Genetic Relationship of Asiatic Hard Clam Populations Collected in Northern Coastal Provinces in Vietnam Based on Mtdna Sequence Analysis

Journal of Aquaculture & Marine Biology

Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam based on mtDNA sequence analysis

Abstract Research Article

The genetic relationship of some Asiatic hard clam (Meretrix meretrix) based on mtDNA Volume 7 Issue 1 - 2018 COI sequence analysis was investigated for populations collected in Thai Binh, Nam Dinh, Nghe An provinces in Vietnam. In addition, this research also targets at species Vu Thi Trang,1 Le Thi Quynh Chi,3 Chu Chi identification based on COI sequences. In total of 59 sequences analyzed, 19 sequences Thiet,2 Nguyen Huu Duc,3 Tran Thi Thuy Ha1 belonged to Meretrix meretrix species with Gen Bank accession number DQ399399.1. 17 1Centre of Aquaculture Biotechnology, Research Institute for sequences of M. meretrix were used for genetic relationship analysis among 3 populations. Aquaculture No.1, Vietnam In which, 6 polymorphic sites, 3 parsimony informative sites and 4 haplotypes observed 2Aquaculture Research Sub-Institute for North Central for the COI gene. Moderately genetic population diversity was observed, overall haplotype (ARSINC), Research Institute for Aquaculture No.1, Vietnam and nucleotide diversity were 0.476±0.233 and 0.00151±0.00069, respectively. Generally, 3Faculty of Biotechnology, Vietnam National University of Agriculture, Vietnam genetic differentiation (FST) (FST < 0.15) was moderate. The genetic distance was rather low, which ranged from 0.001 (Thai Binh–NgheAn, Thai Binh–Nam Dinh populations) to 0.002 (Nam Dinh – Nghe An populations). The result of haplotype network constructing Correspondence: Vu Thi Trang, Centre of Aquaculture indicated that populations shared common haplotype and there was no specific isolation Biotechnology, Research Institute for Aquaculture No.1, Vietnam, of the haplotypes of the populations. Hence, it showed M. meretrix populations had Tel +84 972103043, Fax +84 243-827-3070, intimate genetic relationship. The result of phylogenic tree indicated that three M. meretrix Email [email protected] populations (Thai Binh, Nam Dinh, Nghe An) had a very small or no genetic variation Received: January 19, 2018 | Published: February 27, 2018 among populations.

Keywords: Population, genetic diversity, genetic relationship, meretrixmertrix, phylogenetic analysis

Introduction containing 37 genes, in which 12 protein-coding genes, 2 ribosomal RNAs, and 23 tRNAs.6 In general, the genetic studies of M. Meretrix in Asiatic hard clams (Meretrix meretrix), genus Meretrix (Veneridae), Asia focus primarily on analyzing the genetic relationship of them to are commercially important species in coastal areas of South and closely related species. However, in Vietnam, studies have focused on 1 Southeast Asia. In Vietnam, the northern coastal provinces is the resource assessment and reproductive biology, meanwhile, research 2 main distributor for the total production of this species. These clams on genetic of Asiatic hard clam has not paid much attention. The were considered to be one of the indigenous mollusks in this region. understanding of genetic structure and information about M. meretrix However, recently, in the coastal areas of some Northern provinces, genetic diversity is necessary for the conservation, restoration, and White clams (Meretrix lyrata) or Ben Tre clams were entered from development of this clam resource in Northern part of Vietnam. Southern provinces and produced artificially. As the consequences of rapid development, White clams dominate in number compared Mitochondrial DNA (mtDNA) has been widely studied in almost to indigenous clams with 85-90% of the mollusk yield. This has led marine and freshwater fish species, mainly for taxonomic and to the changes in the structure of coastal organism communities in phylogenetic purposes. The advantages of using mtDNA include its general and decrease rapidly the resource of M. meretrix in particular.3 simple maternal inheritance, absence of recombination, and high substitution rates.7 The mitochondrial COI gene is often used to There was a considerable number of studies about genetic of M. distinguish species in animals because of faciliating in amplification 4 meretrix in Asia. Chen et al. present phylogenetic relationships of by using PCR method and universal primers.8 This sequence of genes the genus Meretrix by using COI gene sequences. Thereafter, Chen et is always conserved among individuals in the same species and the 5 al. built phylogenetic tree for 106 individuals belonging to Veneridae rate of mutation is fast enough to distinguish between species with 6 family including M. meretrix. In 2011, He et al. used clam specimens close genetic relationships.9 In this study, the mitochondrial COI collected from the coast of Panjin, Liaoning province, China for gene sequence was used to identify species and genetic relationship complete mitochondrial genome sequencing. The results showed that analysis in Meretrix genus that were collected in some Northern mitochondrial genome sequence of M. meretrix is 19,826 bp in length, coastal provinces in Vietnam.

Submit Manuscript | http://medcraveonline.com J Aquac Mar Biol. 2018;7(1): 00184 Copyright: Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam 56 based on mtDNA sequence analysis ©2018 Trang et al.

Materials and methods local community (with the Latin name is Meretrix meretrix). Based on morphological characteristics, collected samples were preliminarily Samples collection identified as belonging to the M. meretrix. They are large clams In total, 60 samples were collected in six locations, including with thick shell covered by thin, delicate, straw-coloured or grey HaiPhong (HP), Thai Binh (TB), Nam Dinh (ND), ThanhHoa (TH), periostracum, and a greyish-blue or bluish-brown band on its postero- NgheAn (NA) and Ha Tinh (HT) with 10 samples per province (Table dorsal margin. The length is greater than the height. The muscle tissue 1) (Figure 1). The name Asiatic hard clam is called according to the 1-2g/sample was cut and preserved in 96% alcohol at 4°C.

Table 1 Collection details for Asiatic hard clam samples

Sample location Collection Geographic populations (longitude and latitude) time (abbreviation used)

HP HaiPhong (20°51′59″N, 106°40′57″E) August, 2017 TB Thai Binh (20°32′20″N, 106°23′40″E) August, 2017 ND Nam Dinh (20°25′13″N, 106°10′05″E) September, 2017 TH ThanhHoa (20°08′28″N, 105°18′34″E) June, 2017 NA NgheAn (19°10′35″N, 104°58′38″E) May, 2017 HT Ha Tinh (18°20′28″N, 105°54′26″E) June, 2017

annealing at 45oC for 45s and an extension of 72oC for 50s. After the completion of 30 cycles, a final extension step of 10 min at 72oC was performed. The PCR product was then kept at 4oC until removed from the machine. The amplified product was tested in 1.5% agarose gel and visualized using the Uvitec system. The appropriate PCR products then were purified and sequenced. Data analysis Sequences of COIwaschecked by Finch TV 1.4.0sofware.11 Then, they were aligned and cut into the same length with BioEdit 7.2.512 using Clustal W under default settings. The BioEdit software was also used to check and determine the similarity degree of sequences and to create the consensus sequence of each population. The program DnaSP 5.013 was used to analyze molecular diversity indices including haplotype diversity (Hd), nucleotide diversity (π). Hierarchical analyses of molecular variance (AMOVA) were performed using 14 Figure 1 Map showing sample locations. Arlequin 3.5 to evaluate population structure. Haplotype network was constructed by using Network 4.6.1.15 DNA extraction, PCR amplification and sequencing Analysis of genetic distance between populations was used MEGA Total DNA of 60 clam samples was extracted according to the 6.0.16 The evolutionary history was inferred using the Neighbor- alcohol precipitation method [10]. DNA quality was checked by 0.8% Joining method.17 The evolutionary distances were computed using agarose gel electrophoresis and the absorbance at 260nm was measured the Kimura 2-parameter method18 and are in the units of the number using Nanodrop and cuvette spectrophotometer (NanoDrop™ 2000C) of base substitutions per site. Venerupis/Ruditapes philippinarum to determine DNA concentration. (EU266378.1) and Meretrix petachialis (KY318134.1) were used as The fragments of COI gene of 60 samples were amplified by PCR out group. reaction with primers according to Folmer et al.8 The primer sequence is as follows: Fw – 5’GGTCAACAAATCATAAAGATATTGG3’ and Results and Discussion Rw – 5’TAAACTTCAGGGTGACCAAAAAATCA3’. PCR was M. meretrix identification based on COI region carried out in a 37μl volume containing 1U/μlTaq DNA polymerase, 100ng/μl template DNA, 10μM each primer (1μl), 5mM (0.5μl) of The Blast results from National Center for Biotechnology Information (NCBI) showed that in total of 59 samples, there are 19 each dNTPs, 100mM TrisHCl (pH 8.3), 25mM MgCl2 (2.5μl), 500mM KCl (pH 8.3). The PCR was employed with initial denaturation of 2 samples (32.2%) of M. meretrix with 99-100% identity (Table 2). min at 94oC followed by 30 cycles of denaturation for 30s at 94oC,

Citation: Trang VT, Chi T, Thiet CC, et al. Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam based on mtDNA sequence analysis. J Aquac Mar Biol. 2018;7(1): 00184. DOI: 10.15406/jamb.2018.07.00184 Copyright: Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam 57 based on mtDNA sequence analysis ©2018 Trang et al.

These results illustrated that species identification by morphology the group of bivalves. Because of shades of shells and shell colors, it and molecular biology produced different results. By morphology was wrongly identified with other species.19 The results obtained in method, 100% of the samples were classified as M. meretrix. this study do not support the present taxonomic status of M. meretrix However, by molecular biology method, only 32.2% of samples were and M. petechialis, our goal is to analyze the genetic relationship of identified as M. meretrix based on COI sequences. The remaining M.meretrix in different geographic regions of Vietnam. Specially, we (67.8%) were identified as M. petechialis. According to Prashad,19 focused to analyze genetic relationship of 3 M. meretrix populations M. meretrix is a species which experienced the greatest variation in in Thai Binh, Nam Dinh, Nghe An provinces. Table 2 Number of samples belonging M. meretrix species in investigated populations

No. of No. of analyzed No. of M.meretrix Population Rate (%) samples sequences species Hai Phong 10 10 0 0 Thai Binh 10 10 6 60 Nam Dinh 10 10 3 30 Thanh Hoa 10 10 0 0 Nghe An 10 10 8 80 Ha Tinh 10 9 2 22

Genetic relationship between M. meretrix populations NgheAn) which had more than 2 clams identified as M. meretrix (with GenBank accession numbers is DQ399399.1). In which, 6 Mitochondrial genetic diversity polymorphic sites, 3 parsimony informative sites and 4 haplotypes The fragments of COI sequences (650 bp) were obtained from 17 were observed for the COI gene. The results of M. meretrix populations clams from the 3 of 6 populations studied (Thai Binh, Nam Dinh, genetic diversity were shown in Figure 2 & Table 3.

Table 3 Mitochondrial genetic diversity of studied M. Meretrix populations

No. of No. of Haplotype Nucleotide Sample site sequences haplotype (h) diversity diversity (π± SD) (Hd ± SD) Thai Binh 6 2 0.333 ± 0.215 0.00051 ± 0.00033 Nam Dinh 3 2 0.667 ± 0.314 0.00204 ±0.00096 Nghe An 8 2 0.429 ± 0.619 0.00197 ± 0.00078 Total 17 4 0.476 ± 0.233 0.00151 ± 0.00069

The COI network was radial-like with a number of unique haplotypes closely related to central haplotype. Figure 2 indicated that the haplotype H_1, accounted for 76.47% (13/17), of all 17 individuals; occupied the central position of the network, one step away with other 3 haplotypes. This also suggested that H_1 was the ancestral haplotype and M. meretrix populations had an intimate genetic relationship. Besides, each population had its own haplotype which specific to the population. Hence, there was no population structure or population structure is not clearly established among studied populations the overall haplotype diversity and nucleotide diversitywere 0.476±0.233 and 0.00151±0.00069, respectively. The Hd ranged from 0.333±0.215 (Thai Binh population) to 0.667±0.314 (Nam Dinh population). Nucleotide diversity was highest (0.00204±0.00096) in Nam Dinh population and lowest (0.00051±0.00033) in Thai Binh population. Hd and π values in this study were lower than previous study on Meretrix petechialis and Ruditapes philippinarum using the same method. In fact, these Figure 2 Network of studied M. meretrix populations. values were 0.9483±0.0054 and 0.03364±0.01638, respectively

Citation: Trang VT, Chi T, Thiet CC, et al. Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam based on mtDNA sequence analysis. J Aquac Mar Biol. 2018;7(1): 00184. DOI: 10.15406/jamb.2018.07.00184 Copyright: Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam 58 based on mtDNA sequence analysis ©2018 Trang et al.

in Meretrix petechialis collected in the Northwestern Pacific.20 In increased was correct for the case of the relationship between Nghe An Manila clam (Ruditapes philippinarum), Hd values were ranged population and the other, but it was not correct for other relationships. from 0.80 to1.00 while π values fluctuated 0.17–1.08 in populations Genetic differentiation is influenced by many factors including habitat collected in Asia.21 Grant and Bowen, 1998 pointed out that marine differences, historical events and human activities.27 species which experienced rapid expansion following a period of low The genetic distance values ranged from 0.001 (Thai Binh – effective population size often display high haplotype but medium to NgheAn, Thai Binh – Nam Dinh) to 0.002 (Nam Dinh – Nghe An). low nucleotide diversities.22 Genetic diversity can be influenced by The variation in genetic distance was not correlated with geographic a range of factors including sample size, natural selection, mutation distance. In this study, the geographic distance between NgheAn – rates, gene flow among populations and human factors.23 Previous Thai Binh was highest, but the genetic differentiation between Nam studies revealed high genetic diversity in marine species including the Dinh – NgheAn were largest. miiuy croaker (Miichthys miiuy),24 the fat greenling (Hexagrammos otakii),25 and the clam (Macridiscus multifarius).26 Hierarchical analysis of AMOVA (Table 5) showed that majority of the molecular variation was distributed within populations (91%) rather than among populations (9%), indicating that the total genetic variation was intrapopulation variation. Therefore, it can be found that the population structure was not clearly established and the

genetic diversity was low among studied populations. The FST value was 0.08999 which means there were moderate significant genetic variations among the three M. meretrix populations. Therefore, the use of only COI marker for the mtDNA region had not been polymorphic in this study. Phylogenic analysis Phylogenetic relationships were showed among M. meretrix species and outgroup Meretrix petechialis and Venerupis Figure 3 Dendrogram (NJ tree) based on Nei (1978) genetic distance philippinarum. Because of the limitation in number of M. meretrix between 3 M. meretrix populations.28 samples (3–8 samples per population) and the mixing population among three provines, there was no or less significant differences Genetic differentiation and genetic distance between populations consensus sequences. Tree topologies indicated that three M. meretrix populations and M. meretrix COI gene sequence F values (Table 4) indicated the levels of pair wise genetic ST (Accession number: DQ399399.1) formed a monophyletic group with differentiation between the 3 populations. The F values between ST very small or no genetic variation among populations. populations were moderate (FST < 0.15), in which the lowest FST value was observed between the Nam Dinh and NgheAn populations (FST = M. meretrix and M. petechialis have been known as closely

0.07996), while the highest FST value was observed between the Nam related species and there were some suggestions that they should be 4,6 Dinh and Thai Binh populations (FST = 0.13333). considered as synonyms . However, as of now, the classification ofM. Table 4 Genetic differentiation (above) and genetic distance (below) of 3 M. meretrix and M. petechialis are still debated and unanimously agreed meretrix populations on the morphological and molecular biology identification methods. According to previous studies, M. meretrix was only distributed in Nam Dinh Thai Binh Nghe An the South China Sea, while M. petechialis was widely distributed throughout the coasts of China29 and they were often misidentified.20 Nam Dinh − 0.13333* 0.07996* In another similar case, Chen et al.,4 supposed that M. petechialis and Thai Binh 0.001 − 0.08789* M. lusoria should be treated as a junior synonym of M. meretrix but Nghe An 0.002 0.001 − as the reported by Torii et al.,30 M. petechialis and M. lusoria are the two different species. Moreover, these authors established a method to (*: P value < 0.05) identify M. lusoria and M. petechialis from shell morphology which

The genetic differentiation (FST) increased as geographic distance can identify with 98.89% correct percentage.

Table 5 Results from analysis of molecular variance (AMOVA) of populations

Variance Percentage of Fixation Source of variation d.f. Sum of squares components variation Index FST Among populations 2 1.451 0.04709 9 0.08999

Within populations 14 6.667 0.47619 91

Total 16 8.118 0.52328

Citation: Trang VT, Chi T, Thiet CC, et al. Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam based on mtDNA sequence analysis. J Aquac Mar Biol. 2018;7(1): 00184. DOI: 10.15406/jamb.2018.07.00184 Copyright: Genetic relationship of asiatic hard clam populations collected in northern coastal provinces in Vietnam 59 based on mtDNA sequence analysis ©2018 Trang et al.

Conclusions choice. Nucleic Acids Res. 1994;22(22):4673–80. Nineteen out of 59 samples were identified as M. meretrix. The 13. Rozas J, Sanchez-DelBarrio JC, Messeguer X. DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. M. meretrix populations had moderate genetic diversity that revealed 2003;19(18):2496–7. by values of haplotype diversity and nucleotide diversity. The 14. Excoffier L, Smouse PE, Quattro JM. Analysis of molecular variance genetic differentiation (FST) was relatively high, however, the genetic distance (DA) was low and not related with geographic distance. inferred from metric distances among DNA haplotypes: application to Total genetic variation was intrapopulation variations. There was no human mitochondrial DNA restriction data. Genetics. 1992;131(2):479– 91. clear population structure established among studied populations. The obtained results of this study have contributed scientific basis about 15. Bandelt HJ, Forster P, Rohl A. Median-joining networks for inferring genetic data of Asiatic hard clam in some regions in Vietnam. This is intraspecific phylogenies.Mol Biol Evol. 1999;16(1):37–48. the basis for scientists, managers and people to build timely measures 16. Tamura K, Stecher G, Peterson D, et al. MEGA6: Molecular Evolutionary to research, preserve and develop clam genetic resources in the future. Genetics Analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–9. Acknowledgments 17. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4(4):406–25. The study was supported by Research Institute for Aquaculture 18. Kimura M. A simple method for estimating evolutionary rates of base No.1, Vietnam substitutions through comparative studies of nucleotide sequences. J Conflict of interest Mol Evol. 1980;16(2):111–20. 19. Prashad B. The Lamellibranchia of the Siboga expedition. Systematic None. part. II. Pelecypoda (exclusive of the Pectinidae). Siboga-Expenditie, Leiden. 1932;212–264. References 20. Wang X, Kong L, Chen J, et al. Phylogeography of bivalve Meretrix 1. Tang B, Liu B, Wang G, et al. Effects of various algal diets and starvation petechialis in the Northwestern Pacific indicated by mitochondrial and on larval growth and survival of Meretrix meretrix. Aquaculture. nuclear DNA data. PLoS One. 2017;12(8):e0183221. 2006;254(1):526–533. 21. Cordero D, Delgado M, Liu B, et al. Population genetics of the Manila 2. Phung NH, Tuan VS, Yet NH. Distribution and economic resources of clam (Ruditapes philippinarum) introduced in North America and Gastropoda class and Bivalvia class in Vietnam coastal areas. Proceeding Europe. Scientific Reports. 2017;7:39745. of the first national workshop on marine mollucs, Agricultural Publisher, Ho Chi Minh. 2001:27–60. 22. Grant WAS, Bowen BW. Shallow population histories in deep evolutionary lineages of marine fishes: insights from sardines 3. Thanh NX, Thuoc P, Khoi TC (2013) Situation and development and anchovies and lessons for conservation. Journal of Heredity. orientation of clam culture in Nam Dinh. Journal of Marine Science and 1998;89(5):415–26. Technology. 2013;13(1):88–94. 23. Frankham R. Challenges and opportunities of genetic approaches to 4. Chen A-h, Li Z-x, Feng G-n. Phylogenetic relationships of the Genus biological conservation. Biological Conservation. 2010;143(9):1919– Meretrix (Mollusca: Veneridae) Based on Mitochondrial COI Gene 27. Sequences. Zoological Research. 2009;30(3):233−239. 24. Xu T, Zhu Z, Sun Y, et al. Characterization and expression of the 5. Chen J, Qi Li, Lingfeng Kong, et al. Molecular phylogeny of venus CXCR1 and CXCR4 in miiuy croaker and evolutionary analysis shows clams (Mollusca, Bivalvia, Veneridae) with emphasis on the systematic the strong positive selection pressures imposed in mammal CXCR1. position of taxa along the coast of mainland China. Zoologica Scripta. Dev Comp Immunol. 2014;44(1):133–44. 2011;40(3):260–271. 25. Habib KA, Jeong D, Myoung J-G, et.al. Population genetic structure and 6. He CB, Wang J, Gao XG, et al. The complete mitochondrial genome demographic history of the fat greenling Hexagrammos otakii. Genes & of the hard clam Meretrix meretrix. Mol Biol Rep. 2011;38(5):3401–9. Genomics. 2011;33(4):413–23. 7. Wolstenholme DR. Animal mitochondrial DNA: structure and evolution. 26. Ye YY, Chang WW, Ji JL. Genetic Population Structure of Macridiscus Int Rev Cytol. 1992;141:173–216. multifarius (Mollusca: Bivalvia) on the Basis of Mitochondrial Markers: 8. Folmer O, Black M, Hoeh W, et al. DNA primers for amplification of Strong Population Structure in a Species with a Short Planktonic Larval mitochondrial cytochrome c oxidase subunit I from diverse metazoan Stage. PLoS ONE. 2015;10(12):e0146260. invertebrates. Mol Mar Biol Biotechnol. 1994;3(5):294–9. 27. Grant JA, Wilson SA, Ruff SW, et al. Distribution of rocks on the 9. Rebijith KB, Asokan R, Kumar NKK. Molecular identification of Gusev Plains and on Husband Hill, Mars. Geophysical research letters. Mealybugs. In: Mani M, Shivaraju C, editors. Mealybugs and their 2006;33(16). Management in Agricultural and Horticultural crops. New Delhi: 28. Nei M. Estimation of average heterozygosity and genetic distance from Springer. 2016:75–86. a small number of individuals. Genetics. 1978; 89(3):583–90.

rd 10. Sambrock J, W Russel D. Molecular Cloning: A Laboratory Manual. 3 29. Zhang S, Wang H, Xu F. Taxonomic study on Meretrix (Bivalvia, ed. Cold pring Harbor Laboratory Press, New York; 2001. veneridae) from China Seas. Acta Zoo-taxonomica Sinica. 2012;37:473– 11. http://www.geospiza.com. 479. 12. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving 30. Torii H, Sato Si, Hamaguchi M, et al. The comparison of shell morphology the sensitivity of progressive multiple sequence alignment through and genetic relationship between Meretrix lusoria and M. petechialis in sequence weighting, position-specific gap penalties and weight matrix Japan and Korea. Plankton Benthos Res. 2010;5 Suppl:231–241.