The developmental genetics of exaggerated eyespan in stalk-eyed flies

Imogen Anne Hurley

Submitted for PhD, University College London ProQuest Number: U643424

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.

ProQuest U643424

Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.

All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC.

ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT

Stalk-eyed flies have their eyes and antennae projected on lateral extensions of the head known as eyestalks. It has previously been shown that this trait is under sexual selection, as females prefer to mate with males with the largest eyespan in some stalk-eyed fly species. However, the developmental biology underlying eyestalks is unknown. In this thesis I investigated how this exaggerated trait is constructed.

In Diptera, the eyes, antennae and dorsal head are derived from the fusion of two eye- antennal imaginai discs. The disc morphology of two species of stalk-eyed fly,

Cyrtodiopsis dalmanni and Sphyracephala beccarri is very similar to Drosophila melanogaster. However, an extra disc region exists in the stalk-eyed fly which is absent in

D. melanogaster. Using key regulators of D. melanogaster head development, I showed that these genes have conserved expression in the eye-antennal imaginai disc of stalk-eyed flies. The expression of genes that specify the extremes of the dorsal head in D. melanogaster was preserved in the stalk-eyed fly disc despite their disparate head morphology. Also, although the adult antenna and eye are adjacent in stalk-eyed flies, the disc regions that will form these structures are widely separated.

A fate map of the disc regions was deduced from in vivo culture of disc fragments. This work confirmed my expression data. Surprisingly, the regions that wiU form the palpus

and antenna are adjacent in the eye-antennal disc, yet the adult structures they will form are widely separated. Conversely, the regions that will form the eyestalk and antenna are

separated in the disc even though in the adult they are adjoining. To further explore these issues I successfully performed a D. melanogaster P-element enhancer trap screen in

which I found several genes involved in head capsule morphogenesis and also produced and characterised a cDNA library from the larval stage of C. dalmanni (Diopsidae). TABLE OF CONTENTS

TITLE PAGE: DEVELOPMENTAL GENETICS OF EXAGGERATED

EYESPAN IN STALK-EYED FLIES 1

A b st r a c t 2

T a b l e o f C ontents 3

L ist OF F igures 6

L ist OF T ables 7

CHAPTER 1: GENERAL INTRODUCTION 8

1.1 T h e exaggerated e y e spa n of sta lk -e y e d flies 9

1.2 E volutionary developmental biology 19

1.3 D ipter an h ea d development 3 2

1.4 T h esis st r u c u t u r e 5 3

1.5 R efer en c es 6 3

CHAPTER 2: CONSERVATION OF THE EXPRESSION OF DLL. EN AND WG

IN THE EYE-ANTENNAL IMAGINAL DISC OF STALK-EYED FLIES 80

2 .1 S u m m a r y 81

2 .2 Introduction 8 2

2 .3 M ater ia ls a n d m eth o d s 8 4

2 .4 R e su l t s 88

2 .5 D is c u s sio n 9 2

2 .6 R efer en c es 102 CHAPTER 3: FATE MAP OF THE EYE-ANTENNAL IMAGINAL DISC IN

THE STALK-EYED FLY C. DALMANNI______104

3.1 S u m m a r y 105

3 .2 Introduction 10 6

3.3 M a terials a n d m eth o d s 113

3 .4 R e su l t s 115

3 .5 D is c u s sio n 11 9

3 .6 R e fer en c es 128

CHAPTER 4: DROSOPHILA P-ELEMENT ENHANCER TRAP SCREEN FOR

NOVEL REGULATORS OF HEAD DEVELOPMENT______132

4 .1 S u m m a r y 133

4 .2 Introduction 1 3 4

4 .3 M aterials a n d m eth od s 141

4 .4 R esu l t s 1 4 6

4 .5 D is c u s sio n 1 5 4

4 .6 R efer en c es 1 7 2

CHAPTER 5: CONSTRUCTION AND CHARACTERISATION OF A C.

DALMANNI THIRD INSTAR LARVAL CDNA LIBRARY______177

5.1 S u m m a r y 178

5 .2 Introduction 179

5.3 M a terials a n d m eth od s 1 8 4

5 .4 R e su lt s 1 9 4

5 .5 D is c u s sio n 197

5 .6 R efer en c es 2 0 3 CHAPTER 6: GENERAL DISCUSSION ______204

6.1 S u m m a r y 2 0 5

6 .2 F u t u r e WORK 2 0 8

6 .3 R efer en c es 2 1 2 LIST OF FIGURES

F ig u r e 1. 1 Exaggerated morphologies in insects 55

F ig u r e 1.2 Phylogenetic tree of the A calypterate families (Diptera) 56

F ig u r e 1.3 Phylogenetic tree of33 Diopsidae species 57

F ig u r e 1.4 D r o s o p h ila anterior adult head 5 8

F ig u r e 1.5 Drosopwm dorsal adult head 58

F ig u r e 1.6 D r o s o p h ila eye-antennal imaginal disc fate map 59

F ig u r e 1.7 Theoretical models of imaginal disc regional specm cation 60

Figure 1.8 Regional specmcation of theD r o s o p h ila t h o r a c i c im a g in a l d is c s 61

F ig u r e 1.9 Regional specmcation of theD r o s o p h ila eye-antennal imaginal disc 62

F ig u r e 2.1 Dipteran head m orphology 95

F ig u r e 2.2 Eye-antennal im aginal discs in Drgsgph/za and stalk-eyed flies 96

F ig u r e 2.3 Expression ofe n a n d w g in the third instar eye-antennal disc of stalk-eyed

FLIES 97

F ig u r e 2.4 Comparison of the nucleotide sequence ofw in g le s s in Cyrtodiopsis sp e c ie s

99

F ig u r e 2.5 Proposed fa te map of head region in C.d a lm a n n based i on m arker gene

EXPRESSION 101

Figure 3.1 Schematic representation ofD r o s o p h ila a n d Cyrtodiopsis eye-antennal

DISCS 123

F ig u r e 3.2 Regulation in the eye-antennal disc 124

F ig u r e 3.3 Fragments of eye-antennal disc culturedin v iv o 125

F ig u r e 3.4 Schematic representations of the stalk-eyed fly head(A) and eye-antennal

DISC FATE MAP (B) 126

F ig u r e 3.5 Photographs of w hole eye-antennal disc tissue follow ingin v iv o c u l t u r e

ILLUSTRATING THE LANDMARKS CHOSEN FOR FATE MAP CONSTRUCTION 127

F ig u r e 4.1 Schem atic diagram of enhancer trapping 163

F ig u r e 4.2 Schematic diagram of plasmid rescue and inverse PGR 164 Figure 4.3 The D rosoph ila dorsal head vertex 166

F ig u r e 4 .4 F ive c lasses o f e x pressio n patter n w ere o bse r v e d w ithin th e e y e-a n ten n a l

DISCS OF THE ENHANCER TRAP LINES 1 67

Figure 4.5 Expression ofa ch a e te a n d at o n a l in t h e D . melanogaster eye-antennal disc

168

F ig u r e 4 .6 C l a ss 5 ex pressio n patterns w ere fr o m potentially n o v e l r eg ulator s of

HEAD DEVELOPMENT 1 6 9

Figure 4.7 The expression of a novel regulator of head development,deeectw e

VENTRICULES, IN D . MELANOGASTER PVND C. DALMAAW/EYE-ANTENNAL DISCS 1 7 0

Figure 4.8 d efective ventricules may act downstream of a known regulator of head

DEVELOPMENT, ORTHODENTICLE TO SPECIFY THE DORSAL HEAD VERTEX 171

F ig u r e 5.1 E th id ium bro m ide plate a s s a y o f c d n a fra ctio ns 2 0 1

F ig u r e 5 .2 F r eq u e n c y h isto g r a m o f in ser t size (k b ) fro m ph a g e m id s r a n d o m l y ch o sen

FROM AMPLIFIED LIBRARY 2 0 2

LIST OF TABLES

Table 3.1 Proportion of landmarks in fragm ents of the eye-antennal discs cultured

IN VIVO 12 2

T a b l e 4.1 P -elem en t insertio n sto ck s c h o sen fo r e n h a n c e r t r a p sc r e en 1 5 9

T a b l e 4 .2 P -elem en t inser tio n sto ck s successfully id entified v ia pl a sm id r esc u e

1 6 2

T a b l e 5.1 E x pr e sse d seq u en c e ta g s (E S T s ) w hich w e r e identified b y c o m pa r iso n w ith

SEQUENCES FROM OTHER SPECIES WITHIN THE NON-REDUNDANT G e n B a NK

NUCLEOTIDE DATABASE 2 0 0 1

General Introduction 1.1 THE EXAGGERATED EYESPAN OF STALK-EYED FLIES

1.1.1 Hypercephaly in the Diptera

Exaggerated morphologies

Insects portray a range of exaggerated morphologies, for example, the head and thoracic horns of the Dynastes neptunus (Coleoptera: Scarabaeidae) or the hind legs in

Acanthocephala declivis (Hemiptera: Coreidae) (Emlen and Nijhout 2000) (Fig, 1.1).

Another example of an exaggerated trait is hypercephaly, which describes the lateral extension of the eyes away from the head (Fig. 1.1). Hypercephaly is observed in several insect orders including the Hymenoptera (Yoshimoto and Gibson 1979), the Heteroptera

(Stonedahl 1986) and the Diptera (Grimali and Fenster 1989, Wilkinson and Dodson

1997).

The Diptera

The Diptera or true flies are one of the largest insect orders with 128 families and 125,000 species described (Groombridge 1992). Hypercephalic flies were originally discovered in the eighteenth century (Linnaeus 1775) although it is now believed that the trait has arisen at least 21 times (Grimaldi and Fenster 1989). Exaggerated eyespan has evolved in eight

Dipteran families: Diopsidae, Drosophilidae, Micropezidae, Otitidae, Periscehdidae,

Platystomatidae, Richardiidae and Tephritidae (Fig. 1.2, Grimaldi and Fenster 1989,

Wilkinson and Dodson 1997). Not all species within a family are hypercephalic and the trait has evolved independently at least one time within each family.

Phylogenetic relationships within the order

The smallest monophyletic group containing hypercephalic flies is the Acalypteratae, which is classified into 10 superfamilies (McAlpine 1989, Fig. 1.2). Half of the hypercephalic families lie within one superfamily, the Tephritoidea. If it is assumed that the evolution of this trait is equally likely in different famihes then the probability of the Tephritoidea cluster occurring by chance is highly unlikely (0.01, Wilkinson and Dodson

1997). This finding suggested that the hypercephalic flies are distributed non-randomly between the 61 Acalypteratae famihes. Furthermore, analysis of the distribution of hypercephaly within the family Drosophilidae revealed that clustering at this taxonomic level was also non-random (DeSalle and Grimaldi 1993). These tests suggest that some characteristics of these families and genera predispose them to exaggeration in eyespan

(Wilkinson and Dodson 1997).

Variation in hypercephaly within the order

There is great variation in the morphology of different hypercephalic flies. In some species, the compound eyes are projected away from the body axis on the end of lateral extensions of the head capsule known as eyestalks, for example, Achias australis

(Platystomatidae) (McAlpine 1979) and these flies are consequently known as stalk-eyed flies (Fig. 1.1). The circumference of eyestalks varies between species, for example,

Richardia telescopica (Richardiidae) has thicker eyestalks than Teleopsis species

(Diopsidae) (Grimaldi and Fenster 1989). In other flies the distension of the head is less extensive resulting in broad-headed or hammerhead fhes, for example. Drosophila heteroneura (Drosophilidae) (Grimaldi and Fenster 1989). Stalk-eyed and broad-headed flies represent extremes of a continuum of head morphologies across the Diptera.

Within a single family an array of head morphologies may be observed. In the

Drosophilidae family, for example, a range of changes to the eyes and / or cranial sclerites or plates accompanies broadening of the head (Grimaldi and Fenster 1989). Consequently,

Drosophila species such as D. heteroneura (Drosophilidae) have a broadened head capsule but unmodified eyes when compared to non-hypercephahc Drosophila.

Conversely, the eyes of Zygothrica species such as Z latipanops (Drosophilidae) are displaced anteriolaterally resulting in a broad anterior eye surface with a tapered apex.

Additionally, within a single ’ genus, there may be differences in the extent of exaggeration, for example, in4heZygof/zrica -genera. (Drosophilidae) a range of head sizes are observed

10 from the non-hypercephalic Z vittinubila to the very broad-headed species hke Z. latipanops (Grimaldi and Fenster 1989). Variation in eyespan exaggeration is also observed between the sexes. Sexual dimorphism is present in all of the hypercephalic families (Grimaldi and Fenster 1989). The sex specific morphology of the exaggerated eyespan is exemphfied by R. telescopica (Richardiidae), which has extreme sexual dimorphism for the trait. The male eyespan within this species is highly exaggerated forming eyestalks whereas females shown limited hypercephaly (Grimaldi and Fenster

1989).

1.1.2 Hypercephaly in the Diopsidae

The Diopsidae

Recent research has focused on one Dipteran hypercephalic family, the Diopsidae. Species within this family were also the first hypercephalic flies to be noted (Linnaeus 1775). 13 genera and around 150 species have been described within this family (Steyskal 1972,

Feijen 1984, Feijen 1989) although it is thought that the true number of species is greater than 200 (Feijen 1989). Originally, the Centrioncidae genus was included within the

Diopsidae (Shillito 1950, Hennig 1958) however these flies were subsequently designated as a separate family (Feijen 1983, Feijen 1989, Meier and Hilger 2000). In the absence of the non-hypercephalic Centrioncidae, both sexes of every Diopsidae species have eyestalks. In this respect the Diopsidae are unique among all other hypercephalic families.

The Diopsidae are also the only family in which the antennae as well as the eye, has been displaced laterally.

Variation in hypercephaly within the family

The Diopsidae exhibit a range of head morphologies and sizes, for example,

Sphyracephala species have hammerheads whereas Diopsis species have eyestalks

(Shillito 1971a). Within genera, variation in the extent of exaggeration is often observed.

11 for example, the eyespan of female T. breviscopium is twice the width of female T. quadriguttata (Wilkinson and Dodson 1997).

The eyespan of some Diopsidae species is sexually dimorphic, for example, T. breviscopium males have an eyespan that is nearly twice that of females (Wilkinson and

Dodson 1997). Sexual dimorphism was originally observed in the Teleopsis genera (Frey

1928) although it has since been described in Diopsis, Sphyracephala, Cyrtodiopsis and

Diasemopsis (Descamps 1957, Shillito 1971b, Burkhardt and de la Motte 1983,

Burkhardt and de la Motte 1985, Feijen 1989, Wilkinson and Dodson 1997). In all dimorphic species examined so far, male eyestalks are longer than females relative to body length. Although some female Sphyracephala species have a wider eyespan than males

(Feijen 1989), this is accompanied by greater body length as well and the relative eyespan is the same in both sexes (Wilkinson and Dodson 1997).

The phylogenetic relationships between 33 species of Diopsidae have been resolved using molecular data (Baker et al. 2001a, Fig. 1.3). Combined with phytogenies based on morphological characters (Feijen 1989, Steyskal 1972), this analysis suggests that sexual dimorphism has evolved multiple times within the Diopsidae from monomorphic species, for example, monomorphic C. quinqueguttata is plesiomorphic to C. whitei and C. dalmanni, which are dimorphic (Wilkinson and Dodson 1997). In beetles, sexual dimorphism is positively correlated with body size (Otte and Stayman 1979). However, inter-species comparisons of stalk-eyed flies within the same genera revealed that the body length of dimorphic species does not always exceed monomorphic species, for example, the monomorphic species C. quinqueguttata is larger than the strongly sexually dimorphic species C. dalmanni (Burkhardt and de la Motte 1985, Wilkinson and Dodson 1997).

Eyespan exaggeration is therefore not a correlated response to selection for larger body size.

12 1.1.3 The evolution of hypercephaly

Natural selection

A number of hypotheses have been proposed to explain the origin of hypercephaly in the

Diptera and the evolution of male-specific exaggeration in some species. Optical studies of

Cyrtodiopsis whitei (Diopsidae) revealed one possible adaptive advantage of eyestalks

(Burkhardt and de la Motte 1983, de la Motte and Burkhardt 1983). The divergence angle of adjacent ommatidia is as small as 1° in some regions of the eye, which illustrates the high visual resolution of the stalk-eyed fly eye. A large region of overlap between the visual fields of the left and right eyes was also observed in C. whitei as a result of its exaggerated eyespan (Burkhardt and de la Motte 1983). It was consequently assumed that stalk-eyed flies have binocular vision (Burkhardt and de la Motte 1983), although this idea has not been tested experimentally. One would expect the ‘blind space’ close to the animal, which cannot be viewed by the ommatidia, to increase with an expansion of eyespan. However, a positive correlation was revealed between eyespan width and the number of ommatidia within the compound eyes and consequently ‘blind space’ is independent of eyespan. A wide eyespan, high visual resolution and extensive binocular overlap may enable the stalk-eyed fly to judge the size and distance of objects over greater distances (Burkhardt and de la Motte 1993, de la Motte and Burkhardt 1983). It was hypothesised that this characteristic would be of strong adaptive value for orientation within the dense tropical rainforests inhabited by Cyrtodiopsis. Improved vision might also enable the assessment of opponents or mates from greater distances. However, there is no direct evidence in support of this proposal.

Intrasexual selection

Several authors have proposed a link between the evolution of male-specific exaggeration and behavioural traits. During male combat, D. heteroneura (Drosophilidae) use their heads to ram their opponent’s head and body (Spieth 1981). Males with wider heads win more contests (Boake et al. 1997) and it was therefore proposed that intrasexual

13 competition between males resulted in hypercephaly (Spieth 1981, Boake et al. 1997). Not all hypercephalic flies make contact with their heads during fights. In these species, it has been proposed that male-specific eyespan elongation evolved due to the signalling function of the trait. A. australis (Platystomatidae) males, for example, do not directly use their eyes or eyestalks during fights but instead press their facial regions together (McAlpine 1979).

As eyespan was shown to be a function of overall size, it was proposed that this trait enabled males to judge the body size of their opponent. An individual who could judge size would be able to predict the likely outcome of a contest and consequently, avoid injury through unnecessary conflicts. This “size-up” hypothesis was supported by observations in Zygothrica dispar (Drosophilidae) (Burla 1988). Rival males of this species initially joust with their heads slightly separated and rarely touching and contests finish with the retreat of one male or an escalation into contact. Furthermore, the individual with the largest eyespan won 91% of fights between C. whitei males (Diopsidae) (Burkhardt and de la Motte 1987), although their heads were not used in actual fighting.

Eyespan correlates with body size in all hypercephalic flies (McAlpine 1979, Burkhardt and de la Motte 1985, Grimaldi and Fenster 1989) and it is therefore possible that males with larger eyespans win more contests by virtue of their larger body size. However, this possibility was disproved using male C. whitei and C. dalmanni (Diopsidae), which had been artificially selected for increased or decrease eyespan relative to body length

(Wilkinson 1993). Although both body length and eyespan increase with selection for an increase in the ratio of eyespan to body length, eyespan increases much more than body length under these conditions (Wilkinson 1993). Consequently, it was possible to stage fights between males that differed greatly in eyespan but not in body size (Panhuis and

Wilkinson 1999). Males with large eyespans won significantly more fights than males with smaller eyespans and contest outcome was independent of body length (Panhuis and

Wilkinson 1999). Furthermore, there was an inverse relationship between contest duration and the difference in eyespan amongst competitors, which confirmed that eyespan was involved in opponent assessment (Panhuis and Wilkinson 1999). If selection line males

14 with a large eyespan were more aggressive than small eyespan males, contest outcome would be due to a change in fighting behaviour rather than eyespan assessment. However, this possibility was excluded following an examination of fight duration, which revealed no significant difference in this characteristic between outbred and selection hne flies

(Panhuis and Wilkinson 1999).

An examination of eyespan on body length regression slopes within the Diopsidae suggested that eyespan was a more accurate measure of size than body length (Burkhardt and de la Motte 1985, Wilkinson and Dodson 1997). When there is positive allometry between eyespan and body length a small change in body length will lead to a large change in eyespan, and eyespan will consequently be a more precise gauge of body length than body length itself (Wilkinson and Dodson 1997). If this is indeed the case, one might expect selection to favour increased allometric slopes, which would improve accuracy further. It was consequently hypothesised that sexual dimorphism had evolved through changes in eyespan on body length allometry in males (Wilkinson and Dodson 1997).

However, comparative analysis within a phylogenetic context revealed that changes in allometry are common across the Diopsidae and occur more often than changes in absolute sexual dimorphism (Baker and Wilkinson 2001). No evidence was found in this study to support a directional trend toward increased male eyespan allometry and male- specific eyespan exaggeration (Baker and Wilkinson 2001).

Intersexual selection

It has also been suggested that intersexual selection may have lead to eyespan elongation in males. In the wild, C. whitei form sleeping communities on thread-like structures such as rootlets. The ratio of males to females on these threads is highly female biased and there can be as many as 20 females with a single male (Burkhardt and de la Motte 1983).

Through the use of dummy males, it has been shown in the laboratory that females prefer to roost with larger males and it was hypothesised that males, which acquired a larger harem, would have a greater opportunity for copulation (Burkhardt and de la Motte 1988).

15 This prediction was verified through paternity testing using the phosphoglucomutase allozyme system, which has three alleles A, B and C (Burkhardt and de la Motte 1994).

Initially, homozygous lines of the strains AA, BB or CC were established. Virgin CC females were kept with large eyespan AA males and small eyespan BB males. The proportion of AC and BC progeny was determined by gel electrophoresis and used to determine reproductive success. This experiment confirmed that male C. whitei with larger eyespans sire more offspring than smaller males.

Female choice tests also showed that females prefer to mate with males with the largest eyespan (Wilkinson and Reillo 1994, Wilkinson et al. 1998a, Hingle et al. 2001). Plastic cages were made which were divided in two with a clear acetate partition. Holes were cut in the partition that were big enough to allow female Cyrtodiopsis species to pass freely but hindered the movement of males due to their exaggerated eyespan. By placing males with different eyespans on either one side of the partition, it was possible to observe female preference. This was recorded as the number of females that roosted with either male, or the number of copulations gained by either male. Female preference for males with broader heads has also been shown experimentally in Drosophila heteroneura (Boake et al. 1997). Due to the territorial nature of this species in the wild, females only assess males one at a time. No-choice tests were consequently employed in which a single female was placed with a single male (Boake et al. 1997). Courtship and mating success was only possible if the female was receptive to the male and female receptivity was more likely if the male had a broader head (Boake et al. 1997).

I have already described how males with a larger eyespan win more intra and intersexual competitions than smaller males. A female will therefore increase the mating success of her offspring by choosing a mate with a larger eyespan. Other benefits associated with this preference have also been proposed. The sex ratio of C. dalmanni and C. whitei populations are female-biased (Burkhardt and de la Motte 1983). Males consequently have a higher reproductive value than females and selection may exist for females, which

16 sire offspring with an equal or male-biased sex ratio. The population sex ratio is believed to be female-biased due to the presence of a driving X chromosome, which causes Y- spermatid degeneration in male carriers (Presgraves et aL 1997). Artificial selection experiments for an increase or decrease in eyespan (Wilkinson 1993) suggested that large eyespan indicates a resistance to drive and the size of the trait therefore signals male quality (Wilkinson et al. 1998b). Females may also discriminate between males by eyespan because it is a better indicator of larval condition than any other non-sexual trait

(David et al. 1998). There is no evidence for any short-term benefits associated with choosing large males (Baker et al. 2001b). Female fecundity is independent of male eyespan, as judged by the number of eggs laid per day, and fertihty, as determined by egg hatching rate, is negatively correlated with male eyespan.

Evolution of hypercephaly in monomorphic species

Hypercephaly is frequently associated with sexual dimorphism (Grimaldi and Fenster

1989). I have described how male-male competition and female choice are linked with this trait in dimorphic species. However, these selective forces are not observed in monomorphic species. Fight outcome and duration was shown to be independent of any body size trait including eyespan in the monomorphic species, C. quinqueguttata (Panhuis and Wilkinson 1999). Female mate choice experiments revealed that female preference for large eyespan does not exist in C. quinqueguttata and Teleopsis quadriguttata, which are both monomorphic (Wilkinson et al. 1998a). The sex ratio in C. quinqueguttata is also unbiased suggesting that X-linked meiotic drive polymorphism did not establish the evolution of eyestalks, although it may have lead to an exaggeration of the trait (Wilkinson et al. 1998b). Unlike C. dalmanni and C. whitei, which are dimorphic, C. quinqueguttata does not form aggregations in the wild (Burkhardt and de la Motte 1983, Burkhardt and de la Motte 1987, Wilkinson and Dodson 1997, Panhuis and Wilkinson 1999). It has therefore been suggested that male-male competition does not occur between C. quinqueguttata individuals in the wild and elongation of the eyestalks in sexually dimorphic Cyrtodiopsis males resulted from the ecological transition into aggregations

17 (Wilkinson and Dodson 1997). Further research is therefore required to determine why eyestalks originally evolved in monomorphic species.

Costs associated with hypercephaly

Several authors have suggested possible costs associated with hypercephaly, for example, newly emerged flies must inflate their eyestalks following eclosion and intuitively, one would expect them to be vulnerable to predation during this time (de la Motte and

Burkhardt 1983, Buschbeck and Hoy 1998). However, this theory has yet to be tested experimentally. It also seems likely that the aerial performance of these species will suffer as a result of hypercephaly. To test this hypothesis. Swallow et al. (2000) compared the flight and morphology of male and female C. whitei and C. quinqueguttata. The eyespan of C. whitei is greater than C. quinqueguttata. C. quinqueguttata is monomorphic for the trait whereas male C. whitei have a larger eyespan than females. It was shown that head mass does not differ significantly between these individuals. Sex- and species-specific exaggeration of eyespan therefore does not incur a cost in terms of increased load.

However, it seems likely that flight performance is reduced when the eyespan is elongated because C. whitei males show less manoeuvrability than C. quinqueguttata males. A shallower angle of ascent also suggests that C. whitei males suffer more negative aerodynamic effects than the other individuals tested. In addition, a study of the neuroanatomy of C. quinqueguttata revealed that hypercephaly in this species was accompanied by changes in neural organisation, including fewer but larger giant collector neurons (Buschbeck and Hoy 1998). Stalk-eyed flies are slower flying than other Diptera, possibly because these neurological adaptations result in a reduction in the speed visual information can be processed (Buschbeck and Hoy 1998, Swallow et al. 2000).

18 1.2 EVOLUTIONARY DEVELOPMENTAL BIOLOGY

1.2.1 Evolution and development

Although the function, origin and sex-specific exaggeration of hypercephaly in the Diptera have been investigated, the developmental genetics underlying this trait j is largely unknown. Studies of D. heteroneura suggest that hypercephaly is a polygenic trait

(Templeton 1977, Val 1977, Lande 1982, Lande 1986). However, the genes involved in hypercephaly in Drosophila have not been identified so far. I have examined the development of the exaggerated eyespan in the Diopsidae to understand how the development and evolution of this and other novel phenotypes are connected. Although selection acts on the adult phenotype, novel morphologies such as the exaggerated eyespan are generated through changes in the development of the organism. Consequently, by understanding the development of novel phenotypes we can also reveal how developmental changes produce phenotypic diversity.

The mechanisms underlying other developmental processes have been identified through the ability to mutate and observe gene expression patterns. Developmental biologists have predominantly applied these techniques to a limited range of model organisms, in order to achieve a detailed level of analysis. Conversely, evolutionary biologists have performed a comparative approach between different species and used palaeontology and phylogenetic analysis to understand the context of evolutionary processes. When combined, these fields form a relatively new approach known as evolutionary developmental biology in which the mechanistic knowledge from developmental biology is combined with the comparative approach of evolutionary biology. Although the detailed knowledge afforded by the study of model organisms is lost, a deeper understanding of how organisms interrelate and evolve is gained through this methodology (Garica-Bellido 1993).

19 There are several innovations that have promoted the recent reunion of developmental and evolutionary biology (Holland 1999). Firstly, the phylogenetic relationships between organisms can be determined objectively ■ through the comparison of sequence data.

Consequently, developmental changes can be interpreted within a phylogenetic context.

Secondly, technical advances such as in situ hybridisation, the polymerase chain reaction and low stringency hybridisation enable the analysis of gene sequences and expression patterns in species beyond the model organisms. Thirdly, inter-species comparisons have revealed that the molecules and circuits controlling the development of a wide range of species are largely conserved, for example, the homeotic (Hox) genes that pattern the body plan are present in all animal phyla examined to date (reviewed Perrier and Holland 2001).

Variation is generated instead by the diversification of these constituents. Differential regulation of genes or pathways enables the recruitment of pre-existing elements to novel functions. Consequently, it has been shown that phenotypic novelties may be generated by adaptations to existing processes rather than through the creation of new components and the knowledge gained from model organisms can be applied to other species.

1.2.2 Candidate gene approach

A range of experimental techniques has been adopted for the study of evolutionary developmental biology. The candidate gene approach has been successfully used to uncover the mechanisms by which several types of phenotypic diversity have evolved. The expression patterns of candidate genes were compared between different species to identify the way in which developmental pathways had altered during evolution. This methodology is exemplified by research into the evolution of the insect wing and leg.

Insect wing number

Evidence from the fossil record suggests that the four-winged state of extant winged insects was derived from a pterygote ancestor, which possessed wings or wing-like structures on every segment (Carroll et al. 1995). In order to investigate how the wing

20 number in modem insects evolved, the Hox genes, which establish the segmental identity along the Drosophila anterior-posterior axis, were examined (Carroll et al. 1995).

Antennapedia (Antp) expression had previously been observed in the embryonic second and third thoracic segments (T2 and T3), which will form the wing primordia (Levine et al.

1983, Carroll et al. 1995). This observation suggested that Antp might promote wing development, however, this hypothesis was rejected following mutant analysis and it was revealed instead that the Hox genes. Sex combs reduced {Scr), Ultrabithorax (Ubx) and abdominal-A (abd-A), repress wing formation in the abdominal and thoracic segments apart from T2 and T3 (Carroll et al. 1995).

The repression of wing development by Scr, Ubx and abd-A lead to two suggestions for the evolution of insect wing number: either the spatial restriction of these Hox genes was established during pterygote evolution or their role had diversified to include wing number regulation since this time (Carroll et al. 1995). Comparative studies were employed in order to differentiate between these hypotheses. Antp, Ubx and abd-A had previously been detected in the crustacean, Artemiafranciscana (Averof and Akam 1993), which suggested that these genes were present in the ancestors of the pterygotes. An examination of Ubx and abd-A expression in Thermobia domestica, which belongs to the sister group of the pterygotes (Thysanura), revealed that the spatial restriction of these genes was established prior to the evolution of wings and wing diversification (Carroll et al. 1995). These results lead to the proposal that Hox genes were not involved in the wing number regulation of early pterygotes and instead, several wing patterning genes had later come under the control of the Hox genes enabling the reduction in insect wing number we observe today.

Insect wing morphology

Wings have diversified in morphology and function as well as number during insect evolution, for example, the fore- and hindwings of dragonflies are largely indistinguishable whereas the forewings of some beetles are adapted to form its armour. A comparison of the patterning in D. melanogaster and the butterfly Precis coenia may have revealed one

21 way in which insect wing morphology has diversified (Warren et al. 1994). D. melanogaster has a pair of forewings on the second thoracic segment but the hindwings of the third thoracic segment have been reduced into two balancing organs known as halteres. For several decades it had been known that Uhx, regulated the genetic programs by which these homologous structures were differentiated, for example, mutants for the complete loss of Ubx are four-winged (Lewis 1978). It was therefore proposed that the

Ubx gene evolved for the formation of the halteres and consequently without this gene the fly reverts to its ancestral four-winged state. However, Ubx protein was detected during

Drosophila haltere and butterfly hindwing development, which suggested that Ubx expression alone, is insufficient to suppress wing formation (Warren et al. 1994). Instead, it seems likely that the Ubx mutant does not represent a reversal of evolution but rather the failure of the Ubx controlled genetic program in the posterior flight appendage.

Although the role of Ubx in appendage diversification had been established since the

1970s, it is only in the last decade that the genes regulated by Ubx have begun to be identified (Weatherbee et al. 1998, Weatherbee et al. 1999). By contrasting the expression of known patterning genes in the developing Drosophila wing and haltere, the mechanism of Ubx action was uncovered (Weatherbee et al. 1998). This comparative approach revealed that many of the same regulators are active in the wing and haltere, however, the expression patterns of these genes vary between these appendages. There are two ways

Ubx could create a haltere-specific gene network, either by altering a few key regulators at the top of the patterning hierarchies or by influencing genes throughout these pathways.

Mutant Ubx clones within the developing haltere were used to establish that Ubx regulates many different patterning genes and pathways. It therefore appears that the haltere in

Drosophila evolved through the development of interactions between Ubx and patterning genes at multiple levels within the appendage gene network.

Ubx has also been linked to the evolution of appendage diversification in the butterfly

(Weatherbee et al. 1999). Hindwing-to-forewing transformation was observed in a Precis.

22 coenia Ubx mutant, which suggested that Ubx generates the morphological variation between the hind- and fore wings. Furthermore, an examination of changes in gene expression patterns in this mutant identified the downstream targets of Ubx regulation in the butterfly hindwing. By comparison with previous studies in Drosophila (Weatherbee et al. 1998), this work revealed that Ubx regulates different genes in the Drosophila haltere and butterfly hindwing (Weatherbee et al. 1999). It was therefore concluded that the morphological diversity of insect appendages might have evolved in part through changes to the groups of genes regulated by Ubx.

Butterfly wing patterning

A variety of colours and shapes pattern the adult wings of different butterfly species. The eyespot wing pattern, in particular, has received the attention of evolutionary developmental biologists. The eyespot is a circular region of pigmented scales on the fore and / or hindwing. Evolutionary biologists have identified the adaptive value of the eyespot in predator avoidance (Nijhout 1991, Brakefield and Reitsma 1991) and experimental manipulation revealed that the eyespot is controlled by a patterning focus at its centre

(Nijhout 1980, Nijhout 1985). An examination of developmental networks, originally discovered in Drosophila, in the butterfly has successfully identified some of the genes that pattern the eyespot.

It was originally hypothesised that any gene, which was expressed differently between

Drosophila and butterflies, could be hnked to eyespot formation, especially if expression was confined to the foci precursors (Carroll et al, 1994). Distal-less (Dll) expression was detected along the wing margin, as it is other insects, but was additionally uncovered in the same spatial-temporal position as the foci (Carroll et al. 1994, Brakefield et al. 1996). This observation suggested that Dll had been co-opted in the butterfly wing for the formation of eyespots. More recently, expression analysis has identified the redeployment of an entire signalling pathway during eyespot evolution (Keys et al. 1999). Several genes from the

Hedgehog pathway (Hh) have been linked to foci specification in the butterflies, P. coenia

23 and Bicyclus anynana (Keys et al. 1999). In Drosophila, the expression of these genes is restricted to the anterior or posterior of the disc, however, eyespots and their associated patterning genes were observed in both regions of the B. anynana wing (Keys et al.

1999). It was therefore concluded that the regulation of these genes had been modified during eyespot evolution, permitting a change in their spatial expression and the co-option of an entire signalling pathway for eyespot patterning.

Known patterning genes were also examined in the B. anynana wing disc in an attempt to reveal how the range of species-specific multi-ringed eyespots is achieved (Brunetti et al.

2001). Dll, engrailed {en) and spalt {sal) are expressed in concentric rings around the foci, which suggested that they are linked to this type of eyespot patterning (Brunetti et al.

2001). These genes were then investigated in a range of butterfly species with different multi-ringed eyespots in order to determine the mechanism of patterning diversity

(Brunetti et al. 2001). The widths of the Dll, en and sal expression rings varied between species and correlated with the variation in adult eyespot colour rings. It was therefore concluded that eyespot diversity was generated by changes in the response of these regulatory genes to focal signalling (Brunetti et al. 2001). It was also shown that the same regulatory genes control different structural genes in different species, for example, in B. anynana, Vanessa cardui and Lycaeides Melissa, en expression correlates with gold, black and orange rings respectively (Brunetti et al. 2001). This work demonstrated that the evolution of regulatory and structural gene expression established the variation in eyespot patterning we observe today.

Limbless insect abdomen

In addition to wings, three pairs of legs also adorn the thorax of modem insects. Although abdominal appendages are absent in insects, other arthropods possess limbs in this region and it seems likely that insects are derived from species, which had limbs on every tmnk segment (Snodgrass 1935). In D. melanogaster, expression of the Hox genes Ubx and abd-A repress the limb-patteming gene Dll in the abdomen and consequently, no

24 appendages are formed in this region (Vachon et al. 1992, Castelli-Gair and Akam 1995).

However, overlapping expression ofDll and Ubx / abd-A in the developing thoracic limbs of Anemia suggests that Dll is not repressed by Ubx / abd-A in all arthropods

(Panganiban et al. 1995). Either the repression of Dll by Ubx / abd-A has been gained during the evolution of the insects or was present in the ancestor of the arthropods and was later lost in the crustaceans (Palopoli and Patel 1996).

In order to distinguish between these possibilities, Hox gene expression was examined in a myriapod and a member of the Onychophora, which is the sister group of the arthropods

(Grenier et al. 1997). Expression analysis of Ubx / abd-A and Dll in the centipede

Ethmostigmus rubripes and the onychophoran Acanthokara kaputensis revealed that these proteins are present in overlapping domains in developing trunk limbs (Grenier et al.

1997). It therefore seems likely that the repression of Dll by Ubx and abd-A evolved after the insects had diverged from the other arthropods and is a unique feature of the insects.

Comparative studies between insect orders revealed that Dll repression was initially performed by abd-A alone (Palopoli and Patel 1998, Lewis et al. 2000). The expression of

Ubx / abd-A and Dll was examined in the hexapods: Schistocerca americana

(grasshopper) and Tribolium castaneum (beetle) (Palopoli and Patel 1998, Lewis et al.

2000), which possess an appendage, known as the pleuropod, on their first abdominal segment. Rather than repressing appendage development in this region, Ubx expression is concomitant with Dll and is required for pleuropod formation. In the remaining abdominal segments abd-A represses limb formation. It was therefore proposed that Dll was originally repressed by abd-A, however, the loss of all abdominal limbs was later achieved in derived species orders through the evolution of Dll regulatory regions that were also responsive to Ubx.

25 Butterfly abdominal prolegs

Interestingly, an avatism or reversion to a more ancestral state has occurred in the butterfly species, P. coenia. The larvae of this species possess abdominal limbs known as prolegs, which lead to the hypothesis that the regulation of Hox genes or their downstream targets had changed in this butterfly (Warren et al. 1994). Initially, P. coenia Ubx and abd-A expression was detected in comparable regions to Drosophila, and Dll expression was absent in the abdominal segments. However, at later developmental stages Ubx and abd-A expression was repressed in discrete regions of the abdomen and Dll expression was detected in these domains, which form outgrowths from the body wall. These observations indicated that P. coenia prolegs evolved through a change in the regulation of the Hox genes rather than their downstream targets. Abdominal prolegs are also present in the moth, Manduca sexta, however Dll and abd-A are both expressed in the proleg primordia of this species (Zheng et al 1999). This finding implies that atavism has occurred in P. coenia and M. sexta through modifications at different levels of the limb regulatory hierarchy (Lewis 2000).

Drosophila leg patterning

The legs of Drosophila are covered in hairs known as trichomes, which differ in pattern between species. A patch of cuticle without trichomes is observed in the posterior femur of the T2 leg in D. melanogaster and its sister species D. simulans but is absent in the more distantly related D. virilis. Ubx is believed to control this phenotype because clones mutant for Ubx in the naked patch produce trichomes and the presence of trichomes is positively correlated with Ubx dosage (Stem 1998). The size of the naked patch varies between species so that the region of trichome repression is larger in D. simulans than D. melanogaster. In order to uncover the mechanism by which this variation is achieved, heterozygous flies were created with a null Ubx allele from one species and a wild-type allele from the other (Stem 1998). Individuals with a wild type D. simulans Ubx allele had a larger naked patch than those with the D. melanogaster allele. This result indicated that

26 changes in the cw-regulatory region of the Ubx gene had contributed to the evolution of the interspecies variation in this trait.

Limitations of the candidate gene approach

Investigations of insect leg and wing evolutionary developmental biology illustrate the power of the candidate gene approach. Although this methodology has been informative, there are limitations to this approach, which should also be noted (Palopoli and Patel

1996). Firstly, there is an obvious bias in the genes examined. Analysis will be restricted to genes known to be involved in patterning and previously uncharacterised genes will not be investigated. Secondly, this approach will only reveal the stages of developmental pathways that have changed during evolution. The specific genetic modifications, which have brought about these changes, will remain unknown, for example, we do not know which nucleotides have altered within the cw-regulatory region of Ubx to bring about interspecies variation (Stem 1998).

1.2.3 Quantitative trait locus (QTL) mapping

Some researchers, investigating the evolutionary developmental biology of quantitative traits, have employed an alternative approach. Quantitative traits, such as bristle number, wing shape and longevity, exhibit continuous variation within a population. Quantitative trait locus (QTL) mapping is used to pinpoint the number and identity of genes, which lead to the inter- and intraspecies variation within these traits (Mackay 2001). The use of this methodology is exemplified by investigations into Drosophila bristle number, for example; QTL mapping uncovered the genetic factors, which influence abdominal bristle number in D. melanogaster (Long et al. 1995). 25 generations of divergent artificial selection was used to create two inbred parental strains, which differed in alleles for abdominal bristle number. Crosses between these lines created backcross, F^ and recombinant inbred lines. Consequently, individuals were generated which contained different proportions of the parental genomes. A polymorphic cytogenetic marker was

27 then used to identify the genomic regions, which correlated with bristle number variation.

Statistical tests revealed that a small number of segregating loci had a significant effect on bristle number.

Unlike the candidate gene approach, there is no bias in the genomic regions identified by

QTL mapping. However, there are several other limitations to this method. Firstly, different statistical models may provide different results (Kao et al, 1999). Further analysis is therefore necessary to confirm the map position of QTLs. Introgression, for example, was used to confirm that a chromosomal region identified during QTL mapping was involved in bristle number (Long et al. 1995, Lyman and Mackay 1998).

Introgression is the transfer of genetic material between different strains and can be achieved by repeated backcrosses. This process was used to move a previously identified chromosomal region from a natural population into near-isogenic lines and consequently enabled the effect of this region on bristle number to be assessed (Lyman and Mackay

1998).

Secondly, the resolution of the maps produced by QTL mapping is restricted by marker density and sample size (Pasyukova et al. 2000). The chromosomal regions identified by

QTL will typically be as large as 3 to 10 cM and in regions where recombination is limited; these measurements may represent very large physical distances (Mackay 2001).

Further analysis is therefore required to refine the maps obtained, such as deficiency complementation mapping. If a stock, which is deficient for a particular chromosomal region, fails to complement a QTL, then the deficiency may include the QTL. This technique has been successfully employed to further resolve QTL affecting adult D. melanogaster longevity down to the level of 24 genes (Pasyukova et al. 2000). However, it should be noted that complementation failure might also reflect epistasis between the original QTL and another QTL. Furthermore, deficiency mutants may not be available for every QTL.

28 1.2.4 Candidate gene approach and QTL mapping combined

Theoretically, all the genes within a chromosomal region identified by QTL mapping could be examined in order to identify the gene of interest. However, this approach is impractical when large recombination distances are involved. Instead, it is common to investigate candidate genes within the region, for example, around 8 out of 10 chromosomal regions identified by bristle number QTL mapping contain at least one gene known to be involved in bristle development (Nuzhdin et al. 1999). At the same time, it should be noted that this type of analysis will be less successful when several genes could be involved in traits, such as longevity, or when the genes have previously uncharacterised pleiotrophic effects

(Mackay 2001).

Ideally, the evolutionary developmental biology of a trait would be examined using the detailed investigation available with the candidate gene approach and the unbiased analysis of QTL mapping. The strength of this combination of methodologies has recently been illustrated during an investigation into butterfly eyespot variation (Beldade et al. 2002). As already described. Dll expression is associated with foci development (Carroll et al. 1995,

Brakefield et al. 1996). B. anynana divergent artificial selection lines were established for eyespot size on the dorsal forewing (Beldade et al. 2002). Expression analysis of these lines identified larger areas of Dll expression associated with the foci of the high selection lines than the low lines. Crosses were consequently performed between the parental lines to establish whether the modification of Dll expression was due to changes within Dll or the genes that regulate Dll expression (Beldade et al. 2002). Polymorphic molecular markers were used to test for an association between the Dll locus and eyespot phenotype.

A correlation was found between eyespot size and the Dll alleles, confirming that modification of Dll itself affected eyespot size.

29 1.2.5 The evolutionary developmental biology of the stalk-eyed fly exaggerated eyespan

It would be preferable to apply the strengths of both QTL mapping and the candidate gene approach to the study of the exaggerated eyespan in stalk-eyed flies. However, although divergent artificial selection lines for male eyespan have been created in Cyrtodiopsis

(Wilkinson et al. 1993), no polymorphic molecular markers have been identified in the

Diopsidae family so far. Initially, it was therefore more practical to investigate the developmental genetics of the exaggerated eyespan by examining the gene expression patterns of known genes in different taxa. Mutagenesis has previously been used to identify the genetics underlying the variation in traits such as bristle number (Clark et al.

1995). However, no mutants of the Diopsidae family have been recorded to date. A comparison of transcripts between the developing head regions of different species via subtractive cDNA cloning or differential display (Sargent and Dawid 1983, Hedrick et al.

1984, Hara gfal. 1991, Liang and Pardee 1992) might provide an unbiased investigation.

However, the developmental stage at which subtraction should be performed is unknown. 1 therefore chose to use the candidate gene approach at first because pre-existing pan- specific probes, which cross-react with a diverse range of species, were available for known regulators of head development.

1 have studied the exaggerated eyespan in two species of the Diopsidae family, C. dalmanni and S. beccarri. These organisms are tractable models for comparative developmental and evolutionary research for several reasons. Firstly, they are experimentally amenable as they may be kept in laboratory conditions and have a short life cycle. Secondly, some of the Diopsidae family phylogeny is known (Fig. 1.3, Baker et al.

2001a). Thirdly, there is inter and intra-species variation in the size of trait (Shilhto 1971a,

Shillito 1971b, Wilkinson and Dodson 1997). Consequently, the mechanisms underlying morphogenesis as well as the diversification of a novel phenotype may be explored.

Finally, these flies are sufficiently closely related to the model organism Drosophila that it

30 is reasonable to apply the developmental knowledge, gained from Drosophila, to the

Diopsidae (Fig. 1.2).

31 1.3 DIPTERAN HEAD DEVELOPMENT

1.3.1 The adult head

Dipteran head morphogenesis has been primarily investigated in Drosophila. I have therefore described the structure of the adult head in Drosophila and any morphological differences in the Diopsidae.

Anterior head

The anterior adult head of D. melanogaster can be broadly divided into the compound eyes, antennae, head capsule and mouthparts (Fig. 1.4) (Bryant 1978). Firstly, the compound eyes, positioned laterally on the head, are composed of around 800 photoreceptor organs or ommatidia and associated bristles. Secondly, the antennae, located on the face in between the compound eyes, are subdivided into three segments from which the arista projects. The first antennal segment is a ring of brown cuticle densely covered in fine long hairs and 5 bristles, whilst an average of 25 bristles adorn the second segment.

Numerous hairs and sensilla cover the light grey bulbous third antennal segment. Thirdly, the head capsule separates the compound eyes, surrounds the antennae and is located dorsal to the mouthparts. The dorsal head vertex lies in between the compound eyes, whilst the region connecting the antennae is known as the prefrons and has a similar appearance to the first antennal segment. These head capsule domains are separated by the ptilinal suture, which is derived from the site of ptilinum. The elastic cuticle of the ptihnum is covered in small raised bases or tubercles and inflates to aid the emergence of the fly from the puparium. Ventral to the compound eyes is the gena, a ridge of cuticle from which the two rows of bristles project. Finally, the mouthparts or proboscis lie ventral to the prefrons with the palpus, which is also covered in sensilla and hairs.

Previous studies have described the head morphology of the Diopsidae (Shillito 1971a,

Feijen 1989). Several features of the stalk-eyed fly head have changed as a consequence of

32 the evolution of the exaggerated eyespan. Firstly, the compound eyes, which are projected on the ends of the eyestalks, are bulbous and contain between 1,500 and 2,600 ommatidia

(Burkhardt and de la Motte 1983, de la Motte and Burkhardt 1983). Secondly, the antennae are also laterally displaced, although they do not differ significantly in structure to D. melanogaster. Finally and most significantly, the relative proportions of the head capsule have changed during the evolution of the hypercephaly, leading to modifications such as the extension of the ptilinal suture laterally along the eyestalks.

Dorsal head capsule

The dorsal and ventral head capsule is expanded in stalk-eyed flies. Whilst the development of the D. melanogaster dorsal head region has received extensive attention, the ventral head region is less well characterised and I have therefore limited my description of the head capsule to the structure of the dorsal region.

The D. melanogaster dorsal head capsule can be divided into three distinct domains in the mediolateral axis due to the presence of characteristic structural elements (Fig. 1.5) (Royet and Finkelstein 1995). The medial territory contains one medial and two lateral simple eyes or ocelli. The large ocellar and postverticle bristles surround the ocelli and the smaller interocellar bristles lie in between them. The ocellar cuticle also has small hairs. The medio-lateral field is composed of the ridged cuticle of the postfrons. The lateral dorsal head area is made up of orbital cuticle, which surrounds each compound eye and is similar to the ocellar cuticle. Three orbital bristles project from this lateral domain on both sides of the head.

Several structural differences between the dorsal head capsule of the Diopsidae and D. melanogaster have also been described previously (Shillito 1971a, Feijen 1989). Firstly, the Diopsidae ocelh he on a prominent tubercle, which is often associated with two hairs but rarely with ocellar bristles. Secondly, the frons and eyestalks may be covered in hairs.

Cyrtodiopsis dalmanni, for example, has long hairs over the face, frons and in rows along

33 the eyestalk. Finally, two prominent bristles are normally associated with the eyestalk, the inter-orbital bristle at the mid-point and the outer-orbital bristle close to the dorsal eye margin. Pseudodiopsis species are unusual in that the inter-orbital bristle is absent. The size of the eyestalk bristles varies between species and in some individuals they project from a tubercle. The inter-orbital bristle of Teleopsis species, for example, is set on a notably raised tubercle.

1.3.2 Structural development of the head capsule

The structural development of the Drosophila head capsule has been extensively studied.

An appreciation of this research was essential to my investigation because the development of the stalk-eyed fly was largely unknown.

Drosophila imaginai discs

The larva of the holometabolus insect, D. melanogaster, undergoes complete metamorphosis during pupation to form the adult fly or imago, which bears little resemblance to the larva. The adult structures of D. melanogaster are derived from sets of cells known as imaginai discs, which are set-aside during embryogenesis. The legs, wings, halteres, genitaha and head region of the imago are all derived from imaginai discs. The epidermis of the adult head is formed by the fusion of the clypeolabral (Gehring and

Seippel 1967), labial (Wildermuth and Hadom 1965) and eye-antennal discs (Haynie and

Bryant 1986). The dorsal head region is derived from the eye-antennal disc and the description, which follows therefore centres on this disc (Haynie and Bryant 1986).

Embryonic origins of theDrosophila eye-antennal disc

Enhancer-trap hnes, with p-galactosidase expression in the presumptive imaginai discs

(1(2)4B7, Bitxetal. 1989, Hartenstein and Jan 1992) were used to track the movement of the disc primordia during Drosophila embryogenesis (Younossi-Hartenstein et al. 1993).

Initially, the primordia of the eye-antennal discs make up two long and narrow stripes of

34 70-80 cells along a depression in the dorsal embryonic head region, which eventually forms the dorsal pouch. Late in embryogenesis, the dorsal pouch shortens and the eye- antennal disc primordia condense into two small clusters of cells, which invaginate from the embryonic epidermis to form a pair of imaginai discs.

Morphology of theDrosophila eye-antennal disc

The eye-antennal discs grow mitotically throughout larval development (reviewed

Postlewaite 1978). As they develop, the discs increase in size and fold into a morphologically complex three-dimensional structure. One day old larvae have oval­ shaped discs but by the second day of development distinct anterior and posterior regions can be distinguished either side of a constriction within the disc (Bodenstein 1950) (Fig.

1.6). The mature disc has two sides: the disc proper, which is a thick and folded columnar epithehum, and the peripodal membrane on the opposite side of the disc, which is a thin and unfolded layer of squamous or cuboidal cells (Milner et al. 1983). This epithelial sack surrounds a cavity known as the disc lumen. The narrow anterior disc region is attached to the cephalopharyngeal skeleton and the broader posterior disc region is linked to the brain.

The discs are also joined to one other via a thin layer of squamous cells known as the interantennal connection (Madavan and Schneidermann 1977, Milner et al. 1984).

Fate map of the Drosophila eye-antennal disc

The primordia of adult structures are located in fixed positions within imaginai discs and consequently a map of adult precursors may be derived. A detailed fate map of the mature eye-antennal disc showing the location of the primordia, which will form adult head structures, was established via in vivo culture (Haynie and Bryant 1986) (Fig. 1.6). The disc was cut into multiple overlapping sections by a combination of anterior-posterior, medial-lateral and circular incisions. This donor tissue was cultured in host larvae and examined for the presence of cuticle and cuticular structures following metamorphosis, which would identify the adult head region it had formedjThese data were then used to deduce a fate map with the precursors of adult structures located in the disc proper.

35 peripodial membrane and disc folds (Fig. 1.6), The adult head is derived from a pair of eye-antennal discs therefore only one half of the adult structures were formed from a single disc.

In summary, the anterior region of the disc proper contains the primordia of the antenna and palpus (Fig. 1.6). Nearly concentric rings of tissue within this region give rise to each of the antennal segments with the primordia of the most distal structure located centrally.

The posterior region of the disc proper includes the eye and head capsule primordia. The primordia of the ventral head were located in the posterior ventral flap whilst precursors of the dorsal head were found dorsally in the posterior portion. It was originally believed that the peripodial membrane did not contribute to the formation of adult structures and instead disintegrated during pupation (Poodry and Schneiderman 1970). However, Haynie and

Bryant (1986) showed that the membrane derives elements of the head capsule. The spatial relationship between adjacent adult structures, rather than direct observation, was used to designate primordia to the peripodial membrane. Cross sections of the disc also revealed that there were sufficient cells in these areas to give rise to head capsule structures, due to a thickening of the peripodial membrane.

The fate map derived by Haynie and Bryant (1986) was extended during a detailed study of the dorsal head vertex (Royet and Finkelstein 1995). Lines with P-galactosidase expression in sensory precursor cells (A 101, Huang et al. 1991) and the primordia of photoreceptors (LI, Mozer and Benzer 1993) were used to identify the precise location of ocelli and bristle precursors in the dorsal head primordium and confirmed the crude map positions produced by Haynie and Bryant (1986) (Royet and Finkelstein 1995). Neither the physical nor the molecular map provided direct evidence for the location of the frons precursors. Instead, they were assumed to lie in between the precursors of the ocelli and orbital bristles, in the same way that they are arranged in the adult head (Royet and

Finkelstein 1995).

36 The enhancer-trap line, which marks the ocelh precursors (LI, Mozer and Benzer 1993), was also used to track the morphogenetic movements of the eye-antennal disc during larval development (Royet and Finkelstein 1995). In early to mid-third instar larvae, ocelh precursors were present at the edge of the dorsal side of the posterior disc portion. At mid- third instar the dorsal side of the posterior portion folded inwards forming the dorsal lateral flap and the ocelh precursors were consequently displaced with the flap edge. By the late third instar, the flap unfolded and the ocelh primordia were relocated to their original position.

The stalk-eyed fly eye-antennal disc

Prior to my investigations, the embryonic origins and fate map of the stalk-eyed fly eye- antennal disc were unknown. However, the morphology of the stalk-eyed fly eye-antennal disc was recently described during a structural comparison of Drosophila and C. whitei using sections of staged pupae (Buschbeck et al. 2001). This study primarily focused on changes in neural development as a consequence of the evolution of eyestalks. However, the stalk-eyed fly eye-antennal disc was briefly described prior to eversion. These authors reported that the posterior disc portion of the stalk-eyed fly is larger than the same region in Drosophila, which probably relates to the greater number of ommatidia in stalk-eyed flies (Buschbeck et al. 2001). Furthermore, it was also observed that the anterior disc portion lies closer to the posterior disc portion in C. whitei than D. melanogaster

(Buschbeck et al. 2001).

1.3.3 Developmental genetics ofD. melanogaster thoracic imaginai discs

Previous investigations of the stalk-eyed fly provide a description of the adult head and some of its structural development. However, before my research was performed, nothing was known about the developmental genetics underlying the morphogenesis of eyestalks or any other structure within stalk-eyed flies. Instead, Dipteran developmental studies had focused upon the model organism, D. melanogaster.

37 In order to appreciate how the Drosophila eye-antennal disc is patterned, it is first necessary to have a general understanding of Drosophila imaginai disc development and how investigation in this field has evolved. An account of all the genes imphcated in the patterning of Drosophila would be superfluous to an understanding of head capsule formation. Instead, a description of the research, which provides the foundation to our current knowledge of Dipteran head development, is provided, with the intention of explaining why certain genes were analysed in relation to the adult head.

Initially, the developmental genetics of the wing and leg disc will be described as our understanding is most advanced in these structures. The relevance of information gained from studies of both the wing and leg disc to the eye-antennal disc is illustrated by homeotic transformations. Homeotic mutants revealed that ventral discs share a common patterning system, for example, ectopic expression of Antennapedia in the antennal region of the Drosophila eye-antennal disc causes antenna to leg transformations (Schneuwly et al. 1987, Gibson and Gehring 1988). A similar situation is also observed between dorsal structures, such as the eye and wing discs.

Fate maps of the wing and leg discs

The wing disc gives rise to the adult mesothoracic body wall (notum and pleura) as well as the wing. In summary, the disc may be divided into three concentric regions with a central domain known as the wing pouch, which will form the wing blade (Bryant 1975, Bryant

1978). Within the wing pouch, either side of the presumptive wing blade, are the primordia of the dorsal and ventral wing surfaces. During metamorphosis, evertion of the wing disc leads to the apposition of the dorsal and ventral surfaces of the wing pouch and the flattened wing blade is created (Fristrom 1969, Bryant 1970).

The leg disc contains concentric rings of tissue, which form the segments of the leg following metamorphosis (Fristrom and Fristrom 1975). The precursors of the distal leg

38 segments are located centrally in the disc whilst the primordia of the body wall are positioned in the disc periphery (Schubiger 1968).

Theoretical models of imaginai disc regional specification

Early studies of cell behaviour during insect appendage and imaginai disc regeneration suggested that growth and patterning were interlinked. When a section of an imaginai disc is removed and regeneration of the disc is encouraged in vivo, the resulting growth will intercalate the missing disc region in a predictable manner, either regenerating absent elements or duplicating existing elements. One explanation for this behaviour is that the missing tissue is regenerated by reference to positional values within the periphery of the remaining disc. The polar co-ordinate model suggested that these positional values were also necessary for normal growth and development (French et al. 1976). It was proposed that cell identities were specified by local cell interactions, which created a map of positional information across the disc. In order to account for the regenerative behaviour observed, these values would be arranged according to a polar co-ordinate system rather like a clock face (Fig. 1.7A). This model not only accounted for growth across the axis of the disc, but also along the proximal-distal axis projecting from the disc. Growth in these regions would be produced as a consequence of intercalation between radial and circumferential values respectively.

In an alternative model, it was proposed that imaginai disc patterning was generated through interactions at cell boundaries (Fig. 1.7B, Meinhardt 1983, Meinhardt 1991).

According to this hypothesis, a morphogen produced at a cell boundary could specify the regional identity of cells across the disc. Morphogen production would be restricted to a boundary if, for example, cells on one side produced a cofactor necessary for the production of the morphogen on the adjacent side. Positional identity would be specified in relation to the boundary due to a concentration gradient of the morphogen. Although the morphogen would be produced in a symmetric manner across the disc, the response to this substance could differ either side of the boundary. This model also predicted that the

39 proximal-distal axis was generated by the diffusion of the morphogen from a central intersection point. It was originally predicted that the disc was divided into three sectors in order to define this point (Meinhardt 1983). However, it was later suggested that proximal- distal patterning could also occur through the juxtaposition of two boundary axes

(Meinhardt 1991). Unlike the polar co-ordinate model (French et al. 1976), the boundary model provided a hypothesis for the creation of positional values as well as their role in growth and patterning (Meinhardt et al. 1983, Meinhardt et al. 1991).

Compartments within the wing disc

Work performed in the wing disc suggested a mechanism by which the cell border required by the boundary hypothesis could be created. The disc is initially subdivided into anterior and posterior territories known as compartments, which are established in the embryo. Cell lineage studies in the 1970s revealed how this level of patterning was achieved (Garcla-Bellido et al. 1973, Garcia-Bellido 1975). The ancestry of a cell may be traced through mitotic recombination. If an individual is heterozygous for a mutation and chromosome breaks are induced, for example by X-rays, mitotic recombination will occur between homologous chromatids. After mitosis, a cell, which is homozygous for the mutation will be created and following proliferation, a clone of marked cells will form.

This technique was used to show that founding cells and their descendants only establish one particular compartment and that the cells within one compartment will never mix with cells in the neighbouring compartment. Consequently, a compartment boundary is formed between adjacent populations of cells, which could then enable the establishment of a patterning centre as described in the boundary hypothesis (Meinhardt 1983, Meinhardt

1991).

A class of genes known as the compartment selector genes appear to mediate the formation of compartments through cell lineage restriction. The role of the compartment selector gene, en, was originally established in the wing disc (Lawrence and Morata 1976). en mutant clones induced by mitotic recombination in the anterior compartment were

40 normal. However, clones in the posterior of the wing disrupted patterning and did not respect the compartment boundary. It was therefore concluded that en controls the formation of compartments by regulating cell affinities. The subsequent creation of anti-gn probes established the same role for en in the embryo by revealing the expression of en in the posterior of each embryonic compartment (Fjose et a l 1985, Komberg et al. 1985).

Wing discs reflect the compartment pattern in the segment from which they are derived and consequently the posterior compartment of wing discs is also defined by en.

Anterior-posterior patterning of the wing disc

Direct support for the boundary hypothesis has come from molecular genetic analysis of imaginai disc patterning. The anterior-posterior axis of the wing disc is initially set up by the action of en in the posterior compartment (Lawrence and Morata 1976) (Fig. 1.8A).

Within this region en activates hh and posterior cells consequently secrete Hh (Lee et al.

1992, Mohler and Vani 1992, Tabata et al. 1992). The Hh receptor patched (ptc) is expressed throughout the anterior compartment, although ptc intensity is greatest at the compartment border, where it transduces the Hh signal (Philips et al. 1990, Ingham et al.

1991). Hh then activates the long range signalling molecules decapentaplegic {dpp) and wingless (wg) (Easier and Struhl 1994, Tabata and Komberg 1994, Zecca et al. 1995).

Thus, the co-operation of adjacent en / hh and ptc expressing regions is required for dpp and wg activation, as predicted by the boundary hypothesis (Fig. 1.8A).

Once the distribution of the signalling molecules is established, the identity of cells within compartments is specified by gradients of these gene products, which radiate from the compartment boundaries, also in agreement with the boundary hypothesis. Dpp, for example, acts as a pattern organising centre in the wing disc and it is therefore possible to generate local wing duplications through the ectopic expression of en or hh due to the creation of novel sources of Dpp (Capdevila and Guerrero 1994, Ingham and Fietz 1995,

Zecca et al. 1995). Dpp is secreted at the compartment border and diffuses across both sides of the disc, forming a concentration gradient along the anterior-posterior axis that

41 activates different genes in a concentration dependent manner, sal, for example, is only expressed in the centre of the disc where Dpp is highest, optomotor-blind {omb) requires a lower threshold of Dpp for activation and vestigial (vg) is activated at even lower levels of dpp expression (Nellen et al. 1996, Lecuit et al. 1996, De Cells et al. 1996, Kim et al.

1997).

Dorsal-ventral patterning of the wing disc

During the second larval instar, the wing disc is further subdivided across in the dorsal- ventral axis, apterous (ap) is expressed in dorsal cells where it acts as a compartment selector gene and activates ligands of the Notch signalhng pathway (Diaz-Benjumea and

Cohen 1993, Blair etal. 1994, Irvine and Wieschaus 1994). Notch signalling activates wg either side of the dorsal-ventral boundary, which forms a second pattern organising centre through the regulation of downstream genes in the dorsal and ventral compartments

(Philips and Whittle 1993, Couso et al. 1994, Zecca et al. 1996, Neumann and Cohen

1997).

Dorsal-ventral patterning of the leg disc

The anterior-posterior axis of the leg imaginai disc is specified in the same way as the wing disc, en expression, inherited from the embryo, induces the co-expression of hh in posterior compartment of disc (Komberg et al. 1985, Hama et al. 1990, Lee et al. 1992,

Mother and Vani 1992). However, the response to Hh signalling at the anterior side of the compartment boundary is different in the wing and leg discs, dpp expression along the anterior of the boundary is at higher levels in the dorsal-anterior cells than ventral-anterior cells, whilst wg expression is restricted to the ventral-anterior cells (Basler and Stmhl

1994, Diaz-Benjumea et al. 1994) (Fig. 1.8B).

Unlike the wing disc, cell lineage restriction was not observed between the dorsal and ventral leg (Steiner 1976), which suggested that the disc is not defined by a selector gene in this axis. Instead, mutant alleles of wg and dpp revealed that these genes specify ventral

42 and dorsal cell fates respectively (Held et al. 1994). The asymmetric expression of wg along the dorsal-ventral axis is inherited from the embryo (Couso et al. 1993, Cohen et al.

1993). In the absence of wg, anterior cells respond to Hh by producing dpp at equivalent levels in dorsal and ventral cells of the anterior compartment (Brook and Cohen 1996).

Conversely, a reduction in dpp activity leads to a dorsal expansion in wg expression

(Brook and Cohen 1996). It was therefore concluded that the asymmetry of wg expression, originally specified in the embryo, is maintained through the mutant repression of wg and dpp and the disc is patterned along the dorsal-ventral axis in a compartment- independent mechanism (Fig. 1.8B). The same patterning mechanism was also shown to be active in the antennal region of the eye-antennal disc (Theisen et al. 1996).

Proximal-distal patterning of the leg disc

The thoracic imaginai discs are divided along the anterior-posterior and dorsal-ventral axis.

However, a third level of patterning is necessary in the imaginai discs in order to project the appendages from the body wall. In the leg disc, the expression of hh, wg and dpp reflects the circumferential organisation of the polar co-ordinate model and the opposing regions predicted by the boundary model (Fig. 1.8C). Dll is expressed centrally in the precursors of the distal leg where it promotes the formation of limbs (Cohen and Jurgens

1989, Cohen et al. 1989, Diaz-Benjumea et al. 1994). In the embryo. Dll is expressed in cells near the intersection of wg and dpp stripes of expression (Cohen et al. 1993). This observation, combined with the loss of Dll expression in hh, wg or dpp mutants, led to the suggestion that the combined action of these genes was required for the correct expression of the limb field selector gene. Dll (Diaz-Benjumea et al. 1994, Gonzalez-Crespo and

Morata 1996). In addition, clones, expressing wg and lying near the source of the dpp signal, generated the ectopic expression of Dll and created a secondary proximal-distal axis (Diaz-Benjumea et al. 1994). It was therefore concluded that the juxtaposition of wg and dpp along the dorsal-ventral axis activates the region specific expression of Dll necessary for limb formation (Fig. 1.8C).

43 1.3.4 Developmental genetics ofD. melanogaster eye-antennal imaginai disc

Before I describe the patterning of the Drosophila eye-antennal disc, it is first necessary to outline characteristics, which differentiate the thoracic and eye-antennal discs. I will then explain current hypotheses for the regional specification of the eye-antennal disc. Firstly, how groups of cells are selected within the posterior disc portion to form the head capsule or the compound eye. Secondly, the way in which the head capsule is subdivided into dorsal and ventral regions and finally, the genetics underlying the specification of the dorsal head capsule into three structural subdomains.

Distinctions between patterning of the thoracic and eye-antennal discs

The cells allocated to the thoracic and eye-antennal imaginai discs differ in two fundamental ways. Firstly, the eye-antennal disc is derived from multiple embryonic head segments (Younossi-Hartenstein et a i 1993) whereas each of the thoracic (leg, wing and haltere) discs is derived from cells within a single segment (Bate and Martinez-Arias

1991). The number and identity of contributory segments to the eye-antennal disc has been a source of debate (discussed Finkelstein and Perrimon 1991, Jurgens and

Hartenstein 1993). The gynander technique, used to form a probability distribution of anlagen, originally suggested that the disc was derived from within a single embryonic head segment (Struhl 1981, Haynie and Bryant 1986). However, this proposal was disproved using an enhancer-trap line (1(2)4B7, Bier et al. 1989, Hartenstein and Jan

1992), which revealed the embryonic origin of the eye-antennal disc primordia in relation to the head segments (Younossi-Hartenstein etal. 1993). Prior to compression of the disc primordia during shortening of the dorsal pouch, the presumptive disc spans several embryonic segments and consequently, cells from multiple segments are incorporated in the disc.

Clonal analysis also revealed that compartmental restriction only occurs in the antennal region of the eye-antennal disc and that, unlike the thoracic discs, compartmentalisation

44 does not occur until late third instar (Morata and Lawrence 1978, Morata and Lawrence

1979). Furthermore, the early eye-antennal disc does not express the compartment selector gene, en (Hama et al. 1990). Both these observations indicated that régionalisation of the eye-antennal imaginai disc would be achieved in a different way to the thoracic discs. As regional specification did not appear to be established via selector-gene mediated compartmentahsation, the role of other genes known to play a role in imaginai disc development was investigated instead.

Anterior-posterior patterning of the eye-antennal disc

The cephalic gap geneorthodenticle (otd) was originally linked to embryonic patterning as mutant alleles of the gene caused head defects in the embryo and larvae (Wieschaus et al.

1984, Cohen and Jurgens 1990, Finkelstein and Perrimon 1990). otd was also shown to be involved in later developmental stages through the examination of viable otd mutants, which have disturbed ocellar bristles in the adult head (Finkelstein et al. 1990).

Furthermore, immunohistochemistry revealed that Otd is distributed in a spatially restricted pattern of the third instar eye-antennal disc (Wieschaus et al. 1992). These observations lead to the investigation of otd, firstly in the development of the dorsal head capsule (Royet and Finkelstein 1995, Royet and Finkelstein 1996) and subsequently, in the regional specification of the eye-antennal disc (Royet and Finkelstein 1997).

As a downstream target of otd in the embryo, it was proposed that wg might also be involved in adult head development (Royet and Finkelstein 1996). The role of otd and wg in head capsule development was investigated using immunohistochemistry (Royet and

Finkelstein 1997). It was revealed that otd and wg are expressed all over the second instar eye-antennal disc. However, by the early third instar, the expression of otd and wg is restricted to the anterior of the posterior disc portion, in the precursors of the head capsule

(Baker 1988, Wieschaus et al. 1992, Royet and Finkelstein 1996). The mechanism, by which this restriction was achieved, was revealed through the investigation of hh and dpp using enhancer-trap lines (Royet and Finkelstein 1997) (Fig. 1.9A).

45 dpp and hh, had already been described as patterning genes in the wing and leg disc and the genes were also known to be involved in eye development (Heberlein et al. 1993). In the second instar disc hh expression was detected in the posterior edge of the disc whilst in the third instar disc, dpp expression was observed in a horseshoe shape along the ventral, posterior and dorsal edges of the posterior portion (Royet and Finkelstein 1997).

The regulatory interaction between these genes was revealed through the examination of dpp expression, using an enhancer-trap line, in an hh temperature sensitive allele {hh!'^)

(Royet and Finkelstein 1997). No dpp expression was detected in the absence of hh, suggesting that activation ofdpp was dependent on early hh expression along the posterior edge of the second instar disc.

Interestingly, the anterior edge of dpp expression abutted but did not overlap the distribution of Wg and Otd in the dorsal head primordia (Royet and Finkelstein 1997).

These results suggested that dpp expression might restrict the location of Wg and Otd to the anterior of the disc portion and therefore enable eye development in the posterior of the disc. This hypothesis was confirmed and extended using the dpp mutant, dpp‘^'^^'", as homozygous individuals have reduced dpp activity (Masucci et al. 1990). The eyes of mutant flies were replaced by frons from the dorsal head capsule and immunohistochemistry revealed that otd and wg expression had expanded posteriorly

(Royet and Finkelstein 1997). Conversely, removal of wg expression using a temperature sensitive allele, lead to the expansion of eye tissue at the cost of dorsal head cuticle (Ma and Moses 1995). These results suggested that the complementary domains of dpp and w g/otd expressing cells could be maintained by mutual repression in a similar manner to the subdivision of the leg disc. However, unlike the leg primordia, wg expression in the eye-antennal disc is hh independent as shown by the expanded wg expression in the third instar disc of a hh temperature sensitive allele (Royet and Finkelstein 1997).

46 In summary, the subdivision of the eye-antennal posterior disc portion along the anterior- posterior axis is achieved through the régionalisation of wg and otd, which are initially expressed all over the eye-antennal disc (Fig. 1.9A). The confinement of wg and otd expressing cells to the anterior of the posterior portion is brought about by dpp, which is activated by hh in the posterior of the disc. The subsequent subdivision of the posterior portion may then be maintained by the mutual repression of dpp and wg / otd expressing cells. As a consequence of these interactions, the precursors of the head capsule are restricted to the anterior region of the posterior portion enabling eye tissue differentiation in the posterior of the same disc portion.

Dorsal-ventral patterning of the eye-antennal disc

The posterior disc portion is also divided into dorsal and ventral subregions. This subdivision determines the correct patterning of the ommatidial precursors, which will give rise to the adult compound eye. Additionally, in the anterior of the posterior disc portion, the head capsule primordium is also separated into dorsal and ventral territories. Without compartmentalisation, it had been suggested that a gradient of wg determined dorsal- ventral patterning (reviewed Reifegerste and Moses 1999). However, differential gene expression of pannier, homothorax and the iroquois-complex genes (Fig. 1.9B) has recently been observed in the dorsal and ventral halves of the disc suggesting an alternative mechanism for regional specification.

The role of pannier ipnr), a GAGA-family transcription factor, in patterning had previously been identified in the wing disc where it specifies the expression of proneural genes (Ramain et ah 1993, Garcia-Garcia et ah 1999). In the notum, it was shown that pnr regulates the expression of wg (Calleja et al. 1996, Garcia-Garcia et al. 1999) and the distribution of pnr expressing cells was therefore examined in the eye-antennal disc

(Maurel-Zaffran and Treisman 2000). In the embryo, pnr transcripts were identified in the dorsal regions of the posterior disc portion primordia (Heitzler et al. 1996, Ramain et al.

1993, Maurel-Zaffran and Treisman 2000). This dorsal restriction of expression was also

47 observed at the third instar stage where the distribution of pnr transcripts coincides with the dorsal expression of wg (Maurel-Zaffran and Treisman 2000). The regulatory interaction between these genes was identified through the creation of pnr mutant clones.

Dorsal wg expression was lost in these flies whereas over expression of pnr, using an eye- specific enhancer {eyeless), led to wg expression throughout the posterior portion. This result suggested that pnr positively regulates wg on the dorsal side of the posterior disc portion.

homothorax (hth) had previously been shown to control ventral photoreceptor and head structure differentiation (Casares and Mann 1998, Pai et al. 1998) and consequently, was proposed as a ventral counterpart to pnr. Immunohistochemistry revealed that hth is expressed along the anterior region of the third instar posterior disc portion in overlapping domains to wg (Pichaud and Casares 2000). Although hth is expressed on both sides of the disc, mutant hth clones only led to a reduction in wg expression ventraUy, which confirmed that hth is a positive regulator ofwg in this region (Pichaud and Casares 2000).

The iroquois-complex genes {iro-C) are only expressed in the dorsal half of the posterior disc portion in all larval instars (McNeil et al. 1997, Dominguez and de Celis 1998,

Cavodessi et al. 1999, Pichaud and Casares 2000). This complex of genes were originally shown to determine the polarity of dorsal ommatidia as well as the dorsal-ventral midline which acts as a patterning centre of the eye region (Choi and Choi 1998, Dominguez and de Celis 1998, Papayannopoulos et al. 1998, Cavodeassi et al. 1999). Overexpression of pnr using an eyeless driver causes the ventral expansion of the iro-C gene, mirror

(Maurel-Zaffran and Treismann 2000). It was therefore concluded that pnr acts upstream of the iro-C driving its dorsal expression. Some authors suggested that the iro-C are dorsal-selector genes of the eye-antennal disc and may create a dorsal-ventral patterning centre for the head capsule as well as the eye (Cavodeassi et al. 2000). Support for this hypothesis comes from the examination of iro-C mutant clones. In such clones, adult dorsal head regions were replaced by ventral tissue (Pichaud and Casares 2(XX),

48 Cavodeassi et al. 2000). Furthermore, overexpression of iro-C using eyeless and dpp drivers led to ventral-to-dorsal transformations (Cavodeassi et al. 2000). Interestingly, hth and vug expression was unaffected in the iro-C mutant clones (Pichaud and Casares 2000) suggesting that iro-C enforces a dorsal fate on hth expressing cells, which would otherwise produce ventral head structures.

Regional specification across the primordia of the dorsal head capsule

Research into head capsule patterning originally focused on the subdivision of the dorsal head vertex into three domains across the mediolateral axis (Royet and Finkelstein 1995)

(Fig. 1.5). Otd is expressed in the dorsal head anlagen of the eye-antennal disc

(Wieschaus et al. 1992) and the gene was consequently examined in order to determine its role in dorsal head specification (Royet and Finkelstein 1995). ocelliless (oc) and otd mutants both affect the dorsal head vertex (Finkelstein et al. 1990, Royet and Finkelstein

1995). As otd was localised to the same cytological position as oc, an investigation of the genetic relationship between the genes was performed, which revealed that otd is allehc to oc (Finkelstein et al. 1990). A range of otd and oc mutant alleles were examined and graded according to the severity of their mutant phenotype (Royet and Finkelstein 1995).

For example, in flies hemizygous for the strong oc allele (oc^“^) medial and mediolateral head structures are absent and the lateral domain is slightly expanded, whilst in flies, which are hemizygous for the weaker oc allele, oc^' the mediolateral domain is less affected.

Following the investigation of otd expression in the wildtype third instar dorsal head vertex primordia, it was apparent that the protein is distributed in a graded fashion, with higher levels in the medial precursors than the primordia of the lateral structures (Royet and Finkelstein 1995). Furthermore, otd expression is absent in the dorsal head primordia of oc^“‘ flies and merely reduced in oc^ flies. These observations suggested that otd specified regional identity in the head vertex in a concentration dependent manner. This hypothesis was confirmed through the rescue of oc‘ flies with ubiquitous otd expression driven from a heat shock promoter. As the expression of otd increased with the length of

49 the heat shock, progressively medial head structures were rescued. This led to the conclusion that different threshold levels of Otd are required to form the mediolateral domains of the dorsal head capsule.

In the embryo otd specifies thej expression of segment polarity genes (Cohen and Jiirgens

1990, Finkelstein and Perrimon 1990). The expression of wg, hh and en was consequently examined in the eye-antennal disc (Royet and Finkelstein 1996). In early third instar discs wg and hh are expressed, amongst other regions, in the dorsal head primordia whereas en expression is absent from the disc. This illustrated that, unlike the leg disc, hh expression is independent of en in the eye-antennal disc. By late third instar, en and hh are co­ expressed in the precursors of the medial head region and this expression domain is flanked on either side by wg, although 5-10 cells separate the regions. An examination of these genes in the adult head reveals that en and hh expression is present in the ocelli whereas wg is expressed in the orbital cuticle and the ptilinum. It was therefore proposed that the genes specified the different domains of the dorsal head. In order to test this theory temperature sensitive alleles were employed. When hh expression was reduced, the ocelh were also reduced and replaced by frons cuticle. Conversely, the reduction of wg expression caused the lost of lateral and mediolateral structures, and ocelh were consequently situated next to the compound eyes. Furthermore, clones ectopically expressing hh and wg resulted in supernumerary oceUi and an expansion of the frons respectively. These findings confirmed that regional specification of the dorsal head was achieved through hh and wg.

The regulatory interaction between otd and the segment polarity genes within the disc was assessed through the examination of the genes in oc mutant alleles, en expression is absent in oc^ mutant discs (Royet and Finkelstein 1995). However, the ocelh and en expression is restored in these mutants if heat shock driven expression of otd is apphed, which suggested that en acts downstream of otd to specify the ocelh. In oc^“* mutant discs, wg expression expands across the entire dorsal head vertex primordia at the expense of hh

50 expression (Royet and Finkelstein 1996). A similar enlargement of wg expression is observed in the adult head in parallel with the loss of medial and mediolateral structures.

From these results it was therefore concluded that otd régionalisés the expression of hh and wg by maintaining and ehminating the genes respectively. In this way, the correct specification of the three domains of the dorsal head capsule is achieved.

Insights into the mechanisms by which hh and wg achieve regional specification of the dorsal head capsule have come from the examination of Epidermal growth factor receptor

(EGFR) signalling (Amin et al. 1999, Amin and Finkelstein 2000). The Drosophila

EGFR (DER) is activated by the ligand. Vein (Vn), which is expressed in the wing and haltere discs (Simcox et al. 1996). vn is expressed in an adjacent domain to hh in the dorsal head primordia of the eye-antennal disc and is confined to the mediolateral frons cuticle of the adult head (Amin et al. 1999). Mutant vn clones, EGFR alleles and the expression of a dominant negative form of the EGFR (DN-DER) led to a reduction in the size and number of the ocelh and associated bristles, which suggested that the EGFR pathway was involved in medial head patterning (Clifford and Schupbach 1989, Amin et al. 1999). A positive regulatory relationship between hh and EGFR cascade was established using temperature sensitive hh alleles (Amin et al. 1999). The loss of Hh caused a reduction in the expression of vn and a protein kinase of the EGFR cascade whilst the ectopic expression hh, driven by a disc specific enhancer, induced vn expression ectopically. Conversely, the reduction of wg, in temperature sensitive alleles led to the expansion of vn in the dorsal head piimordium, which suggested that vn was negatively regulated by wg.

In summary, these results indicated that hh expression in the medial dorsal head primordium promotes the formation of the ocelh and associated bristles though the activation of the EGFR cascade via vn. The expression of vn is hmited to the mediolateral frons primordium by wg and consequently, the region of EGFR activation is also spatially limited. Interestingly, it has recently been shown that the ehmination of EGFR signalling

51 causes the loss of otd expression and that the constitutive expression of otd rescues the ocelh in flies expressing DN-DER (Amin and Finkelstein 2000). It was therefore proposed that otd is one of the downstream targets of the EGFR pathway activated by Hh signalling, which is originally specified by otd. The authors were keen to emphasise that patterning of the ocelli through the EGFR cascade is only one of the signalhng pathways, which specify the dorsal head primordia and the others have yet to be described.

1.3.5 Developmental genetics of stalk-eyed fly eye-antennal disc

Although the molecular genetics underlying the D. melanogaster head capsule development have been investigated in last decade, prior to my work, nothing was known about the morphogenesis of the stalk-eyed fly head capsule. The aim of my project was to begin to establish a comparable level of understanding in the stalk-eyed fly eye-antennal disc as in Drosophila. I wanted to compare the regional specification of the stalk-eyed fly and Drosophila eye-antennal discs. Any differences between the patterning of these regions might be related to eyestalk development. Alternatively, if the regional specification of the Drosophila and stalk-eyed fly discs was similar, this would suggest that modifications to later developmental stages had occurred during the evolution of the eyestalk. I also wanted to understand the mechanisms underlying eyespan variation between different hypercephalic species. Buschbeck et al. (2001) observed differences in the morphology of C. whitei and D. melanogaster eye-antennal discs. A closer examination of the disc was therefore required to investigate what role any morphological differences play in mediating the formation of eyestalks. In order to address these issues, the number of regulators known to control head morphogenesis would need to be expanded. An improvement in the molecular genetic resources available for the study of the stalk-eyed fly would also be necessary.

52 1.4 THESIS STRUCUTURE

1 have written up some of my experimental work in the form of two manuscripts. Chapter

2 has been published in Evolution and Development (Hurley et al. 2001) and Chapter 3 has been accepted for publication in Development, Genes and Evolution.

The work was in this thesis was funded by the Natural Environment Research Council and was performed under the supervision of Kevin Fowler, Andrew Pomiankowski and Hazel

Smith. The execution of all experiments was by the author. Additional instruction and assistance was received for in vivo culture (R. Nothiger and A. Diibendorfer, University of

Zürich), electron microscopy (M. Turmaine, University College London) and P-element line staining (C. Roberts, University College London).

Chapter 2 investigates the third instar eye-antennal disc morphology and gene expression patterns in Drosophila and two species of stalk-eyed fly. The expression of Dll, en and wg was examined because these genes are key regulators of head development in

Drosophila (Royet and Finkelstein 1996).

Chapter 3 follows up the results of Chapter 2. Chapter 2 used gene expression patterns to uncover the regional specification of the stalk-eyed fly eye-antennal disc. Here, in vitro culture of disc fragments was employed to derive a fate map of the eye-antennal disc.

Chapter 4 was an investigation of the developmental genetics of Drosophila head capsule morphogenesis. A small-scale P-element enhancer trap screen was performed to identify novel regulators through the comparative analysis of sequence and expression data with known genes. Further characterisation was focused on one candidate in order to determine its role in head morphogenesis. These findings were then extended to the study of the stalk-eyed fly exaggerated eyespan.

53 Chapter 5 was part of a long-term strategy to facilitate the investigation of stalk-eyed fly developmental genetics. The molecular genetic tools available to study these species are limited. Consequently, a third instar larval C. dalmanni larval library was created for the generation of probes for in situ hybridisation.

Chapter 6 summarises the findings and potential follow up work of the experimental chapters and relates them to my overall objective of investigating the developmental genetics of exaggerated eyespan in the stalk-eyed fly.

54 Fig. 1.1 Exaggerated morphologies in insects

The head and thoracic horns of the Dynastes neptunus (Coleoptera: Scarabaeidae) (top), the hind legs in Acanthocephala declivis (Hemiptera: Coreidae) (middle) and the eyestalks of Cyrtodiopsis whitei (Diptera: Diopsidae) (bottom) are examples of exaggerated morphologies. Figures adapted from Emlen and Nijhout (2000).

55 Fig. 1.2 Phylogenetic tree of the Acalypterate families (Diptera)

There are eight hypercephalic families within the Acalypterate (shaded). Half of these families lie within one superfamily, the Tephritoidea (boxed). Figure adapted from

McAlpine(1989).

MIcropazidae Neriidae Cypselosomatidae Tanypezidae Strongylophthalmyiidae Psilidae Somatiidae Nothybiidae Megamerlnidae Syringogastridae Diopsidae C onopidae Lonchaeidae Otitldas Platystomatldas Tephrltidae Pyrgotidae Tachlnlscldae RIchardildas Pallopteridae Piophilidae Lauxaniidae Eurychoromylidae Celyphldae Chamaemyiidae Coelopidae Dryomyzidae Helosclomyzidae Sclomyzldae Ropalomeridae S epsidae Clusildae Acartophthalamidae Odiniidae Agromyzidae Fergusoninidae Opomyzidae Anthomyzidae Aulacigastridae Perlsceiididaa Neurochaetidae Teratomyzidae Xenastelldae A steiidae Australimyzidae Braulidae C arnidae Tethlnidae C anacidae Milichiidae Risidae Cryptochetidae Chloropidae Heleomyzidae Mormotomyildae Chyromyidae Sphaeroceridae Curtonotidae Camlllidae Drosophllidae Diastatldae Ephydridae

56 Fig. 1.3 Phylogenetic tree of 33 Diopsidae species

A molecular data set was used to derive a phylogenetic tree of 33 species within the

Diopsidae family. Figure adapted from Baker et al. (2001a).

Diasemopsis dubia Diasemopsis silvatica Diasemopsis obstans Diasemopsis fasciata Diasemopsis signala Diasemopsis sp. W Diasemopsis sp.M Diasemopsis munroi Diasemopsis aibifacies Trichodiopsis minuta Chaetodiopsis meigenii Diasemopsis conjuncta Diasemopsis nebuiosa Diasemopsis aethiopica Diasemopsis eiongata Diasemopsis longipeduncuiata Diasemopsis hirsute Teieopsis breviscopium Teieopsis rubicunda Teieopsis quadriguttata Cyrtodiopsis currani Cyrtodiopsis dalmanni Cyrtodiopsis whitei Cyrtodiopsis quinqueguttata Eurydiopsis argentifera Diopsis apicaiis Diopsis fumipennis Diopsis iongicornis Diopsis gnu Sphyracephaia munroi Sphyracephaia brevicornis Sphyracephaia bipunctipennis Sphyracephaia beccarii Teiogiabrus miileri Teiogiabrus entabenensis

57 Fig. 1.4 Drosophila anterior adult head

compound eye ptilmum

prefrons antenna

gena palpus

proboscis

Fig. 1.5 Drosophila dorsal adult head

ocellar L orbital cuticle If bristle ocellus frons

compound eye ocellar bristle orbital cuticle ptilinum

antenna

58 Fig. 1.6 Drosophila eye-antennal imaginai disc fate map

A fate map of the Drosophila eye-antennal imaginai disc was derived by in vivo culture

(Haynie and Bryant 1986) and expression analysis (Royet and Finkelstein 1995). In the

Drosophila eye-antennal disc (A) and adult head (B) head structures and their primordia are labelled as follows: palpus (light blue), antennae (dark blue), eyes (yellow), ptilinum

(orange), ocellarcuticle(green),frons (purple) and orbital cuticle(red).

g

A

59 Fig. 1.7 Theoretical models of imaginai disc regional specification

(A) The polar co-ordinate model. According to this model the positional information within a field is arranged according to a polar co-ordinate system rather like a clock face.

Figure adapted from French et al. (1976).

c —

9

6

(B) The boundary hypothesis. According to this model the apposition of different cell types at the compartment boundary leads to the release of a morphogen, which specifies the regional identity of cells across the disc in a concentration dependent manner. Figure adapted from Meinhardt (1994).

compartment A compartment B morphogen source

60 Fig. 1.8 Regional specification of theDrosophila thoracic imaginai discs

(A) The regulatory interactions that specify the anterior-posterior axis of the wing disc.

DPP

dorsal

posterior HH <4-EN

ventral

DPP

(B) Specification of the dorsal-ventral axis of the leg disc.

DPPDPP

WGWG

(C) Establishment of the proximal-distal axis of the leg disc.

DPP

DLL HH

WG

Figures adapted from Easier and Struhl (1984) and Theisen et al. (1996). Fig. 1.9 Regional specifîcation of theDrosophila eye-antennal imaginai disc

(A) The regulatory interactions that specify the eye and head capsule domains of the eye-

antennal disc. Figure adapted from Royet and Finkelstein (1997).

wg + otd e wg • dpp

1st instar 2nd instar 3rd instar

(B) Specification of the dorsal-ventral axis of the eye-antennal disc posterior portion.

Figure adapted from Pichaud and Casares (2000) and Maurel-Zaffran and Treisman

(2000).

pnr hth # wg hth wg iro-C iro-C hth + iro-C hth + pnr

62 1.5 REFERENCES

Amin, A. and Finkelstein, R. 2000. Epidermal growth factor receptor signalling activates orthodenticle expression during Drosophila head development. DNA Cell Biol 19: 631-

638.

Amin, A., Li, Y. and Finkelstein, R. 1999. Hedgehog activates the EOF receptor pathway during Drosophila head development. Development 126: 2623-2630.

Averof, M. and Akam, M. 1993. ROM / Hox genes of Artemia: implications for the origin of insect and crustacean body plans. Curr. Biol 3: 73-78.

Baker, N. E. 1988. Embryonic and imaginai requirements for wingless, a segment polarity gene in Drosophila. Dev. Biol. 125: 96-108.

Baker, R. H., Wilkinson, G. S. and DeSalle, R. 2001a. Phylogenetic utihty of different types of molecular data used to infer evolutionary relationships among stalk-eyed flies

(Diopsidae). Syst. Biol 50: 87-105.

Baker, R. H., Ashwell, R. I. S., Richards, T. A., Fowler, K., Chapman, T. and

Pomiankowski, P. 2001b. Effects of multiple mating and male eye span on female reproductive output in the stalk-eyed fly, Cyrtodiopsis dalmanni. Behav. Ecol. 12: 732-

739.

Baker, R. H. and Wilkinson, G. S. 2001. Phylogenetic analysis of sexual dimorphism and eye-span allometry in stalk-eyed flies (Diopsidae). Evolution 55: 1373-1385.

Basler, K. and Struhl, G. 1994. Compartment boundaries and the control of Drosophila limb pattern by hedgehog protein. Nature 368: 208-214.

Bate, M. and Martinez-Arias, A. 1991. The embryonic origin of imaginai discs in

Drosophila. Development 112: 755-761.

Beldade, P., Brakefield, P. M. and Long, A. D. 2002. Contribution of Distal-less to quantitative variation in butterfly eyespots. Nature 415: 315-318.

Bier, E., Vaessin, H., Shepherd, S., Lee, K. McCall, K., Barbel, S., Ackerman, L., Carretto,

R., Uemura, T., Grell, E, Jan, L. Y. and Jan, Y. N. 1989. Searching for pattern and mutation in the Drosophila genome with a F-lacZ vector. Genes Dev. 3:1273-1287.

63 Blair, S. S., Brower, D. L., Thomas, J. B. and Zavortink, M. 1994. The role of apterous in the control of dorsoventral compartmentalization and PS integrin gene expression in the developing wing of Drosophila. Development 120: 1805-1815.

Boake, C. R. B., Deangelis, M. P. and Andreadis, D. K. 1997. Is sexual selection and species recognition a continuum? Mating behavior of the stalk-eyed fly Drosophila heteroneura. Proc. Natl. Acad. Sci. USA 94: 12442-12445.

Bodenstein, D. 1950. The postembryonic development of Drosophila. In: Demerec, M.

(ed) Biology of Drosophila. Wiley, pp 275-367.

Brakefield, P. M., Gates, J., Keys, D., Kesbeke, F., Wijngaarden, P. J., Monteiro, A,

French, V, and Carroll, S. B. 1996. Development, plasticity and evolution of butterfly eyespot patterns. Nature 384: 236-242.

Brakefield, P. M, and Reitsma, N. 1991. Phenotypic plasticity, seasonal climate and the population biology of Bicyclus butterflies (Satyridae) in Malawi. Ecological Entomol. 16:

291-304.

Brook, W. J. and Cohen, S. M. 1996. Antagonistic interactions between Wingless and

Decapentaplegic responsible for dorsal-ventral pattern in Drosophila leg. Science 273:

1373-1376.

Brunetti, C. R., Selegue, J. K, Monteiro, A., French, V., Brakefield, P. M. and Carroll, S.

B. 2001. The generation and diversification of butterfly eyespot color patterns. Curr. Biol.

11: 1578-1585.

Bryant, P. J. 1970. Cell hneage relationships in the imaginai wing disc of Drosophila melanogaster. Dev. Biol. 22: 389-411.

Bryant, P. J. 1975. Pattern formation in the imaginai wing disc of Drosophila melanogaster. Proc. Natl. Acad. Sci. 81: 7485-7489.

Bryant, P. J. 1978. Pattern formation in imaginai discs. In: Ashbumer, M. and Wright, T.

R. F. (eds) The genetics and biology of Drosophila, Vol 2c. Academic Press, New York, pp 230-336.

64 Burkhardt, D. and de la Motte, L 1983. How stalk-eyed flies eye stalk-eyed flies: observations and measurements of the eyes of Cyrtodiopsis whitei (Diopsidae, Diptera). J.

Comp. Physiol A 151: 407-421.

Burkhardt, D. and de la Motte, I. 1985. Selective pressures, vaiiabihty and sexual dimorphism in stalk-eyed Flies (Diopsidae). Naturwissenschaften 72: 204-206.

Burkhardt, D. and de la Motte, I. 1987. Physiological, behavioural and morphomeric data elucidate the evolutive significance of stalk-eyes in Diopsidae (Diptera). Entomol Genet.

12: 221-233.

Burkhardt, D. and de la Motte, I. 1988. Big ‘antlers’ are favoured: female choice in stalk­ eyed flies (Diptera, Insecta), field collected harems and laboratory experiments. J. Comp.

Physiol A 162: 649-652.

Burkhardt, D., de la Motte, I. and Lunau, K. 1994. Signalling fitness: larger males sire more offspring. Studies of the stalk-eyed fly Cyrtodiopsis whitei (Diopsidae, Diptera). J.

Comp. Physiol A 174: 61-64.

Burla, H. 1988. Lek behaviour in Brazilian Zygothrica dispar (Drosophilae). Manuscript.

Buschbeck, E. K. and Hoy, R. R. 1998. Visual system of the stalk-eyed fly, Cyrtodiopsis quinqueguttata (Diopsidae, Diptera): An anatomical investigation of unusual eyes. J.

Neurobiol 37: 449-468.

Buschbeck, E. K., Roosevelt, J. L. and Hoy, R. R. 2001. Eye stalks or no eye stalks: a structural comparison of pupal development in the stalk-eyed fly Cyrtodiopsis and in

Drosophila. J. Comp. Neurobiol 433: 486-498.

Calleja, M., Moreno, E., Pelaz, S. and Morata, G. 1996. Visuahzation of gene expression in living adult Drosophila. Science 274: 253-255.

Capdevila, J. and Guerrero, I. 1994. Targeted expression of the signalling molecule decapentaplegic induces pattern duplications and growth alteration in Drosophila wings.

EMBO J. 13: 4459-4468.

Carroll, S. B., Gates, J., Keys, D. N., Paddock, S. W., Panganiban, G. E. P., Selegue, J. E. and Wilhams, J. A. 1994. Pattern formation and eyespot determination in butterfly wings.

Science 265: 109-114.

65 Carroll, S., Weatherbee, S. D. and Langeland, J. A. 1995. Homeotic genes and the regulation and evolution of insect wing number. Nature 375: 58-61.

Casares, F. and Mann, R. S. 1998. Control of antennal versus leg development in

Drosophila. Nature 392: 723-726.

Castelli-Gair, J. and Akam, M. 1995. How the Hox gene Ultrabithorax specifies two different segments: the significance of spatial and temporal regulation within metameres.

Development 121: 2973-2982.

Cavodeassi, P., Diez del Corral, R., Campuzano, S. and Dominguez, D. 1999.

Compartments and organising boundaries in the Drosophila eye: the role of the homeodomain Iroquois proteins. Development 126: 4933-4942.

Cavodeassi, P., Modolell, J. and Campuzano, S. 2000. The Iroquois homeobox genes function as dorsal selectors in the Drosophila head. Development 127: 1921-1929.

Choi, K. O. and Choi, K. W. 1998. Fringe is essential for mirror symmetry and morphogenesis in the Drosophila eye. Nature 396: 272-276.

Clarke, A. G., Wang, L, and Hulleberg, T. 1995. P-element-induced variation in metabolic regulation in Drosophila. Genetics 139: 337-348.

Clifford, R. J. and Schupbach, T. 1989. Coordinately and differentially mutable activities of torpedo, the Drosophila melanogaster homolog of the vertebrate EGP receptor gene.

Genetics 123: 771-787.

Cohen, B., Simcox, A. A. and Cohen, S. M. 1993. Allocation of the thoracic imaginai primordia in the Drosophila embryo. Development 117: 597-608.

Cohen, S. M., Bronner, G. Kiittner, P., Jiirgens, G. and Jackie, H. 1989. Distal-less encodes a homeodomain protein required for hmb development in Drosophila. Nature

338: 432-434.

Cohen, S. M. and Jiirgens, G. 1989. Proximal-distal pattern formation in Drosophila: Cell autonomous requirement for Distal-less gene activity in limb development. EMBO J. 8:

2045-2055.

Cohen, S. M. and Jiirgens, G. 1990. Gap-like segmentation genes that mediate

Drosophila head development. Nature 346: 482-485.

66 Couso, J. P., Bate, M. and Martinez-Arias, A. 1993. A wingless-dQp&ndQnt polar co­ ordinate system in Drosophila imaginai discs. Science 259: 484-489.

Couso, J. P., Bishop, S. A. and Martinez-Arias, A. 1994. The wingless signalling pathway and the patterning of the wing margin in Drosophila. Development 120: 621-636.

David, P., Hingle, A., Greig, D., Rutherford, A., Pomiankowski, A. and Fowler, K. 1998.

Male sexual ornament size but not asymmetry reflects condition in stalk-eyed flies. Proc.

R. Soc. Lond. B 265: 2211-2216. de la Motte, I. and Burkhardt, D. 1983. Portrait of an Asian stalk-eyed fly.

Naturwissenschaften 70: 451-461.

De Cells, J. P., Barrio, R. and Kafatos, F. C. 1996. A gene complex acting downstream of dpp in Drosophila wing development. Nature 381: 421-424.

DeSalle, R. and Grimaldi, D. 1993. Phylogenetic pattern and developmental process in

Drosophila. Syst. Biol. 42: 458-475.

Descamps, M. 1957. Recherches morphologiques et biologiques sur les Diopsidae du

Nord-Cameroun. Minist. De la France d ’Outre Mer, Dir. Elev. For., Sect. Tech. Agric.

Trop., Bult. Sci. 1: 1-154.

Diaz-Benjumea, F. J., Cohen, B. and Cohen, S. M. 1994. Cell interactions between compartments establishes the proximal-distal axis of Drosophila legs. Nature 372: 175-

178.

Diaz-Benjaminea, F. J. and Cohen, S. M. 1993. Interaction between dorsal and ventral cells in the imaginai disc directs wing development in Drosophila. Cell 75: 741-752.

Dominguez, M. and de Celis, J. F. 1998. a dorsal / ventral boundary established by Notch controls growth and polarity in the Drosophila eye. Nature 396: 276-278.

Emlen, D. J. and Nijhout, H. F. 2000. The development and evolution of exaggerated morphologies in insects. Ann. Rev. Entomol. 45: 661-708.

Feijen, H. R. 1983. Systematics and phytogeny of Centrioncidae, a new Afromontane family of Diptera (Schizophora). Zool. Verh. 202: 1-137.

Feijen, H. R. 1984. A further contribution to the genus Diopsina Curran, 1928 (Diptera:

Diopsidae). Rev. Zool. Afr. 98: 9-34.

67 Feijen, H. R. 1989. Diopsidae. In: Griffiths, G. C. D. E. (ed) Plies of the Nearctic Region.

Shweizerbartsche Veriagsbuchhandlung, Stuttgart, pp 1-122.

Ferrier, D. E. and Holland, P. W. 2001. Ancient origin of the Hox gene cluster. Nat. Rev.

Genet. 2: 33-38.

Finkelstein, R. and Perrimon, N. 1990. The orthodenticle gene is regulated by bicoid and torso and specifies Drosophila head development. Nature 346: 485-488.

Finkelstein, R. and Perrimon, N. 1991. The molecular genetics of head development in

Drosophila melanogaster. Development 112: 899-912.

Finkelstein, R., Smouse, D., Capaci, T. M., Spradling, S. C. and Perrimon, N. 1990. The orthodenticle gene encodes a novel homeodomain protein involved in the development of the Drosophila nervous system and ocellar visual structures. Genes Dev. 4: 1516-1527.

Fjose, A., McGinnis, W. J., Gehring, W. J. 1985. Isolation of a homeo box-containing gene from the engrailed region of Drosophila and the spatial-distribution of its transcripts. Nature 313: 284-289.

French, V., Bryant, P. J. and Bryant, S. V. 1976. Pattern regulation in epimorphic fields.

Science 193: 969-980.

Frey, R. 1928. Philippinische Dipteren. V. Fam. Diopsidae. Not. Entomol. 8: 69-77.

Fristrom, D. 1969. Cellular degeneration in the production of some mutant phenotypes in

Drosophila melanogaster. Molec. Gen. Genet. 103: 363-379.

Fristrom, D. and Fristrom, J. W. 1975. The mechanism of évagination of imaginai discs of

Drosophila melanogaster. Dev. Biol. 43: 1-23.

Garcia-Bellido, A. 1975. Genetic control of wing disc development in Drosophila. Cell

Patterning GIB A symposium 29: 161-183.

Garcia-Bellido, A. 1993. Coming of age. Trends Genet. 9: 102-103.

Garcia-Belhdo, A., Ripoll, P. and Morata, G. 1973. Developmental compartmentahsation of the wing disc of Drosophila. Nature New Biol. 245: 251-253.

Garcia-Garcia, M. J., Ramain, P., Simpson, P. and Modolell, J. 1999. Different contributions of pannier and wingless to the pattering of the dorsal mesothorax of

Drosophila. Development 126: 3523-3532.

68 Gehring, W. and Seippel, S. 1967. Die imaginalzellen des clypeo-labrums und die bildung des rüssels von Drosophila melanogaster. Rev. Suisse Zool. 74: 589-596.

Gibson, G. and Gehring, W. J. 1988. Head and thoracic transformation caused by ectopic expression of Antennapedia during Drosophila development. Development 102: 657-675.

Gonzalez-Crespo, S. and Morata, G. 1996. Genetic evidence for the subdivision of the arthropod limb into coxopodite and telopodite. Development 122: 3921-3928.

Grenier, J. K., Garber, T. L., Warren, R., Whittington, P. M. and Carroll, S. 1997.

Evolution of the entire arthropod Hox gene set predated the origin and radiation of the onychophoran / arthropod clade. Curr. Biol. 7: 547-553.

Grimaldi, D. and Fenster, G. 1989. Evolution of extreme sexual dimorphism: structural and behavioural convergence among broad-headed Drosophilidae (Diptera). Am. Mus.

Nov. 2939: 1-25.

Groombridge, B. 1992. Global biodiversity: status of the earth’s living resources.

Chapman and Hall, London.

Hama, C., Ali, Z. and Komberg, T. 1990. Region-specific recombination and expression are directed by portions of the Drosophila engrailed promoter. Genes Dev. 4: 1079-1093.

Hara, E., Kato, T., Nakada, S., Sekiya, S. and Oda, K. 1991. Subtractive cDNA cloning using oligo(dT)^Q-latex and PCR: isolation of cDNA clones specific to undifferentiated human embryonal carcinoma cells. Nuc. Acids Res. 19: 7097-7104.

Hartenstein, V. and Jan, Y. N. 1992. Studying Drosophila embryogenesis with V-lacZ enhancer-trap lines. Roux’s Arch Dev Biol. 201: 194-220.

Haynie, J. L. and Bryant, P. J. 1986. Development of the eye-antenna imaginai disc and morphogenesis of the adult head in Drosophila melanogaster. J. Exp. Zool. 237: 293-

308.

Heberlein, U., Wolff, T. and Rubin, G. M. 1993. The TGF-P homolog dpp and the segment polarity gene hedgehog are required for propagation of a morphogenetic wave in the Drosophila retina. Cell 75: 913-926.

Hedrick, S. M., Cohen, D. I., Nielsen, E. A. and Davis, M. M. 1984. Isolation of cDNA clones encoding T cell-specific membrane-associated proteins. Nature 308: 149-153.

69 Heitzler, P., Haenlin, M., Ramain, P., Calleja, M. and Simpson, P. 1996. A genetic analysis of pannier, a gene necessary for viability of dorsal tissues and bristle positioning in

Drosophila. Genetics 143: 1271-1786.

Held, L. I. J., Heup, M. A., Sappington, J. M. and Peters, S. D. 1994. Interactions of decapentaplegic, wingless and Distal-less in the Drosophila leg. Roux’s Archiv. Dev.

Biol. 203: 310- 319.

Hennig, W. 1958. Die Famillien der Diptera Schizophora und ihre phylogenetishcen

Verwandtschaftsbeziehungen. Beitr. Entomol. 8: 505-688.

Hingle, A., Fowler, K. and Pomiankowski, A. 2001. Size-dependent female mate preference in the stalk-eyed fly, Cyrtodiopsis dalmanni. Anim. Behav. 61: 589-595.

Holland, P. W. H. 1999. The future of evolutionary developmental biology. Nature 402

(supplement): C41-C44.

Huang, F., Dambly-Chaudiere, C. and Ghysen, A. 1991. The emergence of sense organs in the wing disc of Drosophila. Development. Ill: 1087-1095.

Hurley, I., Fowler, K., Pomiankowski, A. and Smith, H. 2001. Conservation of the expression of Dll, en and wg in the eye-antennal imaginai disc of stalk-eyed flies.

Evolution and Development 3: 408-411.

Ingham, P. W. and Fietz, M. J. 1995. Quantitative effects of hedgehog and decapentaplegic activity on the patterning of the Drosophila wing. Curr. Biol. 5: 432-440.

Ingham, P. W., Taylor, A. M. and Nakano, Y. 1991. Role of the Drosophila patched gene in positional signalling. Nature 353: 184-187.

Irvine, K. D. and Wieschaus, E. 1994. fringe, a boundary-specific signalling molecule, mediates interactions between dorsal and ventral cells during Drosophila wing development. Cell 79:595-606.

Jiirgens, G. and Hartenstein, V. 1993. The terminal regions of the body pattern. In: Bate,

M. and Martinez Arias, A. (eds). The development of Drosophila melanogaster. Cold

Spring Harbor Laboratory Press, pp 687-746.

Kao, C. -H., Zheng, Z. -B. and Teasdale, R. 1999. Multiple interval mapping for quantitative trait loci. Genetics 152: 1203-1216.

70 Keys, D. N., Lewis, D. L., Selegue, J. E., Pearson, B. J., Goodrich, L. V., Johnson, R. L,

Gates, J., Scott, M. P. and Carroll, S. B. 1999. Recruitment of a hedgehog regulatory circuit in butterfly eyespot evolution. Science 283: 532-534.

Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon, A. 1997. Drosophila Mad binds to DNA and directly mediates activation of vestigial by decapentaplegic. Nature

388: 304-308.

Komberg, T., Siden, I., O’Farrell, P. and Simon, M. 1985. The engrailed locus of

Drosophila: In situ locahzation of transcripts reveals compartment-specific expression.

Cell 40: 43-53.

Lande, R. 1982. Rapid evolution of sexual isolation and character divergence in a chne.

Evolution 36: 213-223.

Lande, R. 1986. The dynamics of peak shifts and the pattern of morphological evolution.

Paleobiology 12: 343-354.

Lawrence, P. A. and Morata, G. 1976. Compartments in the wing of Drosophila: A study of the engrailed gene. Dev. Biol. 50: 321-337.

Lecuit, T., Brook, W. J., Ng, M., Sun, H. and Cohen, S. M. 1996. Two distinct mechanisms for long-range patterning by decapentaplegic in the Drosophila wing. Nature

381: 387-393.

Lee, J. J., von-Kessler, D. P., Parks, S. and Beachy, P. A. 1992. Secretion and localized transcription suggest a role in positional signaling for products of the segmentation gene hedgehog. Cell 71: 33-50.

Levine, M., Hafen, E., Garbe, R. L. and Gehring, W. J. 1983. Spatial distribution of

Antennapedia transcripts during Drosophila development. EMBO J. 2: 2037-2046.

Lewis, E. B. 1978. A gene complex controlling segmentation in Drosophila. Nature 276:

565-570.

Lewis, D. L., DeCamillis, M. and Bennett, R. L. 2000. Distinct roles of the homeotic genes

Ubx and abd-A in beetle embryonic abdominal appendage development. Proc. Nat. Acad.

Sci. USA 97: 4504-4509.

71 Liang, P. and Pardee, A. B. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 251 \ 967-971.

Linnaeus, C. 1775. Dissertatio Entomologica, Bigas Insectorium Sistens, etc. Upsaliae.

Long, A. D., Mullaney, S. L., Reid, L. A., Fry, J. D., Langley, C. H. and Mackay, T. F. C.

1995. High resolution mapping of genetic factors affecting abdominal bristle number in

Drosophila melanogaster. Genetics 139: 1273-1291.

Lyman, R. F. and Mackay, T. F. C. 1998. Candidate quantitative trait loci and naturally occurring phenotypic variation for bristle number in Drosophila melanogaster. The

Delta-Hairless gene region. Genetics 149: 983-998.

Ma, C. and Moses, K. 1995. wingless and patched are negative regulators of the morphogenic furrow and can affect tissue polarity in the developing Drosophila compound eye. Development 121: 2279-2279.

Mackay, T. F. C. 2001. Quantitative trait loci in Drosophila. Nat. Rev. Genet. 2: 11-20.

Madavan, M. M. and Schneiderman, H. A. 1977. Histological analysis of the dynamics of growth of imaginai discs and histoblast nests during the larval development of Drosophila melanogaster. Wilhelm Roux’s Arch. Dev. Biol. 183: 269-305.

Masucci, J. D., Miltenberget, R. J. and Hoffmann, F. M. 1990. Pattern-specific expression of the Drosophila decapentaplegic gene in imaginai discs is regulated by 3' cis-regulatory elements. Genes Dev. 4: 2011-2023.

Maurel-Zaffran, C. and Treisman, J. E. 2000. pannier acts upstream of wingless to direct dorsal eye disc development in Drosophila. Development 127: 1007-1016.

McAlpine, D. K. 1979. Agonistic behavior in Achias australis (Diptera, Platystomatidae) and the significance of eye-stalks. In: Blum, M. and Blum, N. (eds) Sexual selection and reproductive competition. Academic Press, New York, pp 221-230.

McAlpine, J. F. 1989. Phylogeny and classification of the Muscomorpha. In: McAlpine, J.

F. (ed) Manual of Nearctic Diptera 3. Agriculture Canasa Monograph 32. Canadian

Government Publications Centre, Quebec, pp 1397-1518.

72 McNeil, H. Yang, C. H., Brodsky, M., Ungos, J. and Simon, M. A. 1997. mirror encodes a novel PBX-class homeoprotein that functions in the definition of the dorsal-ventral border in the Drosophila eye. Genes Dev, 11: 1073-1082.

Meier, R. and Hilger, S. 2000. On the egg morphology and phylogenetic relationships of

Diopsidae (Diptera: Schizophora). J, Zool Evol. Research 38: 1-36.

Meinhardt, H. 1983. Cell determination boundaries as organizing regions for secondary embryonic fields. Dev. Biol. 96: 375-385.

Meinhardt, H. 1991. Determination borders as organizing regions in the generation of secondary embryonic fields: The initiation of legs and wings. Sem. Dev. Biol 12: 129-

138.

Meinhardt, H. 1994. Biological pattern formation: new observations provide support for theoretical predictions. BioEssays 16: 627-633.

Milner, M. J., Bleasby, A. J. and Pyott, A. 1983. The role of the peripodial membrane in the morphogenesis of the eye-antennal disc of Drosophila melanogaster. Roux’s Arch.

Dev. Biol. 192: 164-170.

Milner, M. J., Bleasby, A. J. and Pyott, A. 1984. Cell interactions during the fusion in vitro of Drosophila eye-antennal imaginai discs. Roux’s Arch. Dev. Biol. 193: 406-413.

Mohler, J. and Vani, K. 1992. Molecular organization and embryonic expression of the hedgehog gene involved in cell-cell communication in segmental patterning of Drosophila.

Development 115: 957-971.

Morata, G. and Lawrence, P. A. 1978. Anterior and posterior compartments in the head of

Drosophila. Nature 274: 473-474.

Morata, G. and Lawrence, P. A. 1979. Development of the eye-antenna imaginai disc of

Drosophila. Dev. Biol. 70: 355-371.

Mozer, B. A. and Benzer, S. 1993. Ingrowth by photoreceptor axons induces transcription of a retrotransposon in the developing Drosophila brain. Development. 120: 1049-1058.

Nellen, D., Burke, R., Struhl, G. and Basler, K. 1996. Direct and long-range action of a dpp morphogen gradient. Cell 85: 357-368.

73 Neumann, C. J. and Cohen, S. M. 1997. Long-range action of Wingless organizes the dorsal-ventral axis of the Drosophila wing. Development 124:871-880.

Nijhout, H. F. 1980. Ontogeny of the colour pattern on the wings of Precis coenia

(Lepidoptera: Nymphalidae). Dev. Biol. 80: 275-288.

Nijhout, H. F. 1985. Cautery-induced colour patterns in Precis coenia (Lepidoptera:

Nymphalidae). J. Embryol. Exp. Morphol. 86: 191-203.

Nijhout, H. F. 1991. The development and evolution of butterfly wing patterns.

Smithsonian Institution Press. Washington, D. C.

Nuzhdin, S. V., Dilda, C. L. and Mackay, T. F. C. 1999. The genetic architecture of selection response: inferences from fine-scale mapping of bristle number quantitative trait loci in Drosophila melanogaster. Genetics 153: 1317-1331.

Otte, D. and Stayman, K. 1979. Beetle horns: some patterns in functional morphology. In

Blum, M. S. and Blum, N. A. (eds) Sexual selection and reproductive competition in insects. Academic Press, New York, pp 259-292.

Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T., Bessarab, D. A., Salzberg, A. and

Sun, Y. H. 1998. The Homothorax homeoprotein activates the nuclear locahzation of another homeoprotein, extradenticle, and suppresses eye development in Drosophila.

Genes Dev. 12: 435-446.

Palopoli, M. F. and Patel, N. H. 1996. Neo-Darwinian developmental evolution: can we bridge the gap between pattern and process. Curr. Biol. 6: 502-508.

Palopoli, M. F. and Patel, N. H. 1998. Evolution of the interaction between Hox genes and a downstream target. Curr. Biol. 8: 587-590.

Panganiban, G., Sebring, A., Nagy, L. and Carroll, S. 1995. The development of crustacean limbs and the evolution of arthropods. Science 270: 1363-1366.

Panhuis, T. M. and Wilkinson, G. S. 1999. Exaggerated male eye span influences contest outcome in stalk-eyed flies (Diopsidae). Behav. Ecol. Sociobiol. 46: 221-227.

Papayannopoulos, V., Tomlinson, a., Panin, V. M., Rauskolb, C. and Irvine, K. D. 1998.

Dorsal-ventral signalling in the Drosophila eye. Science 281: 2031-2034.

74 Pasyukova, E. G., Vieira, C, and Mackay, T. F. C. 2000. Deficiency mapping of quantitative trait loci affecting longevity in Drosophila melanogaster. Genetics 156: 1129-

1146.

Philips, R. G., Roberts, I. J. H., Ingham, P. W. and Whittle, J. R. S. 1990. The Drosophila segment polarity gene patched is involved in a position-signalling mechanism in imagainal discs. Development 110: 105-114.

Philips, R. G. and Whittle, J. R. S. 1993. wingless expression mediates determination of peripheral nervous elements in late stages of Drosophila wing development. Development

118: 427-438.

Pichaud, F. and Casares, F. 2000. homothorax and Iroquois-C genes are required for the establishment of territories within the developing eye disc. Mech. Dev. 96: 15-25.

Poodry, C. A and Schneiderman, H. A. 1970. The ultrastructure of the developing leg of

Drosophila melanogaster. Wilhelm Roux’Archiv. 166: 1-44.

Poodry, C. A and Schneiderman, H. A. 1970. The ultrastructure of the developing leg of

Drosophila melanogaster. Wilhelm Roux’Archiv. 166: 1-44.

Postlethwait, J. H. 1978. Clonal analysis of Drosophila cuticular patters. In: (ed.

Ashbumer, M. and Wright, T, R. F. (eds) The genetics and biology of Drosophila vol. 2d,

Academic Press, London, pp 359-441.

Presgraves, D. C., Severence, F. and Wilkinson, G. S. 1997. Sex chromosome meiotic drive in stalk-eyed flies. Genetics 147: 1169-1180.

Ramain, P., Heitzler, P., Haenlin, M. and Simpson, P. 1993. pannier, a negative regulator of achaete and scute in Drosophila, encodes a zinc finger protein with homology to the vertebrate transcription factor GATA-1. Development 119: 1277-1291.

Reifegerste, R. and Moses, K. 1999. Genetics of epithehal polarity and pattern in the

Drosophila retina. BioEssays 21: 275-285.

Royet, J. and Finkelstein, R. 1995. Pattern formation in Drosophila head development: the role of the orthodenticle homeobox gene. Development 121: 3561-3572.

Royet, J. and Finkelstein, R. 1996. hedgehog, wingless and orthodenticle specify adult head development in Drosophila. Development 122: 1849-1858.

75 Royet, J. and Finkelstein, R. 1997. Establishing primordia in the Drosophila eye-antennal

imaginai disc: the roles of decapentaplegic, wingless and hedgehog. Development 124:

4793-4800.

Sargent, T. D. and Dawid, I. B. 1983. Differential gene expression in the gastrula of

Xenopus laevis. Science 222: 135-139.

Schneuwly, S., Klemenz, R. and Gehring, W. J. 1987. Redesigning the body plan of

Drosophila by ectopic expression of the homeotic gene Antennapedia. Nature 325: 816-

818.

Schubiger, G. 1968. Anlagenplan, Determinationzustand und

Transdeterminationsleistungen der mannlichen Vorderbeinscheibe von Drosophila

melanogaster. Roux’ Arch. Entwicklungsmech. 160: 9-40.

Shillito, J. F. 1950. A note on Speiser’s genus Centrioncus and a revised definition of

Diopsidae (Diptera: Acalypteratae). Proc. R. Entomol. Soc. London B 19: 109-113.

ShiUito, J. F. 1971a. The genera of Diopsidae (Insecta: Diptera). Zool. J. Linn. Soc. 50:

287-295.

Shillito, J. F. 1971b. Dimorphism in flies with stalked eyes. Zool. J. Linn. Soc. 50: 297-

305.

Simcox, A. A., Grumbling, G., Schnepp, B., Bennington-Mathias, C., Hersperger, E. and

Sheam, A. 1996. Molecular, phenotypic, and expression analysis of vein, a gene required

for growth of the Drosophila wing disc. Dev. Biol. 177: 475-489.

Snodgrass, R. 1935. Principles of insect morphology. McGraw-Hill, New York.

Spieth, H. T. 1952. Mating behavior within the genus Drosophila (Diptera). Bull. Am.

Mus. Nat. Hist. 99: 399-474.

Steiner, E. 1976. Establishment of compartments in the developing leg imaginai discs of

Drosophila melanogaster. Wilhelm Roux’s Archiv. 180: 9-30.

Stem, D. L. 1998. A role of Ultrabithorax in morphological differences between

Drosophila species. Nature 396: 463-466.

Steyskal, G. 1972. A catalogue of species and key to the genera of the family Diopsidae

(Diptera: Acalypterate). Stuttg. Beitr. Naturkd. Ser. A. 234: 1-20.

76 Stonedahl, G. M. 1986. Stylopomiris, a new genus and three species of Eccritotarsini

(Heteroptera: Miridae: Bryocorinae) from Viet Nam and Malaya. J. New York Entomol

Soc. 94: 226-234.

Struhl, G. 1981. A blastoderm fate map of compartments and segments of the Drosophila head. Dev. Biol 84: 386-396.

Swallow, J. G., Wilkinson, G. S. and Marden, J. H. 2000. Aerial performance of stalk­ eyed flies that differ in eye span. J. Comp. Physiol B 170: 481-487.

Tabata, T., Baton, S. and Komberg, T. B. 1992. The Drosophila hedgehog gene is expressed specifically in posterior compartment cells and is a target of engrailed regulation. Genes Dev. 6, 2635-2645.

Tabata, T. and Komberg, T. B. 1994. Hedgehog is signalling protein with a key role in patterning Drosophila imaginai discs. Cell 76: 89-102.

Templeton, A. R. 1977. Analysis of head shape differences between two interfertile species of Hawaiian Drosophila. Evolution 31: 630-641.

Theisen, H., Haerry, T. E., O’Connor, M. B., and Marsh, J. L. Developmental territories created by mutual antagonism between Wingless and Decapentaplegic. Development 122:

3939-3948.

Vachon, G., Cohen, B., Pfeifle, C., McGuffin, M. E., Botas, J. and Cohen, S. M. 1992.

Homeotic genes of the bithorax complex repress limb development in the abdomen of the

Drosophila embryo through the target geneDistal-less. Cell 71: 437-450.

Val, F. C. 1977. Genetic analysis of the morphological differences between two interfertile species of Hawaiian Drosophila. Evolution 31: 621-629.

Warren, R. W., Nagy, L., Selegue, J., Gates, J. and Carroll, S. 1994. Evolution of homeotic gene regulation and function in flies and butterflies. Nature 372: 458-461.

Weatherbee, S. D., Haider, G., Kim, J., Hudson, A. and Carroll, S. 1998. Ultrabithorax regulates genes at several levels of the wing-patteming hierarchy to shape the development of the Drosophila haltere. Genes Dev. 12: 1474-4782.

77 Weatherbee, S. D., Nijhout, H. F., Grunert, L. W. Halder, G., Galant, R., Selegue, J. and

Carroll, S. 1999. Ultrabithorax function in butterfly wings and the evolution of insect wing patterns. Curr. Biol. 9: 109-115.

Wieschaus, E., Nlisslein-Volhard, C. and Jiirgens, G. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster III. Zygotic loci on the X- chromosome and the fourth chromosome. Wilhelm Rowe's Arch. Dev. Biol. 193: 296-307.

Wieschaus, E., Perrimon, N. and Finkelstein, R. 1992. orthodenticle activity is required for the development of medial structures in the larval and adult epidermis of Drosophila.

Development 115: 801-811.

Wildermuth, H. and Hadom, E. 1965. Differenzierungsleistungen der labial- imaginalscheibe von Drosophila melanogaster. Rev. Suisse Zool. 12: 686-694.

Wilkinson, G. S. 1993. Artificial sexual selection alters allometry in the stalk-eyed fly

Cyrtodiopsis dalmanni (Diptera: Diopsidae). Genet. Res. 62: 213-222.

Wilkinson, G. S. and Dodson, G. N. 1997. Function and evolution of antlers and eye stalks in flies. In: Choe, J. and Crespi, B. (eds) The evolution of mating systems in insects and arachnids. Cambridge University Press, Cambridge, pp 310-328.

Wilkinson, G. S., Kahler, H. and Baker, R. H. 1998a. Evolution of female mating preference in stalk-eyed flies. Behav. Ecol. 9: 525-533.

Wilkinson, G. S., Presgraves, D. C. and Crymes, L. 1998b. Male eye span in stalk-eyed flies indicates genetic quality by meiotic drive suppression. Nature 391: 276-278.

Wilkinson, G. S. and Reillo, P. R. 1994. Female preference response to artificial selection on an exaggerated male trait in a stalk-eyed fly. Proc. R. Soc. Lond. B 255: 1-6.

Yoshimoto, C. M. and Gibson, G. A. P. 1979. A new genus of Eurytomida (Chaleidoidea:

Eurytomidae, Aziminae) from Brazil. Can. Entomol. Ill: 421-424.

Younossi-Hartenstein, A., Tepass, U. and Hartenstein, V. 1993. Embryonic origin of the imaginai discs of the head of Drosophila melanogaster. Rowe's Arch. Dev. Biol. 203: 60-

73.

Zecca, M., Easier, K. and Struhl, G. 1995. Sequential organizing activities of engrailed, hedgehog and decapentaplegic in the Drosophila wing. Development 121: 2265-2278.

78 Zecca, M., Easier, K. and Struhl, G. 1996. Direct and long range action of a Wingless morphogen gradient. Cell 87: 833-844.

Zheng, Z., Khoo, A., Fambrough, D., Garza, L. and Booker, R. 1999. Homeotic gene expression in the wild-type and a homeotic mutant of the moth Manduca sexta. Dev.

Genes Evol. 209: 460-472.

79 2

Conservation of the expressionDll, of en and wg in the

eye-antennal imaginai disc of stalk-eyed flies

80 2.1 SUMMARY

We studied the developmental basis of exaggerated eyespan in two species of stalk-eyed flies (Cyrtodiopsis dalmanni and Sphyracephala beccarri). These flies have eyes laterally displaced at the end of eyestalks, and males have greatly exaggerated eyespan which they use as a sexual display. To investigate eyespan development we have compared eye- antennal disc morphology and the expression of three key regulator genes of Drosophila head development, Distal-less (DU), engrailed (en) and wingless (wg), in the stalk-eyed flies and Drosophila. We found great similarity in the basic division of the disc into anterior-antennal and posterior-eye portions and in the general patterning of Dll, en and wg. Unexpectedly, our results showed that although the eye and antenna are adjacent in adult stalk-eyed flies, their primordia are physically separated by the presence of an intervening region between the anterior and posterior portions of the disc. This region is absent from Drosophila eye-antennal discs. We chose two stalk-eyed fly species which differed in the degree of eyestalk exaggeration but surprisingly found no corresponding difference in the size of the en-wg expression domains that mark the boundaries of the dorsal head capsule primordia. In summary, our expression data establish the regional identity of the eye-antennal disc and provide a framework from which to address the developmental genetics of hypercephaly.

81 2.2 INTRODUCTION

As described in Chapter 1, hypercephaly, in the form of lateral extensions of the head

capsule, is observed in at least eight families of Diptera (Wilkinson and Dodson 1997).

The most extreme examples are seen in the family Diopsidae. All members of this family

show some degree of hypercephaly with both the eyes and the antennae laterally displaced

at the end of long eyestalks. There is considerable variation between species within the

family both in eyespan and the degree of sexual dimorphism in eyespan (Baker et al.

2001a). In several sexually dimorphic species there is evidence for sexual selection

through strong female mate preference for males with exaggerated eyespan (Burkhardt

and de la Motte 1988, Hingle et al. 2001).

The identity and mode of action of the genes that underlie exaggerated sexually selected traits in general, and hypercephaly in particular, are poorly understood. Here, we address the developmental and genetic mechanisms by which the exaggerated morphology of stalk-eyed flies is achieved. We used Drosophila melanogaster as a non-hypercephalic outgroup against which to compare development in two species of stalk-eyed fly:

Cyrtodiopsis dalmanni and Sphyracephala beccarri. Both species of stalk-eyed fly are sexually dimorphic for eyespan but the degree of male exaggeration is far more extreme in

C. dalmanni than S. beccarri. The eyespan to body length ratio in C. dalmanni males is about 2,5 times greater than that of S. beccarri males. The two stalk-eyed fly species are also distantly related within the diopsid phytogeny (Baker et al. 2001a), and so comparison between them is informative about general aspects of development when compared to the Drosophila outgroup.

The genetics and development of the head capsule are well understood in Drosophila.

The Drosophila head is formed from the clypeolabral, labial and eye-antennal discs. The labrum and proboscis are derivatives of the clypeolabral and labial discs, while the eye, antenna, head capsule and maxillary palps are formed by the fusion of a pair of eye-

82 antennal discs (Gehring and Seippel 1967, Wildermouth and Hadom 1965). The regional identity of the eye-antennal disc has been determined by classical fate mapping and using molecular markers (Haynie and Bryant 1986, Royet and Finkelstein 1996).

We examined the expression of three genes that show region-specific expression in

Drosophila eye-antennal discs in stalk-eyed flies. The first of these. Distal-less (Dll), is associated with outgrowths from the body in the proxiomodistal axis and is expressed in the developing antennae (Panganiban et al. 1997). The other two, wingless (wg) and engrailed (en) are expressed in restricted domains across the mediolateral axis of the adult

Drosophila dorsal head capsule and in the disc regions which give rise to these domains

(Royet and Finkelstein 1996). wg is expressed in the orbital cuticle surrounding the compound eyes, whilst en expression is confined to the medial cuticle around the ocelh. It is believed that these genes are involved in specifying head domain identity: wg for lateral elements and en for medial stmctures (Royet and Finkelstein 1996). Loss of wg causes the deletion of lateral elements including the orbital cuticle, while ectopic wg expression causes an expansion of lateral pattern elements at the expense of medial structures such as the ocelli. The en expression domain is eliminated in the imaginai discs of ocelliless (oc) mutants and expanded in those of wg mutants, which develop an enlarged ocellar region.

We compared the expression of the medial head gene en and the antennal-specific gene

Dll in D. melanogaster,S. beccarri and C. dalmanni via immunohistochemistry using pan-specific antibodies. We then cloned part of the C. dalmanni wg gene and examined its expression by in situ hybridisation. We used the expression data that we generated to define the region of the stalk-eyed fly eye antennal disc which gives rise to the dorsal head capsule, including the exaggerated eyestalks, and compared it with the equivalent region in

D. melanogaster.

83 2.3 MATERIALS AND METHODS

2.3.1 Fly stocks and rearing methods

Experimental samples of C. dalmanni were taken from laboratory populations derived from field collections in 1993 near the Gombak River in Malaysia. Stocks of S. beccarri were derived from collections in South Africa in 1993 (gift of G. Wilkinson). Both species have been maintained in population cages containing at least 200 individuals, kept at 25°C on a 12 hour: 12 hour hght: dark cycle, and fed ground sweetcom. Samples of larvae for the experiments were collected as eggs and reared in uncrowded conditions

(David et al. 1998, Baker et al. 2001b) until the late third larval instar or early pupal stages.

The sample of D. melanogaster came from a stock established in 1972 from a collection in Dahomey (now Benin, West Africa). Subsequently this has been maintained on standard sugar-yeast food medium at large population size in cage culture at 25°C and exhibits high levels of genetic variation (Whitlock and Fowler 1999). Samples of late third instar larvae were collected at the wandering stage from the culture bottles.

2.3.2 Scanning electron microscopy

The heads of flies were removed, fixed in 4% paraformaldehyde in phosphate buffered saline (PFA) overnight at 4°C then post-fixed in OSO^dH^O. Following dehydration in an ethanol series, specimens were incubated overnight in iso-amyl acetate at room temperature. The heads were dried in a COj critical point drier, coated in gold and imaging was achieved in a Jeol 5410LV scanning electron microscope.

84 2.3.3 Immunohistochemistry

Larvae were dissected in phosphate buffered saline (PBS, O.IM NaCI, 25mM KCl, lOmM

Na^Hpo^, 2mM KH^PO^, pH7.4), by inverting the heads so that the imaginai discs

remained attached to the cuticle and mouthhooks, and fixed in equal parts 4% PFA and

heptane for 20 minutes. The PFA layer was then replaced with methanol for a brief wash

followed by 3 quick washes in PBS and 2 in PT (PBS + 0.1% Triton X-100). Samples

were incubated overnight at 4°C in primary antibody pre-absorbed against fixed larval heads and diluted in PT. All subsequent procedures were performed at room temperature unless otherwise stated. Samples were washed in PT for 3 x 5 minutes and 3 x 30 minutes, blocked in serum diluted 3:200 in PT for 1 hour then incubated for 2 hours, at 4°C, in anti-mouse or rabbit secondary biotin-conjugated antibody, diluted 1:200 in blocking serum.

Antigen detection was performed using the Vectastain Avidin / Biotin / Alkaline

Phosphatase ABC System (Vector Laboratories) according to the manufacturer's

instructions. Prior to staining, endogenous alkaline phosphatase was removed with 3 x 5 minute washes in NTMT (O.IM NaCl, 0.05M MgClj, O.IM Tris pH 9.5, 0.1% Tween-20,

O.OOIM levamisole). Staining was carried out in NTMT with 0.35% 5-bromo-4-chloro-3- indolyl phosphate and 0.45% nitroblue tétrazolium then discs were dissected away from the cuticle and mounted. Eye-antennal discs were photographed using a compound microscope. The primary antibodies were mouse anti-En mAb 4F11 (gift from N. Patel) used at 1:20 dilution and rabbit anti-Dll (gift from G. Panganiban) used at 1:500 dilution.

2.3.4 Isolation of diopsid-specificwingless sequence

Whole third instar C. dalmanni larvae were frozen in liquid nitrogen, ground to a powder and RNA extracted using an RNAqueous Total RNA Isolation Kit (Ambion) as described in the manufacturer's protocol. Samples were DNase treated and reverse transcriptase

85 polymerase chain reaction (RT-PCR) performed using diopsid specific wg primers (Baker

et a l 2001a): 5' - GTT AGA ACW TGT TGG ATG CG - 3' and 5' CTT TCG ACG ACA

ATC ACT TC - 3'. For the RT step, 1.5 p.g RNA was incubated with 2 |li1 10 x RT buffer

(0.5 M Tris pH 8.0, 60 mM MgCl 2, 0.4 M KCl, 0.1 M Dithiothreitol), 2 |xl 10 mM dNTPs, 1 pi 0.1 nM random hexanucleotides (pd(N)g), 1 pi RNase inhibitor (10 U / pi,

Gibco ERL), 1 pi Superscript'^^ reverse transcriptase (200 U / pi, Gibco ERL) and

DEPC (diethyl pyrocarbonate) H^O up to a total of 20 pi. This reaction was incubated at

42°C for 1 hour then at 75°C for 8 minutes. For PCR, the RT reaction was combined with

8 pi Buffer II (500 mM KCl, 100 mM Tris-HCl pH 9.0), 8 pi 2.5 pM forward and reverse primer, 1 U Taq DNA polymerase (Advanced Biotechnologies) and HjO to a total of 80 pi. The PCR protocol was 3 min. at 94°C, 35 cycles of (30 sec. at 94°C, 45 sec. at

55°C, 1 min. at 72°), 5 min. at 72°C and held at 4°C. PCR was performed on a Gene Amp

PCR system 2400 (Perkin Elmer).

The PCR product was separated from unincorporated nucleotides and primers via agarose gel electrophoresis and isolated using QIAEX II agarose gel extraction kit (Qiagen). The resulting 581 bp product was cloned into a pGEM-T vector (Promega), plasmid DNA prepared (Qiagen plasmid mini kit) and the identity of the insert confirmed via sequencing from the M13 reverse and forward primers in the vector (Cambridge BioScience) (All kits were used according to the manufacturer's instructions).

2.3.5 In situ hybridisation

AH in situ hybridisations used digoxygenin 11-UTP-labeled RNA probes. Diopsid antisense probe (708 bp) was transcribed from the SP6 transcription start site in the vector following digestion with Aat II and sense probe (667 bp) from the T7 start site of Pst I cut vector. Drosophila Dint-1 wg probes were created from p wg C4 (gift from R. Phillips) in which mRNA had been cloned into pNB40 (Brown and Kafatos 1988): sense (923 bp)

86 and antisense (771 bp) probes were transcribed using T7 RNA polymerase (on Clal cut vector) and SP6 RNA polymerase (on PstI cut vector) respectively.

Detection of wg transcripts was performed by in situ hybridisation as described previously

(Phillips et al. 1990) except that inverted larval heads were digested for 2.5 minutes in 10 pg ml ’ proteinase K and hybridised in hybridisation buffer (50% formamide, 5 x SSC,

0.05 mg ml ’ tRNA, 0.05 mg ml ’ heparin, 0.1% Tween 20). Hybridisations with denatured

Diopsid and D. melanogaster specific wingless probes were performed at 56°C overnight and detected via incubation at 4°C overnight with sheep anti-digoxygenin alkaline phosphatase Fab fragments (Boehringer Mannheim) diluted 1:1500. Staining and photography were performed as described for immunohistochemistry above.

87 2.4 RESULTS

2.4.1 Comparison of adult head morphology

In Drosophila the compound eyes occupy most of the head. The antennae he between the eyes and divide the head capsule into dorsal and ventral halves (Fig. 2.1 A). We wih focus on the structure of the dorsal head capsule as this has been best characterised in terms of

gene expression and origins. In Drosophila the most dorsal part of the head capsule can be subdivided into three domains (Fig. 2. IB). The most medial structures are the ocelh or

simple eyes and the surrounding cuticle and bristles. Next to this region, moving outwards, is the mediolateral domain consisting of the paraUel ridged cuticle of the dorsal frons.

Finally, the most lateral region, which surrounds the compound eyes, is the orbital cuhcle, which is smooth but bears a number of large bristles at specified locations. Immediately ventral to the ocellar and frons regions but still dorsal to the antennae is the ptilinum, a region of elastic cuticle. The antennae he ventral to the ptihnum between the compound eyes. The ventral head capsule (ventral to the antennae) includes the shingle cuticle and gena (Fig. 2. IB)

In both species of stalk-eyed flies, the distance between the medial ocelh and lateral orbital structures has been expanded dramaticahy, creating the cylindrical outgrowths or ‘stalks’ from which their name is derived (Fig. 2.IC-H). Both the eyes and the antennae are displaced laterally at the ends of these stalks. Cuticle patterning is not overtly conserved between these flies and Drosophila, for example there is no equivalent of the ridged frons cuticle (Fig. 2. IE and H). In S. beccarri the stalks are short compared with body length

(Fig. 2.1C), and male flies have slightly longer stalks than females. In C. dalmanni the degree of hypercephaly is much more marked. It is coupled to extreme sexual dimorphism, with female eyespan typically being much shorter than male eyespan (Fig.

2.1F-G). 2.4.2 Comparison of eye-antennal disc morphology

The gross morphologies of stalk eyed fly and Drosophila eye antennal discs are similar.

Drosophila eye-antennal discs can be divided into anterior and posterior portions. On either side of the posterior portion are two lateral flaps (Fig. 2.2A). By late third larval instar, the anterior portion of the disc is marked by a series of concentric folds and gives rise to the antennal segments in the adult (Fig. 2.2B). In the posterior portion of the disc under the lateral flaps, ommatidia have begun to differentiate and form a regular array behind the morphogenetic furrow. The dorsal lateral flap gives rise to the dorsal head capsule, including the ocelli, frons and orbital cuticle, while ventral head capsule features such as the shingle cuticle are derived from the ventral lateral flap.

The stalk-eyed fly discs are similarly divided into anterior and posterior portions.

Morphologically the two portions resemble the halves seen in Drosophila discs (Fig.

2.2C-D). As in Drosophila, the anterior portion is folded to form a series of concentric folds while the posterior portion is flanked by two lateral flaps and differentiating ommatidia and a morphogenic furrow are visible (data not shown). However, a third intervening section of disc tissue can be seen in stalk-eyed fly discs which is absent in

Drosophila. This intervening tissue is similar in size in both species of stalk-eyed fly (Fig.

2.2C-D).

2.4.3 Expression ofDll, en and wg in eye-antennal discs

The distribution of Dll and En protein was investigated in the stalk-eyed fly eye-antennal disc using pan-specific antibodies to perform immunohistochemistry (Patel et al. 1989;

Panganiban et al. 1995). In Drosophila third instar imaginai discs. Dll was restricted to the centre of the anterior portion of the disc (Fig. 2.2B) which give rise to the most distal second and third segments of the adult antenna (Panganiban et al. 1997). Consistent with

89 the hypothesis that the anterior portion of the stalk-eyed fly disc corresponds to the

antennal primordia, central restriction of Dll expression was observed in the anterior

portion of the disc in both species of stalk-eyed fly I (Fig.2.2C-D).

In Drosophila third instar discs, En was detected in a sector of the anterior portion. In the

posterior portion. En was strongly expressed in a wedge-shaped patch in the dorsal lateral

flap (arrow Fig. 2.3A), which gives rise to medial head capsule including the ocelli (Royet

and Finkelstein 1996). In addition, there was a faint band immediately behind the

morphogenetic furrow in the posterior portion of the disc (Fig. 2.3A). We examined the

expression of En in stalk-eyed fly eye-antennal discs. No difference was observed in the

distribution of En in the two stalk-eyed fly species discs. En protein expression was

detected in a sector of the anterior portion of the discs of both species and at two sites in

the posterior portion, one in the dorsal lateral flap and the other behind the morphogenetic

furrow (Fig. 2.3B-C). We propose that, as in Drosophila, the En expression domain in the

dorsal lateral flap marks the medial head primordium.

A pan specific antibody was not available for wg. To study the expression of this gene we

cloned a partial C. dalmanni wg cDNA by RT-PCR (Fig. 2.4) and compared wg

expression in this species and Drosophila via in situ hybridisation. In late third instar

Drosophila, wgtranscripts were detected in a wedge-shaped domain in the anterior

portion. In the posterior portion, wg was expressed along the edge of the ventral lateral

flap in the shingle cuticle primordia and in two domains in the dorsal lateral flap (Fig.

2.3D). These domains have been shown to he either side of the en patch and to give rise to

the ptilinium and to the orbital cuticle in the lateral head capsule (Royet and Finkelstein

1996). Examination of wg transcripts in the C. dalmanni eye-antennal disc uncovered a

similar pattern of wg expression in the anterior portion. Likewise, the wg expression pattern was conserved along the edge of the ventral lateral flap of the posterior portion

(Fig. 2.3D-E). In the dorsal lateral flap, also as in Drosophila, wgtranscripts were

localised in two distinct domains separated by a slight gap. (arrows Fig. 2.3D-E). We

90 propose that, as in Drosophila, one of these domains represents the primordium of the orbital cuticle (arrowhead in Fig. 2.3E) and the other the primordium of the ptilinum (pt in

Fig. 2.3E).

91 2.5 DISCUSSION

2.5.1 An examination of gene expression is necessary for the understanding of hypercephaly

We compared the adult head morphology and the development of the eye-antennal disc in a pair of diopsid species with that of Drosophila. The great differences in head

morphology relate to a lateralward expansion of the head capsule causing a great increase

in the distance between medial structures such as the ocelh and the orbital cuticle around

the eyes. Cuticle patterning is not conserved between diopsids and Drosophila. It was,

therefore, not possible to determine which of the domains within the mediolateral axis of

the Drosophila head defined by gene expression had increased in size or whether all had done so to an equal extent.

2.5.2 The expression of the key regulators Drosophila of head development are conserved in stalk-eyed flies

There were no obvious morphological differences between the eye-antennal discs of the two stalk-eyed fly species. Both discs are extremely similar in their general structure to the eye-antennal discs of Drosophila. However, the anterior and posterior parts of the stalk­ eyed fly discs were separated by an intervening region not seen in Drosophila discs (Fig.

2.5).

To further probe this difference, we used gene expression data of three key regulators of

Drosophila head development (Dll, en and wg) to identify the antenna, eye and head capsule primordia within the stalk-eyed fly eye-antennal discs. In the anterior portion of the stalk-eyed fly discs, expression of Dll in the central region and en/wg in adjacent sectors matched the expression of the Drosophila homologues in the future antennal

92 region (Fig. 2.5). En expression in the posterior portion, behind the morphogenetic furrow, confirmed morphological evidence that this part of the disc contained the presumptive eye region. Further distinctions within the posterior portion were possible using Drosophila as a developmental model. The combined pattern of wg and en in the dorsal lateral flap was consistent with this region giving rise to the dorsal head structures, and the expression of wg along the edge of the ventral lateral flap suggested that this part of the disc produces ventral head structures.

2.5.3 Although the eye and antenna are adjacent in adult stalk-eyed flies, their primordia are physically separated by the presence of an intervening region

The striking similarities in expression of all three marker genes in stalk-eyed flies and

Drosophila was quite unexpected given the differences in adult head. None of the genes that we examined were expressed in the intervening tissue, which separates the anterior and posterior parts of stalk-eyed fly discs. Given that this tissue is of similar size in species with very disparate degrees of hypercephaly, it is unclear what role it plays in adult eyestalk development. Our results also show that although the eye and antenna are

adjacent in the adult, their primordia are physically separated in the eye-antennal imaginai disc. It is possible that the intervening Diopsid-specific tissue facihtates the bringing together of these two primordia during metamorphosis, without contributing directly to the

adult eyestalk.

2.5.4 The size of theen-wg expression domains, that mark the boundaries of the

dorsal head capsule primordia, do not vary with the degree of hypercephaly

In Drosophila, wg is expressed in the most lateral (orbital) and en in the most medial

(ocelli) structures of the dorsal head. The expression of these two genes was therefore

expected to mark the lateral and medial boundaries of the dorsal head capsule primordium

93 in stalk-eyed flies. It is thus quite surprising that despite the enormous variation in adult head size between the three fly species, there is no corresponding difference in the size of the en-wg expression domain in the dorsal lateral flap. One explanation may be that the growth that gives rise to the expanded head region in diopsids occurs after the stage at which we assayed gene expression (third instar larvae). We have preliminary evidence in favour of this hypothesis because development of the exaggerated eyestalks of male C. dalmanni is highly sensitive to heat shocks applied during the later prepupal stage

(Bjorksten et al 2001). It is also possible that wg and/or en specify different structures in stalk-eyed flies than they do in Drosophila. To address these issues and further characterise the genetic basis of eyestalk development, a wider range of markers could be analysed during both larval and prepupal development.

94 Fig. 2.1 Dipteran head morphology

Hypercephaly is absent in D. melanogaster (A-B), intermediate in S. beccarri (C-E) and

greatly exaggerated in C.dalmanni (F-H), especially in males (G). The antennae in both

species of stalk-eyed fly, have moved laterally, compared to D. melanogaster, and are

located adjacent to the eyebulb at the distal end of the eyestalk (E and H). Cuticular

markers of different regions of the head capsule in D. melanogaster are illustrated in (B,

adapted from Haynie and Bryant 1986). In the dorsal head ocellar and orbital regions are

characterised by smooth cuticle bearing a number of large sensory bristles at specific

locations. The frons region between these consists of ridged cuticle with no bristles.

Eye stalk cuticle in S. beccarri (E) is smooth but covered in sensory bristles, in C.

dalmanni bristles are widdy spaced and arrayed in rows (H). Ant, antenna and oc, ocelli

Scale bars, 1 mm in B and E, 500 pim in C, and 100 pm in D and G.

compound aye orbital ptilinum cuticle

B

OC ant

(Q

% o

95 Fig. 2.2 Eye-antennal imaginai discs in Drosophila and stalk-eyed flies

In each case, anterior is uppermost and dorsal is to the right. (A) Structure and fate map of D. melanogaster eye-antennal disc. The disc (left) is divided into anterior and posterior portions and the sides of the posterior portion folded over to form the dorsal and ventral lateral flaps (dotted lines). The antenna is derived from the anterior and the eye from the posterior portion. Head capsule structures are derived from the lateral flaps and are coloured to match the corresponding adult structure (see key). In the diagram of the adult head (right) dorsal is uppermost and ventral below. (B-D) Expression of Dll in the third instar eye-antennal discs of D. melanogaster (B), C. dalmanni (C) and S. beccarri

(D) is shown using pan-specific antibodies to perform immunohistochemistry. Note the intervening tissue (brackets) separating the anterior and posterior portions of the discs in the two stalk-eyed flies.

ptilinum

ocelli frons anterior portion orbital cuticle morphogenetic furrow shingle cuticle

p osterior portion

B (0

^

i5

D. melanogaster C. dalmanni S. beccarri

96 Fig. 2.3 Expression ofen and wg in the third instar eye-antennal disc of stalk­ eyed flies

In each case the anterior portion of the disc is at the top and dorsal is to the right. (A-C)

Immunohistochemistry against En protein is shown in D. melanogaster (A), C. dalmanni

(B) and S. beccarri (C). Note En expression in the dorsal lateral flap (arrows). In D. melanogaster this region gives rise to the ocellar cuticle of the medial head capsule. En is also expressed in a sector of the anterior portion of the disc (ant) and in the morphogenetic furrow (mf). (D-E) In situ hybridisation with wg probes is shown in D. melanogaster (D) and C. dalmanni (E). wg is expressed in three domains in the dorsal and ventral lateral flaps associated with the posterior portions of both discs. Staining in the central part of the posterior portion in the C. dalmanni disc (E) is artefactual and also seen with sense probes. In D. melanogaster, one domain (thin arrowheads) of wg expression in the dorsal lateral flap gives rise to the orbital cuticle and one (pt) to the ptilinum. Expression in the ventral lateral flap (s) is confined to the shingle cuticle primordium. Note that the intervening tissue in the C. dalmanni disc (E) is twisted, such that wg expression in the anterior portion of this disc (ant) appears to occupy a broader domain than in the D. melanogaster disc (D).

97 Fig. 2.3 continued

B

m f

V)

pt I ) 4.-I

D. melanogaster C. dalmanni S. beccarri

98 Fig. 2.4 Comparison of the nucleotide sequence ofwingless in Cyrtodiopsis species

The wingless sequence of several Cyrtodiopsis species was originally obtained from genomic DNA (gDNA) (Baker et al. 2001a). Previously, genomic structure had been predicted by the position of the forth and fifth exons in D. melanogaster (Rijsewijk et al

1987). Our sequence data, derived from mRNA, confirm that the predicted intron position in C. dalmanni is correct. The resulting cDNA sequence also partially resolves the identity of a stretch of unknown nucleotides (?) within the C. dalmanni genomic sequence. Upper case letters indicate exonic sequence, lower case letters denote intronic sequence.

dalmanni cDNA TCTAGCAAATTTCCGAGTAATTGGTGATAACCTAAAGGATCGTTTTGATGGAGCATCACG 60] dalmanni gDNA TCTAGCAAATTTCCGAGTAATTGGTGATAACCTAAAGGATCGTTTTGATGGAGCATCACG 60] whitei TCTAGCAAATTTCCGTGTAATTGGTGATAACTTAAAGGATCGTTTTGATGGGGCATCACA 60] currani TCTAGCAAATTTCCGTGTAATTGGTGATAACTTAAAGGATCGCTTTGATGGAGCATCACG 60] quinqueguttata TTTAGCAAATTTTCGTGTAATTGGTGATAATTTAAAGGATCGTTTCGATGGAGCATCACG 60]

dalmanni cDNA CGTTATGGTCAGTCACAATTTACGTCAAAATGGTAACTCAGTCGCCGGAAATGGTATCCG 120] dalmanni gDNA CGTTATGGTCAGTCACAATTTACGTCAAAATGGTAACTCAGTCGCCGGAAATGGTATCCG 120] whitei AGTTATGGTCAGTCACAATTTACGTCAAAATGGTAACTCAGTCGCTGGAAATGGTATCCG 120] currani CGTTATGGTCAGTCACAATTTACGTCAAAATGGTAACTCAGTCGCTGGAAATGGCATCCG 120] quinqueguttata TGTTATGGTCAGTCACAATATGCGTCAAAATGGTAACTCAGTTAATGGGAATGTTATTCG 120]

dalmanni cDNA TGCAAATGCAGCTGTTAAGCAAAGTGTACTGCTTACATCAAATACTCCCAATCCAAATAT 180] dalmanni gDNA TGCGAATGCAGCTGTTAAGCAAAGTGTACTGCTTACATCAAATACTCCCAATCCAAATGT 180] whitei TGCGAATGCAGCTGTTAAACAAAGTGCATTGCTTACATCAAATACTCCCAATCCAAATGT 180] currani CCCGAATGCAGCTGTTAAGCAAAGTGCATTGCTTACATCAAATACTCCCAATCCAAATGT 180] quinqueguttata TCCGAATGCAGCCGTTAAGCAAACTGCATTACTCACATCAAATACTCCCAATCCAAATGT 180]

dalmanni cDNA TTTCGATGCTGAACGTATGGCTAATGATCATATTACCGCCCCTGAGCATGTGAAACATCA 240] dalmanni gDNA TTTCGATGCTGAACGTATGGCTAATGATCATATTACCGCCCCTGAGCATGTGAAACATCA 240] whitei TTTCGATGCTGAACGTATGGCTAATGATCATATTACCGCCCCTGAGCATGTGAAACATCA 240] currani TTTCGATGCTGAACGTATGGCTAATGATCATATTACCGCCCCTGAGCATGTGAAACATCA 240] quinqueguttata TTTTGATGCTGAACGTATGGCAAATGATCATATTACTGCCCCCGAGCATGTGAAACATCA 240]

dalmanni cDNA CCCAAACTTGCCATCTGTAAATAATATTCAGAATCAAAATATTGTGTCACGAAATTCAGT 300] dalmanni gDNA CCCAAACTTGCCATCTGTAAATAATATTCAGAATCA7\AATATTGTGTCACGAAATTCAGT 300] whitei CCCAAACTTGCCATCTGTAAATAATATTCAGAATCAAAATATTGTGTCACGAAATTCAGT 300] currani CCCAAACTTGCCATCTGTAAATAATATTCAGAATCAAAATATTGTGTCACGAAATTCAGT 300] quinqueguttata CCCAAACTTGCCATCTGTAAATAATATGCCAAACCAAAATATTGTATCACGAAATTCGGT 300]

dalmanni cDNA ACGTGAACGGGGACGACAGGGAAGAAAACACAATAG------336] dalmanni gDNA A???????????????????????????????????????????????????tttgaaag 360] whitei ACGCGAACGGGGACGACAGGGAAGAAAACACAATAGgtaggtttataatttctttcaaag 360] cur ran i ACGTGAACGGGGACGACAGGGAAGAAAACATAATAGgtaagtttataattt ctt ttaaag 360] quinqueguttata ACGTGAACGTGGACGACAGGGAAGAAAACACAATAGgtaagcacataattttttgaaaag 360]

dalmanni cDNA ------420] dalmanni gDNA ttgtaaacaaatgttgtgatattgtatgcatataccatatataaaaagtttcatacattt 420] whitei ttgtaaataattgttgtgatattaaatgcataaatataaaaagttgcatacatttttaaa 420] currani ttgtaaacaatttgggtgttattgtatgcataaatataaaaagtttcataaatttttaaa 420] quinqueguttata ttatacaatattataaattgtgatattataagcataaatttataattttatctcatgatt 420]

dalmanni cDNA 480] dalmanni gDNA taaaaacttataacaaaacattatatgtatacgagtatgcacccaaaacaaagctggcta 480] whitei atttataacaaaatattgtatgtatatgagtatgtacccaaaacaaagccggctaacatt 480] currani atttttaacaaaatattgtatgtatacgagtataaatacccaaaacaaagctggctaaca 480] quinqueguttata ttctaaaatttataacaaaatattgtttaaaaagtaccttagaagacctgactaacatat 480]

99 C. dalmanni cDNA ATATCATTTTCAATTAAAACCACATA [540] C. dalmanni gDNA acattcttttccatattgtttttgacattttcagATATCATTTTCAATTAAAACCACATA [540] C. white! cttttccgtattgtttttgacattttcag------ATATCATTTTCAATTAAAACCACATA [540] C. currani ttcctttccgtattgtttttgacattttcag--- ATATCATTTTCAATTAAAACCACATA [540] C. quinqueguttata ttttccgtattgttttgtttttgacatttttag-ATATCATTTTCAATTAAAACCGCATA [540]

C. dalmanni cDNA ATCCTGATCACAAGCCACCAGGACCAAAAGATATAGTGTACTTAGAGAATTCGCCAAGCT [600] C. dalmanni gDNA ATCCTGATCACAAGCCACCAGGACCAAAAGATATAGTGTACTTAGAG?ATTC?CCAAGCT [600] C. white! ATCCTGATCACAAGCCACCAGGACCAAAAGATATAGTGTACTTAGAGAATTCGCCAAGCT [600] C . currani ATCCTGATCACAAGCCACCAGGACCAAAAGATATAGTGTACTTAGAGAATTCGCCAAGCT [600] C . quinqueguttata ATCCTGATCACAAGCCACCAGGACCGAAAGATATAGTGTACTTAGAGAATTCGCCAAGTT [600]

C , dalmanni cDNA TTTGTGAAAAAAATTTAAGACTCGGTATTCAGGGTACACATGGTCGACTGTGTAATGACA [660] C. dalmanni gDNA TTTGTG ?AAAAAATTTAAGACTCGGTATTCAGGGTACACATGGTCGACTGTGTAATGACA [660] C. white! TTTGTGAAAAAAATTTAAGACTCGGTATTCAGGGTACACATGGTCGACTGTGTAATGACA [660] C. currani TTTGTGAAAAAAATTTAAGACTCGGTATTCAGGGTACACATGGTCGACTGTGTAATGACA [660] C. quinqueguttata TTTGTGAAAAAAATTTACGGCTCGGTATTCAGGGTACGCATGGTCGACTGTGTAATGACA [660]

C . dalmanni cDNA CATCAATCGGTGTTGACGGCTGCGATTTAATGTGCTGTGGTCGAGGCTATCGGACACAA [719] C . dalmanni gDNA CATCAATCGGTGTTGACGGTTGCGATTTAATGTGCTGTGGTCGAGGCTATCGGACACAA [719] C, white! CATCAATCGGTGTTGACGGTTGCGATTTAATGTGCTGTGGTCGAGGCTATCGGACACAA [719] C. currani CATCAATCGGTGTTGACGGTTGCGATTTAATGTGCTGTGGTCGAGGCTATCGGACACAA [719] C. quinqueguttata CATCAATCGGTGTTGACGGTTGCGATTTAATGTGCTGCGGTCGAGGCTATCGGACACAA [719]

100 Fig. 2.5 Proposed fate map of head region inC. dalmanni based on marker gene expression

(A) Schematic diagram of the expression of Dll (blue), wg (red) and en (green) in the third instar eye-antennal disc of D. melanogaster and C. dalmanni. Anterior is top and dorsal to the right in both. In D. melanogaster imaginai discs the dorsal head primordium lies between the en and wg domains (bracketed). The equivalent domain in C. dalmanni is marked and appears to be similar in size. (B) Predicted adult derivatives of Dll, wg and en expression domains in D. melanogaster and C. dalmanni. In D. melanogaster the wg expressing domain gives rise to orbital cuticle (red) and the en expressing domain to ocellar cuticle(green). Note that the domain between the ocelli and orbital cuticle is much larger (relative to other parts of the head) in C. dalmanni (bracketed).

D. melanogaster C. dalmanni

Distal-less engrailed wingless

B

101 2.6 REFERENCES

Baker, R. H., Wilkinson, G. S. and DeSalie, R. 2001a. The phylogenetic utility of different types of molecular data used to infer evolutionary relationships among stalk-eyed flies

(Diopsidae). Syst. Biol. 50: 1-20.

Baker, R. H., Ashwell, R. I. S., Richards, T. A., Fowler, K., Chapman, T. and

Pomiankowski, P. 2001b. Effects of multiple mating and male eye span on female reproductive output in the stalk-eyed fly, Cyrtodiopsis dalmanni. Behav. Ecol.12: 732-

739.

Bjorksten, T. A., Pomiankowski, A. and Fowler, K. 2001. Temperature shock during development does not increase fluctuating asymmetry of a sexual trait in stalk-eyed flies.

Proc. R. Sac. Land. 268:B 1503-1513.

Brown, N. H. and Kafatos, F. C. 1988. Functional cDNA hbraries from Drosophila embryos. J. Mol. Biol. 203: 425-437.

Burkhardt, D. and de la Motte, I. 1988. Big 'antlers' are favoured: female choice in stalk­ eyed flies (Diptera, Insecta), field collected harems and laboratory experiments. J. Comp.

Physiol. A 162: 649-652.

David, P., Hingle, A., Greig, D., Rutherford, A., Pomiankowski, A. and Fowler, K. 1998.

Male sexual ornament size but not asymmetry reflects condition in stalk-eyed flies. Proc.

R. Soc. Lond. B.265: 2211-2216.

Gehring, W. and Seippel, S. 1967 Die Imaginalzellen des Clypeo-Labrums und die

Bildung des Ruessels von Drosophila melanogaster. Rev Suisse Zool.74: 589-596.

Haynie, J. L. and Bryant, P. J. 1986. Development of the eye-antenna imaginai disc and morphogenesis of the adult head in Drosophila melanogaster. J. Exp. 237: Zool. 293-

308.

Hingle, A., Fowler, K. and Pomiankowski, A. 2001. Size-dependent male preference in the stalk-eyed fly, Cyrtodiopsis dalmanni. Anim. Behav. 61: 589-595.

Panganiban, G., Irvine, S. M., Lowe, C., Roehl, H., Corley, L. S., Sherbon, B., Grenier, J.

K., Fallon, J. F., Kimble, J., Walker, M., Wray, G. A., Swalla, B. J., Martindale, M. Q. and

102 Carroll, S. B. 1997. The origin and evolution of animal appendages. Proc. Natl Acad. Sci.

US A 94: 5162-5166.

Panganiban, G., Sebring, A., Nagy, L. and Carroll, S. 1995. The development of crustacean limbs and the evolution of arthropods. Science 270: 1363-1366.

Patel, N. H., Martin-Bianco, E., Coleman, K. G., Poole, S. J., EUis, M. C., Komberg, T. B. and Goodman, C. S. 1989. Expression of engrailed proteins in arthropods, annehds, and chordates. Cell 58: 955-968.

Phillips, R. G., Roberts, I. J., Ingham, P. W. and Whittle, J. R. 1990. The Drosophila segment polarity gene patched is involved in a position- signalling mechanism in imaginai discs. Development 110: 105-114.

Rijsewijk, F., Schuermann, M., Wagenaar, E., Parren, P., Weigel, D. and Nusse, R. 1987.

The Drosophila homolog of the mouse mammary oncogene int-l is identical to the segment polarity gene wingless. Cell 50: 649-657.

Roy et, J. and Finkelstein, R. 1996. hedgehog, wingless and orthodenticle specify adult head development in Drosophila. Development 122: 1849-1858.

Whitlock, M. C. and Fowler, K. 1999. The changes in genetic and environmental variance with inbreeding. Genetics 152: 345-353.

Wildermuth, H. and Hadom, E. 1965 Differenzierungsleisteungen der Labial-

Imaginalscheibe von Drosophila melanogaster. Rev. Suisse Zool.72: 686-694.

Wilkinson, G. S. and Dodson, G. N. 1997. Function and evolution of antlers and eye stalks in flies. In: Choe, J. and Crespi, B. (eds) The evolution of mating systems in insects and arachnids. Cambridge University Press, Cambridge, pp 310-327.

103 3

Fate map of the eye-antennal imaginai disc in the

stalk-eyed flyCyrtodiopsis dalmanni

104 3.1 SUMMARY

We established a fate map of the C. dalmanni eye-antennal imaginai disc by cutting it into

fragments and culturing them in vivo following microinjection into host larvae. Diopsid

eye-antennal imaginai discs are divided into anterior and posterior portions, which are joined by a narrow "disc-stalk" of intervening tissue. We have shown that the adult eye

and dorsal head capsule structures, including the eyestalk and the ocelli, are derived from

the posterior portion of the disc, while ventral adult structures such as the antenna and the

palpus are derived from the anterior portion of the disc. Thus both posterior and anterior

disc portions give rise to structures that are widely separated in the adult head. Moreover,

structures that are adjacent in the adult are derived from different regions of the disc.

These results confirm and extend previous conclusions about regional identity in Diopsid

eye-antennal discs that were based on the analysis of molecular markers.

105 3.2 INTRODUCTION

The fate of cells within a primordium, such as the eye-antennal disc, describes the

structures they will form on the adult. A fate map indicates the location of these cells

within the tissue. In Chapter 1, I described the fate map of the D. melanogaster eye-

antennal disc (Haynie and Bryant 1986). There are several ways in which such maps may

be derived. In the preceding chapter, we used a comparative method to determine regional

identities in the eye-antennal disc of stalk-eyed flies. Essentially, we compared disc

morphology and marker gene expression in C. dalmanni and S. beccarri with that in D.

melanogaster, for which the fate map has been well established. The D. melanogaster eye-antennal disc consists of an anterior half which gives rise to the antenna and palpus,

and a posterior half which gives rise to the eye and most of the head capsule (Haynie and

Bryant 1986) (Fig. 3.1). In Chapter 2 we showed that the Diopsid eye-antennal discs are divided into anterior and posterior portions, which are morphologically equivalent to those

seen in D. melanogaster (Fig 3.1). We therefore proposed that the fate map of these disc portions was also the same.

We also compared the expression of marker genes Distal-less {Dll), engrailed {en) and wingless (wg). As in D. melanogaster, the Dll gene, which regulates distal Drosophila

antennal development, is expressed in the anterior portion of the stalk-eyed fly disc. The two other regulator genes, wg and en, mark the lateral and medial boundaries of the

Drosophila dorsal head capsule primordium and are expressed in the posterior portion, and also show conserved patterns in stalk-eyed flies. We assumed that marker gene function was evolutionarily conserved between D. melanogaster and the stalk-eyed fly, for example. Dll was expressed in the disc region which would give rise to the antenna.

Consequently, similarities in the distribution of marker gene expression in the D. melanogaster and stalk-eyed fly discs, further supported our hypothesis that regional identity was conserved between the species examined.

106 Despite this conservation of disc morphology and gene expression, it remains possible that the stalk-eyed fly disc is organised differently from that of D. melanogaster. Firstly, the discs although similar, are not morphologically identical. In D. melanogaster the anterior and posterior halves of the disc are adjacent while in Diopsids a narrow "disc- stalk" of intervening tissue separates anterior and posterior portions. Secondly, insufficient areas of the head capsule / disc are covered by the available genetic markers. For example, in Drosophila none of the three genes described above, are expressed in the part of the disc which gives rise to the mediolateral head capsule (frons) (Chapter 2). Finally, similarities in gene expression may not reflect functional conservation, for example, the expression of Dll in the wing disc of D. melanogaster and Precis coenia marks the wing perimeter and eyespot primordia respectively (Carroll et al. 1994). It would therefore be useful to confirm our fate map of the C. dalmanni eye-antennal disc using a more direct method of establishing regional identity.

One alternative method is direct observation of imaginai discs during their development. It is possible to observe the development of Dipteran imaginai discs in situ by sectioning whole staged larvae and pupae (Madhavan and Schneiderman 1977, Robinow and White

1991, Buschbeck et al. 2001). Alternatively, imaginai disc tissue could be dissected from a series of aged individuals. For example, évagination of the D. melanogaster genital discs was examined by isolating developing tissue from a succession of individuals following puparium formation (Epper 1983) and metamorphosis of the D. melanogaster thoracic discs was also investigated using timed preparations (Zeitlinger and Bohmann 1999, Usui and Simpson 2000). It has been suggested that the morphogenetic movements, which create the adult head capsule, are too complex to examine in situ and it may, therefore, be easier to follow the progression of isolated discs through in vitro culture (Milner and

Haynie 1979). This technique has previously been employed in D. melanogaster to observe metamorphosis of the eye-antennal disc (Milner et al. 1983, Milner et al. 1984).

Unfortunately, the culture conditions required for the growth of stalk-eyed fly imaginai discs have yet to be established.

107 In situ observations are most useful in forming a fate map, when it is possible to identify individual cell populations as they progress through development. Visualisation of gene expression can be used to follow specific sets of precursor cells during metamorphosis in order to determine which adult structures they form. During this process, it would not be necessary to assume an evolutionarily conserved relationship between the expression data in D. melanogaster and the stalk-eyed fly. Instead, the identification of gene expression would simply be used to label certain cell populations. Lines exist with reporter gene expression in subsets of precursor cells, for example, in the primordia of the D. melanogaster dorsal head (AlOl, Huang et al. 1990, Royet and Finkelstein 1995). It is also possible to trace cell hneage by creating clones in D. melanogaster, which express reporter genes in specific areas of developing tissue (Weigmann and Cohen 1999).

Unfortunately, the molecular genetic resources with which to study the stalk-eyed fly are limited. The probes we employed in Chapter 2 would be of hmited value for in situ fate mapping because they would label large populations of cells. No reagents have been identified which cross-react with small subsets of precursors within the C. dalmanni eye- antennal disc and no reporter constructs have been engineered for our study organism.

Consequently, although it may be possible to observe the development of hypercephaly in situ (Buschbeck et al. 2001), without the ability to trace specific cell lineages, it is currently not possible to derive a detailed stalk-eyed fly eye-antennal disc fate map in this way.

A fate map may be deduced by examining the adult structures derived from experimentally manipulated discs. Bryant (1971) removed regions of the imaginai discs from D. melanogaster larvae by in situ surgery. The location of defects, which formed following metamorphosis, revealed the fate of the absent disc regions. Unfortunately, fate maps derived by in situ surgery are imprecise due to the restricted accuracy with which dissection can be performed using this technique and it is therefore preferable to operate on discs in vitro. Ursprung (1957, 1959) derived a map of the genital disc by wounding

108 discrete areas of the disc with an ultra-violet microbeam and recording the position of adult deficiencies. It is equally possible to deduce a fate map by culturing disc fragments in vivo and observing which adult structures are formed following metamorphosis. The primordia of the D. melanogaster head capsule were located on the eye-antennal disc in this way

(Haynie and Bryant 1986) (Chapter 1).

Imaginai discs are cultured in vivo by transplantation into living hosts (Ephrussi and

Beadle 1936, Ursprung 1967). If tissue from a donor third instar larva is microinjected into a larva of the same age and the host then goes through metamorphosis, the abdomen of the emerging fly will contain the donor tissue. The injected disc will also metamorphose due to the hormonal milieu provided by the host. Consequently, when the posterior portion of the D. melanogaster eye-antennal disc was injected into a larva, eye tissue was recovered from the abdomen of the host fly (Gehring 1966, Haynie and Bryant 1986). The transplanted disc fragment metamorphosed normally with, for example, bristles, ommaddia, cuticle and pigment. Unlike in situ imaginai discs, implants rarely evert and instead form hollow vesicles with the adult external cuticle facing inwards. Following dissection of the vesicle, structures, such as bristles, may be used as landmarks with which to identify different adult regions.

The reliability of in vivo culture as a fate mapping method has been confirmed by molecular genetic analysis. For example, the crude location of the sensory primordia in the dorsal head primordia of the D. melanogaster was identified by in vivo culture (Haynie and Bryant 1986) and a detailed investigation of the region, using expression analysis, subsequently confirmed and extended the fate map (Royet and Finkelstein 1995).

However, specific culture conditions must be apphed if this method is to be informative.

The developmental capacity of implanted tissue increases with the age of donor, for example, the first signs of competency in D. melanogaster eye-antennal started in the middle second instar (Gateff and Schneidermann 1975). When using this technique to

109 form a fate map, it is therefore important to ensure that the donor tissue is sufficiently mature to produce all pattern elements.

A fate map can only be created by in vivo culture if disc fragments produce the same set of pattern elements in culture as in situ. If this is tme, we would expect the sum total of structures created by the culture of complementary disc fragments to equal those observed following culture of the whole intact disc. However, there are circumstances in which this condition is not met and the interpretation of the pattern elements produced is therefore more problematic. Imaginai discs can be cultured in the adult abdomen where they wiU grow by cell division. Discs must be cut or damaged for prohferation to occur and consequently, intact eye-antennal discs did not grow in adult hosts (Ginter and Kusin

1969). Long-term cultures can be established indefinitely by transplanting donated tissue between a series of adult hosts. Discs cultured in vivo proliferated but would not metamorphose in the adult abdomen, as the host did not provide a suitable hormonal environment (Bodenstein 1943, Vogt 1944, Postlethwaite and Schneidermann 1970).

However, discs cultured in adult hosts, which are then transferred to larvae, will metamorphose in parallel with the second host. This process is known as short-term culture and provides a means of extending the phase of implant proliferation prior to metamorphosis. Implant growth can also be prolonged using young larval hosts.

Several outcomes are observed when culture methods are used to prologue growth of disc fragments for short periods in culture (2-30 days, Bryant 1978). Cultured fragments can multiply the anlagen that they contain and form two or more bilaterally symmetrical structures, for example, duphcate antennae were observed when the anterior disc portion was cultured (Vogt 1946, Gehring 1966) (Fig. 3.2A). Alternatively, implanted disc portions can regenerate the anlagen in the remainder of the disc and form structures from the entire disc following metamorphosis, for example, the whole eye-antennal disc was regenerated from a culture of the posterior portion in a proximal-distal sequence (Gehring

1972) (Fig. 3.2A). Duplication and regeneration have been referred to as regulation by

110 previous authors (Bryant 1978). In addition, short-term culture can cause a change in determination state from one disc type to another known as transdetermination (reviewed

Hadom 1978), for example, a switch from antenna to leg. The age of the donor has also been linked to the probability that regulation wiU occur, for example, duphcation was observed more frequently when second rather than third instar D. hydei larvae were used

(Vogt 1946). In order to avoid regulation when creating a fate map via in vivo culture it is therefore important to control of the age of the host and donor.

Donor and host age will determine the likelihood of duplication or regeneration but the regulation type is dependent on the fragment transplanted. The ventral and dorsal halves of the D. hydei disc always duplicated and regenerated respectively (Vogt 1946) (Fig. 3.2B).

In D. melanogaster, the anterior portion of the disc duplicated whilst regeneration of the posterior portion was observed (Gehring 1966, Gehring 1972) (Fig. 3.2A). If the anterior disc portion was divided into an anterior half and a posterior half, the sections duplicated and regenerated respectively (Fig. 3.2C). Interestingly, duplication was absent from the anterior portion if it remained attached to part of the posterior portion and no regulation occurred in whole discs (Fig. 3.2D and Fig. 3.2E). In summary, regulation occurs in a predictable fashion: one disc fragment duplicates and the complementary fragment regenerates.

Several theories have been proposed to explain the reciprocity between duplication and regeneration. The polar co-ordinate model stated that regulation type was a consequence of the interaction between normally non-adjacent regions, which were brought together during wound healing (French et al. 1976). This novel interaction then lead to the stimulation of cell proliferation and the interpolation of positional information at the wound site via fate re-specification. A molecular basis for this model was suggested by

Meinhardt (1983, 1991) who proposed that during normal growth, compartment boundaries in imaginai discs acted as patterning organisers through the production of morphogenetic substances. New intersections of compartment boundaries were created

111 through wound healing, which lead to the conditions necessary for regulation. Recently, the functional basis of regulation has been examined through expression analysis in cultured disc fragments (Brook et a/. 1993, Gibson and Schubiger 1999). This work revealed that the genes involved in normal disc patterning also control the re-specification necessary for regulation (Brook et al. 1993, Gibson and Schubiger 1999). Genes were also identified which were expressed specifically during regulation (Brook et al. 1993).

Although regulation can occur during in vivo culture, it is controllable and predictable and therefore need not hinder fate mapping. Consequently, we employed in vivo disc culture to uncover a fate map of the stalk-eyed fly eye-antennal disc. We used this method because: unlike the observations from in situ studies, the experimental data resulting from in vivo culture could be easily analysed; molecular markers, which are severely restricted in stalk­ eyed flies, were not required and a detailed map of specific precursors could be obtained.

It was also unnecessary to determine the particular culture conditions for our study organism as the discs were cultured in vivo.

In this chapter, we identified landmark structures on the adult C. dalmanni dorsal head, which could be used to recognise head regions following in vivo culture. We introduced a series of eye-antennal disc fragments from donor larvae into host larvae by microinjection.

Following metamorphosis of the host and donor tissue, we recovered the implants and scored them for the presence of landmark structures. This allowed us to generate a fate map of the stalk-eyed fly eye-antennal disc.

112 3.3 MATERIALS AND METHODS

3.3.1 Fly stocks and rearing methods

Laboratory stocks of C. dalmanni were reared and sampled as described in Chapter 2.

3.3.2 Preparation of donor tissue and host larvae

Microinjection was performed as described by previous authors (Ephrussi and Beadle

1936, Ursprung 1967). Donor larvae were washed in 100% ethanol, rinsed and dissected in Musca Ringers (0.75% NaCl, 0.1% KCl, 0.0179% CaCl^.ZH^O, 0.012% NaHCOj) and eye-antennal discs were dissected away from the larval mouthparts. When required, the disc was cut into fragments (Fig. 3.3) using a tungsten needle sharpened by electrolysis. The resulting discs or disc fragments were transferred to a drop of Musca

Ringers on a depression slide and kept in a glass Petri dish lined with damp filter paper at

4°C until required. Host larvae were washed in Musca Ringers but were not rinsed in ethanol as described by previous authors (Ephrussi and Beadle 1936, Ursprung 1967) because we observed that C. dalmanni larvae were susceptible to desiccation. The larvae were etherised for 2 minutes, wetted with Musca Ringers and lined up with their trachea uppermost and to one side.

3.3.3 Microinjection and dissection of implants

Glass capillaries (1.2 mm outer diameter, 0.94 mm internal diameter, Clark Electromedical

Instruments) were pulled into injection needles using a microbumer. A tungsten pointer was inserted into the fine end of the glass needles and snapped to produce smooth and sharp tips. A constriction was then forged behind the tip of the needles via a heated metal coil.

113 The needle was mounted in the injection apparatus, which consisted of a metal needle holder connected to a syringe via plastic tubing. The system was filled with Musca

Ringers and lubricated with fat body from third instar C. dalmanni larvae prior to use. A donor disc or disc fragment was taken up into the tip of the needle. Host larvae were injected at a level one-third-body length from the posterior end. Once the disc had been inserted, the glass needle was swiftly withdrawn and used to wet the hosts with a drop of

Musca Ringers. The hosts were then transferred to Petri dishes containing sweetcom, lined with moist filter paper and incubated at 25°C. Adult flies, 2 days post eclosion, were washed in 100% ethanol, rinsed in Musca Ringers and implants dissected from their abdomens. Any hosts, which had not eclosed by 10 days after the formation of white pupae, were also inspected. Implants were washed in Musca Ringers prior to dissection and mounting in Aquamount (BDH). The specimens were scored under a dissection microscope and photographed using a compound microscope.

114 3.4 RESULTS

3.4.1 The head of C. dalmanni

Previous authors have described the head morphology of the Diopsidae (Shillito 1971,

Feijen 1986) and their terminology has been used in the present study (Fig. 3.4A). The eyes and antennae are located at the distal end of tubular eyestalks. Close to the dorsal eye margin is the outer vertical bristle (OB), which is one of the two large and strong head bristles. In Cyrtodiopsis, the antenna consists of three segments: the scalpus (F‘ segment) is a ring of cuticle; the pedicellus (2"^* segment) is trapezium shaped with its narrow side bordering the scalpus; the funiculus (3"** segment) is cupped within the pedicellus and is an apically rounded bulb from which the arista projects. The F‘ and 2"^ segments contain an evenly spaced row of hairs of approximately 4 and 15 hairs respectively.

The head of C. dalmanni is covered in long hairs over the face and in rows along the eyestalk. The second large head bristle, the inner vertical bristle (IB), projects dorsally at the mid-point of the eyestalk, from a raised base or tubercle. The coloration of cuticle across the head is graduated medio-laterally from the light brown face to the black orbital cuticle surrounding the lateral eyes. The most medial head structures are the three ocelli, which rest on a prominent tubercle. Two hairs are associated with the tubercle but ocellar bristles are absent in this species. Between the oceUi and the face is the ptilinum, a region of elastic cuticle that is dotted with small tubercles and inflates to aid the emergence of the fly from its puparium. Finally, ventral to the face are the proboscis and the palpus. The palpus is light brown and covered in medium hairs.

3.4.2 In vivo culture conditions in C.dalmanni

Several pilot studies were performed to perfect microinjection and determine the culture conditions suitable for C. dalmanni. Initially, D. melanogaster hosts and donors were

115 used to establish the technique in our laboratory using the microinjection methods

described by Ephrussi and Beadle (1936) and Ursprung (1967). Interspecies culture has

previously been described using different species of Drosophila (Wildermuth 1968).

Consequently, D. melanogaster hosts were then successfully used to culture stalk-eyed

fly imaginai discs. Finally, C. dalmanni hosts and donors were employed, and a range of culture conditions tested in order to maximise survival rates, which included: needle type,

anaesthesia and post-operative incubation. Survival rates of eighty to ninety percent have previously been described in Drosophila (Ephrussi and Beadle 1936, Ursprung 1967) but,

unfortunately, the overall success rate of in vivo culture in our hands was only ten percent.

3.4.3 In vivo culture of whole eye-antennal discs

To determine the fate map it was first necessary to choose landmark regions with which implants could be scored. Structures were selected which were easily characterised following in vivo culture. We pinpointed ten landmark structures and noted the rate of their recovery following the injection of whole eye-antennal discs (PIA, for posterior, intervening and anterior) into host larvae (Table 3.1). We had good recovery rates of landmark structures from whole discs, which show that in vivo culture was possible in our

study organism.

The landmarks showed variable frequency in recovered tissue, but most were identified in greater than 50% of the sample (Table 3.1). The most distal part of the eyestalk was characterised by the eye ommatidia and the OB (Fig. 3.5A). The pedicellus, funiculus and the arista of the antenna could also be distinguished following metamorphosis. These segments were easily identified by the neat row of bristles on the pedicellus and the smooth light brown funiculus (Fig. 3.5B).

It was not possible to differentiate between the hairy cuticle of the eyestalk and face. This was due to a graduated, rather than discrete, medio-lateral cuticular colour change and the

116 absence of distinct orbital or ocelli bristles. This character was therefore summarised crudely as head capsule cuticle. However, dorsal eyestalk tissue was identified specifically by the presence of the IB. The two eyestalk bristles (IB and OB) were easily distinguished. The IB projects from a prominent tubercle and is surrounded by head capsule cuticle whilst black orbital cuticle and ommatidia were associated with the OB

(Fig. 3.5B).

The three ocelli were chosen as a medial landmark. The injection of a single disc led to the recovery of one and a half ocelh. (In Drosophila, the ocelli are located at the border where the pair of eye-antennal discs fuse (Haynie and Bryant 1986)). A second medial landmark, the ptilinum, could be recognised easily due to its highly characteristic spotting with small tubercles (Fig. 3.5B). Finally, the palpus was the most ventral structure selected and was identified by its light brown hairy cuticle (Fig. 3.5B).

3.4.4 In vivo culture of eye-antennal disc fragments

Having established the technique of in vivo culture in C. dalmanni and chosen suitable landmarks, we proceeded to perform injections of specific disc fragments. We injected two sets of fragments. In the first set, a horizontal incision was made between the anterior portion and the intervening disc-stalk region to divide the disc in half (Fig. 3.3). This created two fragments: one with the anterior portion only (A) and another with the posterior portion plus the intervening disc-stalk (PI). These fi*agments were then cultured independently in separate hosts and the resulting implants scored for landmarks (Table

3.1).

Head capsule and the ptihnum were observed in implants derived from both A and PI fragments. However, the pedicellus, funiculus, arista and palpus were only present in the A disc fragment, whilst the IB, OB, ommatidia and ocelh were only recovered from the PI fragment (Fig. 3.4A and Fig. 3.4B). These initial injections enabled us to directly map the

117 position of the antenna and palpus. However, it was not possible to distinguish whether the eyestalk was derived from the posterior portion or the intervening stalk region.

A second set of cultures was prepared in which the disc was cut horizontally between the posterior portion and intervening region (Fig. 3.3). The resulting fragments were the posterior portion (P) and the intervening region plus the anterior portion (lA) (Table 3.1).

Once again both implants gave rise to head capsule and ptilinum. As expected from the first cultures, the antennal landmarks and palpus were observed only in the lA fragment

(Fig. 3.4A and Fig. 3.4B). The eyestalk marker IB was not observed in any of the implants from the lA fragment. However, the ommatidia, OB, ocelli and most notably, the

IB, were observed in cultures from the P fragment (Fig. 3.4A and Fig. 3.4B).

118 3.5 DISCUSSION

3.5.1 A fate map of the C. dalmanni eye-antennal disc was derived by in vivo culture

In summary, these findings indicate that in C. dalmanni, the anterior portion of the eye- antennal disc forms the entire antenna and the palpus whilst the eye and the dorsal head, including the orbital cuticle, the eyestalk and the ocelli are derived from the posterior portion of the disc.

It is unclear from the results of these experiments what, if any, adult tissues are produced by the intervening disc-stalk region. Both AI and PI fragments gave rise to the same set of derivatives as A and P fragments respectively. Several attempts were made to culture the intervening disc-stalk region alone but no adult structures were recovered (data not shown). This maybe due to technical limitations of our culture and recovery system when applied to very small fragments of disc tissue. Alternatively, apoptosis could account for the results we have observed. The intervening disc-stalk region may be ehminated by apoptosis during pupal development and the region may therefore not directly contribute to the adult tissue but instead play a role in the rearrangements of the disc during metamorphosis.

3.5.2 Regeneration and duplication in theC. dalmanni eye-antennal disc

One difference between our Diopsid fate map and the map for Drosophila (Haynie and

Bryant 1986) hes in the origin of the ptilinum. In Drosophila this structure is entirely derived from the posterior portion of the disc whereas our results indicate that in stalk­ eyed flies both anterior and posterior portions give rise to ptilinum. However, if the ptilinum primordium lies near the edge of the anterior fragment it is possible that this may be due to regeneration of posterior structures during the culture period. Regeneration of

119 structures following in vivo culture has previously been noted in the Drosophila eye-

antennal disc (Vogt 1946, Gehring 1966, Gehring 1972). If the disc is divided into two fragments and both cultured for prolonged periods one fragment will regenerate the entire disc while the other duplicates structures that it normally gives rise to (Fig. 3.2).

Significantly, we observed duphcation of the arista in 4 of 21 implants of the A fragment.

Since any particular fragment may either duphcate or regenerate structures (but not both) this implies that in stalk-eyed flies the anterior portion normally gives rise to at least part of the ptihnum. Furthermore, it has been shown that regeneration or duphcation is more likely to occur if the growth of implants is prolonged, for example, through culturing in young hosts (Bryant 1978). In a series of experiments using brown prepupae as older hosts, no duphcation was observed when we injected the A fragment (n=10, data not shown). This suggests that in C. dalmanni, as in Drosophila, the use of older hosts is sufficient to suppress the extra growth required for duphcation or regeneration to occur.

The ptihnum was still recovered from anterior disc fragments cultured in older hosts confirming that the ptihnum was not the result of regeneration in this portion (data not shown). However, the ptihnum was significantly more likely to be derived from the posterior fragment than the anterior fragment = 13.1, p < 0.01). This suggests that a larger proportion of the ptihnum was formed from the posterior portion than the anterior portion.

3.5.3 In vivo culture of the eye-antennal disc confirms and extends previous expression analysis

In vivo culture of the stalk-eyed fly eye-antennal disc has produced a detailed fate map of the disc (Fig. 3.4B), which supports and develops the unexpected findings from our expression analysis (Chapter 2). Firstly, we have directly shown that the anterior region gives rise to both distal and proximal antennal segments. We have also provided evidence for the first time that the palpus is derived from the anterior region. This finding is surprising as these structures are widely separated on the adult head.

120 Secondly, our results demonstrate that the posterior region gives rise to the eye and dorsal

head capsule. Again this finding is somewhat counterintuitive as it means that different

disc regions give rise to the eye and antenna although these structures are adjacent in the

adult. The inner vertical bristle (IB) represents a definitive dorsal eyestalk marker. The IB

was only recovered from posterior disc implants, which shows that the posterior region of

the disc gives rise to at least part of the eyestalk. Previously, we have shown that molecular

markers for the most medial, and most lateral regions of the dorsal head capsule are also

expressed in this region (Chapter 2). Together these results suggest that the entire dorsal

eyestalk is derived from the posterior portion of the disc. This is interesting given our

finding that the antenna and the palpus, which lie at opposite ends of the ventral eyestalk,

are both derived from the anterior portion. It is possible that the dorsal and the ventral

eyestalk are derived from different portions of the disc, and that at least part of the ventral eyestalk is derived from the intervening disc-stalk region. Unfortunately, we were unable to test this hypothesis due to the absence of ventral eyestalk specific landmarks in C. dalmanni. However, a different stalk-eyed fly species may provide the head structures necessary for this analysis.

Despite the significant sexual dimorphism in the eyespan of C. dalmanni, we have found no evidence for a size difference between male and female late third instar whole discs or disc-stalk regions (data not shown). Likewise, we have previously shown the absence of any morphological differences between the late third instar whole discs or disc-stalk regions of Diopsid species portraying extreme and subtle hypercephaly (Chapter 2). It is possible that such differences reflect differential growth during the pupal period. Studies of the development of the pupal disc may be necessary to determine how varying degrees of hypercephaly are achieved from equivalent sized discs and the role, if any, of the intervening disc-stalk in this aspect of the trait.

121 Table 3.1 Proportion of landmarks in fragments of the eye-antennal discs

cultured in vivo

Fragment PIA PI A P lA

Sample size 13 13 21 13 16

Landmark ommatidia 1.00 1.00 0.00 1.00 0.00 OB 0.46 0.46 0.00 0.46 0.00 ocelli 0.15 0.23 0.00 0.31 0.00 IB 0.46 0.62 0.00 0.69 0.00 head capsule 1.00 1.00 0.71 1.00 0.88 ptilinum 0.85 0.85 0.29 0.92 0.50 pedicellus 0.77 0.00 0.86 0.00 0.81 funiculus 0.85 0.00 1.00 0.00 0.94 arista 0.62 0.00 0.48 0.00 0.25 palpus 0.77 0.00 0.29 0.00 0.25

Parts of disc: PIA - whole, PI - posterior and intervening, A - anterior, P - posterior,

LA - intervening and anterior.

122 Fig. 3.1 Schematic representation of Drosophila and Cyrtodiopsis eye-antennal discs

The stalk-eyed fly disc is divided into three sections, two of which have counterparts in

Drosophila: the anterior portion (A) from which the antenna (ant) is derived and the posterior portion (P) which contains the eye and dorsal head capsule primordia (dorsal head). An intervening region of tissue (1) is also present which is stalk-eyed fly specific.

O anterior portion • intervening region O posterior portion

dorsal dorsal head head

• eye

D . melanogaster C. dalmanni

123 Fig. 3.2 Regulation in the eye-antennal disc

Fragments of the Drosophila eye-antennal disc will duplicate (D) or regenerate (R) following short-term culture in vivo. (F) dérivâtes as expected from fate map. (NT) not tested (Adapted from Bryant 1978). In each diagram anterior is top and ventral left.

\

I A :\

B

D E * I

124 Fig. 3.3 Fragments of eye-antennal disc cultured in vivo

A - anterior, lA - intervening and anterior, PIA - whole, PI - posterior and intervening

P - posterior.

A AI AlP IP

125 Fig. 3.4 Schematic representations of the stalk-eyed fly head (A) and eye-antennal disc fate map (B)

The disc was divided horizontally at the boundaries of the anterior or posterior portions shown in (B). Following in vivo culture, landmark structures illustrated in (A) were recovered and the locations of their primordia derived as listed in (B). The hairs of the face and eyestalk are omitted for the purpose of clarity.

a r is t a outer vertical Inner vertical bristle (OB) f u n i c u lu s bristle (IB)

tuciercle hairs p ed icellu s o c e I

ptilinum O anterior portion

# Intervening region

O posterior portion p alp us p ro b o scis

antenna p alp us

e y e IB OB ocelli B

126 Fig. 3.5 Photographs of whole eye-antennal disc tissue followingin vivo culture illustrating the landmarks chosen for fate map construction

The head capsule cuticle is uncoloured as the implants were taken from a newly eclosed host.

ommatidia

head capsule ptilinum funiculus

palpus pedicellus arista

127 3.6 REFERENCES

Bodenstein, D. 1943. Hormones and tissue competence in the development of

Drosophila. Biol. Bull. 84: 34-58.

Brook, W. J., Ostafichuk, L. M., Piorecky, J., Wilkinson, M. D., Hodgetts, D. J. and

Russell, M. A. 1993. Gene expression during imaginai disc regeneration detected using enhancer-sensitive P-elements. Development 117: 1287-1297.

Bryant, P. J. 1971. Regeneration and duplication following operations in situ on the imaginai discs of Drosophila melanogaster. Dev. Biol. 26: 637-651.

Bryant, P. J. 1978. Pattern formation in imaginai discs. In: Ashbumer, M. and Wright, T.

R. F. (eds) The genetics and biology of Drosophila. Vol. 2c. Academic Press, London, pp

230-335.

Buschbeck, E., Roosevelt, J. L. and Hoy, R. R. 2001. Eye stalks or no eye stalks: a structural comparison of pupal development in the stalk-eyed fly Cyrtodiopsis and in

Drosophila. J. Comp. Neurobiol. 433: 468-498.

Carroll, S. B., Gates, J., Keys, D. N., Paddock, S. W., Panganiban, G. E. P., Selegue, J. E. and Williams, J. A. 1994. Pattern formation and eyespot determination in butterfly wings.

Science. 265: 109-114.

Ephrussi, B. and Beadle, G. W. 1936. A technique of transplantation for Drosophila. Am.

Nat. 728: 218-225.

Epper, F. 1983. The évagination of the genital imaginai discs of Drosophila melanogaster. Roux's Arch. Dev. Biol. 192: 280-284.

Feijen, H. R. 1989. Diopsidae. In: Griffiths, G. C. D. (ed) Flies of the Neartic Region. E.

Schweizerbartsche Verlagsbuchhandlung, Stuttgart, pp 1-122.

French, V., Bryant, P. J. and Bryant, S. V. 1976. Pattern regulation in epimorphic fields.

Science 193: 969-980.

Gateff, E. A. and Schneiderman, H. A. 1975. Developmental capacities of immature eye- antennal imaginai discs of Drosophila melanogaster. Wilhelm Roux’s Archiv. 176: 171-

189.

128 Gehring, W. 1966. Übertragung und anderung der determinationsqualitâten in antennenscheiben-kulturen von Drosophila melanogaster. J. Embryol. Exp. Morphol. 15:

77-111.

Gehring, W. 1972. The stability of the determined state in cultures of imaginai disks in

Drosophila. In: Ursprung, H. and Notinger, R. (eds). Biology of imaginai discs. Springer,

New York, pp 35-58.

Gibson, M. C. and Schubiger, M. Hedgehog is required for activation of engrailed during regeneration of fragmented Drosophila imaginai discs. Development 126: 1591-1599.

Ginter, E. K. and Kusin, B. A. 1969. Growth of the imaginai discs of Drosophila in the adult host. Dros. Inf. Serv. 44: 74.

Hadom, E. 1978. Imaginai discs: transdetermination. In: Ashbumer, M. and Wright, T. R.

F. (eds). The Genetics and Biology of Drosophila. Vol. 2c. Academic Press, London, pp

556-617.

Haynie, J. L. and Bryant, P. J. 1986. Development of the eye-antenna imaginai disc and morphogenesis of the adult head in Drosophila melanogaster. J. Exp. Zool. 237: 293-

308.

Huang, P., Dambly-Chaudiere, C. and Ghysen, A. 1991. The emergence of sense organs in the wing disc of Drosophila. Development. Ill: 1087-1095.

Madhavan, M. M. and Schneiderman, H, A. 1977. Histological analysis of the dynamics of growth of imaginai discs and histoblast nests during the larval development of

Drosophila melanogaster. Roux's Arch. Dev. Biol. 183: 269-305.

Meinhardt, H. 1983. Cell determination boundaries as organizing regions for secondary embryonic fields. Dev. Biol. 96: 375-385.

Meinhardt, H. 1991. Determination borders as organizing regions in the generation of secondary embryonic fields: The initiation of legs and wings. Sem. Dev. Biol. 12: 129-

138.

Milner, M. J., Bleasby, A. J. and Pyott, A. 1983. The role of the peripodial membrane in the morphogenesis of the eye-antennal disc of Drosophila melanogaster. Roux's Arch.

Dev. Biol. 192: 164-170.

129 Milner, M. J., Bleasby, A. J. and Pyott, A. 1984. Cell interactions during the fusion in vitro of Drosophila eye-antennal imaginai discs. Roux’s Arch. Dev. Biol. 193: 406-413.

Milner, M. J. and Haynie, J. L. 1979. Fusion of Drosophila eye-antennal imaginai discs during differentiation in vitro. Rowe’s Arch. Dev. Biol. 185: 363-370.

Postlethwait, J. H. and Schneiderman, H. A. 1970. Induction of metamorphosis by ecdysone analogues: Drosophila imaginai discs cultured in vivo. Biol. Bull. 138: 47-55.

Robinow, S. and White, K. 1991. Characterization and spatial distribution of the ELAV protein during Drosophila melanogaster dQvélopmQni. J. Neurobiol. 22: 443-461.

Royet, J. and Finkelstein, R. 1995. Pattern formation in Drosophila head development: the role of the orthodenticle homeobox gene. Development 121: 3561-3572.

Shillito, J. F. 1971. The genera of Diopsidae (Insecta: Diptera). Zool. J. Linn. Soc. 50:

287-295.

Ursprung, H. 1957. Untersuchungen zum anlagemuster der weiblichen genitalscheibe von

Drosophila melanogaster durch UV-Strahlenstich. Rev. Suisse Zool. 64: 303-311.

Ursprung, H. 1959. Fragmentierungs- und bestrahlungsversuche zur bestimmung von determinationszustand und anlageplan der genitalscheiben von Drosophila melanogaster.

Wilhelm Roux. Arch. EntwMech. Org. 151: 504-558.

Ursprung, H. 1967. In vivo culture of Drosophila imaginai discs. In: Wilt, F. H. and

Wessells, N. K. (eds) Methods in Developmental Biology. Thomas Y Crowell Company,

New York, pp 485-492.

Usui, K. and Simpson, P. 2000. Cellular basis of the dynamic behaviour of the imaginai thoracic discs during Drosophila metamorphosis. Dev. Biol. 225: 13-25.

Vogt, M. 1944. Induktion von metamorphoseprozesen durch implantierte ringdriisen bei

Drosophila. Wilhelm Roux. Arch. EntwMech. Org. 142: 131-182.

Vogt, M. 1946. Zur labilen determination der imaginalscheiben bei Drosophila. I.

Verhalten verschiedenaltriger imaginalanlagen bei operativer defektsetzung. Biol. Zbl. 66:

81-105.

Weigmann, K. and Cohen, S. 1999. Lineage-tracing cells bom in different domains along the PD axis of the developing Drosophila leg. Development 126: 3823-3830.

130 Wildermuth, H. 1968. Differenzierungleistungen, mustergliederung und

transdeterminationsmechanismen in hetero-und homoplastischen transplanten der russelprimordien von Drosophila. Wilhelm Roux Arch. EntwMech. Org. 160: 41-75.

Zeitiinger, J. and Bohmann, D. 1999. Thorax closure in Drosophila: involvement of Fos

and the JNF pathway. Development 126: 3947-3956.

131 4

Drosophila P-element enhancer trap screen for novel

regulators of head development

132 4.1 SUMMARY

The developmental biology of the Drosophila eye-antennal disc has been extensively

studied. Previous research has primarily focused on the genetics underlying the formation

of the compound eye. Relatively little is known about the genes controlling the formation

of the head capsule. Genes are often expressed in the regions in which they are

functionally required. We performed a P-element enhancer trap insertion screen of gene

expression patterns in the dorsal head primordia to uncover novel regulators of head

capsule development. Initially, lines were grouped into five classes according to similarities

in eye-antennal disc staining patterns. Plasmid rescue was used to identify the genes

flanking the P-element insertions. All but one class of stocks were discarded following

comparative analysis of expression and sequence data with known genes. The remaining

class included a number of genes whose role in head development had previously been

overlooked. In order to identify whether the isolated genes specified head structure by known or formerly unrelated pathways, further analysis was focused on one gene, defective ventriculus {dve). Dve was detected in a similar distribution to Orthodenticle

(Otd), a known regulator of head development. However, the expression of dve was absent

in the head vertex primordia of ocelliless mutants. This suggested that dve acts

downstream of otd to specify dorsal head structures. Dve expression was also observed in

a similar distribution of the Cyrtodiopsis dalmanni eye-antennal disc, where it was

extended to the disc-stalk.

133 4.2 INTRODUCTION

Without a fundamental understanding of the developmental processes underlying Dipteran head morphogenesis, an extensive investigation of the formation and evolution of novel head phenotypes is not feasible. A limited number of genes have been implicated in

Dipteran head development to date and the molecular genetic study of this process is in its infancy. In this chapter, we have sought to identify new genes expressed during head capsule development.

Several techniques are available for investigating the genetics of developmental processes.

Classical genetic screens of maternal effect and embryonic lethal mutations have been performed to identify the genes underlying D. melanogaster embryogenesis (e.g.

Niisslein-Volhard et a l 1984). Mutations in the embryo which are lethal, or maternal genes which affect embryogenesis, are likely to be involved in development. This method relies on the abihty to observe morphological aberrations as a result of mutation. For example, the genes underlying the segmented body plan were identified by mutant larval cuticle phenotypes (Niisslein-Volhard et al. 1984). However, mutations may not have a visible phenotype, for example, if they affect internal structures. Wieschaus et al. (1984) found that cuticular phenotype was affected in mutants of only 10 % of essential embryonic genes. Classical genetic screens rely on lethal mutations and will therefore not identify genes which are functionally redundant. Mutations, which affect complex processes, may be difficult to interpret. Finally, embryonic lethal mutations will not reveal the gene function at later stages of development.

Genes are often expressed in the regions in which they are functionally required. For example, engrailed is expressed in the medial dorsal head primordia where it is required for ocelli formation (Royet and Finkelstein 1995). Consequently, an examination of gene expression may identify candidates involved in development and mutants need not be created. We have previously investigated several genes known to be involved in D.

134 melanogaster head development using monoclonal antibodies (Chapter 2). However, a large-scale screen of expression patterns via immunohistochemistry would be a very lengthy process restricted to pre-existing antibodies or involving the generation of novel markers. Furthermore, subsequent analysis of the candidates identified by this method would be protracted unless they had previously been isolated and cloned.

We have avoided the restrictions associated with classical genetic and antibody screening by performing an enhancer trap screen of gene expression to uncover novel regulators of head development. Before the function of the enhancer trap can be explained, the role of enhancer and promoter sequences must first be understood. Enhancer sequences stimulate the initiation of transcription through the binding of regulatory proteins and may be separated from the initiation site by several kilobases in either direction. Enhancers and their associated proteins interact with another type of cw-regulatory region, the promoter, to regulate the time and location of transcription. The promoter extends upstream of the initiation start point and also binds regulatory proteins.

Enhancer traps consist of a reporter gene fused to a weak promoter, which is unable to drive the expression of the reporter gene on its own (Fig. 4.1). However, if the construct is inserted into an organism within the range of an endogenous enhancer, the promoter is upregulated and the reporter gene is expressed. One type of reporter gene is lacZ from

Escherichia colt which encodes p-galactosidase. This enzyme cleaves a blue dye from the

X-Gal substrate complex and the expression of lacZ is therefore visuahsed as blue staining. Regulatory proteins control the spatio-temporal expression of endogenous and reporter genes alike. Consequently, the locahsation of an endogenous gene product is visualised via reporter gene expression. Enhancer trapping therefore facihtates the study of gene expression without the need for gene-specific probes.

Enhancer traps can be inserted into D. melanogaster via P-element mediated transformation (O'Kane and Gehring 1987). P-elements are one type of naturally

135 occurring transposable genetic element or transposon (reviewed Engels 1989).

Transposable elements are discrete stretches of DNA which can relocate themselves from one region of the genome to another. On average, an individual D. melanogaster carries elements from as many as 50 different transposon famihes (Engels 1992). Transposable elements can be classified into three groups according to their structure and mode of transposition. The retrovirus-like elements, such as Copia, are the biggest group and have, at each end, direct repeats which are several hundred base pairs long. These elements encode reverse transcriptase (RT) and move via an RNA intermediate. The second class of elements is the retroposons that have a 3' AT rich sequence rather than terminal repeats but also mobilise via an RNA intermediate due to the action of an element-encoded RT. The F element in Drosophila is a member of this group. P-elements belong to the final class of transposons which contain inverted repeats at each end which are less than 100 base pairs

(bp) long. P-elements have 31 bp inverted terminal repeats and 11 bp sub terminal inverted repeats (O'Hare and Rubin 1983). Transposition in this class follows rephcation or excision of the element. Transposons move as DNA and mobility is as a result of P- element transposase activity.

P-element mobilisation can be controlled by the relocation of transposase onto a helper P- element or jumpstarter (Cooley et al. 1988). The P-element carrying the enhancer trap and the jumpstarter are injected into the posterior region of the egg, which will form the germ cells. The transposon carrying the enhancer trap is mobilised by in trans transposase activity and the helper element, which is incapable of insertion, is subsequently lost. If a marker gene, such as the eye colour mutant rosy, is included on the transposon and injected into rosy embryos, then an examination of eye colour can identify progeny known as transposants, which contain transposons. The P-element is also a convenient source of promoter sequence required for enhancer trapping because the transposase promoter is relatively weak and constitutively active (O’Kane and Gehring 1987).

136 Enhancer traps are often upregulated by the regulatory elements of genes nearby

(discussed Bellen 1999) and observations from large-scale screens give an indication of how frequently this occurs. Bellen et al. (1989) mapped the cytological position of six transposons and confirmed that the staining pattern in aU lines correlated with the expression of endogenous genes from the same map position. In two of the six transposants examined, expression of the candidate gene was also present in regions beyond the p-galactosidase staining pattern. This might have been because several enhancers, only one of which was detected by the enhancer trap, control the candidate genes. Wilson et al. (1989) created probes from the DNA flanking the insertion point of twelve transposons. In four of these lines the transcripts detected by in situ hybridisation were distributed identically to the reporter gene. Transcripts from five lines could not be detected above background. However, this might have been because the probes generated were too short or the detection method was not sufficiently sensitive. In situ hybridisation staining of the remaining transposants differed from the expression of p-galactosidase. In spite of this, the genes identified by the enhancer trap of these lines could have been adjacent to the transposon because probes were only generated 3' of the insertion site and genes 5' of the element were therefore not investigated. A screen performed by Harvie et al. (1998) provides further proof that most enhancer traps detect the expression of genes in the vicinity of the insertion point. In situ hybridisation was performed on four insertion lines using a probe derived from the genes adjacent to the transposon. Staining in three of the transposants was similar to the lacZ expression pattern whilst the remaining line differed significantly. The enhancer identified by the transposon in the fourth stock may only regulate a subset of the ubiquitous expression detected by hybridisation and it cannot, therefore, be discounted that the correct gene was identified in the flanking DNA.

We have described how the majority of reporter gene expression occurs in the same spatio-temporal distribution as the genes adjacent to the insertion. Cloning the DNA flanking the transposon can, therefore easily isolate the genes revealed by enhancer trapping. This principle has been successfully used to clone numerous genes identified by

137 enhancer trapping, for example, ming (Cui and Doe 1992) and bunched (Dobens et al.

1997). The sequence flanking one side of the transposon can been isolated by plasmid rescue (Fig. 4.2). Plasmid rescue is possible due to the creation of a second generation of transposons which contain polylinker sequence, recognised by several restriction enzymes and absent 3' of the polylinker (Bellen et al. 1989, Wilson et al. 1989). Transposant genomic DNA is digested by a restriction enzyme with a recognition site within the polylinker. The resulting fragments are circularised via self-hgation into plasmids. One of these plasmids contains the enhancer trap and the genomic DNA flanking one side of the insertion point. It is possible to isolate this plasmid via the ampiciUin resistance encoded on the transposon. DNA probes can then be created from this rescued genomic fragment enabling examination of its spatio-temporal expression.

It is also possible to clone the sequence flanking the insertion point by inverse polymerase chain reaction (inverse PCR) (Ochman et al. 1988, Trigliaet al. 1988). As with plasmid rescue, genomic DNA from P-element insertion lines is digested with a restriction endonuclease and the resulting fragments are ligated intramolecularly. One of the circular molecules generated will contain the transposon sequence and the DNA flanking it. This molecule is not selected by antibiotic resistance, as described during plasmid rescue, but by PCR. Amplification of the flanking DNA is achieved using primers which hybridise with the transposon and extend outwards towards the sequence either side of the enhancer trap. The linear fragment generated can then be sequenced. Inverse PCR avoids the need to transform and isolate re-ligated digestion products. However, the length of flanking sequence derived by inverse PCR may be shorter than those obtained by plasmid rescue.

Consequently, it may more difficult to identify genes and their expression patterns by inverse PCR and we therefore employed plasmid rescue.

Enhancing trap lines are available from a number of sources. The visual database FlyView,

(http://flyview.uni-muenster.de/), was estabhshed in order to disseminate the data obtained from enhancer trap studies more effectively (fanning 1997). Within the database are

138 thousands of expression pattern images of enhancer trap lines. Accompanying these images are the genotype and donor of the strain, the map position of the transposon and a description of the staining pattern. The database includes unpublished work and information about previously uncharacterised genes. Stocks of enhancer trap strains are kept from several projects (fanning 1997): 100 lines from enhancer trapping performed in

Münster, Germany; 244 lines from the Berkeley Drosophila genome project (BDGP); 5 lines from a study of mitosis in Novosibirsk, Russia; 500 lines from the Gottingen X- chromosome project. The database holds images of embryonic and larval staining in the

Münster lines, embryonic staining patterns from the BDGP and Gottingen X-chromosome projects and ovarian tissue from the Russian study.

Enhancer tap lines are also available from the Bloomington Drosophila stock centre at

Indiana University. The centre holds a collection P-element insertion strains which it maintains and distributes to the research community. The majority of transposants held at

Bloomington were donated from projects involving lethal P-element mutagenesis. For example, a large proportion was donated from the BDGP gene disruption project

(Spradling et al. 1995, Spradling et al. 1999). The information available on each line varies according to its source but many include the genotype and donor of the strain, the map location of the transposon, a photograph of the embryonic staining pattern, the sequence flanking the element, the gene identified by the enhancer trap and any expressed sequence tags associated with the insertion point.

P-galactosidase activity was visualised in the third instar eye-antennal discs of a selection of P-element insertion stocks which enabled classification of the lines into 5 gene expression classes. Transposants unrelated to our aim were discarded following comparison of their expression patterns and sequence adjacent to their transposons, with known genes. The remaining lines were potential novel regulators of head development and were further characterised. Additional investigations were focused on one line, an insertion into defective ventriculus (dve). Dve expression was examined in wild type D.

139 melanogaster and contrasted with staining in the C. dalmanni eye-antennal disc. The role of the gene in Drosophila head development was further investigated using an ocelliless allele, which lacks the medial dorsal head domain (Royet and Finkelstein 1995). Finally, the effects of Dve over-expression in the dorsal head were examined via targeted gene expression.

140 4.3 MATERIALS AND METHODS

4.3.1 Fly stocks and rearing methods

The P-element enhancer trap screen consisted of 74 P-element lines from the Bloomington

Stock Centre and a further 23 P-element insertion stocks from the University of Münster

(W. fanning). A complete list of the flies used is listed in Table 4.1. Gene trapping was achieved using a dve5.0.Scer\UAS strain (kindly provided by B. Fuss) crossed with

Scer\GAL4‘'^^' flies (kindly provided by K. Kaiser). The ocelliless mutant line oc^“^

(T(l;2)ocgammaI,oc[gammaal]/FM7a) (Bloomington stock centre) was also used. Flies were maintained at room temperature on standard sugar-yeast food medium. Samples of late third instar larvae were collected at the wandering stage from the culture vials.

Laboratory stocks of Drosophila melanogaster and Cyrtodiopsis dalmanni were reared and sampled as described in Chapter 2.

4.3.2 Histochemical staining for p-galactosidase

P-element insertion line larvae were dissected in phosphate buffered saline (PBS, O.IM

NaCl, 25mM KCl, lOmM Na^Hpo^, 2mM KH 2PO4, pH7.4), by inverting the heads so that the imaginai discs remained attached to the cuticle and mouthhooks, and fixed in 1 % gluteradldehyde in PBS for 15 minutes. The fix was then replaced with staining solution

(10 mM Na^HPO/NaH^PO^ [pH 7.2], 3.1 mM K3(Fe[II][CN]6), 3.1 mM

K4(Fe[II][CN]6), 150 mM NaCl 2, 1 mM M gCy containing a 1 / 2000 dilution of X-gal

(5-Bromo-4-chloro-3 indolyl p-D-galactoside) ( 8% in dimethyl formamide). Samples were incubated overnight at 37°C and subsequently transferred to PT (PBS + 0.1% Triton

X-100). Discs were dissected away from the cuticle, mounted and photographed using a compound microscope.

141 4.3.3 Immunohistochemistry

D. melanogaster and C. dalmanni larvae were dissected, fixed and incubated in primary

antibody as described in Chapter 2. The primary antibodies were rabbit anti-Ato (kind gift

from A. Jarman) used at 1:1500, mouse anti-Ac (Developmental Studies Hybridoma Bank,

investigator J. Skeath) used at 1:20 and rabbit anti-Dve (kind gift from H. Nakagoshi) used at 1:1500. With one exception, antigen detection for all proteins was via Vectastain

Avidin / Biotin / Alkaline Phosphatase ABC System (Vector Laboratories) according to the manufacturer's protocol. BCIP / NBT substrate was used for all Drosophila discs as

described in Chapter 2. Antigen detection of C. dalmanni discs was via Vectastain Avidin /

Biotin / Horseradish Peroxidase ABC System (Vector Laboratories) and staining was

performed using DAB (3,3 '-diaminobenzidine) substrate kit (Vector Laboratories) as

described in the manufacturer’s instructions. Discs were dissected away from the cuticle, mounted and photographed using a compound microscope.

4.3.4 Isolation of genomic DNA

Genomic DNA was extracted from batches of 30 flies which were frozen overnight or for

1 hour at -70°C before use. Samples were homogenised in 300 |il Homl (O.IM Tris HCl pH 8.0, 0.6M NaCl, O.IM EDTA, 0.00015M spermidine, 0.5% Triton X-100) using a household drill. 200 p\ Homl was added and samples were centrifuged for 5 minutes. All centrifugations were performed at 13,000 rpm. The supernatant was discarded and the pellet re-suspended in 400 pi Homl, 100 pi 10% SLS and 5 pi Proteinase K. Samples were incubated at 50°C 2.5 hours after which 50 pi 3M sodium acetate, 250 pi phenol and

250 pi chloroform were added. Samples were shaken by hand and centrifuged for 5 minutes. The aqueous layer was transferred to a fresh tube, 500 pi chloroform added and centrifuged for 5 minutes. Once again, the aqueous layer was retained before 1 ml -20°C

100% ethanol was added. The samples were gently inverted and DNA precipitated at 4°C for 30 minutes or overnight. Samples were centrifuged for 10 minutes, the supernatant

142 removed and 400 80% ethanol added. Following centrifugation for 5 minutes, the supernatant was removed and the pellet air-dried for 5 minutes. Finally, the DNA was re­ suspended in 100 pi TE (10 mM Tris, 1 mM EDTA) and quantified via agarose gel electrophoresis.

4.3.5 Plasmid rescue

Genomic DNA from one side of the P-element was obtained by plasmid rescue as described by Roberts (1998). This method had previously been more reliable than inverse

PCR in our laboratory (H. Smith pers. comm.). 25 pi genomic DNA was digested with

HindHi for PlArB constructs and EcoRI for PlacW constructs in a volume of 30 pi with the appropriate buffer and dH^O. In order to purify and precipitate the digest, 2 pi of 0.5

M EDTA, 173 pi TE and 200 pi phenol was then added. Samples were centrifuged for 10 minutes and the aqueous layer retained. All centrifugations were performed at 13,000 rpm.

Following the addition of 200 pi chloroform, samples were centrifuged for 10 minutes and the aqueous layer kept. The DNA was precipitated with 0.1 volumes of 3 M sodium acetate and 2.5 volumes of ethanol overnight at -70°C. The digest was centrifuged for 30 minutes at 4°C and the pellet washed in -20°C 70% ethanol. The sample was centrifuged for 2 minutes, air dried and re-dissolved in 50 pi TE. 12 pi of the digest was saved for agarose gel electrophoresis and the remainder ligated in a volume of 200 pi overnight at

14°C with the appropriate buffer. Following the addition of 5 pi EDTA, the ligation was purified and precipitated as described previously and the pellet re-dissolved in 15 pi TE.

Comparison of 10 pi undigested DNA, 12 pi digested DNA and 5 pi re-ligated DNA was performed via agarose gel electrophoresis to confirm the success of the procedure.

4.3.6 Transformation of XLl-Blue subcloning-grade competent cells

The plasmid rescue ligation reaction was used to transform XLl-Blue Subcloning-Grade

Competent Cells (Stratagene) according to the supplier’s instructions. The cells were

143 thawed on ice and gently mixed by hand. 50^il of cells was added to a pre-chilled 15 ml

Falcon 2059 polypropylene tube and 5 pi of hgated DNA added before the tube was gently swirled. The tube was incubated on ice for 20 minutes, heat-pulsed at 42°C for 45 seconds then returned to ice for 2 minutes. 0.9 ml pre-warmed SOC medium (2% tryptone, 0.5% yeast extract, 0.05% NaCl, 20 mM glucose, 2.5 mM KCl, 10 mM M gCy was added to each tube and incubated at 37°C for 30 minutes with shaking. Cells were concentrated by centrifugation at 5000 rpm for 3 minutes, re-suspended in 50 - 100 pi

SOC by pipetting and plated on Luria-Bertani (LB) (1% NaCl, 1% tryptone, 0.5% yeast extract, pH7.0) ampicilhn (50 pg / ml) plates. Plates were incubated overnight at 37°C.

4.3.7 Sequencing

Plasmid DNA was prepared using Qiagen plasmid mini kit as described in the manufacturer’s instructions. The identity of the insert was uncovered via sequencing using

Spel primer (5' - GAC ACT CAO AAT ACT ATT C - 3') for lacW and ESTf primer (5' -

GAA ACA GCT ATG ACC ATG ATT ACG CC - 3') for lArB containing plasmids. 500 ng plasmid DNA, 2 pi Big Dye terminator cycle sequencing ready reaction (Perkin

Elmer), 1 pi Spel primer (3.2 pmol / pi), 6 pi filtered dilution buffer (200 mM Tris-HCl pH 9.5, 5 mM M gC y and dH^O up to 20 pi was heated in a Gene Amp PCR System

9700 (Perkin Elmer). The heating cycles were as follows: 10 min. 95°C, 25 cycles of

(95°C 45 sec., 45°C 15 sec., 60°C 4 min.), and held at 25°C. ESTf primer was used in the same way except that the annealing step was performed at 58°C. For purification, the reaction was transferred to a 0.5 ml microcentrifuge tube with 50 pi molecular biology grade ethanol, incubated on ice for 10 minutes then centrifuged for 30 minutes at 13,000 rpm. The supernatant was discarded and 80 pi ice cold 70% molecular biology grade ethanol added. The samples were incubated at room temperature for 1 minute, centrifuged at 13,000 rpm for 10 minutes. Finally, the supernatant was discarded and the pellet air- dried at room temperature for 20 minutes. The sequencing reaction was run on an ABI

377 Automated sequencer. Sequences were compared to the Drosophila genome database

144 with the blastn programme from the NCBFs BLAST services

(http://www.ncbi.nlm.nih.gov/blast/BLAST.cgi) using BLAST 2.0 (Altschul etal. 1990).

145 4.4 RESULTS

4.4.1 Selection of lines for P-element enhancer trap screen

Two sets of P-element insertion strains were used in our screen (Table 4.1). A total of 23

P-element insertion stocks were selected from the image database, RyView

(http://flyview.uni-muenster.de/). Transposants were chosen from the Münster hnes

because images of eye-antennal discs were only available for these stocks. Lines were

used if they contained staining specially in the region of the eye-antennal disc which will

form the dorsal head vertex (Fig. 4.3). 74 stocks were arbitrarily chosen at regular

chromosomal intervals from the Bloomington Stock Centre hnes, which contain insertions

within the first, second, or third chromosomes. Transposants from both sources were

selected which contained the P-lArB (Wilson et al. 1989) or P-lacW (Bier et al. 1989)

transposons to facilitate plasmid rescue analysis.

4.4.2 Expression patterns from enhancer trap screen divide into five classes

The eye-antennal discs of the P-element insertion lines were stained with X-gal and the resulting expression patterns broadly grouped into five classes according to similarities in

staining (Fig. 4.4). This subdivision enabled swift discrimination between relevant and

unrelated lines through further analysis of representative members of each class. Class 1

expression: blanket staining across the disc, or absent in the head vertex primordia

although present in other disc regions excluded from our selection criterion (Fig. 4.4A).

Class 2 expression: two large discrete spots in the region which will form the dorsal head

vertex, a broad circle of expression in the proximal antennal region and behind the

morphogenetic furrow (Fig. 4.4B). Class 3 expression: multiple small discrete dots of

expression in the head vertex region and antennal region as well as behind the

morphogenetic furrow (Fig. 4.4C). Class 4 expression: broad stripes of staining across

the whole of the eye disc in the dorsal / ventral axis and in concentric rings of the anterior

146 portion (Fig, 4.4D). Class 5 expression: a band of expression on the dorsal flap of the

posterior portion, which was absent ventrally, accompanied by a range of staining in other

regions of the disc (Fig. 4.4E).

4.4.3 Comparison of class 2 and 3 expression and sequence data, with genes

involved in photoreceptor and bristle development

The staining pattern of class 1 flies suggested that the genes they identified were unrelated

to our specific aim and consequently, these lines were not studied any further. Overall, the

vast majority of lines were from this class, making up 6 out of the 23 FlyView lines and 63

out 74 Bloomington stocks (Table 4.1). Although the remaining classes all contained

specific staining in the head vertex region, further refinement was possible through the

comparison of our lines with known genes. The aim of our study was to investigate the

genes involved in head capsule morphogenesis. Many of the genes expressed in the

primordia of the dorsal head vertex were unlikely to be relevant to our investigation. These

genes will have functions related to the specification or differentiation of pattern elements

(such as photoreceptors or sensory bristles), which are not unique to the head and not

involved in head capsule morphogenesis. This important distinction was used to isolate

and discard classes of expression unconnected to our aim. We compared the expression

patterns seen in classes 2 and 3 with those of genes {atonal and achaete) known to mark

neural pattern elements.

The transcription factor atonal {ato) is a proneural gene which is expressed in the neural precursors of the chordontal organs (which sense sound or mechanical vibrations) in the

second antennal segment (Jarman et al. 1993) and the photoreceptors of the eye and oceUi

(Jarman et al. 1994, Jarman et al. 1995) (Fig. 4.5A). The same expression pattern was

observed in lines from class 2 suggesting that P-element insertion had occurred within

genes involved in photoreceptor development (Fig. 4.4B). This hypothesis was confirmed

via plasmid rescue, which was successfully performed on two randomly chosen class 2

147 transposants, 10042 and 10099 (Table 4.2). The P-element within Une 10042 had inserted

within the previously uncharacterised genes, CGI405 or CG2865. However, the gene

adjacent to the transposon from line 10099 was scabarous, which is involved in

onunatidial arrangement (Baker et al. 1990). The expression data and sequence analysis of

class 2 genes supported our proposal that these genes were regulators of photoreceptor

development and therefore unrelated to head morphogenesis.

achaete (ac) specifies bristle precursor cells and is also a proneural gene (reviewed

Campos-Ortega 1998).ac is consequently expressed in spots in the antenna, behind the

morphogenetic furrow and in the head vertex primordia (Fig. 4.5B). A similar expression

pattern was observed in lines from class 3 (Fig. 4.4C) suggesting that the staining pattern

was due to the enhancers of genes which play a role in bristle formation. Plasmid rescue

was performed on two class 3 lines to test this theory (Table 4.2). The transposon from

line 10030 was inserted within amnesiac, a neuropeptide hormone which was originally

uncovered during a study of memory defective mutants (Quinn et al 1979). The sequence

flanking the P-element in line 10120 was couch potato, which is present in neuronal precursor cells of the peripheral nervous system (PNS) (Bellen et al. 1992). In conclusion,

genes from class 3 were shown to be involved in bristle and nervous system development

and were consequently were not analysed any further.

4.4.4 Identification of class 4 genes via plasmid rescue

Plasmid rescue was successfully performed on three transposants from class 4 (Table

4.2). The P-element within hne 10051 was shown to he within capricious {caps) or

CGI 1281. caps is a transmembrane receptor expressed in the synapse (Shishido et al.

1998) whilst CGI 1281 has not been characterised beyond its sequence. The sequence flanking the transposon in hne 10993 was Drosulfakinin, a neuropeptide hormone

expressed in the protocerebrum (Nicols et al. 1988) or CGI2583 which was previously uncharacterised. Finally, Calreticulin (Crc) was identified at the insertion site of hne

148 11092. Crc is a calcium binding protein and Crc mutations affect the embryonic neuron and PNS (Salzberg et cd., 1997). In conclusion, plasmid rescue of representative

transposants from class 4 revealed that the P-element had inserted within genes imphcated in nervous system development. It was unlikely that stocks from this class were related to

dorsal head capsule morphogenesis and were therefore excluded from further study.

4.4.5 Identincation of novel regulatorsDrosophila of head development

Following expression analysis and plasmid rescue, it was concluded that class 5 expression patterns were most likely to be involved in dorsal head capsule development.

Subsequent characterisation was therefore focused on these lines (Fig. 4.6). These stocks made up roughly 10 percent of the original screen (8 / 97 total, 5/74 Bloomington, 3/23

FlyView).

The location of the P-element within the class 5 hne 10049 (Fig. 4.6A) was uncovered via plasmid rescue and found to he next to CGI2537, of unknown function or Cyp6d5, a cytochrome P450 from the endoplasmic reticulum (Table 4.2). Neither of these genes had been studied previously beyond their sequence identities. However, it has been proposed that some cytochrome P450s may play a role in developmental regulation (Stoilov 2001).

For example, in Drosophila Cyp302Al which is also known as disembodied. This cytochrome P450 is involved in the control of ecdysone levels thereby regulating, amongst other developmental processes, the progression of the morphogenetic furrow (Chavez et al

2000).

Strain 10052 (Fig. 4.6B) was also flanked by one of two genes, CG4257 or signal transducer and activator of transcription protein at 92E {stat92E) (Table 4.2). Another

P-element insertion within stat92E, stat92Ef^^^^ (Zeidler et al 1999) has the same expression pattern observed in 10052 suggesting that stat92E was the gene affected.

Zeidler et al. (1999) concluded that the staining from stat92Ef^^"^^ represented only one

149 component of stat92E expression because in situ hybridisation with a stat92E specific

probe resulted in ubiquitous staining. Stat92E has previously been shown to be involved in

ommatidial polarity (Zeidler et al. 1999).

We were, unfortunately, unable to identify two other class 5 hnes, 10596 (Fig. 4.6C) and

10046 (Fig. 4.6D). Both stocks were rescued but the DNA flanking the transposons of

both lines contained vector sequence only. This is probably due to a rearrangement of the

transposon as it inserted into the genome. It was subsequently discovered that 10596 had

been rejected from the BDGP gene disruption project (Spradling et al. 1999).

The sequence flanking a pair of class 5 lines had previously been identified and was used

to determine the genes with the expression we had observed. Stock 10205 (Fig. 4.6E) lay between either CG7651 or CG12545 for which only sequence information had previously been described. The region around the P-element insertion of 10704 (Fig. 4.6F) had also been sequenced previously and was found to be the transmembrane receptor ISwheeler with homology to Toll and Interleukin-1 -receptor (Eldon et al. 1994, Chiang and Beachy

1994). Eldon et al. (1994) proposed that the receptor performs the developmental processes orchestrated by segment polarity and homeotic genes by acting as a cell adhesion or receptor molecule. Expression of 18w either side of the morphogenetic furrow and in concentric rings of the antennal region had previously been described in another

18w P-element insertion line (Chiang and Beachy 1994).

For two of the class 5 hnes, 11468 (Fig. 4.6G) and 10399 (Fig. 4.6H) the P-element insertion point was already known. Strain 11468 (Fig. 4.6G) resulted from an interruption of lozenge (Iz). This was a surprising result because the wild type expression of the RNA polymerase 11 transcription factor Iz resembles the members of class 4 (Fig. 4.4D) with multiple stripes in the dorsal / ventral axis either side of the morphogenetic furrow and in concentric rings in the antennal region (Flores et al. 1998). However, 11468 had previously been examined by Crew et al. (1997) who described the same expression

150 pattern we had observed. Crew et al. explained that expression of Iz along the posterior edge of the disc relates to its the role in the development of cone cells (Fig. 4.6G). A combination of complementation tests and expression analysis lead the authors to propose that the subset of Iz expression observed in 11468 was due to enhancers of the first of the two Iz cistrons. However, Crew et al. did not comment on the staining which was present in the head vertex primordia of the 11468 discs they examined. Over 130 recorded Iz alleles, mutant phenotypes of the antennal sensilla and ommatidia development exist, but no alleles affecting the head capsule have be described. It therefore seems unlikely that Iz is involved in head morphogenesis.

The second previously identified class 5 P-element insertion line was 10399 (Fig. 4.6H).

The expression pattern observed in this strain was due to the effects of a defective ventriculus (dve) enhancer. The transcription factor dve contains a novel class of homeobox domain at its carboxy terminal, which has similarities to the POU and

Orthodenticle (Otd) homeodomains (Nakagoshi et al. 1998). Research has focused around the role dve plays in gut development, dve mutants affect two regions of the

Drosophila gut: the proventriculus, a valve at the foregut / midgut boundary, and the central midgut (Fuss and Hoch 1998, Nakagoshi et al. 1998). Examination of gut development in several mutants led these authors to conclude that dve expression is in response to the wingless and decapentaplegic pathways (Fuss and Hoch 1998, Nakagoshi etal. 1998).

4.4.6 defective ventriculus is expressed in the dorsal head primordia ofD. melanogaster and C. dalmanni eye-antennal discs

A deeper investigation into the dve was pursued. An antibody, raised against the carboxyl terminal of the protein (Nakagoshi et al. 1998), was used to examine the expression of dve in wild type discs. The distribution of Dve matched the staining pattern observed in line

10399 (Fig. 4.7A and Fig. 4.7B). In both third instar discs, a ring of expression was

151 present in the distal antennal segment and along the dorsal edge of the anterior region, dve was also strongly expressed in the dorsal flap of the posterior region. Two small spots of dve were detected by immunohistochemistry either side of the optic nerve in the posterior of the eye. The staining associated with the optic nerve was not detected in the enhancer trap line. These results confirm that the expression pattern observed in line 10399 is due to a dve enhancer. Interestingly, the distribution of Dve in the eye-antennal disc is similar to the expression of the regulator of head development, orthodenticle (otd) (Wieschaus et al

1992). Otd is detected at the dorsal edge of the anterior region and in the dorsal flap of the posterior portion. However, unlike Dve, Otd is absent in the distal antennal segment and present in cells behind the morphogenetic furrow.

In an extension to the immunohistochemistry performed in Drosophila, we also investigated the distribution of Dve in Cyrtodiopsis dalmanni (Fig. 4.7C). We detected

Dve in a ring in the centre of the anterior portion and in two spots in the posterior portion either side of the optic nerve. Interestingly, Dve was also distributed along the dorsal edge of the anterior region and disc-stalk. Finally, Dve was strongly expressed in the dorsal flap of the posterior portion.

4.4.7 Investigation of the relationship betweendefective ventriculus and a known regulator of head development,orthodenticle

In order to uncover the role dve plays in Drosophila dorsal head development, we investigated the relationship between dve and the homeodomain protein Otd. As previously described, otd is expressed in a graded fashion across the primordia of the dorsal head, decreasing laterally (Royet and Finkelstein 1995). otd is allelic to ocelliless (oc) and a range of oc alleles affect head development to varying degrees. Hemizygosity for the weak oc allele, oc\ results in the loss of the ocelli and associated bristles (Royet and Finkelstein

1995). engrailed (en) expression is absent in the medial head vertex primordium of oc^ discs and over-expression of en restores the ocelh (Royet and Finkelstein 1995). These

152 findings led the authors to conclude that en acts downstream of otd to establish the ocelli.

However, as over-expression of en was not able to fully restore the dorsal head phenotype,

it was deduced that other genes must also act downstream of otd to produce other

components of the dorsal head.

We examined gene expression in the strong oc allele, oc'^^\ Hemizygosity for leads

to the almost complete loss of medial and medial lateral dorsal head structures (Royet and

Finkelstein 1995). As previously described (Chapter 2), en is expressed in the posterior third of the anterior portion, in a wedge shaped patch of the dorsal posterior flap and immediately behind the morphogenetic furrow (Royet and Finkelstein 1995) (Fig. 4.8A).

Unsurprisingly, in light of previous work performed on oc^ discs, we found that en expression in was unchanged in the anterior region and behind the morphogenetic furrow but undetectable in the dorsal lateral flap (Fig. 4.8B). dve was observed in a ring of the distal antennal segment and along the dorsal edge of the anterior portion of the discs (Fig. 4.8C). However, in discs dve expression was absent from the dorsal posterior flap.

4.4.8 Investigation of the effects ofdefective ventriculus over-expression in the dorsal head vertex

The function of dve was further examined by testing the effects of over-expression of the gene in the dorsal head vertex. Over-expression was achieved via gene-targeting using the

GAL4 / UAS system (Brand and Penimon 1993). Fhes were used in which a yeast transcriptional activator protein, GAL4, was coupled to a head vertex specific enhancer

(Manseau et al. 1997). This stock was crossed with a strain containing an upstream activator sequence, UAS, coupled to dve (Fuss and Hoch 1998). Together in an individual, these elements drove the over-expression of dve in the head vertex as GAL4 bound the

UAS and activated transcription of dve. Unfortunately, the effects of dve on head morphogenesis could not be assessed as the progeny had a pupal lethal phenotype.

153 4.5 DISCUSSION

4.5.1 An enhancer trap screen facilitated the search for novel candidates of dorsal

head development

We have performed a pilot enhancer trap screen in D. melanogaster to identify novel regulators of head development. Our initial screen of 97 P-element insertion lines is small compared to previous enhancer trap screens. For example, 1,300 lines were screened in a

study of adult leg morphogenesis (Gates and Thummel 2000) whilst a staggering 180,000 flies were analysed during a screen for genes expressed in photoreceptors (Mollereau et al. 2000). However, even this small-scale enhancer trap screen has provided valuable gene expression data.

Our enhancer trap screen was derived from two sources, FlyView and the Bloomington stock centre and was selected by different criteria. We were able to view the eye-antennal discs of lines from FlyView before selection. This was advantageous because it enabled a minimisation of the proportion of class 1 (staining ubiquitous across the disc or absent from the head vertex primordia) expression patterns, which were unrelated to our aim.

However, the number of stocks recorded at FlyView is much lower than the Bloomington

stock centre. The FlyView stocks are from a handful of projects and are therefore restricted to a few chromosomal locations. Conversely, flies were selected from

Bloomington with insertion sites spread across the genome. The number of FlyView hnes

with images of imaginai discs was low due to a bias towards the study of embryonic

stages. The database consists of low-resolution images, which may be viewed rapidly

(fanning 1997), but their staining was consequently more ambiguous. It was therefore necessary to re-stain and analyse all these hnes. Ultimately, only 3 of the 23 FlyView hnes were described as useful because they were possibly involved in head morphogenesis

(Table 4.1). Many of the remaining hnes either showed sequence or expression pattern

similarities to genes unrelated to our aim.

154 No expression data from eye-antennal discs was available for the Bloomington

transposants, to positively bias selection. However, roughly the same proportion of novel

potential regulators of head development were identified from the Bloomington lines as the

FlyView stocks (5 out of 74 and 3 out of 23 respectively). Furthermore, pre-existing

sequence data and resources were more readily available for Bloomington than FlyView

lines. Consequently, as the Bloomington stocks were also more numerous and spanned a

wider range of the genome than the FlyView hnes, the transposants for a future large-scale enhancer trap screen would be selected from the Bloomington Stock centre rather than

FlyView.

4.5.2 Novel candidates genes identified in our screen enable the analysis of head development

Sequence data or in some cases, gene identity was known for the insertion point of several of the lines we screened. In the absence of this information, we performed plasmid rescue and sequence analysis to identify the genes flanking the P-element insertions. Plasmid rescue was unsuccessful in lines 10596 and 10046. However, it may be possible to sequence the DNA flanking the other side of the transposon if an alternative restriction enzyme is employed. Inverse polymerase chain reaction could also be used to amphfy the

DNA adjacent to the insertion site.

Two possible candidate genes were identified for the staining observed in some lines.

When the expression pattern of one of the candidates was already established, it was possible to differentiate between the imphcated genes. For example, strain 10052 had a similar staining pattern to another line carrying a P-element insertion in stat92E (Zeidler et al. 1999). Plasmid rescue could also provide the sequence information to select pre­ existing probes or if these were unavailable, enable the creation of new probes.

Consequently, the correct gene could be distinguished by in situ hybridisation. Once

155 candidates are identified, an investigation of their expression, in mutant backgrounds, may

establish gene function. Re-mobilisation of the P-element insertion causes flanking

deletions and the phenotype of the resulting mutants may be informative about the

endogenous role of the gene.

We have described the advantages of enhancer trapping as a screening method, however

the technique also has limitations. The enhancer trap may only detect one element of a

complex gene expression pattern if several enhancers are involved. It is important to recognise that the screen detects regulatory elements of genes not the genes per se.

Although the majority of enhancers detected identify genes in the vicinity of the

transposon, there are exceptions. The cw-regulatory regions of some genes span over tens

of kilobases (kb), for example, sting (>15.3 kb, Edgar et al. 1994) and decapentaplegic

(>25 kb, St. Johnston et al. 1990). Consequently, the regulatory sequences may be long distances from the transcription initiation site, for example, the bithorax complex (>50 kb,

Peifer et al. 1987). It may, therefore, be difficult to identify candidate genes, as the sequence flanking the transposon would be uninformative. Finally, P-element mediated insertion of the enhancer trap may lead to a non-random screen due to the P-element insertional site preference (reviewed Engels 1989). In spite of these limitations, an enhancer trap screen is a valuable starting point in the search for novel regulators of head development.

4.5.3 defective ventriculus acts downstream of orthodenticle in the head vertex primordia of the eye-antennal disc

In this study, once we had identified candidates, we focused our analysis on one gene in particular, dve. The distribution of Dve in D. melanogaster was similar to the expression of otd, an established regulator of head development. These findings lead us to investigate the role of dve in an oc mutant allele. Although present in other regions of the mutant disc, dve expression was absent from the dorsal flap of the posterior portion. This observation

156 suggested that dve acts downstream of otd to specify medial dorsal head structures. It has previously been shown that otd acts through en to regulate ocelh formation. It would be interesting to determine if dve plays a distinct or overlapping role with en under the direction of otd in the dorsal head primordia.

It is not possible to examine gene expression in the eye-antennal discs of Dve mutants because they are embryonic homozygous lethal (Nakagoshi et al 1998). Furthermore, over-expression using a head vertex driver unfortunately produced progeny with a pupal lethal phenotype. However, the ‘flp-out’ technique (Struhl and Easier 1993) could be used to circumvent these problems by enabling late-acting constitutive expression. The dve promoter could be coupled to a constitutive promoter separated by two flp recombinase targets (FRT) between which lies a marker gene. In the presence of the yeast site-specific recombinase flp, the marker gene would be excised from the FRT sites and the constitutive promoter would be brought next to dve. It would therefore be possible to control the timing of ‘flp-out’ by fusing the recombinase to a heat shock promoter. After heating, the effects of dve over-expression could be examined in the eye-antennal disc.

The FRT / FLP recombination system could also be used to create mosaic animals containing dve mutant clones (Xu and Rubin 1993). Drosophila chromosomes exist carrying an FLP element driven by a heat-shock protein. Mitotic recombination between homologous chromosomes carrying the FRT sequence can therefore be induced by heat- shock. Moreover, crossing individuals, that carry a mutant gene and the FRT sequence on the same chromosome arm, with a second strain, which carries the FRT sequence and a cell marker in addition to a FLP element on a separate chromosome, can create homozygous clones for a mutation. Cells in the mutant clone are identified by the absence of the cell marker.

157 4.5.4 Novel regulators identified in our enhancer trap screen may be informative for studies of hypercephaly

The results form our enhancer trap screen can also be applied to C. dalmanni. For example, if a candidate gene has been sequenced in multiple species and conserved regions can be identified, this information could then be used to design panspecific probes, oligonucleotides for degenerate PCR or probes for low stringency hybridisation. We were fortunate that a pan-specific antibody was available for the study of dve in C. dalmanni, as well as D. melanogaster. Dve is distributed similarly between D. melanogaster and C. dalmanni except for an extension of expression along the C. dalmanni disc-stalk. We have previously observed a conservation of gene expression between these species in the eye-antennal disc (Chapter 2). This work, led us to propose that the regional identity between the C. dalmanni and D. melanogaster discs is also conserved (discussed Chapter

2 and Chapter 3). Dve expression data further supports this hypothesis, dve is currently the only gene known to be expressed in the C. dalmanni specific disc-stalk and may prove to be a useful marker with which to view the fate of this region during pupal development.

We have previously suggested that the disc-stalk may not contribute to head morphogenesis but instead be destroyed by apoptosis (Chapter 3). If dve is present in a tissue destined for apoptosis, this may represent a previously unidentified function of the gene.

158 Table 4.1 P-element insertion stocks chosen for enhancer trap screen

Cytological Line Source Class position Insertion 10017 FlyView 1 088F06-09 P{w[+mO]=lacW}SS067 Yeti 10029 FlyView 1 001C-D P{ry[+t7.2]=IArB}SW076-A7.3 X W 10030 FlyView 3 019B P{ry[+t7.2]=IArB}SW084-A7.10 X W 10041 FlyView 2 072 P{ry[+t7.2]=IArB}SW0173-A18.16IIIB 10042 FlyView 2 0003A P{ry[+t7.2]=IArB}SW187 10046 FlyView 5 059F P{ry[+t7.2]=IArB}MW042 10049 FlyView 5 088A P{ry[+t7.2]=IArB}SW237-A25.1111W 10051 FlyView 4 070A P{ry[+t7.2]=IArB}SW241 10052 FlyView 5 092E P{ry[+t7.2]=IArB}SW252 10076 FlyView 2 037001-02P{ry[+t7.2]=IArB}MW010-7a 10079 Bloomington 1 004F P{w[+mO]=lacW}l(1 )G0106[G0106] 10081 FlyView 4 085001-02 P{ry[+t7.2]=IArB}MW024-31 a 10085 FlyView 1 089A01-02 P{ry[-ht7.2]=IArB}MW032-66a 10093 FlyView 3 018F03-04 P{ry[+t7.2]=IArB}MW057-130a 10097 FlyView 3 049D P{ry[-ht7.2]=IArB}OB034-M41 a 10099 FlyView 2 049D P{ry[+t7.2]=IArB} OB040-92a 10100 FlyView 4 071A-B P{ry[+t7.2]=IArB} OB041-95a 10112 FlyView 1 021E01 P{ry[+t7.2]=IArB}MW062-30b 10120 FlyView 3 090D P{ry[+t7.2]=IArB} UR138-m66a 10125 Bloomington 1 014B P{w[+mO]=lacW}l(1 )G0473[G0473] 10131 FlyView 1 060F P{ry[+t7.2]=IArB} UR057-m160a(60F) 10137 FlyView 3 047A-B P{ry[+t7.2]=IArB} UR095-277b 10139 FlyView 2 022A-B P{ry[+t7.2]=IArB} UR104-294a 10147 FlyView 4 079D P{ry[+t7.2]=IArB} K0459 10149 FlyView 1 048E P{ry[+t7.2]=IArB} K0532 10164Bloomington 2 064A04-05 P{w[+mO]=lacW}l(3)L1459[L1459] 10173Bloomington 1 067F01-02P{w[+mO]=lacW}l(3)rl075[L6731] 10176Bloomington 1 070B07-001P{w[+mO]=lacW}l(3)L5212[L5212] 10181Bloomington 1 057E06-10 P{w[+mO]=lacW}l(2)01467[k00119] 10186Bloomington 1 074B04-05 P{w[+mO]=lacW}l(3)L6750[L6750] 10190 Bloomington 1 076B09-10 P{w[+mO]=lacW}l(3)L3809[L3809] 10200Bloomington 1 078005-06 P{w[+mO]=lacW}l(3)j1 B10[]1 B10] 10205Bloomington 5 079F01-02 P{w[+mO]=lacW}l(3)L7251 [L7251 ] 10206Bloomington 1 082A03-05 P{w[+mO]=lacW}l(3)j1 E6[j1 E6]

159 Table 4.1 continued

Cytological Line Source Class position Insertion 10212 Bloomington 1 083A05-06 P{w[+mC]=lacW}l(3)ksr[j5E2] 10244 Bloomington1 086E16-19 P{w[+mC]=lacW}l(3)j1 D8[j1 D8] 10282 Bloomington 1 006C04-08 P{w[+mC]=lacW}l(1 )G0290[G0290] 10293 Bloomington 1 088F07-08P{w[+mC]=lacW}l(3)j16A6[j16A6] 10301Bloomington 1 089D01-02 P{w[+mC]=lacW}l(3)CH5[L4032] 10308Bloomington 1 091F10-11 P{w[+mC]=lacW}l(3)j5A6[j7A3] 10312 Bloomington 1 093D09-9 P{w[+mC]=lacW}mod(mdg4)[L3101 ] 10331Bloomington 1 095F11-12 P{w[+mC]=lacW}l(3)j1 B5[j1 B5] 10347 Bloomington1 099A05-06 P{w[+mC]=lacW}l(3)L6241[L6241] 10382Bloomington 1 024A01-02 P{w[+mC]=lacW}for[k04703] 10386Bloomington 1 033A01-02 P{w[+mC]=lacW}crol[k05205] 10397 Bloomington 1 048C06-08 P{w[+mC]=lacW}Ef 1 alpha48D[k06102] 10399 Bloomington 058D01-02 P{w[+mC]=lacW}dve[k06515] 10420Bloomington 1 60A08-09 P{w[+mC]=lacW}Thiolase[k09828] 10437 Bloomington 1 043E04-06 P{w[+mC]=lacW}l(2)05643[k11110] 10450Bloomington 1 059C03-04 P{w[+mC]=lacW}l(2)06496[k14618] 10452 Bloomington 1 049F07-08 P{w[+mC]=lacW}Aats-val[k14804] 10458Bloomington 1 039A01-02 P{w[+mC]=lacW}l(2)06496[k16804b] 10478Bloomington 4 047D05-06 P{w[+mC]=lacW}shn[k00401 ] 10596 Bloomington 021B04-06 P{w[+mC]=lacW}l(2)k06019[k06019] 10626Bloomington 1 025F03-04 P{w[+mC]=lacW}l(2)k06502[k06502] 10659 Bloomington 1 038E05-06 P{w[+mC]=lacW}for[k04703] 10704Bloomington 5 056F06-09 P{w[+mC]=lacW}dia[k07135] 10707Bloomington 1 035C P{w[+mC]=lacW}C3-2-9 10768Bloomington 1 090D P{w[+mC]=lacW}l(3)E7-3-58[1 ] 10860Bloomington 1 042C01-02 P{w[+mC]=lacW}l(2)09107[k09107] 10865Bloomington 1 052D11-12P{w[+mC]=lacW}ATPCL[k09217] 10909 Bloomington 1 037C06-07 P{w[+mC]=lacW}k09613 10970 Bloomington 1 055B05-06 P{w[+mC]=lacW}pabp[k10109] 10987 Bloomington 1 069C P{ry[+t7.2]=IArB}A265.2M3 10993 Bloomington 4 081F P{ry[+t7.2]=IArB}A321.3M3 11002 Bloomington 1 096F05-08 P{ry[+t7.2]=IArB}A353.2M3 11006Bloomington 1 036D01-03 P{w[+mC]=lacW}dl[k10816] 11092 Bloomington 4 085E P{ry[+t7.2]=IArB}A140.1 M3

160 Table 4.1 continued

Cytological Une Source Class position Insertion 11103Bloomington 1 001A P{ry[+t7.2]=IArB}A461.1F1 11123Bloomington 1 028F01-02P{w[+mC]=lacW}l(2)k14308[k14308] 11153Bloomington 4 071 A-B P{ry[+t7.2]=IArB}A179.4F3 ry[506] 11155Bloomington 1 100F P{ry[+t7.2]=IArB}A102.2F3 11168 Bloomington3 019A P{ry[+t7.2]=IArB}A135.2F1 11206Bloomington 1 061A P{ry[+t7.2]=IArB}A55.1M3 11468Bloomington 008C-D P{ry[+t7.2]=IArB}lz[A27.1F1] 11477 Bloomington 1 003A01-04 P{w[+mC]=lacW}l(1 )G0023[G0023] 11580Bloomington 1 005D P{w[+mC]=lacW}l(1 )G0050[G0050] 11810Bloomington 1 017C-D P{w[+mC]=lacW}l(1 )G0092[G0092] 11819Bloomington 1 016C01-02 P{w[+mC]=lacW}l(1 )G0108[G0108] 11844 Bloomington 1 002F P{w[+mC]=lacW}l(1 )G0144[G0144] 11877 Bloomington 1010C01-02 P{w[+mC]=lacW}l(1 )G0237[G0237] 11894 Bloomington 1 018D01-02 P{w[+mC]=lacW}l(1 )G0013[G0013] 11914Bloomington 1 013E07-15P{w[+mC]=lacW}l(1 )G0027[G0027] 11982Bloomington 1 007E05-06P{w[+mC]=lacW}l(1 )G0356[G0356] 11989 Bloomington 1 003E01-04 P{w[+mC]=lacW}l(1 )G0373[G0373] 12004 Bloomington 1 020AB P{w[+mC]=lacW}l(1 )G0393[G0393] 12064Bloomington 1 063B07-08P{w[+mC]=lacW}Hsp83[]5C2] 12098 Bloomington 1 012C P{w[+mC]=lacW}l(1 )G0031 [G0031 ] 12127 Bloomington1 001C P{w[+mC]=lacW}l(1 )G0109[G0109] 12163Bloomington 1 009B P{w[+mC]=lacW}l(1 )G0197[G0197] 12170 Bloomington 1 022D03-04 P{w[+mC]=1 acW}l(2)s5379[s5379] 12188Bloomington 1 050E04-05 P{w[+mC]=1 acW}l(2)s3475[s3475] 12229 Bloomington 1 011D P{w[+mC]=lacW}l(1 )G0208[G0208] 12230Bloomington 1 011A P{w[+mC]=lacW}l(1 )G0214[G0214] 12251Bloomington 1 009F P{w[+mC]=lacW}l(1 )G0386[G0386] 12272 Bloomington 1 015F P{w[+mC]=lacW}l(1 )G0484[G0484] 12282Bloomington 1 002C01-02P{w[+mC]=lacW}l(1 )G0500[G0500]

161 Table 4.2 P-element insertion stocks successfully identified via plasmid rescue

Sequence data was not available for all transposants and consequently plasmid rescue was performed to identify the genes flanking the transposons.

Line Expression Class Candidate Gene

10030 3 amnesiac 10042 2 CG1405/CG2865

10049 5 cyp6d5/CG12537

10051 4 capricious / CGI 1281

10052 5 signal transducer and activator o f transcription protein at 92E E / CG4357

10099 2 scabrous

10120 3 couch potato 10993 4 Drosulfakinin / CGI2583 11092 4 calreticulin

162 Fig. 4.1 Schematic diagram of enhancer trapping

(A) The spatio-temporal expression of genes is controlled by regulatory elements which can act over long distances. (B) The weak promoter of the enhancer trap was upregulated by the action of endogenous regulatory elements. The reporter gene was expressed in the spatio-temporal pattern of the endogenous genes controlled by the same enhancer.

(A)

Enhancer action

ENHANCER GENE

Transcription of gene product

(B) Enhancer action

ENHANCER-TRAP ENHANCER GENE

Transcription of Transcription of reporter gene gene product

163 Fig. 4.2 Schematic diagram of plasmid rescue and inverse PCR

(A) Plasmid Rescue. Transposant genomic DNA was digested with a restriction enzyme which recognised a site within the transposon polylinker. One of the resulting fragments contained the transposon and the DNA flanking it. Each of these fragments was self­ ligated into plasmids and transformed into bacteria. Bacteria containing the transposon and flanking DNA were selected via ampiciUin resistance, encoded on the transposon. The plasmid DNA derived from these bacteria was finally digested and the DNA flanking the transposon isolated. (B) Inverse PCR. Genomic DNA from transposants is digested into fragments and ligated intermolecularly. The sequence flanking the transposon is amplified using primers (black arrows), which hybridise to the enhancer trap and face outwards towards the adjacent gene.

164 genomic DNA

ENHANCER-TRAP GENE

digestion

DNA fragments ENHANCER-TRAPGENE

ligation

ligated plasmids

GENE

ENHANCER TRAP o

(A) PLASMID RESCUE (B) INVERSE PCR

transformation + selection amplification

GENE GENE

ENHANCER TRAP ENHANCER TRAP

digestion isolation

+ isolation GENE ] GENE

165 Fig. 4.3 The Drosophila dorsal head vertex

Schematic diagrams representing the Drosophila adult dorsal head vertex (A) and larval eye-antennal disc (B) from which the head is derived (Adapted from Haynie and Bryant

1986). Eye-antennal discs were examined for the presence of staining in the head vertex primordia on the dorsal flap of the posterior portion (arrow). This region will form the ocelli and surrounding structures. The antenna is derived from the anterior disc portion whilst the morphogeneticfurrow (MF) of the compound eye develops from the posterior portion of the disc. In A, dorsal is top. In B, anterior is top and dorsal to the right.

tcelir anterior O'! p ortion

entérina. dorsal com pound ' head eye

antennae p osterio r p ortion MF eye B

166 Fig. 4.4 Five classes of expression pattern were observed within the eye-antennal discs of the enhancer trap lines

P-element insertion lines were grouped into five classes according to similarities in staining pattern. Class 1 (A): complete absence of expression in the eye-antennal disc or staining only in disc regions excluded from the selection criterion. Class 2 (B): staining was detected in two large spots in the dorsal head primordia, a broad circle in the proximal antennal region and behind the morphogenetic furrow. Class 3 (C): multiple small discrete dots of expression in the head vertex primordia and antenna accompanied by staining behind the morphogenetic furrow. Class 4 (D): broad stripes of expression across the whole eye-antenna disc in the dorso-ventral axis and in concentric rings in the anterior portion. Class 5 (E): a band of expression on the dorsal flap of the posterior portion, which was absent ventrally and was accompanied by a range of staining in other disc regions.

%

tj Aw E

167 Fig. 4.5 Expression ofachaete 2knd atonal thein D. melanogaster eye-nntenna\ disc

Immunohistochemistry was used to detect the expression of two proneural genes, achaete {ac) and atonal {ata) in the eye-antennal disc of D. melanogaster. (A) ac was expressed in the bristle precursors of the anterior region, which will form the antenna, and the dorsal flap of the posterior region,from which the head vertex is derived (A, white arrows). A similar staining pattern was observed in class 3 P-element insertion lines. (B) ato was detectedin a ring of cell clusters in the anterior region. These cells are the neural precursors to the chordontal organ of the second antennal segment (Jarman et al. 1993). ato is also involved in the development of photoreceptors (Jarman et al. 1994, Jarman et al. 1995) and was, consequently,expressed in the ocelli primordia (white asterisks) and along the morphogenetic furrow of the eye. The same expression pattern was observed in stocks from class 2.

168 Fig. 4.6 Class 5 expression patterns were from potentially novel regulators of head development

The expression patterns from class 5 lines of our enhancer trap screen suggested that the

P-element had inserted within novel regulators of head development. Expression of the reporter construct was driven by enhancers of the following genes: (A) 10049 - CGI2537

or Cyp6d5; (B) 10052 - signal transducer and activator of transcription 92E; (C) 10596 and (D) 10046 - unidentified; (E) 10205- CG7651 or CGI 2545; (F) 10704- ISwheeler,

(G) 11468 - lozenge', (H) 10399 - defective ventriculus.

B C

i' é f -9 / •

I*

F 'G H

169 Fig. 4.7 The expression of a novel regulator of head development,defective ventriculus^ in D. melanogaster 2caA C. da/z/ianwi eye-antennal discs

Immunohistochemistry was used to test if the P-element from class 5 line, 10399, had

inserted within the enhancer of defective ventriculus {dve). (A) Staining was detected in a ring in the distal antennal segment, on the dorsal edge of the anterior region and in the

dorsal flap of the posterior region (arrowhead) in line 10399. (B) dve was expressed in the

same regions of the D. melanogaster eye-antennal disc confirming that the staining

observed in line 10399 was due to an insertion into dve. The detection of dve in the head vertexprimordia(arrowhead) suggested that it was a novel regulator of head development.

The role of dve in the development of hypercephaly was explored by examining its

expression in the C. dalmanni eye-antennal disc (C). Immunohistochemistry revealed that

the expression of was conserved between/), melanogaster and C. dalmanni, in a ring in the centre of the anterior region, in the dorsal side of the anterior region and across the dorsal flap of the posterior region (arrowhead). Interestingly, Jve was also detected in the

dorsal side of the C. dalmanni disc-stalk (C, bracket), dve is the first gene shown to be

expressed in this C. dalmanni specific region. Top is anterior and dorsal to the right.

A B C > >

170 Fig. 4.8 defective ventriculus may act downstream of a known regulator of head development,orthodenticle to specify the dorsal head vertex

The distribution of Dve in D. melanogaster was similar to the expression of otd, an established regulator of head development (Royet and Finkelstein 1995). These findings lead us to investigate the role of dve and another known head development regulator, engrailed {en), \n an 6>c mutant allele,(A) In the wild-type eye-antennal disc, en was expressed in the anterior third of the anterior region, at the morphogenetic furrow and in a wedge of the head vertex primordia (arrow). (B) However, in the oc mutant, en expression was specifically lost in the region which will form the dorsal head (arrow).

This finding supported previous work which has shown that otd acts through en to regulate ocelli formation (Royet and Finkelstein 1995). (C) Although present in other regions of the mutant disc, dve expression was absent from the dorsal flap of the posterior portion (arrow). This observation suggested that dve may act downstream of otd to specify dorsal head structures.

171 4.6 REFERENCES

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. 1990. Basic local alignment search tool. J. Mol Biol 215: 403-140.

Baker, N. E., Mlodzik, M. and Rubin, G. M. 1990. Spacing differentiation in the developing Drosophila eye: a fibrinogen-related lateral inhibitor encoded by scabrous.

Science 250, 1370-1377.

Bellen, H. J. 1999. Ten years of enhancer detection: lessons from the fly. Plant Cell 11:

2271-228.

Bellen, H. J., O’Kane, C. J., Wilson, C., Grossniklaus, U., Pearson, R. K. and Gehiing,

W. J. 1989. P-element-mediated enhancer detection: a versatile method to study development in Drosophila. Genes Dev. 3: 1288-1300.

Bellen, H. J., Kooyer, S., DEvelyn, D. and Pearlman, J. 1992 The Drosophila couch potato protein is expressed in nuclei of peripheral neuronal precursors and shows homology to RNA-binding proteins. Genes Dev. 6: 2125-2136.

Bier, E., Vaessin, H., Shepherd, S., Lee, K., McCall, K., Barbel, S., Ackerman, L., Carretto,

R., Uemura, T., Grell, E., et al. 1989. Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector. Genes Dev. 3: 1273-1287.

Brand, A. H. and Perrimon, N. 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401-415.

Campos-Ortega, J. A. 1998. The genetics of theDrosophila achaete-scute gene complex: a historical appraisal. Int. J. Dev. Biol. 42: 291-297.

Chavez, V. M., Marques, G., Delbecque, J. P., Kobayashi, K., Hollingsworth, M., Burr, J.,

Natzle, J. E., O'Connor, M. B. 2000. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development 127: 4115-4126.

Chiang, C. and Beachy, P. A. 1994. Expression of a novel To/Mike gene spans the parasegment boundary and contributes to hedgehog function in the adult eye of

Drosophila. Mech. Dev. 47: 225-239.

172 Cooley, L., Kelley, R. and Spradling, A. C. 1988. Insertional mutagenesis of the

Drosophila genome with single P elements. Science 239: 1121-1128.

Crew, J. R., Batterham, P. and Pollock, J. A. 1997. Developing compound eye in lozenge mutants of Drosophila: lozenge expression in the R7 equivalence group. Dev. Genes

Evol 206: 481-493.

Cui, X. and Doe, C. Q. 1992. ming is expressed in neuroblast sublineages and regulates gene expression in the Drosophila central nervous system. Development 116: 943-952.

Dobens, L. L., Hsu, T., Twombly, V., Gelbart, W. M., Raftery, L. A. and Kafatos, F. C.

1997. The Drosophila bunched gene is a homologue of the growth factor stimulated mammalian TSC-22 sequence and is required during oogenesis. Mech. Dev. 65: 197-208.

Edgar, B. A., Lehman, D. A. and O’Farrell, P. H. 1994. Transcriptional regulation of string (cdc25): a link between developmental programming and the cell cycle.

Development 120: 3131-3143.

Eldon, E., Kooyer, S., D’Evelyn, D., Duman, M., Lawinger, P., Botas, J. and Bellen, H.

1994. The Drosophila 18 wheeler is required for morphogenesis and has striking similarities to Toll. Development 120: 885-899.

Engels, W. R. 1988. P elements in Drosophila. In Berg, D. E. and Howe, M. M. (eds.). P elements in Drosophila. American Society for Microbiology, Washington D C. pp 437-

484.

Engels, W. R. 1992. The origin of P elements in Drosophila melanogaster. BioEssays

14: 681-686.

Flores, G. V., Daga, A., Kalhor, H. R. and Baneijee, U. 1998. Lozenge is expressed in pluripotent precursor cells and patterns multiple cell types in the Drosophila eye through the control of cell-specific transcription factors. Development 125: 3681-3687.

Fuss, B. and Hoch, M. (1998) Drosophila endoderm development requires a novel homeobox gene which is a target of Wingless and Dpp signalling. Mech. Dev. 19: 83-97.

Gates, J. and Thummel, C. S. 2000. An enhancer trap screen for ecdysone-inducible genes required iox Drosophila adult leg morphogenesis. Genetics 156: 1765-1776.

173 Harvie, P. D., Filippova, M. and Bryant, P. J. 1998. Genes expressed in the ring gland, the major endocrine organ of Drosophila melanogaster. Genetics 149: 217-231.

Haynie, J. L. and Bryant, P. J. 1986. Development of the eye-antenna imaginai disc and morphogenesis of the adult head in Drosophila melanogaster. J. Exp. Zool. 237: 293-

308. fanning, W. 1998. FlyView, a Drosophila image database, and other Drosophila databases. Semin. Cell Dev. Biol. 8: 469-475.

Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, N. Y. 1993. atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell 73:

1307-1321.

Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan, N. Y. 1994. atonal is the proneural gene for Drosophila photoreceptors. Nature 369: 398-400.

Jarman, A. P., Sun, Y., Jan, L. Y. and Jan, N. Y. 1995. Role of the proneural gene, atonal, in formation of Drosophila chordotonal organs and photoreceptors. Development 121:

2019-2030.

Manseau, L., Baradaran, A., Brower, D., Budhu, A., Elefant, P., Phan, H., Philp, A. V.,

Yang, M., Glover, D., Kaiser, K., Palter, K. and Selleck, S. 1997. GAL4 enhancer traps expressed in the embryo, larval brain, imaginai discs and ovary of Drosophila. Dev.

Dynamics 209: 310-322.

Mollereau, B., Wemet, M. P., Beaufils, P., KiUian, D., Pichaud, P., Kiihnlein, R. and

Desplan, C. 2000. A green fluorescent protein enhancer trap screen in Drosophila photoreceptor cells. Mech. Dev. 93: 151-160.

Nakagoshi, H., Hoshi, M., Nabeshima, Y. and Matsuzaki, P. 1998. A novel homeobox gene mediates the Dpp signal to establish functional specificity within target cells. Genes

Dev. 12: 2724-2734.

Nichols, R., Schneuwly, S. A. and Dixon, J. E. 1988. Identification and characterization of a Drosophila homologue to the vertebrate neuropeptide cholecystokinin. J. Biol. Chem.

263: 12167-12170.

174 Nüsslein-Volhard, C., Wieschaus, E. and Kluding, H. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. I. Zygotic loci on the second chromosome. Wilhelm Roux's Arch. Dev. Biol. 193: 267-282.

Ochman, H., Gerber, S. A. and Haiti, D. L. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120: 621-625.

O’Hare, K. and Rubin, G. M. 1983. Structure of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34: 25-35.

O’Kane, C. J. and Gehring, W. J. 1987. Detection in situ of genetic regulatory elements in

Drosophila. Proc. Natl. Acad. Sci. USA 84: 9123-9127.

Peifer, M., Karch, F. and Bender, W. 1987. The bithorax complex: control of segmental identity. Genes Dev. 1: 891-898.

Quinn, W. G., Sziber, P. P., and Booker, R. 1979. The Drosophila memory mutant amnesiac. Nature 277: 212-214.

Roberts, D. 1998. Drosophila: A Practical Approach (Practical Approach Series) IRL

Press.

Roy et, J. and Finkelstein, R. 1995. Pattern formation in Drosophila head development: the role of the orthodenticle homeobox gene. Development 121: 3561-3572.

St. Johnston, R. D., Hoffman, F. M., Blackman, R. K., Segal, D., Giimaila, R., Padgett, R.

W., Irick, H. A. and Gelbart, W. M. Molecular organisation of the decapentaplegic gene in Drosophila melanogaster. Genes Dev. 4: 114-1127.

Salzberg, A., Prokopenko, S. N., He, Y., Tsai, P., Pal, M., Maroy, P., Glover, D. M., Deak,

P. and Bellen, H. J. 1997. P-element insertion alleles of essential genes on the third chromosome of Drosophila melanogaster: mutations affecting embryonic PNS development. Genetics 147: 1723-1741.

Shishido, E., Takeichi, M. and Nose A. 1998. Drosophila synapse formation: regulation by transmembrane protein with Leu-rich repeats, CAPRICIOUS. Science 280: 2118-2121.

Spradling, A. C., Stem, D. M., Kiss, I., Roote, J., Laverty, T., Rubin, G. M. 1995. Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA. 1995 92:10824-10830.

175 spradling, A. C., Stem, D., Beaton, A., Rhem, E. J., Laverty, T., Mozden, N., Misra, S. and

Rubin, G. M. 1999. The Berkeley Drosophila Genome Project gene dismption project: single f -element insertions mutating 25% of vital Drosophila genes. Genetics 153: 135-

177.

Stoilov, I. 2001. Cytochrome P450s: couphng development and environment. Trends

Genet. 17: 629-632.

Stmhl, G. and Basler, K. 1993. Organizing activity of Wingless protein in Drosophila.

Cell 72: 527-540.

Trigha, T., Peterson, M. G. and Kemp, D. J. 1988. A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res.

16: 8186.

Wieschaus, E., Nüsslein-Volhard, C. and Jurgens, G. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster III. Zygotic loci on the X- chromosome and the fourth chromosome. Wilhelm Roux’s Arch. Dev. Biol. 193: 296-307.

Wieschaus, E., Perrimon, N. and Finkelstein, R. 1992. orthodenticle activity is required for the development of medial structures in the larval and adult epidermis of Drosophila.

Development 115: 801-811.

Wilson, C., Pearson, R. K., Bellen, H. J., O’Kane, C. J., Grossniklaus, U. and Gehring,

W. J. 1989. P-element-mediated enhancer detection: an efficient method for isolating and characterizing developmentally regulated genes in Drosophila. Genes Dev. 3: 1301-1313.

Xu, T. and Rubin, G. M. 1993. Analysis of genetic mosaics in developing and adult

Drosophila tissues. Development. 117:1223-1237.

Zeidler, M. P., Perrimon, N. and Stmtt, D. I. 1999. Polarity determination in the

Drosophila eye: a novel role for unpaired and JAK/STAT signalling. Genes Dev. 13:

1342-1353.

176 5

Construction and characterisation of aC. dalmanni

third instar larval cDNA library

177 5.1 SUMMARY

We have created a C dalmanni third instar larval complementary DNA (cDNA) library to facihtate the examination of stalk-eyed fly molecular genetics. Messenger RNA (mRNA) was extracted from whole third instar larvae and synthesised into cDNA. A selection of transcripts, which combined cDNA size and quantity, were cloned into the engineered lambda vector, ZAP Express (Stratagene) and the usefulness of the library was then assayed. The number of recombinants was a hundred-fold greater than background plaques confirming the density of novel transcripts within the library. Phagemid derived from randomly chosen plaques were sized and sequenced. The average insert size was 1.9 kilobases (kb), although a range of cDNA between 0.5 kb and 4.5 kb was observed, indicating the presence of full-length transcripts. A range of novel C. dalmanni expressed sequence tags were identified, several of which showed significant protein sequence similarities with known Drosophila melanogaster genes. Finally, the relative abundance of rare and common inserts was examined and it was revealed that less abundant transcripts were relatively easily isolated.

178 5.2 INTRODUCTION

An investigation of the development of novel phenotypes, such as hypercephaly, requires an understanding of the molecular genetics underlying these traits. Unfortunately, the molecular biology of stalk-eyed flies is largely unknown. Previous research has utihsed the hmited molecular data available, for the examination of evolutionary concepts. For example, allozyme markers of phosphoglucomutase were used to test the paternity of

Cyrtodiopsis whitei (Burkhardt and de la Motte 1994) and several gene regions were sequenced in multiple diopsid species for phylogenetic analysis of the group (Baker et al.

2001). In this chapter, we describe the creation of a molecular genetic resource for investigating the regulators of head development in the stalk-eyed fly.

We have chosen to study the developmental genetics of hypercephaly by examining the expression of the genes underlying this process. Several types of probes can be employed to reveal gene expression. We have already illustrated the use of immunohistochemistry to determine protein distribution (Chapter 2). During our investigation of the known regulators of head development, engrailed and Distal-less, we did not need to generate probes, as pre-existing antibodies were available. These reagents were particularly useful because they were pan-specific or raised against a region of the genes, which is conserved between our study organisms. Consequently, these antibodies enabled the examination of proteins in C. dalmanni as well as D. melanogaster. However, pre-existing antibodies are not available for all genes and even fewer are pan-specific. A study based on the use of immunohistochemistry would be limited to previously characterised genes as the generation of novel antibodies is costly and time consuming.

Pan-specific antibodies were not available for examining wingless (wg) in our study organism. We therefore performed polymerase chain reaction (PCR) to derive a C. dalmanni specific probe for in situ hybridisation studies of gene expression (Chapter 2).

The sequence of wg was already available for C. dalmanni so gene specific primers could

179 be designed (Baker et al. 2001). Intronic sequence is absent in the transcripts detected by in situ hybridisation so reverse-transcriptase PCR was employed to avoid the inclusion of these regions in the probe. Rather than using a genomic DNA template, a DNA copy of the messenger RNA (mRNA) was synthesised, which is known as complimentary DNA

(cDNA). cDNA is preferable to RNA because it is less hable to degradation by nucleases and RNA can form secondary structures, which interfere with amphfication. Following amplification of wg it was necessary to clone the reaction product into a vector for the creation of in situ hybridisation probes. RNA probes were generated through the use of

RNA polymerase promoter sequences present in the vector either side of the cloned insert.

The creation of a stalk-eyed fly specific wg probe was facilitated by a priori knowledge of the gene in C. dalmanni. However, sequence data is only available for six diopsid genes

(Baker et al. 2001). Future studies of established regulators of head development, such as orthodenticle or hedgehog, or the novel candidates we have previously identified (Chapter

4), would rely on sequence comparisons between species to find conserved gene regions, which are likely to be present in our study organism. In cases where the protein sequence, rather than the underlying nucleotides, is conserved, C. dalmanni genes would be amplified via degenerate PCR. Degenerate primers correspond to every combination of nucleotides which could form the amino acids of a protein region. Unfortunately, the length of the product would be restricted by the extent of conservation. Lengthier probes would be preferable for more specific in situ hybridisation, which produces less background staining.

We have created a cDNA library to generate probes for in situ hybridisation. A cDNA library contains DNA copies of the mRNA within an organism, which are cloned into convenient vectors. The cDNA within a library is transferred to a membrane and specific transcripts identified by hybridisation. Screening can be performed by high stringency hybridisation of the library with the probes derived from degenerate PCR. Alternatively, low stringency hybridisation with probes from related species can be employed thereby

180 avoiding the need to carry out degenerate PCR. The cDNA identified by screening contains the probe sequence plus flanking DNA. Full-length transcripts are therefore isolated from a cDNA library more efficiently than by PCR. Probes for in situ hybridisation can be generated from any transcript within the library and consequently, a greater range of genes can be examined using the library rather than pre-existing antibodies. Finally, unhke PCR, the cDNA isolated from a library is easily sequenced and transcribed, without further treatment, as the inserts are already cloned.

The type and quantity of different transcripts present in a cDNA hbrary, will depend on many factors that affect gene expression, such as tissue type and developmental stage.

Ideally, RNA would have been extracted from isolated eye-antennal discs, which form the

Dipteran adult head capsule (Haynie and Bryant 1986). However, it was more technically feasible to extract the quantities of RNA needed for a library, from whole larvae. Also, many of the same regulators specify different types of Dipteran adult structures and these genes are consequently expressed in multiple imaginai discs (e.g. wingless. Baker 1988).

RNA was therefore isolated from whole larvae containing all of the imaginai discs. We used the mRNA from third instar larvae because the genes, which we intend to study, are expressed at this stage in other Diptera.

We have created a cDNA library using a ZAP Express vector (Stratagene). This vector was selected for convenient and effective cloning. The cDNA were ligated into phage rather than plasmids because, unlike bacteria, phage can effectively be stored indefinitely and provide cleaner screening results. As a lambda vector, ZAP Express has a high packaging efficiency enabling rare transcripts to be cloned. Our library should therefore be representative of aU the transcripts from the C. dalmanni larvae. The vector was engineered with increased cloning capacity compared to the lambda phage from which it is derived and it is therefore possible to insert up to 12 kilobases (kb) of transcript. This facility should increase the probability that full-length transcripts are cloned. There are 12

181 unique cloning sites within the vector and directional cloning of cDNA is possible, for example, between the Xho\ and EcoRI sites.

The ZAP Express vector enables the determination of the proportion of recombinants by blue / white selection. Isopropyl-1-thio-p-D-galactopyranodide (IPTG) induces expression from the lac promoter of the ZAP Express vector leading to the production of p-galactosidase protein which cleaves a blue dye from 5-Bromo-4-chloro-3-indoyl-p-D- galactopyranoside (X-gal). However, the presence of cDNA in the polylinker of the ZAP

Express vector interrupts transcription of the protein and the dye is not released.

Consequently, blue plaques were formed by background phage without inserts, whereas recombinant phage were recognised by the production of colourless plaques.

Probes for in situ hybridisation are easily produced when the ZAP Express vector is employed. Cloned inserts are excised out of the phage in the form of the pBK-CMV phagemid. Initiation and termination sequences from the fl bacteriophage origin of replication have been engineered in the ZAP Express vector, either side of the cDNA insertion site. If library phage are incubated with helper phage, proteins from the helper phage recognise the engineered sites and duplicate DNA between them. The resulting single stranded DNA molecule is then circularised, packaged and secreted, also under the action of helper phage proteins. This process creates a phagemid containing the insert

DNA. The orientation of the insert is known due to the unidirectional cloning capacity of the vector. The cDNA can be excised from the phagemid via the 17 unique restriction enzyme sites present in the polylinker flanking the insert. Either side of the polylinker are standardised primer sites for sequencing, and the promoters of RNA polymerases for the transcription of nucleic acid probes.

There are several factors that determine the usefulness of a cDNA library as a resource for examining gene expression. Ideally, a high proportion of the phage should contain inserts, otherwise, the number of transcripts present will be insufficient to clone any gene

182 expressed at this stage. A high ratio of recombinants to background phage will also reduce the number of phage necessary for screening. The cDNA present in the library should preferably be full-length transcripts as longer probes increase the specificity of in situ hybridisation. The library should be representative of all mature transcripts. In this way the expression of any gene can be analysed and the probes derived from the library will not contain sequences, which are absent from the transcripts in situ. Finally, the density of the library should be sufficient for the convenient isolation of rare as well as abundant transcripts.

In summary, mRNA was extracted from C. dalmanni third instar larvae and synthesised into cDNA, which was divided into fractions according to size. Aliquots of cDNA maximising size and quantity of transcript were cloned into an engineered vector. One of the resulting primary libraries was then selected for amplification. The ratio of recombinants to background phage was determined by blue / white selection and we analysed the transcript size within randomly chosen phagemids following in vivo excision.

The sequence of several novel C. dalmanni expressed sequence tags was determined and identified through comparison with known genes. Finally, we established the abundance of common and rare transcripts via high stringency hybridisation of the library with stalk­ eyed fly specific probes.

183 5.3 MATERIALS AND METHODS

5.3.1 Fly stocks and rearing methods

Laboratory stocks of Cyrtodiopsis dalmanni were reared and sampled as described in

Chapter 2.

5.3.2 Extraction of total RNA from wholedalmanni C. third instar larvae

Batches of 10 third instar C. dalmanni larvae were frozen in liquid nitrogen and swiftly added to pre-chilled 1.5 ml screw cap centrifuge tubes containing 500 pi beads (Hybaid) and 600 pi Tri Reagent (Sigma). The larvae were then homogenised using a RiboLyser

(Hybaid) at maximum speed for 8 seconds. A further 400 pi Tri Reagent was added and larvae were homogenised for a further 8 seconds at maximum speed. The samples were then incubated at room temperature for 5 minutes. 200 pi chloroform was added and the tubes were shaken vigorously by hand for 15 seconds before incubation at room temperature for 3 minutes. Following, centrifugation at 12,000 g and 4°C for 15 minutes, the upper aqueous layer was transferred to a fresh 1.5 ml centrifuge tube and 600 pi isopropanol and 60 pi 3M sodium acetate were added. The tubes were shaken briefly by hand and incubated at -80°C for 40 minutes. Samples were centrifuged at 12,000 g and

4°C for 15 minutes before the supernatant was discarded and the pellet broken up by pipetting in 600 pi ice cold 70% ethanol-DEPC (diethyl pyrocarbonate) H 2O. Samples were centrifuged at 10,000 g and 4°C for 10 minutes, the supernatant discarded and the resulting pellets air dried for 1 minute. The pellets were re-suspended in 20 pi DEPC-H^O following incubation at room temperature for 10 minutes, then at 50°C for 5 minutes.

Samples were quantified via spectrophotometry (Pharmacia Biotech) and agarose gel electrophoresis and stored at -80°C until required.

184 5.3.3 Isolation of mRNA from total RNA preparations

The mRNA from 750 pg total RNA was isolated using the PolyATtract system (Promega) according to the manufacturer’s instructions. The total RNA sample was made up to 500 pi with DEPC HjO and incubated at 65°C for 10 minutes. 3 pi biotinylated-oligo(dT) probe (Promega) was added and 13 pi 20 x SSC (3M NaCl, 0.3M sodium citrate, pHT.O,

DEPC treated). This was the annealing reaction which was mixed gently and incubated at room temperature until cooled. Streptavidin-paramagnetic particles (SA-PMPs, Promega) were re-suspended by gentle flicking and then captured by magnetism before the supernatant was discarded. SA-PMPs were washed 3 times in 0.5 x SSC and re­ suspended in 100 pi 0.5 X SSC. The annealing reaction was combined with the SA-PMPs and incubated for 10 minutes. The SA-PMPs were captured by magnetism, the supernatant discarded and washed 4 times in 0.1 x SSC. mRNA was eluted through the addition of 100 pi DEPC H^O and removal of the particles by magnetism. A further 150 pi DEPC HjO was applied to the particles and the eluate combined with the previous elution step. 250 pi of isopropanol and 25 pi sodium acetate was used to precipitate the mRNA overnight at -20°C. The resulting pellet was centrifuged at 12,000 g for 10 minutes and washed in 70% ethanol-DEPC H^O. The mRNA was finally re-suspended in 30 pi

DEPC HjO and stored at -80°C until required.

5.3.4 First and second-strand cDNA synthesis

C. dalmanni whole third instar mRNA was converted into cDNA using the ZAP Express cDNA synthesis kit (Stratagene) according to the manufacturer’s instructions. Reagents supplied with the Stratagene kit are denoted by an asterisk. The first-strand cDNA was synthesised by incubating: 21 pi mRNA (5 pg), 5 pi 10 x first-strand buffer*, 3 pi first- strand methyl nucleotide mixture* (10 mM dATP, dGTP, and dTTP plus 5 mM 5-methyl dCTP), 2 pi linker-primer* (1.4 pg / pi), 16.5 pi DEPC H^O and 1 pi RNase block ribonuclease inhibitor* (40 U / pi) at room temperature for 10 minutes. 1.5 pi StrataScript

185 reverse transcriptase* (50 U / jil) was then added. 5 jil of this reaction was transferred to a separate tube containing 0.5 pi [a-^^P] dGTP (800 Ci / mmol) forming the first-strand synthesis control reaction. Both sets of reactions were incubated at 42°C for 1 hour. The experimental reaction was then added to 20 pi 10 x second-strand buffer*, 6 pi second- strand dNTP mixture* (10 mM dATP, dGTP, and dTTP plus 26 mM dCTP), 114 pi

DEPC HjO and 2 pi [a-^^P] dGTP (800 Ci / mmol) to form the second-strand synthesis reaction. 2 pi RNase H* (1.5 U / pi) and 11 pi DNA polymerase I* (9.0 U / pi) were subsequently added and the reaction incubated at 16°C for 2.5 hours.

5.3.5 Pretreatment of cDNA termini prior to cloning

Blunting of cDNA termini was achieved through the addition of 23 pi blunting dNTP mix* (2.5 mM dATP, dGTP, dTTP and dCTP) and 2 pi Pfu DNA polymerase* (2.5 U / pi) to the second-strand synthesis reaction and incubation at 72°C for 30 minutes. The reaction was purified by phenol-chloroform [1:1 (v/v)] extraction. Blunted cDNA was precipitated by adding 20 pi 3 M sodium acetate* and 400 pi 100% ethanol and incubating overnight at -20°C. Centrifugation at 13,000 g for 60 minutes at 4°C resulted in a pellet which was washed with 500 pi 70% ethanol. The pellet was air dried, re-suspended in 9 pi EcoRI adapters* (0.4 pg / pi) and incubated at 4°C for 30 minutes. 1 pi of this reaction was transferred to a separate tube forming the second-strand synthesis control reaction. The EcoRI adapters were ligated to the blunted cDNA by incubation overnight at

8°C with 1 pi 10 X ligase buffer*, 1 pi 10 mM rATP* and 1 pi T4 DNA ligase* (4 U / pi). The ligase was heat inactivated at 70°C for 30 minutes and the adapter termini phosphorylated with 1 pi 10 x ligase buffer*, 2 pi 10 mM rATP*, 6 pi H^O and 1 pi T4 polynucleotide kinase* (10 U / pi). Following incubation of the reaction at 37°C for 30 minutes, the kinase was inactivated for 30 minutes at 70°C. The cDNA was digested with

28 pi Xhol buffer supplement* and 3 pi Xhol* (40 U / pi) at 37°C for 1.5 hours. The reaction was precipitated overnight at -20°C with 5 pi 10 x STE* (IM NaCl, 200 mM

186 Tris-HCl pH7.5, 100 mM EDTA) and 125 p,l 100% ethanol. Following centrifugation at

13,000 g and 4°C for 60 minutes, the resulting pellet was air dried and re-suspended in 14 p,l 1 X STE buffer*.

5.3.6 Size fractionation and quantification of cDNA

The synthesised and pretreated cDNA reaction was size fractionated using a drip column containing Sepharose CL-2B gel filtration medium* buffered by 1 x STE buffer*. The drip column was washed with 10 ml 1 x STE buffer* before the sample plus 3.5 |xl column loading dye* (50% [v/v] glycerol, 10% [v/v] 10 x STE buffer, 40% [w/v] saturated

Bromophenol blue) was added. Once the sample had entered the column, a further 3 ml of

1 X STE buffer* was applied. Fractions of three drops each were collected when the leading edge of the dye had reached the -0.4 ml gradation of the column. In total, 12 fractions were collected and 8 |uil of each was electrophoresed on a 5% nondenaturing acrylamide gel to assess the success of size fractionation. The cDNA fractions were purified via phenol-chloroform [1:1 (v/v)] extraction and precipitated overnight at -20°C in a volume of 100% ethanol equal to twice the individual fraction volume. Following centrifugation, twice at 13,000 g and 4°C for 60 minutes, the pellets were washed with 200 p,l 80% ethanol, air dried and re-suspended in 3.5 |il H^O. The cDNA fractions were quantified using an ethidium bromide plate assay. 0.5 )al standards of 200, 150, 100, 75,

50, 25 and 10 ng / jil À Hindill fragments (GibcoBRL) in 100 mM EDTA were spotted onto a Petri dish containing: 0.8% agarose, 40 mM Tris-acetate, 1 mM EDTA and 10 p,g ethidium bromide. 0.5 p,l of each cDNA fraction was then spotted onto the same plate. The concentration of DNA in each fraction was calculated following visualisation of the plate over a ultra-violet transilluminator (Alpha Innotech Corporation). Photographs were then taken using a camera system attached to a computer (Alpha Imager 2000 Documentation and Analysis System, Alpha Innotech Corporation).

187 5.3.7 Ligation of cDNA into the Zap Express vector and packaging of recombinats using Gigapack III Gold Packaging extract

Following quantification and size analysis, cDNA fractions 4 and 5 were ligated separately into the ZAP express vector. 70 ng of each cDNA was ligated to 700 ng ZAP Express vector* with 0.5 pi 10 x ligase buffer*, 0.5 pi 10 mM rATP* (pH 7.5) and 0.5 pi T4

DNA ligase* (4 U / pi) overnight at 12°C. The ligations were added to 25 pi aliquots of

Gigapack III Gold packaging extract (Stratagene) in the following quantities: 1 pi cDNA fraction 5 ligation (0.14 pg ZAP Express vector) and 3 pi cDNA fraction 4 ligation (0.42 pg ZAP Express vector). Both reactions were incubated at room temperature for 2 hours before the addition of 500 pi SM buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM

MgSO^, 0.05% gelatin) and 20 pi chloroform. The tubes were mixed and centrifuged briefly to sediment debris from the phage in the supernatant.

5.3.8 Primary library titration and quantification of the proportion of recombinants

The primary libraries were titred by adding 1 pi of the lambda phage to 200 pi of host cells diluted in 10 mM MgSO^ to OD^oq = 0.5. 1 pi of a 1:10 dilution of the packaged material in SM buffer was also added to 200 pi of host cells. The host bacteria used were the XL 1-Blue MRP' strain {A(mcrCBhsdSMR-mrr)\l?> endAl supE44 thi-l recAl gyrA96 relAl lac [F’ proAB Zad^ZM15 TnlO (Tet")]). Host bacteria cultures were created by inoculating NZY broth (90 mM NaCl, 10 mM MgSO^, 0.5% yeast extract, 1% casein hydrolysate, pH7.5), supplemented with 10 mM MgSO^ and 0.2% (w/v) maltose, with a single host bacteria colony and incubating overnight at 37°C with shaking. The phage and bacteria were incubated for 15 minutes at 37°C and then added to 3 ml molten NZY top agar (90mM NaCl, 10 mM MgSO^, 0.5% yeast extract, 1% casein hydrolysate, 0.7% agarose, pH7.5), 15 pi 0.5 M isopropyl-1-thio-P-D-galactopyranodide (IPTG) and 50 pi

5-Bromo-4-chloro-3-indoyl-P-D-galactopyranoside (X-gal). This mixture was plated onto

188 NZY agar plates (90 mM NaCl, 10 mM MgSO^, 0.5% yeast extract, 1% casein hydrolysate, 1.5% bactoagar, pH7.5) which were left to set for 10 minutes, inverted and incubated at 37°C overnight. The number of recombinants / background phage was calculated as: (Number of plaques x dilution factor x total packaging volume) / (Total pg packaged x pi plated).

5.3.9 Amplification of primary library

50 pi of primary library, containing cDNA fraction 4, was added to 600 pi XL 1-Blue

MRF' host cells (OD^ qq = 0.5) and incubated for 15 minutes at 37°C. In total, four aliquots were prepared in this way; each mixed with 6.5 ml molten NZY top agar, plated onto four 150 mm NZY agar plates and incubated for 8 hours at 37°C. The resulting phage were overlaid with 8 ml SM buffer and incubated overnight at 4°C with gentle rocking. The resulting bacteriophage suspension was pooled from all plates as well as 2 ml of SM buffer used to rinse each plate. Chloroform was added to a 5% (v/v) final concentration and incubated for 15 minutes at room temperature. Cell debris was removed by centrifugation twice at 500 g for 10 minutes and chloroform added to a 0.3% (v/v) final concentration. 1 ml aliquots were taken and stored in 7% (v/v) dimethyl sulfoxide

(DMSO) at -80°C. Finally, the titre of the amplified library was determined as described previously (5.3.8) using 1 pi phage stock diluted 1:10,000, 1:100,000 and 1:1,0(X),000 in

SM buffer.

5.3.10 Single-clonein vivo excision

Randomly chosen plaques were cored from plates of the amplified library using a wide bored tip and transferred to 500 pi SM buffer and 20 pi chloroform. The suspension was vortexed to release phage particles and incubated overnight at 4°C. 250 pi of this phage stock was combined in a Falcon 2059 polypropylene tube with 200 pi XL 1-Blue MRF'

(OD^oo =1) and 1 pi Ex Assist helper phage (>1 x 10^ pfu / pi) and incubated at 37°C for

189 15 minutes. 3 ml NZY broth was added and the tubes were incubated for 3 hours at 37°C with shaking. Host cells were killed and the lambda phage lysed by heating at 67°C for 20 minutes. After centrifugation at 1,000 g for 15 minutes, the supernatant contained the excised pBK-CMV phagemid vector, which was decanted into a sterile polypropylene tube. Phagemid were plated through the addition of 100 pi phagemid supernatant to 200 pi host cells (ODgoo =1.0). At this stage the host cells were XLOLR

{A(mcrA)\^?> A(mcrCBhsdSMR-mrr)\l?> endAl thi-l recAl gyrA96 relAl lac [F’ proAB lacf7M\5 TnlO (Telf)] Su (nonsupressing) V (lambda resistant)). Host bacteria cultures were created by inoculating NZY broth with a single host bacteria colony and incubating the culture overnight at 37°C with shaking. The phagemid and cells were incubated at 37°C for 15 minutes before the addition of 300 pi NZY broth and the tubes were returned to 37°C for a further 45 minutes. 200 pi of the cell mixture was plated onto

LB-kanamycin agar plates (180 mM NaCl, 1% tryptone, 0.5% yeast extract, pH7.0, 2% agar, 50 pg / ml kanamycin) and incubated overnight at 37°C.

5.3.11 Analysis of phagemid DNA

Colonies resulting from the single clone excision were used to inoculate 2 ml LB medium

(180 mM NaCl, 1% tryptone, 0.5% yeast extract, pH7.0) and incubated at 37°C with shaking overnight. 1.5 ml of the culture was centrifuged for 1 minute. All centrifugations were performed at 13,000 g. The supernatant was discarded and the cells re-suspended by vortexing in 200 pi TELT (50 mM Tris-HCl pH 7.5, 62.5 mM EDTA, 2.5 M LiCl, 0.4 %

Triton X-100 (Sigma)). The samples were boiled for 1 minute, incubated on ice for 3 minutes to precipitate protein and centrifuged for 15 minutes. The supernatant was retained for DNA precipitation with 120 pi isopropanol, mixed by vortexing and incubated on ice for 15 minutes. The precipitate was centrifuged for 15 minutes and the supernatant discarded. The pellet was washed with 400 pi 70% ethanol, air dried and re-suspended in

10 pi HjO. In order to determine cloned insert size, phagemid DNA was digested by restriction enzymes with recognition sites flanking the insertion site and the size of

190 resulting fragments was determined by agarose gel electrophoresis against known size standards.

The phagemid DNA from 15 randomly chosen excised clones was prepared using a plasmid mini kit (Qiagen) according to the manufacturer's instructions and the identity of the inserts revealed via sequencing from the M l3 reverse and forward primers in the vector

(Cruciform sequencing service, UCL). The six-frame translations of the sequences were compared against the six-frame translations of the non-redundant GenBank nucleotide sequence database. This was possible using the tblastx programme from the NCBI’s

BLAST services (http://www.ncbi.nlm.nih.gov/blast/BLAST.cgi) using BLAST 2.0

(Altschul et al. 1990).

5.3.12 Transfer of library phage DNA to nylon membranes

Library phage were diluted in SM buffer to a final concentration of 200,000 pfu / plate and mixed with 1 ml XL 1-Blue MRF' host cells (OD^oq = 2). Four aliquots of cells and phage were prepared in this way and incubated at 37°C for 20 minutes before the addition of 50 ml molten NZY top agar to each. The plating cultures were poured onto four pre-warmed

200 mm x 200 mm square NZY agar plates and swirled to distribute cells evenly. The plates were left to set for 30 minutes, inverted and incubated at 37°C overnight. The resulting plaques were chilled at 4°C for at least 1 hour. Nylon membranes (Biodyne B,

PALL) slightly smaller in area than the plate, were lowered onto the surface of each for 30 seconds using forceps. The orientation of the filters was marked using a syringe needle to drive blue ink through the filter into the plate below. 2 minutes was allowed for the transfer of phage particles onto rephca membranes and the same orientation marks from the first plaque lift were used. Individual membranes were labelled using a ballpoint pen before the plaque hft. Membranes were laid, phage-particle-side uppermost, onto separate filter papers saturated in denaturing solution (1.5 M NaCl, 0.5 M NaOH), then neutralising solution (1.5 M NaCl, 0.5 M Tris-HCl pH 8.0) and then rinsing solution (2 x SSC).

191 These steps each lasted 5 minutes after which the membranes were air dried for 1 hour and baked at 80°C for 2 hours. Agar plates were stored at 4°C and the membranes between filter paper at room temperature.

5.3.13 Preparation of DNA templates for nucleic acid hybridisation

The wingless (wg) template was created by excising the C. dalmanni wg cDNA insert from within the pGEM-T vector into which it had been previously cloned (Chapter 2).

Digestion was performed with Ncol and Pst\ and the resulting fragments separated by agarose gel electrophoresis. The excised insert was isolated using the QIAEX II agarose gel extraction kit (Qiagen), according to the manufacturer’s protocol. DNA quantification was performed via agarose gel electrophoresis.

The elongation factor 1-a (EFl-a) template was amplified via the polymerase chain reaction (PCR) using the diopsid specific primers: 5' - AAT TTA TTG CAC TAA TCT

GCC - 3' and 5' - GCT GGA ATG AAT GGT TGG ACG - 3' (Baker et al. 2001). Eight

50 pi reactions were performed each containing: HotStarTaq PCR Buffer (including 15 mM MgCl^ (Qiagen)); 1.25 mM each of dATP, dGTP, dTTP; 12.5 pM each EF l-a primer; 1.25 units HotStarTaq DNA polymerase (Qiagen). The PCR protocol was 15 min. at 95°C, 35 cycles of (1 min at 94°C, 1.5 min. at 55°C, 2 min. at 72°), 10 min. at 72°C and held at 4°C. PCR was performed on a Gene Amp PCR system 9700 (Perkin Elmer). The

PCR reactions were pooled and the PCR product separated from unincorporated nucleotides and primers via agarose gel electrophoresis. The PCR product was isolated and quantified as described above.

5.3.14 Radiolabelling of DNA probes by random priming

Two 10 ng aliquots of wg DNA template were diluted in TE (10 mM Tris-HCl pH8.0, 1 mM EDTA) to a total volume of 45 pi and denatured by boiling for 5 minutes. A 20 ng

192 aliquot of EFl-aD NA template was also treated in this manner. The denatured DNA was transferred to three separate redipnmQ II reaction tubes (Amersham Pharmacia Biotech) and flicked until re-suspended. 30 pCi Redivue [^^P] dCTP (ICN) was then added to each and the reactions heated for 10 minutes at 37°C. The labelled probes were purified from unincorporated nucleotides using Sephadex G-50 NICK columns (Amersham Pharmacia

Biotech). The colunms were equihbrated with 400 pi TE before the probe reactions were applied. A further 400 pi TE was added to each of the columns and the waste discarded following gravity flow. A final 400 pi TE was applied and the three sets of flow-through, containing labelled probes, were retained and boiled for 10 minutes.

5.3.15 Nucleic acid hybridisation of library membranes

Four nylon transfer membranes of hbrary phage DNA and their replicates (5.3.12) were wetted in 2 X SSC and pre-hybridised for over 2 hours at 65°C in hybridisation buffer

(1.8 M NaCl, 180 mM sodium citrate, 0.15 M EDTA, 0.5% SDS, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin, 100 pg / ml denatured sonicated salmon sperm DNA). Hybridisation was performed at 65°C overnight with hybridisation buffer and labelled probe. One membrane and its rephcate were incubated with the entire

£F7-a labelled probe reaction (5.3.14) whilst the remaining three membranes and their replicates were each hybridised with two-thirds of the wg labelled probe reactions (5.3.14).

All membranes were washed at 65°C for 1 hour in solution A (1 x SSC, 0.1% SDS, 0.1% sodium pyrophosphate) and then 2 x 1 hour in solution B (0.1% x SSC, 0.1% SDS, 0.1% sodium pyrophosphate). Membranes were exposed to autoradiography film (Hyperfilm

MP, Amersham Pharmacia Biotech) and then processed (Xograph Compact X2, Xograph imaging systems).

193 5.4 RESULTS

5.4.1 Construction of a third instar C.dalmanni larval cDNA library

Complementary DNA (cDNA) was synthesised from third instar C dalmanni larval messenger RNA (mRNA). The cDNA was separated according to size using a drip column and twelve fractions were collected in total. The effectiveness of size fractionation was assessed via nondenaturing acrylamide gel electrophoresis. High molecular weight nucleic acid was observed in fractions 4, 5, and 6 indicating the presence of cDNA.

Conversely, unincorporated nucleotides and residual adapters of low molecular weight were detected in fraction 12. The nucleic acid within each fraction was quantified by an ethidium bromide plate assay (Fig. 5.1). A comparison of the staining intensity obtained from standards and the experimental fractions revealed that fractions 4, 5 and 6 contained roughly 25 ng / pi cDNA, This assay also confirmed the presence of unincorporated nucleic acids in later fractions. Fractions 4, 5 and 6 contained higher quantities of transcripts than earher fractions and the length of cDNA from fractions 4 and 5 was greater than those present in later samples, including fraction 6. Based on these results, libraries were prepared from fractions 4 and 5.

5.4.2 Characterisation of the primary libraries

Two primary libraries were created by the hgation of cDNA from fractions 4 and 5 with the ZAP Express vector (Stratagene). The proportion of phage containing cloned inserts was assayed via blue / white selection. Phage from the primary library which contained fraction 4 cDNA, resulted in 1.2 x 10^ recombinant pfu / pg of arms and 8.3 x 10^ background pfu / pg of arms. Phage from the primary library which contained fraction 5 cDNA, resulted in 1.2 x 10^ recombinant pfu / pg of arms and 1.1 x 10"^ background pfu / pg of arms. The number of recombinant plaques was therefore over a hundred-fold above

194 background in both libraries. The titre of the primary libraries containing fraction 4 and 5 cDNA was 1x10^ and 3x10^ pfu / ml respectively.

5.4.3 Amplification of a primary library

Primary libraries can be unstable therefore amplification of the library was performed immediately. The primary library containing cDNA fraction 4 was selected for amplification because fraction 4 was collected earlier from the drip column than fraction 5, and was therefore more likely to contain longer cDNA transcripts. The titre of the phage from the amplified library was 1 x 10^ pfu / ml, confirming that amplification had occurred. It was also shown that the number of recombinant phage remained a hundred­ fold over background phage.

5.4.4 Analysis of library insert size

In vivo excision was performed on phage randomly chosen from the amphfied library.

Restriction enzymes, with recognition sites flanking the insertion site, were used to digest the resulting phagemids and the length of inserts, if present, was determined. In vivo excision was successfully performed on forty phage and all phagemid contained inserts.

The average insert size was 1.9 kb and the range of insert lengths was between 4.5 and 0.5 kb (Fig. 5.2).

5.4.5 Examination of library insert identiy

In vivo excision also enabled analysis of the insert DNA sequence. The inserts within fifteen randomly chosen phagemid were sequenced producing expressed sequence tags

(ESTs). Only six C. dalmanni gene regions have previously been described (Baker et al.

2001), consequently the inserts were identified by comparison with sequences from other species within the non-redundant GenBank nucleotide database. Protein identity is more

195 likely to be conserved between species than nucleotide sequence due to the redundancy of the genetic code. The six-frame translations of each sequence were therefore compared against the six-frame translations of the sequences within the nucleotide database.

Significant similarities in protein identity were found between eight insert sequences and genes within the database (Table 5.1). Drosophila melanogaster is the most closely related model organism to C. dalmanni. It was therefore unsurprising that the identified insert sequences shared the highest sequence similarity with D. melanogaster genes. No significant sequence similarities were found between the remaining inserts and known genes.

5.4.6 Comparison of common and rare transcript abundance

The relative abundance of common transcripts within the library was determined by examination of the housekeeping gene, Elongation factorl-a (EFl-a). E F l-a is involved in protein synthesis and is ubiquitously expressed in all cells and all developmental stages of Drosophila melanogaster (Ackermann and Brack 1996). The relative abundance of

£F7-acDNA within the library was determined by high stringency hybridisation of a C. dalmanni E F l-aD H k probe against a library plaque lift. The library membrane contained the DNA from 200,000 library phage and approximately 800 positives were identified.

The frequency of £F7-a transcripts was therefore 0.4%. The abundance of rare transcripts was determined by an examination of wingless (wg). Hybridisation of library membranes with a C. dalmanni wg DNA probe revealed 2 positives. The frequency of wg transcripts was therefore 0.001%.

196 5.5 DISCUSSION

5.5.1 A third instar C. dalmanni larval cDNA library was successfully constructed and established as a excellent resource for the isolation of novel genes

We have successfully produced a third instar C dalmanni larval complementary DNA

(cDNA) library. cDNA was synthesised from larval messenger RNA (mRNA) and separated into fractions according to size using a drip column. The assays we performed revealed that size fractionation was effective and subsequently, we were able to select the optimal fraction of cDNA from which to create a library balancing quantity and size of transcripts.

A series of experiments were performed to assess the value of the library we had created.

Firstly, the proportion of phage containing cDNA transcripts was determined via blue / white selection. The frequency of recombinants was a hundred-fold over background phage confirming the usefulness of the library as a source of transcripts. In vivo excision enabled the isolation of inserts within phagemids from randomly chosen phage. All phagemids successfully recovered, contained transcripts confirming the high proportion of recombinant phage within the library. The average size of inserts was 1.9 kb although cDNAs in excess of 4 kb were recovered. This assay indicated the value of the library for the procurement of full-length Cyrtodiopsis transcripts, for example, the average length of transcripts within the mouse embryo is approximately 2 kb (Harrison et al. 1995).

Randomly selected inserts were sequenced producing novel expressed sequence tags

(ESTs) relating to known and previously uncharacterised genes (Table 5.1). The ESTs contained poly(T) stretches which illustrated that the cDNA was synthesised from processed RNA with poly (A) tails and the orientation of inserts was correct. Several ESTs shared significant sequence similarities, at the amino acid level, with known D. melanogaster genes. The range of different genes identified demonstrated the variety of

197 transcripts present in the library. The remaining ESTs were unidentified, as they did not contain conserved protein regions. Approximately 500 bp from each end of the ESTs was analysed, therefore sequence conservation may be present in the regions of the ESTs, which were not sequenced. Finally, an examination of transcript abundance revealed that the concentration of the library was sufficient to isolate rare transcripts relatively easily.

This observation further establishes the value of the library.

5.5.2 The library is a vital resource for the study of the regulators of head development

The molecular biology of stalk-eyed flies is largely unknown which is a reflection of an absence of molecular genetic resources for the species. We developed a larval cDNA library to investigate developmental processes, which are regulated by genes expressed at this stage. Hybridisation of the library, with probes derived from other species or degenerate PCR products, will identify phage containing the cDNA of interest. Probes may then be created for in situ hybridisation, the distribution of the transcript in stalk-eyed fly head tissues determined and consequently, the role of the gene in the formation of hypercephaly revealed.

An alternative method with which to examine gene function is also possible using the ZAP

Express vector. We have previously illustrated the informative nature of an investigation into cross talk between different regulators (e.g. orthodenticle and defective ventriculus.

Chapter 4). Many of the genes known to be involved in developmental processes encode

DNA binding proteins such as transcription factors. South-western screening of the cDNA library we have created, could isolate proteins which bind and therefore regulate the genes we have identified. Isopropyl-1-thio-P-D-galactopyranodide (IPTG) induces expression from the lac promoter within the library lambda vector and the cDNA inserts are translated into proteins. Unidirectional cloning ensures that inserts are translated in the correct orientation. Membranes containing the proteins from the library could then be

198 hybridised with transcripts thought to contain DNA-binding protein specific sequence.

DNA-binding proteins would be identified, assuming that the expressed proteins are functional.

199 Table 5.1 Expressed sequence tags (ESTs) which were identifîed hy comparison with sequences from other species within the non-redundant GenBank nucleotide database

Expectation Accession EST Associated gene value * number Slib2 le-64 AE003661 Diphenol oxidase A2 Glutamine :fmctose-6-phosphate SlibV 4e-36 AE003355 aminotransferase Slib8 9e-06 AE003507 ariadne-1 Slib9 6e-80 AE003678 CG7483 Wg32R le-33 AE003437 Spt6 Wg42R 2e-39 AE003462 Muscle LIM protein 60A Wg52R 9e-93 AE003467 Larval serum protein gamma

* The expectation value is the number of different alignments with scores equivalent to or better than the EST alignment that are expected to occur in a database search by chance.

The lower the expectation value, the more significant the EST alignment score.

200 Fig. 5.1 Ethidium bromide plate assay of cDNA fractions

Synthesised cDNA was size fractionated using a drip column and 12 fractions were collected. Known quantities of X Hind III fragments (top) and aliquots of the fractions

(bottom) were spotted onto an agarose plate containing ethidium bromide and exposed to ultra-violet radiation. The quantity of DNA in each fraction was determined by comparison of staining intensity between standards and experimental samples.

Y Standards ng/ul

200 150 100 75 50 25 10

10 * 11 * 12 # #

Fractions

201 Fig. 5.2 Frequency histogram of insert size (kb) from phagemids randomly chosen from amplified library

The cDNA library was plated onto agar and plaques randomly selected. Phagemids were derived from the resulting phage suspensions and the size of forty inserts was deduced via restriction enzyme digestion. The frequency of insert sizes is shown.

12

10

>. o c 0) 3 C7 0) a 0.25 0.75 1.25 1.75 2.25 2.75 3.25 3.75 4.25 Insert size (kb)

202 5.6 REFERENCES

Ackermann, R. and Brack, C. 1996. A strong ubiquitous promoter-enhancer for development and aging of Drosophila melanogaster. Nucleic Acids Res. 24: 2452-2453.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. 1990. Basic local alignment search tool, J. Mol Biol 215: 403-140.

Baker, N. E. 1988. Transcription of the segment-polaiity gene wingless in the imaginai discs of Drosophila, and the phenotype of a pupal-lethal wg mutation. Development 102:

489-497.

Baker, R, H., Wilkinson, G. S. and DeSalle, R. 2001. The phylogenetic utility of different types of molecular data used to infer evolutionary relationships among stalk-eyed flies

(Diopsidae). Syst. Biol 50: 1-20.

Burkhardt, D. and de la Motte, I. 1994. Signaling fitness: larger males sire more offspring.

Studies of the stalk-eyed fly Cyrtodiopsis whitei (Diopsidae, Diptera). J. Comp. Physiol

A 174: 61-64.

Harrison, S. M., Dunwoodie, S. L., ArkeU, R. M., Lehrach, H. and Beddington, R. S. P.

1995. Isolation of novel tissue-specific genes from cDNA libraries representing the individual tissue constituents of the gastrulating mouse embryos. Development 121: 2479-

2489.

Haynie, J. L. and Bryant, P. J. 1986. Development of the eye-antenna imaginai disc and morphogenesis of the adult head in Drosophila melanogaster. J. Exp. Zool 237: 293-

308.

203 6

General discussion

204 6.1 SUMMARY

As a consequence of extensive studies by evolutionary biologists, we are beginning to know why the exaggerated eyespan of the stalk-eyed fly has evolved. However, the developmental genetics underlying this, and other sexually selected traits, is largely unknown. Unless we understand the development of novel morphologies, such as hypercephaly, we cannot appreciate how phenotypic diversity has evolved. I therefore examined the developmental genetics of the exaggerated eyespan in stalk-eyed flies in order to understand the evolution of this novel and sexually selected trait.

6.11 Conserved gene expression patterns but dissimilar disc morphologies

The comparison of conserved developmental pathways in different species has previously been used to study the evolution of phenotypic novelty (e.g. butterfly eyespots, Carroll et al. 1994). I applied this approach to the study of exaggerated eyespan in Diopsid stalk­ eyed flies. I assumed that the genes which pattern the Drosophila head also generate the eyestalks of the stalk-eyed fly and compared these genes between species with varying degrees of hypercephaly. The general patterning of the key regulators of Drosophila head development. Distal-less (Dll), engrailed (en) and wingless (wg), are conserved in the stalk-eyed fly disc.Thesedata, combined with morphological observations, suggested that the basic division of the discs into anteiior-antenna and posterior-eye is similar. Although the eye and antenna are adjacent in adult Diopsids, a stalk-eyed fly specific region, the

“disc-stalk”, divides the primordia of these structures, en and wg expression, which defines the medial and lateral boundaries of the dorsal head in Drosophila, was detected in the posterior portion of the stalk-eyed fly disc. This implied that the posterior portion, rather than the disc-stalk, gives rise to the adult eyestalk. In addition, the en-wg expression domain is unchanged in Diopsidae species with varying degrees of hypercephaly, which indicated that variation within the trait is generated at a later developmental stage than I examined.

205 6.12 Fate map of the stalk-eyed fly eye-antennal disc

In vivo culture of fragments of the stalk-eyed fly eye-antennal disc was used to test the unexpected findings from the comparative expression assay. The regional identity of the

Drosophila eye-antennal disc has been mapped by expression analysis (Royet and

Finkelstein 1995) but in vivo culture was originally employed to determine the location of the head capsule precursors (Haynie and Bryant 1986). In vivo culture was used to study the stalk-eyed fly because it is a more direct method of determining regional specification than expression analysis and the molecular genetic tools available in this species were limited. This work confirmed that the anterior disc portion gives rise to the antenna, whilst the eye and dorsal head capsule are derived from the posterior portion. The location of the palpus primordia was also identified for the first time via this method. Together, the results from my molecular analysis and in vivo culture identified the arrangement of the head capsule precursors within the stalk-eyed fly disc. Surprisingly, each disc portion gives rise to structures that are widely separated in the adult and structures, which are adjacent in the adult, are derived from different disc regions. Even though it is relatively crude, the fate map derived from this work is crucial for the interpretation of future expression analysis in the stalk-eyed fly.

6.13 Novel regulators of head morphogenesis

Although the developmental genetics of Drosophila thoracic imaginai discs has been extensively studied, our knowledge of eye-antennal disc patterning is limited. There are many molecular genetic tools available for the investigation of development within model organisms and the information gained from these animals is essential for the study of other species, which are less well characterised, such as the stalk-eyed fly. A small-scale screen of 97 P-element enhancer trap lines was consequently used to uncover novel regulators of Drosophila dorsal head capsule morphogenesis. Comparative analysis of expression and sequence data with known genes identified eight candidates, which were

206 potentially related to my aim. Further study was focused on one of these previously overlooked genes, defective ventriculus (dve). The role of dve in dorsal head capsule morphogenesis was confirmed through expression analysis. Dve is distributed in a similar manner to a known regulator of head development, Orthodenticle (Otd), but is absent from ocelliless {oc) mutants, which suggested that dve acts downstream of otd to pattern the dorsal head capsule. The role of this pathway, in the evolution of hypercephaly, was subsequently investigated. Interestingly, dve expression was conserved in the stalk-eyed fly eye-antennal disc, allowing for morphological differences between the Drosophila and stalk-eyed fly discs, and it was the first gene to be detected in the stalk-eyed fly specific disc-stalk.

6.14 Molecular genetic resource for the stalk-eyed fly

Through my P-element enhancer trap screen the number of genes implicated in

Drosophila head capsule morphogenesis was extended. However, it was only possible to examine a few of these genes in my study organism due to the limited availability of pan­ specific probes. A stalk-eyed fly third instar larval cDNA library was therefore created for the generation of probes for in situ hybridisation studies. An engineered vector was employed to aid sequencing and transcription of inserts. This construct also facihtated the characterisation of the library. A large proportion of recombinants was demonstrated which indicated that a high density of inserts was present within the library. The inserts were on average 1.9 kb in length although inserts of up to 4.5 kb were recovered. It is therefore likely that full-length transcripts are present which would make excellent probes.

Furthermore, high stringency hybridisation illustrated that rare, as well as abundant, transcripts could be relatively easily isolated. In summary, the library was shown to be a useful and much needed resource for the study of stalk-eyed fly developmental genetics.

207 6.2 FUTURE WORK

6.21 Different species of stalk-eyed fly

The work I have performed has provided several unexpected findings. The arrangement of the adult stalk-eyed fly head is inconsistent with the regional specification of eye-antennal disc from which it is derived. I also revealed that the Diopsid eye-antennal disc contains a stalk-eyed fly specific region of tissue of unknown function. To further explore these findings, it would be interesting to examine the morphology and gene expression patterns of the eye-antennal disc within other families of stalk-eyed flies. This work would determine if the disc-stalk is a Diopsid specific character or if it is present in all species of stalk-eyed fly. The relationship between regional specification of the disc and final adult morphology may be more fully understood by examining non-Diopsid stalk-eyed fly species with medial antennae, such as Achias australis (Diptera, Platystomatidae,

McAlpine 1979) ox Drosophila heteroneura (Diptera, Drosophilidae). An investigation of these species would reveal if the position of the disc-stalk is modified in relation to the antenna primordia, when the location of adult head structures is changed. Diopsid stalk­ eyed fly species with ventral specific eyestalk markers could also be used to create a more detailed fate map of the eye-antennal disc.

6.22 In vitro studies

The morphogenetic movements of the Drosophila eye-antennal disc during metamorphosis have been investigated through in vitro studies (Milner et al. 1983, Milner et al. 1984). The same technique could be used to show how the stalk-eyed fly disc rearranges during the formation of the adult head capsule. This method may also elucidate the function of the disc-stalk. Without ventral head capsule markers, I was unable to rule out the possibility that this tissue formed some part of the eyestalk. I hypothesised that the disc-stalk may not be directly involved in head capsule morphogenesis but instead be

208 destroyed by apoptosis during metamorphosis. It would be possible to trace the fate of the disc-stalk during in vitro studies in order to settle this dispute. During pilot studies for my in vivo work, I successfully cultured stalk-eyed fly discs in Drosophila hosts. This work suggests that the hormonal miheu necessary for growth and differentiation are similar in both species and the in vitro culture conditions may therefore be comparable.

6.23 Later developmental stages

I examined the morphology and gene expression patterns of third instar stalk-eyed fly eye-antennal discs. The conservation of these characters between species with varying degrees of hypercephaly and complementary work performed by other members of our group (Bjorksten et a l 2000) lead us to propose that variation within this trait is generated later in development. I could test this hypothesis by examining gene expression at early pupal stages. The fate of the disc-stalk could also be traced during this phase through the detection of dve, which is expressed in this region of the disc at earlier developmental stages. Buschbeck et al, (2001) followed the growth of the eyestalk during metamorphosis by taking sections of developing pupae. It may be possible to observe the morphogenetic movements of the eye-antennal discs by this technique. Alternatively, staged pupae could be dissected.

6.24 Novel regulators of head morphogenesis

It was surprising to find that a gene involved in gut development (dve) might also play a role in the regional specification of the head capsule. I was able to characterise the function of dve within dorsal head capsule morphogenesis to a limited extent. It would be interesting to further explore the role of this gene, and the other novel regulators I discovered, in Drosophila using the full range of molecular genetic tools available to this model organism. The screen I performed could also be extended to the remaining enhancer trap lines held in stock centres. Furthermore, gene trap hnes, which enable genes

209 to be identified through their phenotypic effects, could be used to identify genes that affect

head capsule morphology.

Following the creation of my stalk-eyed fly cDNA library, it would now be possible to

examine a wider range of the genes imphcated in head capsule morphogenesis. Low

stringency hybridisation and degenerate PCR based screens could be used to clone genes

with conserved DNA or amino acid sequences. It would then be possible to transcribe these genes for expression analysis via in situ hybridisation. The regulatory interactions between genes of interest could also be investigated by South-western screening of the library.

6.25 Sexual dimorphism

Despite the significant sexual dimorphism in the eyespan of C. dalmanni, I have found no evidence for a size difference between male and female late third instar whole discs or disc-stalk regions. If I was able to determine the sex of individuals at larval or pupal stages it would be possible to conclusively test for sex-specific differences in morphology or gene expression patterns during development. In Drosophila, the sex of third instar larvae is easily distinguished by examining the size of the gonads. Unfortunately, these structures are sexually monomorphic in C. dalmanni (personal observations). However, in other Dipteran species genital disc morphology differs between the sexes and it may therefore be possible to distinguish Diopsidae larvae in this way. Recently, it has been shown that the regulation of sexually dimorphic pigmentation in species of Drosophila is due to the integration of the sex-determination and segmentation pathways (Kopp et al.

2000). It would be fascinating to see if a similar interaction occurs between the sex- determination and head morphogenesis pathways in sexually dimorphic species of stalk- eyed fly.

210 Ultimately, a wealth of information about the evolution of novel morphologies could be determined from the developmental genetics of the stalk-eyed fly. The morphological and expression data I have provided, as well as the resources I have created, wiU greatly benefit any future work in this field.

211 6.3 REFERENCES

Bjorksten, T. A., Pomiankowski, A. and Fowler, K. 2001. Temperature shock during development does not increase fluctuating asymmetry of a sexual trait in stalk-eyed flies.

Proc. R. Soc. Lond. B 268: 1503-1513.

Buschbeck, E. K., Roosevelt, J. L. and Hoy, R. R. 2001. Eye stalks or no eye stalks: a structural comparison of pupal development in the stalk-eyed fly Cyrtodiopsis and in

Drosophila. J. Comp. Neurobiol. 433: 486-498.

Carroll, S. B., Gates, J., Keys, D. N., Paddock, S. W., Panganiban, G. E. P., Selegue, J. E. and Williams, J. A. 1994. Pattern formation and eyespot determination in butterfly wings.

Science 265'. 109-114.

Haynie, J. L. and Bryant, P. J. 1986. Development of the eye-antenna imaginai disc and morphogenesis of the adult head in Drosophila melanogaster. J. Exp. Zool. 237: 293-

308.

Kopp, A., Duncan, I. and Carroll, S. B. 2000. Genetic control and evolution of sexually dimorphic characters in Drosophila. Nature 408: 553-559.

McAlpine, D. 1979. Agonistic behavior in australis (Diptera, Platystomatidae) and the significance of eye-stalks. In: Blum, M. and Blum, N. (eds) Sexual selection and reproductive competition. Academic Press, New York, pp 221-230.

Milner, M. J., Bleasby, A. J. and Pyott, A. 1983. The role of the peripodial membrane in the morphogenesis of the eye-antennal disc of Drosophila melanogaster. Roux’s Arch.

Dev. Biol. 192: 164-170.

Milner, M. J., Bleasby, A. J. and Pyott, A. 1984. Cell interactions during the fusion in vitro 0 Ï Drosophila eye-antennal imaginai discs. Roux's Arch. Dev. Biol. 193: 406-413.

Royet, J. and Finkelstein, R. 1995. Pattern formation in Drosophila head development: the role of the orthodenticle homeobox gene. Development 121: 3561-3572.

212