan Memorial Bridge. , . Page 23: (mileage) "..7.7 ?1.6 (accurnu}ative rnitreage)" " " should read ...9"4 73,3, .
    [Show full text]
  • A New Species of Meretrix from Taiwan (Bivalvia: Veneridae)
    A New Species of Meretrix from Taiwan (Bivalvia: Veneridae) Kin-Yang Lai1 and Yung-Gong Nien2 1. 4F, No. 12, Lane 39, Shuiyuan Street, Yungho City, Taipei County, Taiwan 234. 2. No. 27, Hoping East Road, Puli, Nantou County, Taiwan 545. Key words: Meretrix, Veneridae, New species, Taiwan. Introduction In September 2004, several small Meretrix clams were trawled by the fishing boats from off Taichung in Taiwan Strait. Because their shell markings are so unique and peculiar, they are recognized to be a new species and described in this paper. Taxonomy Family Veneridae Rafinesque, 1815 Subfamily Meretricinae Gray, 1847 Genus Meretrix Lamarck, 1799 Meretrix tigris n. sp. Description: Shell more or less thin, medium in size, up to 46 mm in length, but it is the smallest species in the genus. Oval-subtriangular in shell shape, and less inflate than other species of Meretrix. Umbo small, close to the center, and slightly prosogyrous. Outer surface smooth and glossy, yellow-grey in color, with many black commarginal streaks, which arranged 1 somewhat irregular. Because these black streaks are so peculiar, the new species differs from all other Meretrix species in marking pattern. Lunule not distinct and yellow in color. Escucheon broad and grey in color. Ligament short, external posteriorly stituated, and dark-brown in color. Internal surface white, with a purple mark at posterior margin near to posterior adductor scar. Hinge plate narrow, with three cardinal teeth on each valve, bearing two anterior lateral teeth on right, one anterior lateral tooth on left. Dimyarian, pallial sinus short and semicircular. It is said the animal is pink in color.
    [Show full text]
  • Population Genetic Analysis and Characterization of Nuclear Gene Regions and Mitogenomes in Four European "Donax"Speci
    Population genetic analysis and characterization of nuclear gene regions and mitogenomes in four European Donax species Doctoral Thesis 2018 Jenyfer Fernández Pérez Population genetic analysis and characterization of nuclear gene regions and mitogenomes in four European Donax species Jenyfer Fernández Pérez Doctoral Thesis 2018 Directora/Tutora: Josefina Méndez Felpeto Programa Oficial de Doctorado en Biología Celular y Molecular This is a work distributed under the terms of the Creative Commons Attibution- NonCommercial-NoDerivates 4.0 International (CC BY-NC-ND 4.0) License. To see a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to: Share – copy and redistribute the material in any medium or format. The licensor cannot revoke these freedoms as long as you follow the license terms. Under the following terms: Attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggest the licensor endorses you or your use. NonCommercial – You may not use the material for commercial purposes. NonDerivatives – If you remix, transform, or build upon the material, you may not distribute the modified material. No additional restrictions – You may not apply legal terms or technological measures that legally restrict others from doing anything the license permits. Population genetic analysis and characterization of nuclear gene regions and mitogenomes in four European Donax species DEPARTAMENTO DE BIOLOGÍA Memoria que para optar al Título de Doctora con Mención Internacional presenta Jenyfer Fernández Pérez 2018 Directora: Dra. Josefina Méndez Felpeto Financiación de la investigación La realización de esta tesis ha sido posible gracias a la financiación obtenida a través del proyecto “Contribución genética para la recuperación de los bancos naturales de coquina (Donax spp.) en Galicia”, dirigido por la Dra.
    [Show full text]