Unravelling the Evolutionary Histories of Disjunct and Invasive

Home , Gentianella quinquefolia, Gypsophila fastigiata, Heterolepis, Ixanthus, Obolaria, Sporobolus

COMPARATIVE PHYLOGEOGRAPHY IN CONSERVATION BIOLOGY:

UNRAVELLING THE EVOLUTIONARY HISTORIES OF DISJUNCT AND INVASIVE

SPECIES AROUND THE LAURENTIAN GREAT LAKES

A dissertation submitted to the Committee on Graduate Studies

in partial fulfilment of the requirements for the degree of

Doctor of Philosophy

in the Faculty of Arts and Science

TRENT UNIVERSITY

Peterborough, Ontario, Canada

Environmental and Life Sciences Ph.D. Graduate Program

May 2015

ProQuest Number: 10186783

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion.

ProQuest 10186783

Published by ProQuest LLC ( 2016 ). Copyright of the Dissertation is held by the Author.

ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, MI 48106 - 1346

ABSTRACT

COMPARATIVE PHYLOGEOGRAPHY IN CONSERVATION BIOLOGY:

UNRAVELLING THE EVOLUTIONARY HISTORIES OF DISJUNCT AND INVASIVE

SPECIES AROUND THE LAURENTIAN GREAT LAKES

Claudia Ciotir

Phylogeographic histories of taxa around the Great Lakes region in North America are relevant to a range of ongoing issues including conservation management and biological invasions. In this thesis I investigated the comparative phylogeographic histories of plant species with disjunct distributions and plant species with continuous distributions around the Great

Lakes region; this is a very dynamic geographic area with relatively recent colonisation histories that have been influenced by a range of factors including postglacial landscape modifications, and more recently, human-mediated dispersion. I first characterized four species that have disjunct populations in the Great Lakes region: (Bartonia paniculata subsp. paniculata,

Empetrum nigrum, Sporobolus heterolepis, and Carex richardsonii). Through comparisons of core and disjunct populations, I found that a range of historical processes have resulted in two broad scenarios: in the first scenario, genetically distinct disjunct and core populations diverged prior to the last glacial cycle, and in the second scenario more recent vicariant events have resulted in genetically similar core and disjunct populations. The former scenario has important implications for conservation management. I then characterized the Typha species complex (T. latifolia, T. angustifolia, T. x glauca), which collectively represent species with continuous ii

distributions. Recent microevolutionary processes, including hybridization, introgression, and intercontinental dispersal, obscure the phylogeographic patterns and complicate the evolutionary history of Typha spp. around the Great Lakes region, and have resulted in the growing dominance of non-native lineages. A broader geographical comparison of Typha spp. lineages from around the world identified repeated cryptic dispersal and long-distant movement as important phylogeographic influences. This research has demonstrated that comparisons of regional and global evolutionary histories can provide insight into historical and contemporary processes useful for management decisions in conservation biology and invasive species.

KEY WORDS

Chloroplast DNA, cryptic introductions, disjunct populations, invasive species, microsatellites, next generation sequencing postglacial recolonisation, phylogeography.

iii

ACKNOWLEDGEMENTS

The last five years of my life have been a great learning journey and I would have not arrived here without the help of many people. My project covered a lot of ground and I owe a great debt of gratitude to the many people who have contributed to the work laid out on these pages, colleagues, co-workers, friends, family, and kind science lovers, your help has been extremely valuable to me. This dissertation would not have been possible without the exceptional guidance and support of my supervisor Dr. Joanna Freeland. Joanna was immensely generous with her time and resources, patiently reading draft by draft securing research and travel funding. She was an unwavering advocate for the work I was doing and continuously helped and encouraged me in writing-up articles. More than anything Joanna inspired me to have confidence when I wandered off before my qualifying exam or struggled to defend my thesis proposal. She taught me to be rational, kind and humble but also keen and focused, and has become a true collaborator, one I look forward to continuing to do science with for years to come.

Thanks also to my committee Dr. Marcel Dorken and Dr. Paul Wilson for their time, expertise, encouragement and constructive comments on my thesis and to Dr. Bradley White for his advice in hybridization of cattails and for broadening my thesis horizons during my qualifying exam. A huge thank you goes to Dr. Chris Wilson who deserves a formal recognition for being in my qualifying exam and thesis defence committees and for showing me how to grow. His willingness to help was always above and beyond the call of duty. Chris was a great mentor who instilled confidence in my ideas, offered a balanced understanding of the phylogeography and hybridization, and genuinely made me feel a peer of the academia. I am a better scientist for his influence, always turning the impossible into a possibility, always offering iv

resourceful books and relevant research papers. Overall, I feel so very fortunate to have had such passionate mentors during my doctoral work.

I would like to thank Trent University for the financial support I received during this project via Jack Matthew and Sara Bursaries for field trip and conference travel, and for research and travel grants secured by Joanna Freeland. In addition, Parks Ontario and National Sciences and Engineering Research Council of Canada (NSERC) funded this study as well. I would always remember the kindness of the graduate studies officers Jane Rennie, Erin Davidson, Jen

Richardson, Linda Cardwell and Mary Lynn Scriver who always send me home with a smile of hope making sure that I had the right paperwork, a decent bursary or a quiet office set to be able to work on my thesis.

Many thanks to all the past and present members of the Freeland lab, Nicole Vachon,

Jennifer Paul, Heather Kirk, Jessica Szabo, Sage Fleming, Allison Marinich, Anna Cho, Connor

Walsh, Laura Wensink and Sara Pieper for their support and constructive criticism over the years. I thank all the volunteers who helped me extract hundreds of DNA samples Angeline

Pitawanakwat, Daria Molodtsova, Candace Connolly, Victoria Campbell, Jessica Szabo and

Denis Baker. I am indebted to Amy Detta, Larissa Nituch, Joanna Zigouris and Stan Yavno for generously generously supplemented my sequence data on their left over plates. Thank-you to

Dr. Cornelya Klutsch for critical and constructive phylogenetic discussions that improved my manuscripts especially during late evenings. A special thank –you to Dr. Joanna Zigouris for continuous support and software tweaking scripts when I got stuck and for pushing me to reach the finish line together. Many thanks to other post-doctoral members Heather Kirk and Erin

Koen for kindly reviewing my thesis proposal, to Jeff Row, Celine Gomez, Laura Finnegan,

Agnes Pelletier, Mohammed Alshamlih, Vythegi Srithayakumar and Laura Thompson for useful

guidance and to PhD student and friend Ryan Franckowiak for useful comments and suggestions on my thesis synthesis.

I am indebted to lab technicians Kristyne Wozney, Anne Kidd, Caleigh Smith, Emily

Kerr, Brad Seyler, Jennifer Dart, Marina Kerr, Dale Irene McKay and Smolly Coulson. A special thank-you to Matthew Harnden for his IT assistance with Linux and GS assembly software for the next generation sequencing data. I owe big to my office mates Dr. Michael Donaldson who kindly helped with Python Blast searches and to the wise Jason Rae who patiently read my abstracts, listened to my ramblings and never protested that I continuously invaded his office space. A warm thank you to all American Typha collectors, Eva, William and Kelvin Conrad,

Mike Oldham, Sam Brinker, Stephi Coulson, Matt Harden, Morgan and Walter Wehtje, Stan

Yavno, Jennifer Coughlan, Serena Caplins, Sarah Dungan and Nicole Vachon. I have a huge gratitude to all Typha collectors and helpers with my European field trip collection and logistics including the ones from UK: Drs. Jonathan Mitchley, Alastair Culham and Kalman Konyves, and friend Alex Radu. I am especially grateful to Dr. Chris Yesson and his kind wife Donna who collected cattails from across the world and sent them from UK with special care and descriptions. Your unconditional friendship, scientific mentoring, and evolutionary perspectives are priceless. I am indebted to my adoptive Italian family, to my Colombian, French and

Romanian friends that hosted me and my son during our European field trip and herbarium visits.

I am so grateful to my parents, Ion and Lucia from Romania, who had faith in me, and taught me early on that we all stand on the shoulders of those who have come before us. I now fully appreciate the sentiment in those words, your wisdom, encouragement, and unfailing support. Finally, to my son Sabin and to my partner Nick who encouraged me when it was challenging or enjoyed small victories of this journey, you are my greatest source of calm,

perspective, and unconditional love. Over the last six years, you fought every of my time line due-dates picking me out of the mud in the field, solving IT emergencies, labeling samples, filling tips in the lab, and making coffee to keep me awake when sunk in my writing. Without a doubt, I could have not accomplished nearly what I have without you.

vii

PREFACE

My dissertation has been written in manuscript format. Chapter 2 has been published in

Botany, Chapter 4 has been published in Biology of Invasions and Chapter 5 has been published in Fundamental Applied Limnology. As such, each chapter is presented in the style of the journal to which it was submitted. In this dissertation, each chapter is the result of multiple collaborations and I use the plural “we” throughout the manuscript chapters. Collaborators are indicated on the abstract page for each chapter.

viii

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGEMENTS ...... iv

PREFACE ...... viii

LIST OF TABLES ...... xi

LIST OF FIGURES ...... xiii

LIST OF APPENDICES ...... xvi

CHAPTER 1 ...... 1

GENERAL INTRODUCTION ...... 1

References ...... 8

CHAPTER 2 THE EVOLUTIONARY HISTORY AND CONSERVATION VALUE OF DISJUNCT BARTONIA PANICULATA SUBSP. PANICULATA (BRANCHED BARTONIA) POPULATIONS IN CANADA ...... 14

Abstract ...... 15 Keywords: ...... 15 Introduction ...... 16 Methods ...... 20 Results ...... 26 Discussion ...... 29 Acknowledgements ...... 32 References ...... 33

CHAPTER 3 CONTRASTING PATTERNS OF PHYLOGEOGRAPHY IN DISJUNCT POPULATIONS OF THREE PLANT SPECIES IN THE GREAT LAKES REGION ...... 55

Abstract ...... 55 Introduction ...... 56 Material and methods ...... 59 Results ...... 61 Discussion: ...... 63 References ...... 69

CHAPTER 4 INTERCONTINENTAL DISPERSAL OF TYPHA ANGUSTIFOLIA AND TYPHA LATIFOLIA BETWEEN EUROPE AND NORTH AMERICA HAS IMPLICATIONS FOR TYPHA INVASIONS ...... 88

Abstract ...... 89 Introduction ...... 90 Methods ...... 92 Results ...... 100 Discussion ...... 103 Acknowledgements ...... 107 References ...... 108

CHAPTER 5 PRELIMINARY CHARACTERIZATION OF TYPHA LATIFOLIA AND T. ANGUSTIFOLIA FROM NORTH AMERICA AND EUROPE BASED ON NOVEL MICROSATELLITE MARKERS IDENTIFIED THROUGH NEXT- GENERATION SEQUENCING ...... 126

Abstract ...... 127 Introduction ...... 128 Material and Methods ...... 129 Results and Discussion ...... 131 Acknowledgments ...... 134 Conflict of Interest ...... 134 References ...... 134

CHAPTER 6 CONTRASTING PATTERNS OF GLOBAL PHYLOGEOGRAPHY IN THREE INCREASINGLY DOMINANT CATTAIL SPECIES (TYPHA ANGUSTIFOLIA, T. DOMINGENSIS, AND T. LATIFOLIA)...... 141

Abstract ...... 141 Introduction ...... 142 Material and methods ...... 145 Results ...... 148 Discussion ...... 151 Conclusions ...... 155 Acknowledgements ...... 156 References ...... 157

CHAPTER 7 GENERAL DISCUSSION ...... 180

References ...... 188

LIST OF TABLES

Table 2.1 Locations and sample sizes of Bartonia spp. and outgroups that were sequenced in this study. See Figure 2.1 for map of locations...... 43

Table 2.2 Primers used for cpDNA amplification in Bartonia spp., G. quinquefolia and O. virginica ...... 43

Table 2.3 PCR conditions used for cpDNA amplification ...... 44

Table 2.4 Best-fit models of nucleotide substitution for each of the five cpDNA regions selected under the Akaike information criterion (AIC)...... 44

Table 2.5 Node calibration points resulted from the matK and trnL-trnF analyses. For each node, mean ages (in My), standard deviation (SD) and the lowest and the largest percentile of the Highest Posterior Density (HPD) are presented...... 45

Table 2.6 TRMC estimates and confidence intervals 95% HPD (confidence index) ...... 45

Table 3.1 PCR conditions used for trnT-trnL DNA amplification...... 77

Table 3.2 E. nigrum cpDNA nucleotide diversity (π) and haplotype diversity (h) are calculated for all samples. Haplotype richness (Hr) and private haplotype counts (Hp) are standardized to the smallest sample size for both disjunct (g=3) and core (g=9) samples using ADZE rarefaction...... 77 Table 3.3 S. heterolepis cpDNA nucleotide diversity (π), and haplotype diversity (h) are calculated for all samples Haplotype richness (Hr) and private haplotype counts (Hp) are standardized to the smallest sample size for both disjunct (g=11) and core (g=9) samples using ADZE rarefaction...... 77 Table 3.4 C. richardsonii cpDNA nucleotide diversity (π) and haplotype diversity (h) are calculated for all samples. Haplotype richness (Hr) and private haplotype counts (Hp) are standardized to the smallest sample size for both disjunct (g=16) and core (g=23) samples using ADZE rarefaction...... 77

Table 4.1 Demographic parameters and prior distributions used in invasion models ...... 118

Table 5.1 . Primer sequences and characteristics of the nine T. latifolia (T.l.) microsatellite markers and their transferability to T. angustifolia (T.a.). The fluorescent dye label is given at the beginning of each forward primer sequence. (Ta°C)= annealing temperatures used in each species, the original size of the amplified fragment (bp), No. alleles = the total number of alleles detected for each species...... 138

Table 5.2 Results of initial primer screening in T. latifolia (nine loci) and T. angustifolia (seven loci) from North America (NA) and Europe (EU). N= number of individuals. .. 139

Table 6.1 PCR conditions used for amplifying the three cpDNA regions...... 166

Table 6.2 Best-fit models of nucleotide substitution and alignment length for the three cpDNA regions selected under the AIC...... 166

xii

LIST OF FIGURES

Figure 2.1 Map showing the locations where Bartonia was sampled for this study. On the main map Canadian B. paniculata subsp. paniculata populations are labelled with their location (O’Donnell, Austin Lake, Bala and Medora), and the two locations from which Canadian B. virginica was sampled are also identified. On the inset map the Newfoundland and USA sample locations are labelled with the relevant species’ names. For full site names, see Table 2.1 ...... 46

Figure 2.3 TCS maximum parsimony networks showing the relationships between Bartonia haplotypes, with A) mutations in repetitive regions included, and B) mutations in repetitive regions excluded. Name abbreviations: Au=Austin, Axe=Axe, Bala=Bala, O’Do=O’Donnell, MTier=MacTier, Med1=Medora1, Med2=Medora2, Bptex= B. paniculata subsp. texana and BppUSA= B. paniculata subsp. paniculata (Table 2.1, Figure 2.1). Each solid black circle or fork represents a single mutation. Connections that encompass multiple mutations are shortened by horizontal lines, and the numbers adjacent to these lines represent the number of mutations that the shortcut spans...... 48

Figure 3.1 Haplotype locations for the 12 samples of Empetrum nigrum. Black circles represent haplotypes that were found only in core populations, while black and grey circles (on the map, haplotype BC1/ON1/Lake Superior is abbreviated as BOL) represent identical haplotypes from core and disjunct populations. In the inset map of North America the grey shading shows the geographic range of E. nigrum. For more information on haplotype provenances see Appendix 3.1...... 78

Figure 3.2 Sample locations and haplotype distribution in Sporobolus heterolepis. Black circles represent haplotypes that were found only in core populations from the Canadian prairies and grey circles represent samples from the alvar disjunct populations. The inset map of North America shows the geographic range of S. heterolepis in dark grey shading and the black square shows the range of core and disjunct populations sampled in this study. For more information on haplotype provenances see Appendix 3.1...... 79

xiii

Figure 3.3 Sample locations and haplotype distribution in Carex richardsonii. Abbreviations are identical to the haplotypes networks and indicate the province for the prairie core population or the location for disjunct alvar populations. Black circles represent haplotypes that were found only in core populations from the Canadian prairies and grey circles represent samples from the alvar disjunct populations. Haplotypes coloured half black half grey represent shared haplotypes between prairie and alvar haplotypes: SD=South Dakota, SK=Saskatchewan, MB=Manitoba, MI=Michigan, MN=Minnesota, B=Bruce Peninsula (Ontario). In the inset map of North America, America the grey shading shows the geographic range of C. richardsonii. For more information on haplotype provenances see Appendix 3.1...... 80

Figure 3.4 TCS maximum parsimony network showing the relationships between Empetrum nigrum haplotypes. Black haplotypes are sampled from central populations (ON2 & NFL1). The haplotype coloured half black and half grey is identical in some of the central populations (BC & ON1) and in all the disjunct populations (Lake Superior). Haplotype abbreviations correspond to their geographic locations: BC=British Colombia; ON =Ontario; NFL=Newfoundland. For more information on haplotype provenances see Appendix 3.1...... 81

Figure 3.5 TCS maximum parsimony networks showing the relationships between Sporobolus heterolepis haplotypes, with A) mutations in repetitive regions included, and B) mutations in repetitive regions excluded. Black haplotypes are sampled from central populations and grey haplotypes are sampled from disjunct populations. The haplotype coloured half black and half grey is identical in some of the central and some of the disjunct populations. Haplotype abbreviations correspond to their geographic locations: ON =Ontario, MB1=Manitoba; NY=New York; SK =Saskatchewan. For more information on haplotype provenances see Appendix 3.1...... 82

Figure 3.6 TCS maximum parsimony networks showing the relationships between Carex richardsonii, with A) mutations in repetitive regions included, and B) mutations in repetitive regions excluded. Black haplotypes are sampled from central populations, grey haplotypes represent samples from disjunct populations and haplotypes coloured half black and half grey are identical in some of the central and in some of the disjunct populations. Haplotypes coloured half black half grey represent shared haplotypes between prairie and alvar haplotypes: AB=Alberta; B=Bruce Peninsula (Ontario), Ontario, K= Komoka, Ontario, MB=Manitoba, MI=Michigan, MN=Minnesota, SD=South Dakota, SK=Saskatchewan. For more information on haplotype provenances see Appendix 3.1...... 83

Figure 4.1 Three possible invasion scenarios for Typha angustifolia and T. latifolia between North America and Europe: a) cryptic intercontinental movement of two native lineages, b) a single colonization event of a native North American lineage into Europe (invasion a), and c) a single colonization event of a native European lineage into North America (invasion b). Abbreviations are explained in Table 4.1...... 119

xiv

Figure 4.2 Parsimony tree showing the evolutionary relationships of 11 Typha cpDNA haplotypes. Bootstrap values > 70 are shown next to the relevant branches. H (e.g. H1) refers to the haplotype number, and x followed by a number (e.g. x12) indicates the number of plants in which that haplotype was found...... 120

Figure 4.3 Principal components analyses showing the genetic similarity of European and North American genotypes in a) T. latifolia and b) T. angustifolia. In T. angustifolia, the first axis explained 26.7% of the variation and the second axis explained 21.5% of the variation. In T. latifolia, the first axis explained 30.3% of the variation and the second axis explained 21.0% of the variation...... 121

Figure 4.4 A, Bayesian clustering results for K = 2 in T. latifolia. Each individual is represented by a line, which is partitioned into K colored segments according to the individuals ’ estimated membership fractions in each of the K clusters. Membership clusters are referred to in the text as North America (orange) and Europe (blue). B, Mean L ( K ) ( ± SD) over 5 runs for each value of K between 1 and 10. C, Δ K calculated according to Evanno et al. (2005) for K = 1 – 10...... 122

Figure 4.5 A, Bayesian clustering results for K = 2 in T. angustifolia. Each individual is represented by a line, which is partitioned into K colored segments according to the individuals ’ estimated membership fractions in each of the K clusters. Membership clusters are referred to in the text as North America (orange) and Europe (blue). B, Mean L ( K ) ( ± SD) over 5 runs for each value of K between 1 and 10. C, Δ K calculated according to Evanno et al. (2005) for K = 1 – 10...... 123

Figure 5.1 Collecting sites for samples included in this study: T. latifolia (dark circles) and T. angustifolia (dark triangles) ...... 140

Figure 6.1 Map of T. angustifolia indicating the sampling sites represented by black circles and the contemporary distribution areas represented in dark grey. Distribution Information from WCSP, 2012; Kim & Choi, 2011; Ciotir et al., 2013...... 167

Figure 6.2 Map of T. domingensis indicating the sampling sites represented by black circles and the contemporary distribution areas represented in dark grey. Distribution Information from WCSP, 2012; Kim & Choi, 2011...... 168

Figure 6.3 Map of T. latifolia indicating the sampling sites represented by black circles and the contemporary distribution areas represented in dark grey. Distribution Information from WCSP, 2012; Kim & Choi, 2011; Ciotir et al., 2013...... 169

Figure 6.4 The 50% majority rule consensus tree from Bayesian analyses based on combined cpDNA sequences of Typha and Sparganium species. Numbers on nodes represent the posterior probability support values. Haplotypes are labelled with letters that indicate provenance: A=Asia, E=Europe, Af=Africa, Au=Australia and N= North America. T. latifolia haplotypes E4, E5, E6 are from eastern Europe, and E1, E2, E3, E7, E8 and E9 are from western Europe. See Appendix 6.1 for more detailed information on locations...... 171

Figure 6.5 TCS networks for T. angustifolia. A) repetitive regions (microsatellites and minisatellites) included, B) repetitive regions excluded. Haplotype labels: A=Asia, E=Europe, Af=Africa, Au=Australia and N= North America. Haplotypes are coloured according to their actual or inferred origin: white= North America, light grey= Asia, dark grey= Europe. Haplotypes present in multiple continents are marked with thick line. Sizes of circles are proportional to haplotype frequencies ...... 172

Figure 6.6 TCS networks for T. domingensis. A) included repetitive regions (microsatellites and minisatellites) included, B) repetitive regions excluded. Haplotype labels: A=Asia, E=Europe, Af=Africa, Au=Australia and N= North America. Haplotypes are coloured according to their actual or inferred origin: white= North America, light grey= Asia, dark grey= Europe. Haplotypes present in multiple continents are marked with thick line. Sizes of circles are proportional to haplotype frequencies...... 173

Figure 6.7 TCS networks for T. latifolia: A) included repetitive regions (microsatellites and minisatellites) included, B) repetitive regions excluded. Haplotype labels: A=Asia, E=Europe, Af=Africa, Au=Australia and N= North America. Haplotypes E4, E5, E6 were from eastern European (east of longitude 13°29.0.4.41", while haplotypes E1, E2, E3, E7, E8 and E9 were from western Europea (west of longitude 13°01.39.15"). Haplotypes are coloured according to their actual or inferred origin: white=North America, light grey=Asia, dark grey=Europe. Haplotypes present in multiple continents are marked with thick line. Sizes of circles are proportional to haplotype frequencies. Haplotype A* represents the collapsed Asian haplotypes A1-A7...... 174

LIST OF APPENDICES

APPENDIX 2...... 49

Appendix 2.1 Bayesian consensus tree of the genus Bartonia based on five combined chloroplast DNA regions using G. quinquefolia and O. virginica outgroups. Numbers at nodes on top left indicate Bayesian posterior probabilities and on the bottom left represent branch lengths...... 50

Appendix 2.2 matK cladogram and chronogram of the genus Bartonia calibrated with Frasera outgroups: ages of nodes (My) are represented on the time axis while posterior probability support values for each node are represented outside of the clades...... 51

xvi

Appendix 2.3 trnL-trnF cladogram and chronogram of the genus Bartonia calibrated with

Frasera outgroups: ages of nodes (My) are represented on the time axis while posterior probability support values for each node are represented outside of the clades...... 52

Appendix 2.4 Summary of DNA sequences that were used in this study...... 53

APPENDIX 3...... 84

Appendix 1.1 Summary of DNA sequences used in this study...... 84

APPENDIX 4...... 123

Appendix 4.1 Stand locations and sample sizes of T. angustifolia, T. latifolia, and T. domingensis plants that were included in this study...... 124

APPENDIX 6...... 175

Appendix 6.1 Haplotype identity of each sequence and the geographic locations from which each haplotype was recovered. Location: Kim & Choi, 20111, Ciotir & Freeland2. Abbreviations:

AB= Alberta, AK= Arkansas, BC= British Columbia, CA= California, Ca= Canada,

GA=Georgia, ID= Idaho, MA=Maine, MT= Montana, NS=Nova Scotia, ON=Ontario, OR=

Oregon, QC=Quebec, NB= New Brunswick, NC= North Carolina, SK=Saskatchewan, VA=

Virginia, WA=Washington...... 174

xvii

PERMISSIONS TO REPRINT WORKS PUBLISHED

NRC Research Press

BOTANY

xviii

BIOLOGY OF INVASIONS

xix

1 FUNDAMENTAL AND APPLIED LIMNOLOGY

2 Schweizerbart and Borntraeger science publishers

We can grant you permission to include the paper mentioned in your PhD thesis if it is NOT intended to be placed Open Access in repositories. Please confirm us that this will not be the case and we will grant you permission.

This confirmation was well received and we therefore grant you permission to include Ciotir C., Dorken M. and Freeland J. (2013) “Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing” published in Fundamental Applied. Limnology Journal, Volume 182/3, 247-252, DOI: 10.1127/1863-9135/2013/0437, Stuttgart, March 2013 as a chapter of your thesis.

Please state the original source and indicate our website www.schweizerbart.de

1 CHAPTER 1

GENERAL INTRODUCTION

Although Pleistocene glaciations impacted profoundly plant distributions in North

America, species histories are often extremely difficult to reconstruct due to the complexity of historical and contemporary events that occurred since the glacial retreat. Moreover, not all species that colonised previously glaciated areas are native, and elucidating their origins can be challenging. Understanding the evolutionary relationships among species and populations can be important in conservation biology and for managing invasive species. Molecular markers are useful tools to reconstruct historical and contemporary evolutionary events and quantifying genetic diversity is easier now than ever.

Molecular markers answer biological questions and contribute to broad evolutionary investigations of molecular ecology, population genetics, conservation biology and phylogeography, specifically questions about paternity, mating behaviour, census counts, mark- recapture, and growth patterns of organisms under different environmental conditions (Freeland et al. 2010). In the field of population genetics, molecular markers assess genetic variation within and between populations, reproductive success, migration, population sizes and natural selection (Sunnucks, 2001). In phylogenetics, molecular markers can estimate species delimitations in taxa with difficult morphologies (De Queiroz, 2007; Hayes and Karl, 2009;

Morin et al. 2010). In phylogeographic approaches, molecular markers can infer genealogy of different lineages across their distribution range (Avise et al. 1987).

For any given question appropriate genetic markers need to be chosen because genes have specific modes of inheritance and different rates of mutations, which in turn may provide 1

different insights into patterns of evolution. In plants, chloroplast markers are maternally inherited and nuclear markers such as microsatellite DNA are biparentally inherited; therefore markers from each of these genomes may reflect an evolutionary history that is different than the evolutionary history of the species (McCauley, 1995; Sunnucks, 2001). For example, cpDNA data is haploid, does not usually recombine (Daniell and Chase, 2004), has a low overall rate of mutation (relative to the nuclear genome) and is generally conserved in structure, size and gene content across vascular plants (Shaw et al. 2007). Thus, cpDNA tends to show different evolutionary history to the nuclear genome, which has biparental inheritance, recombination, and a relatively large effective population size (Sunnucks, 2001). In particular, non-coding cpDNA markers address intraspecific questions in population genetics and phylogeography because they have a lower effective population size than nuclear markers and consequently are good indicators of historical bottlenecks, founder effects, and genetic drift (McCauley, 1995; Ennos, 1999).

Non-coding cpDNA regions have been successfully used to retrace dispersal events and reconstruct phylogeographic patterns at the -inter- and intraspecific level (Petit et al. 1993;

McCauley, 1995).

Molecular markers have also been successfully used in phylogeographic studies of invasive alien species (Hierro et al. 2005). Studying invasive species in both their native and introduced ranges is crucial in phylogeographic studies because it can help determine where introduced species are likely to have originated, based on their genetic similarity to native populations (Schaal et al. 2003). These studies can also inform researchers of closely related native species in the introduced range that may be potential candidates for interspecific hybridization, or identify if such hybridization has already occurred. In addition, molecular markers in phylogeographic studies may be a means for identifying cryptic invaders (Schaal et

al. 2003). Cryptic invaders are non-native lineages of plant species that are native to the introduced range; because of the native status of the species and of morphological similarity, they often remain undetected (Geller et al. 2010).

Molecular markers can also be useful tools for helping us to understand the significance of plant populations that occur towards the limits of species’ distributions, and which often make important contributions to local biodiversity (Nantel and Gagnon 1999). Disjunct plant populations comprise a specific subset of peripheral populations that are valuable from a conservation perspective. Rare disjunct populations are potential contributors to species’ range expansion, climate change adaptation, and rapid diversification (Higgins and Richardson 1999;

Coyne and Orr 2004; Hampe and Petit 2005). However, although the majority of disjunct populations in Canada are rare, particularly those concentrated around the Great Lakes, they are often more abundant south of the Canada-USA border, which means that many are regionally but not globally threatened, and as a result their conservation priority may be questionable (Hunter and Hutchinson 1994; Bunnell and Squires 2004). At the same time, their isolation may mean that disjuncts have relatively high levels of genetic differentiation from the core populations and may therefore be considered important for the conservation of genetic diversity; a useful measure of their conservation value would be to evaluate whether peripheral populations have differentiated from central populations (Lesica and Allendorf 1995). Predicting the extent to which disjuncts have diverged from core populations is easily done using molecular markers, and because the long-term conservation of species requires the preservation of genetic diversity, the results should be factored into decisions surrounding conservation management.

The main goal of my thesis was to reconstruct the phylogeographic histories of plant species with disjunct distributions and plant species (including non-native species) with

continuous distributions around the Great Lakes region in North America. Both categories are highly relevant to the Great Lakes region -disjuncts because there are many disjunct species at risk that arrived in the region since the retreat of the glaciers, and also a large number of introduced species that are often associated with transportation traffic around the Great Lakes. I used either cpDNA sequences or a combination of cpDNA sequences and nuclear microsatellite loci on samples collected from core and disjunct populations, or from multiple countries and continents, to investigate these species. The former included four species that each have different ecologies, and different patterns of current distribution. The overarching hypothesis that

I tested for these comparisons was that in each case the disjunct populations arose following a relatively recent vicariant split from the core populations. The main prediction from this hypothesis was that for each species there should be high genetic similarity between core and disjunct populations. For latter comparison, which was based on widespread Typha species, I tested two hypotheses: 1) In eastern North America, T. latifolia is native whereas T. angustifolia is introduced; 2) At the global scale there have been repeated introductions of non-native lineages of T. latifolia, T. angustifolia, and T. domingensis. Thus, I predicted that in North

America, the native cattail populations are closely related to each other and divergent from the non-native cattails that arose following recent long distance dispersal from core populations situated in other continents.

Using primarily non-coding cpDNA markers, in Chapter 2 and Chapter 3 I studied phylogeographic patterns in four species with disjunct populations around the Great Lakes,

Ontario, with the goal of reconstructing the phylogeography and evolutionary diversification of disjunct populations with respect to their core populations, and understanding their potential evolutionary and conservation value. Phylogeographic expectations across taxa with disjunct

distributions predict low genetic divergence between disjunct and core populations. This prediction is based on limited dispersal means in disjunct populations, and on the recency of historical events that isolated them since the Last Glacial Maximum. In Chapter 2- The evolutionary history and conservation value of disjunct Bartonia paniculata subsp. paniculata in

Canada-, I used five cpDNA regions to compare the genetic divergence of Bartonia paniculata subsp. paniculata, a threatened species in Ontario, to a core population in the USA. The genetic divergence between disjunct and core populations inform conservation management professionals about the status of a disjunct plant unique in Canada and unique in Ontario. In

Chapter 3 -Comparative phylogeography between species with disjunct distribution in Ontario

(Empetrum nigrum, Sporobolus heterolepis and Carex richardsonii-, I used a non-coding cpDNA marker, the trnT-trnL intergenic spacer, to assess genetic divergence of three disjunct species with disjunct populations in Ontario isolated from their respective core populations:

Empetrum nigrum was compared to northern core populations; Sporobolus heterolepis, a vulnerable species in Ontario, was compared to core populations in the prairies; and Carex richardsonii was also compared to core populations in the prairies. Previous studies have demonstrated low levels of genetic divergence between disjunct and core populations (Hamilton and Eckert, 2007; Row et al. 2011). Genetic divergence between disjunct and core populations can inform us about the conservation significance of disjuncts.

Maternally inherited cpDNA haplotypes are often suitable for phylogeographic studies and hence useful to distinguish the origin of species on a large geographic scale (Schaal et al.

1998). However, for many globally distributed species, spatial patterns of genetic variation have been considerably modified more recently by humans through long-distance dispersal and land fragmentation (Young et al.1996). As a consequence, contemporary events can mask the

historical evolutionary events and therefore, in addition to cpDNA markers, nuclear DNA markers should be used to differentiate between recent and historical evolutionary changes.

Nuclear DNA markers are biparentally inherited and extremely informative in a variety of population genetics studies (Chambers and MacAvoy, 2000). In particular, microsatellite markers are considered ideal markers to analyse population structure, population size, population history and subdivision, population assignment and admixture, and geneflow (Taberlet et al.

1999; Sunnucks, 2001). Microsatellites are useful for the fine scale or recent population processes, such as past population growth (King et al. 2000), estimation of individuals’ identification and kinship (Chackraborty and Jin, 1993), and parentage analyses (Taberlet et al.

1999). Comparison of nuclear and chloroplast data can identify hybrid individuals, asymmetrical mating preferences and stochastic effects on variants for which ancestral taxa were polymorphic

(Sunnucks, 2001). Finally, microsatellites can be used in phylogeographic studies because the distribution of genotypes and allele frequencies can be spatially explored (Rannala and

Mountain; 1997; Taberlet et al. 1999; Luikart and England 1999; Beaumont, 1999). In addition, microsatellites can reveal a more recent evolutionary history undetected by the cpDNA and potential newly formed genotypes between native and non-native species.

Two complementary phylogeographic patterns were predicted for Typha spp. due to their continuous distributions in both regional and global ranges. My first hypothesis was that T. angustifolia is introduced to North America and around the Great Lakes and my second hypothesis was that T. latifolia has native and introduced non-native lineages to North America.

I predicted that native cattail lineages will be closer related to each other and farther related to non-native lineages due to their recent introductions from other continents. I tested these hypotheses in Chapter 4- ‘Intercontinental dispersal of Typha angustifolia and T. latifolia

between Europe and North America has implications for Typha invasions’- where, in addition to non-coding cpDNA trnL-trnF sequences, I used microsatellite markers to compare T. latifolia and T. angustifolia genotypes from eastern North America and Europe and identify recent intercontinental dispersal in the two species. In regions affected by human disturbance I expected a complicated pattern of phylogeography due to novel introductions and potential admixtures between native and non-native lineages. However, in Typha spp., complicated patterns of dispersal and hybridization challenge the elucidation of microevolutionary processes, and patterns of Typha dispersal within and between continents. I also tested the introduction of

T. angustifolia in North America in Chapter 5- ‘Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing’-, in which I developed additional microsatellite markers to identify species-specific and continent-specific alleles. These additional markers along with those previously characterized are aimed to unravel patterns of dispersal within and between continents, studies of parentage, clonality, hybridization and admixture in this broadly distributed species complex.

The second hypothesis was that at the global level, geographically isolated regions from the native ranges of Typha spp. preserve phylogeographic structure and genetic divergence due to previous historical events that occurred in separate continents, although phylogeographic evidence of multiple intra and intercontinental cattail exchanges was also predicted. These expectations are based on previous empirical work that identified intercontinental exchange in aquatic macrophytes Phragmites australis (Saltonstall, 2001), Brachypodium sylvaticum

(Rosenthal et al. 2008), Spartina alterniflora (Anttila et al. 2000; Blum et al. 2007), plus Ciotir et al. (2013). I used three non-coding cpDNA regions, to investigate phylogeographic patterns of

three widespread cattail species, T. angustifolia, T. domingensis, and Typha latifolia in Chapter 6

-‘Phylogeographic data reveal cryptic intercontinental dispersal of three increasingly aggressive cattail Typha species’-. The aims of this chapter were 1) reconstructing the phylogeography and evolutionary diversification of each species, and 2) quantifying the extent to which non-native species or lineages have been introduced into novel geographic areas. In Typha spp. human mediated fast dispersal and wide ecological tolerance could be related to the results of the intercontinental exchanges which in turn can be important in conservation biology for managing invasive species.

Finally, in Chapter 7 Synthesis, I summarise the differences in the phylogeographic patterns observed across the investigated species and I discuss the relevance of disjunct evolutionary history for conservation biology and the relevance of Typha spp. evolutionary history in invasion biology. The chapter addresses the possible evolutionary explanations for any differences in phylogeographic patterns between native and non-native species/populations at regional and global geographic scales, and it outlines future directions that could further enhance our understanding of how dispersal and vicariance processes affect phylogeographic patterns in species with disjunct and continuous distributions.

References

Alsos IG, Eidesen PB, Ehrich D, Skrede I and Westergaard K. 2007. Frequent long-distance

plant colonization in the changing arctic. Science 316: 1606-1609.

Anttila CK, King RA, Ferris C, Ayres DR, and Strong DR. 2000. Reciprocal hybrid formation of

Spartina in San Francisco Bay. Molecular Ecology 9: 765-770.

Arnold ML. 1997. Natural Hybridization and Evolution. Oxford University Press.

Avise JC.1998. The history and purview of phylogeography: a personal reflection. Molecular

Ecology 7: 371-379.

Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA and Saunders NC.

1987. Intraspecific phylogeography - the mitochondrial-DNA bridge between population-

genetics and systematics. Annual Review of Ecology and Systematics 18: 489-522.

Beaumont MA. 1999. Detecting population expansion and decline using microsatellites.

Genetics 153: 2013-2029.

Blum MJ, Bando KJ, Katz M and Strong DR. 2007. Geographic structure, genetic diversity and

source tracking of Spartina alterniflora. Journal of Biogeography 34, 2055-2069.

Bunnell FL and Squires KA. 2004. Plagued by a plethora of peripherals: refining guidelines for

peripheral taxa, proceedings of the species at risk pathways to recovery conference.

species at risk 2004 pathways to recovery conference organizing committee, Victoria,

B.C.

Carstens BC, Brunsfeld SJ, Demboski JR, Good JM, and Sullivan J. 2005. Investigating the

evolutionary history of the Pacific northwest mesic forest ecosystem: Hypothesis testing

within a comparative phylogeographic framework. Evolution 59: 1639-1652.

Chakraborty R, and Jin L. 1993. A unified approach to study hypervariable polymorphisms -

statistical considerations of determining relatedness and population distances. DNA

Fingerprinting State of the Science Progress in Systems and Control Theory, pp 153-175.

Chambers GK, and MacAvoy ES. 2000. Microsatellites: consensus and controversy.

Comparative Biochemistry and Physiology Biochemistry & Molecular Biology 126: 455-

476.

Ciotir C, Kirk H, Row JR, and Freeland JR. 2013. Intercontinental dispersal of Typha

angustifolia and T. latifolia between Europe and North America has implications for

Typha invasions. Biological Invasions 15: 1377-1390.

Coyne JA and Orr HA. 2004. Speciation. Sinauer Associates, Sunderland, Massachusetts.

Daniell H, and Chase CD eds. 2004. Molecular biology and biotechnology of plant organelles:

chloroplast and mitochondria. Springer Netherlands.

Davies N, Villablanca FX, and Roderick GK. 1999. Determining the source of individuals:

multilocus genotyping in non-equilibrium population genetics. Trends in Ecology &

Evolution 14: 17-21.

De Queiroz K . 2007. Species concepts and species delimitation. Systematic Biology 56: 879-

886.

Ennos RA, Sinclair WT, Hu XS and Langdon A. 1999. Using organelle markers to elucidate the

history, ecology and evolution of plant populations. Molecular Systematics and Plant

Evolution, pp 1-19.

Freeland JR, Kirk HR and Petersen S. 2010. Molecular Ecology. John Wiley & Sons, Chichester.

Hamilton JA, and Eckert C. 2007. Population genetic consequences of geographic disjunction: a

prairie plant isolated on Great Lakes alvars. Molecular Ecology 16: 1649-1660.

Hampe A and Petit RJ . 2005. Conserving biodiversity under climate change: the rear edge

matters. Ecology Letters 8: 461-467.

Hayes KA and Karl SA. 2009. Phylogenetic relationships of crown conchs (Melongena spp.): the

corona complex simplified. Journal of Biogeography 36: 28-38.

Hewitt GM. 2001. Speciation, hybrid zones and phylogeography or seeing genes in space and

time. Mol Ecol 10: 537-549.

Hewitt GM.1999. Post-glacial re-colonization of European biota. Biol J Linnean Soc 68: 87-112.

Hickerson MJ, Carstens BC, Cavender-Bares J, Crandall KA, Graham CH, Johnson JB, Rissler

L, Victoriano PF, and Yoder AD. 2010. Phylogeography's past, present, and future: 10

years after Avise, 2000. Molecular Phylogenetics and Evolution 54: 291-301.

Hierro JL, Maron JL and Callaway RM. 2005. A biogeographical approach to plant invasions:

the importance of studying exotics in their introduced and native range. Journal of

Ecology 93: 5-15.

Higgins SI and Richardson DM. 1999. Predicting plant migration rates in a changing world: The

role of long-distance dispersal. American Naturalist 153: 464-475.

Hunter ML, and Hutchinson A. 1994. The virtues and shortcomings of parochialism - conserving

species that are locally rare, but globally common. Conservation Biology 8: 1163-1165.

King JP, Kimmel M, and Chakraborty R. 2000. A power analysis of microsatellite-based

statistics for inferring past population growth. Molecular Biology and Evolution 17:

1859-1868.

Lesica P, and Allendorf FW. 1995. When are peripheral-populations valuable for conservation.

Conservation Biology 9: 753-760.

Luikart G and England PR. 1999. Statistical analysis of microsatellite DNA data. Trends in

Ecology & Evolution 14: 253-256.

McCauley DE .1995. The use of chloroplast DNA polymorphism in studies of gene flow in

plants. Trends in Ecology & Evolution 10: 198-202.

Morin PA, Martien KK and Taylor BL. 2009. Assessing statistical power of SNPs for population

structure and conservation studies. Molecular Ecology Resources 9: 66-73.

Nantel P and Gagnon D .1999. Variability in the dynamics of northern peripheral versus southern

populations of two clonal plant species, Helianthus divaricatus and Rhus aromatica.

Journal of Ecology 87: 748-760.

Petit RJ, Kremer A and Wagner DB 1993 Finite island model for organelle and nuclear genes in

plants. Heredity 71: 630-641.

Rannala B and Mountain JL. 1997. Detecting immigration by using multilocus genotypes.

Proceedings of the National Academy of Sciences of the United States of America 94:

9197-9201.

Rosenthal DM, Ramakrishnan AP, and Cruzan MB. 2008. Evidence for multiple sources of

invasion and intraspecific hybridization in Brachypodium sylvaticum (Hudson) Beauv. in

North America. Molecular Ecology 17: 4657-4669.

Row JR, Brooks RJ, MacKinnon CA, Lawson A, Crother BI, White M and Lougheed SC. 2011.

Approximate Bayesian computation reveals the factors that influence genetic diversity

and population structure of foxsnakes. Journal of Evolutionary Biology 24: 2364-2377.

Saltonstall K. 2002. Cryptic invasion by a non-native genotype of the common reed, Phragmites

australis, into North America. Proceedings of the National Academy of Sciences of the

United States of America 99: 2445-2449.

Schaal BA, Hayworth DA, Olsen KM, Rauscher JT and Smith WA .1998. Phylogeographic

studies in plants: problems and prospects. Molecular Ecology 7: 465-474

Schaal BA, Gaskin JF, and Caicedo AL. 2003. Phylogeography, haplotype trees, and invasive

plant species. Journal of Heredity 94: 197-204.

Shaw J, Lickey EB, Schilling EE, and Small RL. 2007. Comparison of whole chloroplast

genome sequences to choose noncoding regions for phylogenetic studies in angiosperms:

The tortoise and the hare III. Am J Bot 94(3): 275-288.

Soltis DE, Morris AB, McLachlan JS, Manos PS and Soltis PS (2006) Comparative

phylogeography of unglaciated eastern North America. Mol Ecol 15: 4261-4293.

Sunnucks P. 2000. Efficient genetic markers for population biology. Trends in Ecology &

Evolution 15: 199-203.

Swenson NG, and Howard DJ. 2005. Clustering of contact zones, hybrid zones, and

phylogeographic breaks in North America. American Naturalist 166: 581-591.

Taberlet P, Waits LP, and Luikart G. 1999. Noninvasive genetic sampling: look before you leap.

Trends in Ecology & Evolution 14: 323-327.

Young A, Boyle T, and Brown T. 1996. The population genetic consequences of habitat

fragmentation for plants. Trends in Ecology & Evolution 11: 413-418.

2 CHAPTER 2

THE EVOLUTIONARY HISTORY AND CONSERVATION VALUE OF DISJUNCT BARTONIA PANICULATA SUBSP. PANICULATA (BRANCHED BARTONIA) POPULATIONS IN CANADA

A version of this chapter has been published

Ciotir C. Yesson C. and Freeland J. 2013. The evolutionary history and conservation value of disjunct Bartonia paniculata subsp. paniculata (Branched Bartonia) populations in Canada.

Botany-Botanique, 91, 605-613.

Abstract

Understanding the spatial distribution of genetic diversity and its evolutionary history is an essential part of developing effective biodiversity management plans. This may be particularly true when considering the value of peripheral or disjunct populations. Although conservation decisions are often made with reference to geopolitical boundaries, many policy- makers also consider global distributions, and therefore a species’ global status may temper its regional status. Many disjunct populations can be found in the Great Lakes region of North

America, including those of Bartonia paniculata subsp. paniculata, a species that has been designated as threatened in Canada but globally secure. We compared chloroplast sequences between disjunct (Canada) and core (USA) populations of B. paniculata subsp. paniculata separated by 600 km, which is the minimum distance between disjunct and core populations in this subspecies. We found that although lineages within the disjunct populations shared a relatively recent common ancestor, the genetic divergence between plants from Ontario and New

Jersey was substantially greater than expected for a consubspecific comparison. A coalescence- based analysis dated the most recent common ancestor of the Canadian and US populations at approximately 534, 000 years ago (ya) with the lower confidence estimate at 226 000 ya. This substantially pre-dates the Last Glacial Maximum, and suggests that disjunct and core populations have followed independent evolutionary trajectories throughout multiple glacial- interglacial cycles. Our findings provide important insight into the diverse processes that have resulted in numerous disjunct species in the Great Lakes region, and highlight a need for additional work on Canadian B. paniculata subsp. paniculata taxonomy prior to a re-evaluation of its conservation value.

Keywords: disjunct populations, conservation, phylogeography, Great Lakes, Bartonia paniculata 15

Introduction

Plant populations that occur towards the limits of species’ distributions often make important contributions to local biodiversity (Nantel and Gagnon 1999); however, many such populations have been identified as ‘at risk’, and therefore their persistence may be precarious.

As a result, a disproportionately high investment into the local protection of threatened species may be directed towards peripheral or disjunct populations (Bunnell et al. 2004). In Canada, for example, 90% of species listed as endangered or threatened by the start of the 21st century occurred at the northern periphery of their ranges (Yakimowski and Eckert 2007). The majority of these are more abundant south of the Canada-USA border, which means that many are regionally but not globally threatened. The investment of substantial resources into species that are secure throughout much of their range is often questioned (see Arponen 2012 and references therein). This, in turn, has led to widespread debate over the value of peripheral populations

(Hunter and Hutchinson 1994), with their potential elevated extinction risk, low genetic diversity and reduced adaptive potential (Hoffman and Blows 1994) balanced against their potential contributions to range expansion, climate change adaptation, and rapid diversification (Hampe and Petit 2005; Coyne and Orr 2004; Higgins and Richardson 1999). The possible value of peripheral populations has been supported by a number of empirical studies that have found no evidence for reduced genetic diversity relative to core populations (reviewed in Eckert et al.

2008). In addition, peripheral populations may be genetically distinct from central populations, and because the long-term conservation of species requires the preservation of genetic diversity, the extent to which peripheral populations have differentiated from central populations may be a useful measure of their value (Lesica and Allendorf 1995).

Disjunct plant populations comprise a specific subset of peripheral populations that provide particular challenges from a conservation perspective, because bottlenecks or local 16

extinctions may be irreversible if there are no nearby seed sources for recolonisation or restoration. At the same time, their isolation may mean that they have relatively high levels of genetic differentiation from the core populations and may therefore be considered important for the conservation of genetic diversity; however, this prediction has seldom been tested. The extent to which core and disjunct populations are genetically distinct from one another will have been influenced by multiple factors including time since divergence, effective population size

(and hence rate of genetic drift), and local selection pressures (Eckert et al. 2008; Willi et al.

2006). Predicting the extent to which disjuncts have diverged from core populations is therefore challenging, although it should be factored into decisions surrounding conservation management.

Several areas in the Great Lakes region between the border of the US and Canada harbour disjunct populations (Argus et al. 1987), many of which are thought to have been influenced by the last climatic fluctuations of the Quaternary which substantially altered species’ ranges and distributions (Brownell et al. 1996; Reznicek 1994). In particular, the Pleistocene glaciations have been regarded as a historical driving force in generating disjunctions and genetic diversification (Waltari et al. 2007; Schonswetter et al. 2003; Hewitt 2004; Hewitt 1996). Low genetic divergence between the core and disjunct populations of some species suggests that relatively recent vicariant events explain current distributions (e.g. Row et al. 2011; Hamilton and Eckert 2007), which in turn may reduce the perceived importance of disjuncts to biodiversity management; however, too few comparisons have been made to allow for generalizations. A frequent category of disjuncts around the Great Lakes shores and plains are the Coastal Atlantic

Plain (CAP) flora, so called because their southern core populations are situated within the

Atlantic and Gulf coastal plains (Cain 1944). The typical distribution of CAP species is throughout the Coastal Plain, ranging from southeastern Texas to southern New Jersey and

occasionally southern New England, with few to no populations throughout most of the North

American interior (Jackson and Singer 1997). The most common CAP plant disjuncts are emergent Cyperaceae and Poaceae which grow in shallow wetlands and lakeshores that have fluctuating water levels (Reznicek 1994).

CAP disjuncts grow in areas of sand deposits that are associated with postglacial lakes and drainage channels, a correlation that led Reznicek (1994) to suggest that migration of most

CAP disjuncts into the Great Lakes region likely resulted from seed dispersal by birds traversing short to moderate distances into the suitable habitat that exists along areas of major postglacial drainages. The timing of such dispersal events must have postdated the last glacial maximum, which occurred ~20,000 years ago (Ehlers and Gibbard 2008; Hewitt 2004). The Laurentide ice sheet retreated 14 000-10 000 years ago and ended with the formation of many glacial lakes including the Great Lakes (Lomolino et al. 2006). Keddy (1981) suggested that disjunct populations entered the Georgian Bay region, one of the three main regions of Great Lakes disjuncts, approximately 7000 years ago when Lake Algonquin was replaced by smaller lakes.

However, the geology of other areas of Great Lakes disjuncts is not congruent with this timing

(Hamilton and Eckert 2007; Lomolino et al. 2006), and disjuncts in those areas must therefore have been established during other periods. In addition, some disjuncts are not in locations of postglacial drainage outlets and therefore presumably arose following relatively recent long- distance dispersal events (Reznicek 1994). The histories of many CAP disjuncts around the

Great Lakes therefore remain equivocal (Whitehead 1972), which in turn means that the genetic - and hence conservation - significance of these disjunct populations should not be assumed.

Bartonia paniculata subsp. paniculata (Branched Bartonia) in the family Gentianaceae,

Subtribe Swertiinae, is one example of a CAP disjunct in Ontario. Bartonia paniculata (Michx.)

Muhl. is one of the three species in the genus Bartonia that can be found in temperate North

America, and includes three subspecies: B. paniculata subsp. paniculata, B. paniculata subsp. iodandra, and B. paniculata subsp. texana. The latter was historically considered a separate species, but recently reclassified as a subspecies of B. paniculata based on flower morphology and phylogenetic affinity with B. paniculata (Mathews et al. 2009). The other two congeneric species are B. verna (Michx.) Muhl. and B. virginica (L.) Britton, Sterns & Poggenb., (USDA,

NRCS 2007; Struwe et al. 2002). All Bartonia species have Atlantic and Gulf coastal plain affinities and are present along humid shores, bogs, fens and meadows. Branched Bartonia, an annual herb with mycotrophic roots and reduced scale-like leaves (Mathews et al. 2009; Gillet

1963; Gillet 1959), was first discovered in Canada in 1976 in bogs within the Muskoka district, close to Georgian Bay in Lake Huron, southcentral Ontario (Reznicek and Whiting 1976). These populations, which represent the entirety of the species’ Canadian distribution, are approximately

600 km from the species’ core range (COSEWIC 2003). Their provenance is unknown, although they are presumed to have arisen from core populations in the Atlantic coastal plain where multiple refugia may have existed along the Gulf coast and the southern Appalachians. These refugia may have been separated by multiple geographic barriers including the Mississippi River, the Apalachicola River, and the Appalachian Mountains (Soltis et al. 2006), which likely constrained the postglacial migration to north-south corridors, potentially leading towards the

Great Lakes.

The isolation of Canadian Bartonia paniculata subsp. paniculata populations, combined with their low abundance (11 known populations; Brinker 2006) and threats from invasive species, have led to the classification of Branched Bartonia in Canada as threatened, although the species is considered globally secure (NatureServe 2003; COSEWIC 2003). In this study we

used molecular genetic data to investigate the evolutionary relationships between B. paniculata subsp. paniculata from disjunct and central populations, and to test the hypothesis that disjunct populations of B. paniculata subsp. paniculata recently separated from central populations and therefore show a strong genetic affinity to the plants located within the core. Our data add to the paucity of information concerning the origins of disjunct populations around the Great Lakes, and are relevant to conservation management decisions regarding Bartonia in Canada.

Methods

Sampling, DNA extraction, and DNA sequencing

Ontario samples of Bartonia paniculata subsp. paniculata were collected between 2006 and

2008 from six sites (Table 2.1). Their highly reduced scale-like leaves mean that non-invasive sampling of B. paniculata subsp. paniculata is not possible, and therefore sampling required removal of an entire plant which was immediately placed in a bag of silica beads for drying, and stored in the freezer at -20C on return to the lab. This need for destructive sampling restricted our collections to one out of every 25 plants in each population. In addition, two Ontario samples of B. virginica were collected in 2008. Dried plant material was ground in a mixer mill

(Retsch MM300; Retsch, Newtown, Pennsylvania, USA), and genomic DNA was extracted from approximately 10-30 mg dried tissue per plant using the E.Z.N.A. Plant DNA Mini Kit (Omega

Bio-Tek, Norcross, Georgia, and USA), eluted into a final volume of 100 µL. Authors of a recent taxonomic study of Bartonia (Mathews et al. 2009) kindly sent us a sample of B. paniculata subsp. paniculata from the core distribution of this species in USA, two outgroup samples of Obolaria virginica and Gentianella quinquefolia, plus several other congeneric and conspecific samples. See Table 2.1 and Figure 2.1 for locations and sample sizes.

All B. paniculata subsp. paniculata and Ontario B. virginica plants were characterized on the basis of DNA sequences from three non-coding chloroplast regions (trnL intron-trnL-trnF spacer, trnH-psbA, and trnT-trnL) and two coding regions (matK and rbcL). The remaining

Bartonia, Obolaria, and Gentianella species and subspecies were characterized only at four regions because their trnL- trnF sequences were previously published by Mathews et al. (2009)

(Appendix 2.4). Primers for all regions are given in Table 2.2. PCR amplifications used an

Eppendorf Mastercycler Ep gradient (Mississauga, Ontario, Canada). The PCR cocktail included

1x Taq reaction Buffer, 2mM MgSO4, 200 μM dNTPs , 0.2μM of each primer, 13.30 μL

Nanopure H2O, 2.5U of High Purity Taq polymerase (UBI Life Sciences Ltd., Saskatoon, SK,

Canada), 1.2 μL (100%) of BSA additive and approximately 10ng DNA in a final volume of 25

μL. In addition, the matK cocktail included 1.4 μL of 100% DMSO. PCR cycling parameters are given in Table 2.3. Unincorporated primers and dNTPs were removed from PCR products by incubating samples with 10U exonuclease I (Fermentas International Inc.) plus 2U shrimp alkaline phosphatase (Fermentas) for 15 minutes at 15°C followed by 15 minutes at 80°C.

Purified products were sequenced in both directions using a BigDye Terminator v3.1 Cycle

Sequencing Kit (Applied Biosystems, Foster City, California, USA). Sequencing reactions were run out on a DNA Analyser 3730xl ABI (Applied Biosystems).

Sequence alignments and data analysis

Nucleotide sequences were edited and assembled using Seqman (DNASTAR LaserGene

5) software (Madison, WI, USA 2001). Additional sequences for Frasera spp. were downloaded from the NCBI (von Hagen and Kadereit 2000; von Hagen and Kadereit 2002; Whitlock et al.

2010). All sequences used in this study (Appendix 2.4) were imported into BioEdit Software

(Hall 1999). Each region was aligned using CLUSTALW (Thompson et al. 1994) with

subsequent manual adjustments. Multiple individuals from disjunct populations had identical sequences. In our analyses we discarded the duplicate sequences and included only one representative of each haplotype. The individual region alignments were appended to each other and used for the combined analyses.

Phylogenetic analyses

The goal of our phylogenetic analysis was to date the time of divergence between Ontario and USA B. p. paniculata, which we accomplished by first calibrating divergence dates among outgroups. In a typical molecular dating analysis, fossils of closely related groups would be used to calibrate the node ages; however, fossils are not known for relatives of Bartonia and therefore a typical primary calibration was not possible for this study. Instead, we employed secondary and tertiary calibrations based on multiple outgroup species: Frasera spp., Obolaria virginica, and Gentianella quinquefolia. Previous studies estimated the Frasera-Bartonia divergence at 7-

12 Mya (von Hagen and Kadereit 2001; von Hagen pers. comm. 2012), and subtribe Swertiinae at 15 Mya (von Hagen and Kadereit 2002). The subtribe Swertiinae comprises the genera of

Bartonia, Frasera, Obolaria and Gentianella and its calibration age has been used in other studies of Gentianaceae (Favre et al. 2010; Yuan et al. 2005).

We performed a two step dating process because we did not have cpDNA sequences from all five regions for each Frasera species (Appendix 2.4). The first step in the analyses was based on three individual sequence datasets (matK, trnL-trnF and trnH-psbA), and used a secondary calibration on Frasera (7-12 mya) with a maximum root age of 15 mya. In this step, each dataset included sequences of at least two Frasera species, O. virginica, G. quinquefolia and all

Bartonia species. This produced an age range for the node of Obolaria-Gentianella outgroups.

The second step in the analyses was to generate estimates of divergence dates based on five cpDNA regions from Gentianella, Obolaria plus all Bartonia samples. In this second step, the mid-point age estimate of the Gentianella-Obolaria node estimated in step 1 was used as a tertiary calibration to estimate the ages of divergence of Bartonia. Multi-stage calibrations such as this have been successfully used in other studies (Favre et al. 2010; Yesson et al. 2008). In the trnH-psbA analysis the O. virginica and B. p. iodandra sequences were not available, and we therefore did not use the trnH-psbA analysis for the secondary calibration (data not shown). The trnH-psbA analysis was used only to compare the output results of tree topology and tree root height with those generated by the two other regions matK and trnL-trnF analyses. In addition, the trnT-trnL sequence of B. p. iodandra was not available for the combined, five-region analysis. The missing sequences were treated as missing data, but for these analyses missing data do not contribute any probability to the likelihood for that branch and site (Felstenstein

2004). Similarly, we did not eliminate or code indels because gaps and missing characters do not contribute any phylogenetic information and are also considered missing data (Simmons and

Ochoterena 2006; Felstenstein 2004). Models of nucleotide sequence substitution for each DNA region were identified using MrModeltest v.2.3 based on all variable sites and AIC selection criteria (Nylander 2004) (Table 2.4). Each model was then used as a nucleotide substitution model for the combined analyses. We used BEAST v1.7. 3 (Drummond and Rambaut 2007), a coalescence-based program, to estimate divergence times of the major lineages based on the nucleotide substitution models in Table 2.4. We used a relaxed uncorrelated lognormal molecular clock because it allows the substitution rates to vary independently among lineages and across the tree (Drummond et al. 2006).

The relaxed molecular clock model also allows the co-estimation of substitution parameters drawn from an ‘a priori’ parametric distribution whose mean is a function of the rate on the parent branch with a lognormal distributed rate among branches. Time to the most recent common ancestor (TRMCA) was estimated using model Yule trees recommended by BEAST for multiple species phylogenies because this model assumes a constant speciation rate per lineage.

Runs were initiated on random starting trees. Initially, several short BEAST runs were performed to examine the MCMC performance. After optimal operator adjustment as suggested by the output diagnostics, two final BEAST runs each of 10,000,000 MCMC iterations were performed, sampling every 1000 steps. The output log files were examined to assess the convergence of the

MCMC chains between samples, and to visualize parameter estimates from two simultaneous runs and trees. Log files from each analysis were compiled in Tracer v.1.5. (Rambaut and

Drummond 2008). Raw traces for all parameters with posterior probabilities set to 0.0 and summarizing mean node heights were input in TreeAnnotator (Drummond and Rambaut 2007).

A ‘burnin’ of 10% value (of the 10,000,000 iterations) was used to produce the maximum clade credibility trees (MCC) which were visualized in FigTree v.1.3.1

[http://tree.bio.ed.ac.uk/software/figtree/] (Drummond and Rambaut 2007).

Previous phylogenetic reconstructions reported accelerated mutation rates in Bartonia and thus different molecular clocks compared to the rest of the Gentianaceae family (Favre et al.

2010, von Hagen and Kadereit 2001, 2002, Chassot 1999). Phylogenetic methods that do not correct for branch lengths are recommended to test for differences in mutation rates. To examine the impact of the temporal calibration on our analysis, we performed a phylogenetic reconstruction without rate smoothing using MRBAYES software v3.1 (Huelsenbeck and

Ronquist 2001). The default prior and likelihood settings were used for all parameters except for the nucleotide substitution models which were set to models corresponding to each DNA region

(Table 2.4). Substitution model parameters and rates of substitution were allowed to vary across partitions using ratepr = variable and the ‘unlink’ command. The MCMC (Hastings 1970) chain was run for up to 5,000,000 iterations, sampling trees once every1000 iterations. Convergence of the Markov chain and assessment of ‘burn-in’ values was determined by examining the average standard deviation of split frequencies and by plotting the likelihood values against the number of generations on a linear regression graph.

Parsimony networks

Two parsimony networks were reconstructed using TCS software (Posada and Crandall

2000). All five cpDNA sequences from B. p. paniculata, B. p. texana and B. p. iodandra were concatenated in 2967bp. We replaced each indel with one nucleotide base, thus coding each indel as one mutation step. The analyses were set in TCS software using 95% statistical parsimony and gaps as the fifth state (Templeton et al. 1992). To calculate the number of mutations between B. p. paniculata and B. p. texana in the first network, we temporarily decreased the stringency of statistical parsimony to 93%. In the first network, sequences that comprised repetitive regions (microsatellites and minisatellites) were included, and in the second

network, they were excluded in order to assess the potential influence of homoplasy which is higher in repetitive sequences, and also to assess the influence on our network of mutations in relatively rapidly evolving sequences (repetitive regions) that may be more indicative of relatively recent evolutionary change (Vachon and Freeland 2011; Freeland and Vachon 2012).

Results

Phylogenetic analysis

The results from the time calibrated (BEAST) analysis and the uncalibrated (MrBayes) analysis show strong agreement (Figure 2.2 and Appendix 2.1). Uncorrected branch lengths from

MrBayes analyses were not substantially higher in Bartonia than outgroups O. virginica and G. quinquefolia (Appendix 2.1). This pattern is repeated for single region analyses (data not shown) indicating that mutation rates do not appear to be accelerated for Bartonia in comparison with closely related groups, and therefore do not explain the unusually large genetic divergence between disjunct and core populations of Bartonia paniculata subsp. paniculata. Parameter estimates from the individual and combined BEAST analyses are reported as the mean node ages with standard deviation (SD) and the lowest and the Highest Posterior Density 97.5% (HPD)

(Table 2.5 and Table 2.6). The topologies of the trees generated with matK, trnL-trnF and trnH- psbA were in agreement (Appendix 2.2 and Appendix 2.3).

The first step in the analyses estimated the time to the most recent common ancestor

(TMRCA) for the node of Obolaria-Gentianella outgroups at ~ 12.5 Mya (HPD= 7.23-18.61

Mya) (Table 2.5, Appendix 2.2 and Appendix 2.3). The second step in the analyses estimated the TMRCA for the Bartonia ingroup at 6.88 Mya (HPD= 5.01-9.14 Mya; Table 2.6 and Figure

2.2). Our estimates suggest a divergence time of the Ontario B. paniculata subsp. paniculata from the USA B. paniculata subsp. paniculata as approximately 534,000 ya (HPD=226 000-903

000 ya) (Table 2.6 and Figure 2.2). The Ontario lineages are among the youngest tips on the tree and have a single common ancestor which diverged approximately 166 000 ya (HPD=38 000-

381 000 ya) (Table 2.6 and Figure 2.2). The most recent common ancestor of B. paniculata subsp. paniculata originated approximately 2.46 Mya (HPD=1.38-3.84 Mya). Inter- and intraspecific phylogenetic relationships in Bartonia were supported by maximum values of posterior probability distributions. The two clades of B. paniculata subsp. paniculata from

Ontario and the USA received robust clade support (posterior probability=1 as shown in Figure

2.2). TRMCA values for all nodes are provided in Table 2.5 and Table 2.6.

Networks

In the network with the repetitive regions included, Canadian populations of B. paniculata subsp. paniculata had four haplotypes (Figure 2.3A) that were separated from one another by 1-8 mutations, whereas Canadian and USA B. paniculata subsp. paniculata haplotypes were separated by 15-21 mutations. B. paniculata subsp. texana differed from

Canadian B. paniculata subsp. paniculata haplotypes by a minimum of 25 mutations, and from

USA B. paniculata subsp. paniculata by 40 mutations. B. paniculata subsp. iodandra was excluded from the network because its divergence from other haplotypes exceeded that permitted under the 93% threshold that we established (see above). The network from which repetitive sequences were excluded showed a similar pattern but with fewer haplotypes and fewer mutational steps (Figure 2.3B).

Discussion

Pleistocene glacial-interglacial cycles were important drivers of historical migration and evolutionary divergence for the majority of species in the Northern Hemisphere (Hewitt 2004;

Hewitt 1996). In many cases, these historical migrations led to disjunct populations such as those representing the 62 species of Coastal Atlantic Plain floristic elements (CAP) that have disjunct populations around the Great Lakes and core populations in the central Gulf and eastern coastal Atlantic regions (Reznicek 1994). Although CAP disjuncts populated the Great Lakes region soon after the Last Glacial Maximum (LGM), little is known of their evolutionary history

(Reznicek 1994; Cain 1944; Peattie 1922). Conservation management of these species is based to a large extent on geopolitical boundaries, in other words the regional abundance of species, although is also influenced by the global status of each species (COSEWIC 2003). Unless there are data to support a different view, management decisions surrounding peripheral populations typically assume that disjunct and core populations are close relatives. However, disjunct populations of Bartonia paniculata subsp. paniculata in Ontario showed an unexpectedly high level of genetic divergence from the core lineage included in our study, and this finding may warrant a reassessment of their conservation status and a more general questioning of the assumption that disjunct populations are closely related to their conspecific core populations.

Below, we summarize our reasons for this conclusion based on results from the phylogenetic and network analyses.

The phylogenetic analyses that we conducted on multiple Bartonia species identified B. p. paniculata as a paraphyletic group with B. p. texana nested within it, and estimated that the most recent common ancestor of the Ontario and US lineages of B. paniculata subsp. paniculata originated approximately 534 000 ya, a time that coincided with the first of the last four major glaciations of the Pleistocene (Augustin et al. 2008; Ehlers and Gibbard 2003; Hewitt 1996). 29

The most recent common ancestor of the Ontario lineages arose approximately 166 000 ya

(HPD= 38 000 ya-381 000 ya) during the glaciation that predated the Wisconsinan. The confidence intervals suggest that even the minimum age for the divergence between Ontario and

USA lineages substantially pre-dates the LGM. Therefore, our molecular chronologic estimation for Ontario B. paniculata subsp. paniculata rejects the hypothesis of contemporary habitat fragmentation of the core populations and a recent diversification of Ontario lineages.

Bartonia paniculata networks similarly revealed substantial divergence between disjunct and central lineages, and the majority of the mutations between the most closely related USA and

Ontario lineages were in non-repetitive regions (12 out of 19 mutations). Because mutations in chloroplast sequences accumulate most rapidly in repetitive regions, a preponderance of mutations in non-repetitive regions (sequences other than minisatellites and microsatellites) further contradicts the idea of a recent divergence. In contrast, a comparison of the haplotype networks shows that divergence among Ontario lineages is based predominantly on mutations in repetitive regions, which suggests that these lineages diverged from one another more recently

(Vachon and Freeland 2011, and references therein). The phylogenetic analysis is therefore consistent with the network analyses: they both reflect a more recent divergence within Ontario

B. paniculata subsp. paniculata than between Ontario and USA B. paniculata subsp. paniculata, and neither type of analysis supports the hypothesis of recent divergence between disjunct and core populations.

To date, only a few studies have assessed the genetic divergence between disjunct populations in the Great Lakes region and their core populations. Disjunct populations of foxsnake (Pantherophis gloydi and P. vulpina) in the Great Lakes regions diverged an estimated

5,000 ya from western prairie populations (Row et al. 2011). Similarly, genetic comparisons

between prairie smoke (Geum trifolium) populations suggested that the disjunct Ontario populations split from the core prairie populations about 5,000 ya (Hamilton and Eckert 2007).

Disjunct Ontario and Quebec populations of Helenium autumnale, a plant specific to sinkhole ponds, were found to be highly genetically similar to core populations in Virginia and Missouri, and likely differentiated during the Xerothermic period when former widespread wetlands remained isolated in small pockets (8000-4000 ya) (Simurda et al. 2005). In another example,

Engelman’s Quillwort (Isoetes engelmannii), which is a CAP disjunct, was found to have high genetic similarity between Ontario disjunct populations and core USA populations, again suggesting a recent evolutionary split (Coleman 2007). These studies all contrast with our finding that disjunct populations of B. paniculata subsp. paniculata in Ontario appear to have diverged from the core populations more than 500,000 ya, in other words long before the last glacial maximum, and likely existed in different refugia throughout the past several glacial- interglacial cycles.

Although we have not characterized B. paniculata subsp. paniculata from across its range, and therefore cannot elucidate CAP postglacial colonisation patterns, colonization scenarios of disjunct populations around the Great Lakes could involve dispersal corridors through the inland of North America, including the west side of the Appalachian or

Mississippian corridors from the Gulf Coast. To some extent, the phylogeographic patterns of B. paniculata subsp. paniculata support the Appalachian disjunction pattern which is common to many species in North America (Soltis et al. 2006). Pollen studies showed that the southern part of the New Jersey State, from where our USA B. paniculata subsp. paniculata sample originated, remained south of the glacial border throughout the past 200,000 years (Florer 1970; Potzger

1952; Lewis and Kummel 1940). Given that B. paniculata subsp. paniculata has southern and

central populations (Gillett 1959; Mathews et al. 2009), it may have colonised northwards through the eastern corridor up to the nearby New Jersey location, while the Ontario populations migrated from a different southern refugia through the western Appalachian migration corridor.

Although the genetic divergence identified in this study suggests that disjunct populations from

Ontario and the core US lineage from New Jersey originated in at least two different glacial refugia, more sampling is needed to elucidate glacial-interglacial dispersal routes.

The data that we present in this study are the first to reveal a divergence time between

Great Lakes disjuncts and their core population that substantially pre-dates the last glacial maximum. The relatively small number of studies on Great Lakes disjuncts means that we are unable to speculate on whether this finding is unusual. However, we can comment on the importance of this finding to questions of conservation. As noted in the introduction, the long- term conservation of species requires the preservation of genetic diversity, and therefore the extent to which peripheral populations have differentiated from central populations may be one way in which to measure their value (Lesica and Allendorf 1995). The genetic novelty of

Ontario B. paniculata subsp. paniculata populations should be factored into future conservation decisions, because the evolutionary history of these disjuncts is very different to that of at least some of the core lineages. Additional genetic surveys of Great Lakes disjuncts and core populations are needed before we can determine how common it is for threatened marginal populations to have a high degree of genetic novelty.

Acknowledgements

We are very grateful to Burke Korol, Mike Oldham and Sam Brinker from the Ontario

Ministry of Natural Resources for providing samples of disjunct Branched Bartonia.

Many thanks to Drs. Katherine Mathews and Lena Struwe, who kindly provided us with

Bartonia, Obolaria and Gentianella samples from the USA. Thanks also to Dr. K. Mathews and

Dr. Cornelya Klütsch for comments on our manuscript. We are grateful to Prof. Bernard von

Hagen for providing advice with the molecular calibration and outgroup information. Many

thanks to Prof. Bernard von Hagen and Dr. Steven R. Hill for valuable comments on the

manuscript. This study was funded by the Ontario Parks division of the Ministry of Natural

Resources, the Natural Sciences and Engineering Council (NSERC), and Trent University.

References

Argus, G., W., Pryer, K., M., and White, D. J. 1987. Atlas of the Rare Vascular Plants

of Ontario. National Museum of Natural Sciences, Ottawa, Ontario

Arponen, A. 2012. Prioritizing species for conservation planning. Biodivers. Conserv. 21(4):

875-893. doi: 10.1007/s10531-012-0242-1.

Augustin, L., Barbante, C., Barnes, P.R.F., Barnola, J.M., Bigler, M., Castellano, E., Cattani, O.,

Chappellaz, J., DahlJensen, D., Delmonte, B., Dreyfus, G., Durand, G., Falourd, S.,

Fischer, H., Fluckiger, J., Hansson, M.E., Huybrechts, P., Jugie, R., Johnsen, S.J., Jouzel,

J., Kaufmann, P., Kipfstuhl, J., Lambert, F., Lipenkov, V.Y., Littot, G.V.C., Longinelli,

A., Lorrain, R., Maggi, V., Masson-Delmotte, V., Miller, H., Mulvaney, R., Oerlemans,

J., Oerter, H., Orombelli, G., Parrenin, F., Peel, D.A., Petit, J.R., Raynaud, D., Ritz, C.,

Ruth, U., Schwander, J., Siegenthaler, U., Souchez, R., Stauffer, B., Steffensen, J.P.,

Stenni, B., Stocker, T.F., Tabacco, I.E., Udisti, R., van de Wal, R.S.W., van den Broeke,

M., Weiss, J., Wilhelms, F., Winther, J.G., Wolff, E.W., and Zucchelli, M. 2004. Eight

glacial cycles from an Antarctic ice core. Nature, 429 (6992): 623-628. doi:

10.1038/nature02599.

Brinker, S. (Dougan and Associates). 2006. Detailed inventory of Branched Bartonia Bartonia

paniculata (Michx.) Muhlenb ssp. paniculata in Central Ontario. Prepared for Ontario

Ministry of Natural Resources and Ontario Parks. 29 pp + appendices.

Brownell, V.R., Blaney, C.S., and Catling, P.M. 1996. Recent discoveries of southern vascular

plants at their northern limits in the granite barrens area of Lennox and Addington

County, Ontario. Can. Field Nat. 110(2): 255-259.

Bunnell, F.L., Campbell, R.W., and Squires, K.A. 2004. Conservation priorities for peripheral

species: the example of British Columbia. Can. J. Forest Res. 34(11): 2240-2247. doi:

10.1139/X04-102.

Cain, S.A. (1944) Foundations of Plant Geography, Harper and Brothers, New York and London.

Clement, M., Posada, D., and Crandall, K.A. 2000. TCS: a computer program to estimate gene

genealogies. Mol. Ecol. 9(10): 1657-1659. doi: 10.1046/j.1365-294x.2000.01020.x.

Coleman, M. J. 2007. The conservation genetics of two endangered plants of Ontario, Canada,

Cirsium pitcheri and Isoetes engelmannii, using nuclear and chloroplast DNA. MSc

Thesis, Trent University, Peterborough, Ontario.

COSEWIC. 2003. COSEWIC assessment and update status report on the branched Bartonia

(Bartonia paniculata ssp. paniculata) in Canada. Edited by COSEWIC. Ottawa.

Government of Canada. p. 14. http://publications.gc.ca/collections/Collection/CW69-14-

357-2004E.pdf (Accessed13 March, 2013).

Coyne, J. A., and Orr. H. A. 2004. Speciation. Sinauer Associates, Sunderland, Massachusetts.

Cuenoud, P., Savolainen, V., Chatrou, L.W., Powell, M., Grayer, R.J., and Chase, M.W. 2002.

Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL,

atpB, and matK DNA sequences. Am. J. Bot. 89(1): 132-144. doi: 10.3732/ajb.89.1.132.

Drummond, A.J., Ho, S.Y.W., Phillips, M.J., and Rambaut, A. 2006. Relaxed phylogenetics and

dating with confidence. Plos Biol. 4(5): 699-710. doi: 10.1371/journal.pbio.0040088.

Drummond, A.J., and Rambaut, A. 2007. BEAST: Bayesian evolutionary analysis by sampling

trees. Bmc Evol. Biol. 7(8): 214. doi:10.1186/1471-2148-7-214.

Eckert, C.G., Samis, K.E., and Lougheed, S.C. 2008. Genetic variation across species'

geographical ranges: the central-marginal hypothesis and beyond. Mol. Ecol. 17(5):

1170-1188. doi: 10.1111/j.1365-294X.2007.03659.x.

Ehlers, J., and Gibbard, P.L. 2003. Extent and chronology of glaciations. Quaternary Sci. Rev.

22(15-17): 1561-1568. doi:10.1016/S0277-3791(03)00130-6.

Ehlers, J., and Gibbard, P. 2008. Extent and chronology of Quaternary glaciation. Episodes,

31(2): 211-218.

Favre, A., Yuan, Y.M., Kupfer, P., and Alvarez, N. Phylogeny of subtribe Gentianinae

(Gentianaceae): Biogeographic inferences despite limitations in temporal calibration

points. Taxon, 59(6): 1701-1711.

Felsenstein J. 2004. Inferring Phylogenies. Sinauer Associates, Sunderland, Massachusetts.

Florer, L.E. 1972. Palynology of a Postglacial Bog in the New Jersey Pine Barrens. B. Torrey

Bot. Club 99(3): 135-138.

Freeland, J., and Vachon, N. 2012. Repetitive sequences in phylogeographic inference: a reply to

Saltonstall and Lambertini. Mol. Ecol. Resour. 12(4): 586-589.

Freeland, J.R., Gillespie, J., Ciotir, C., and Dorken, M.E. 2010. Conservation genetics of Hill's

thistle (Cirsium hillii). Botany, 88(12): 1073-1080. doi:10.1139/B10-080

Gillett, J.M. 1959. A revision of Bartonia and Obolaria (Gentianaceae). Rhodora, (61): 43-62.

Gillett, J.M. 1963. The Gentians of Canada, Alaska, and Greenland. Ottawa,Canada Department

of Agriculture, Research Branch, Publication 1180 .

Hall, T.A. 1999. BioEdit: a user friendly biological sequence alignment editor and analysis

program for Windows 95/98NT. Nucl. Acids. Symp. Ser.41: 95-98.

Hamilton, J.A., and Eckert, C. 2007. Population genetic consequences of geographic disjunction:

a prairie plant isolated on Great Lakes alvars. Mol. Ecol. 16(8): 1649-1660. doi:

10.1111/j.1365-294X.2007.03241.x.

Hampe, A., and Petit, R.J. 2005. Conserving biodiversity under climate change: the rear edge

matters. Ecol. Lett. 8(5): 461-467. doi: 10.1111/j.1461-0248.2005.00739.x.

Hastings, W. 1970. Monte Carlo sampling methods using Markov chains and their applications,

Biometrika 57: 97-109.

Hewitt, G.M. 1996. Some genetic consequences of ice ages, and their role in divergence and

speciation. Biol. J. Linn. Soc. 58(3): 247-276.

Hewitt, G.M. 1999. Post-glacial re-colonization of European biota. Biol. J. Linn. Soc. 68(1-2):

87-112. doi: 10.1111/j.1095-8312.1996.tb01434.x.

Hewitt, G.M. 2004. Genetic consequences of climatic oscillations in the Quaternary. Philos. T.

Roy. Soc. B. 359(1442): 183-195. doi: 10.1098/rstb.2003.1388.

Higgins, S.I., and Richardson, D.M. 1999. Predicting plant migration rates in a changing world:

The role of long-distance dispersal. Am. Nat. 153(5): 464-475. doi: 10.1086/303193.

Hill, S.R. 2003. Conservation assessment for twining screwstem (Bartonia paniculata) (Michx.)

Muhl. Report for USDA Forest Service, Eastern Region, Milwaukee, Wisconsin. 23 pp. +

appendices.

Hoffmann, A.A., and Blows, M.W. 1994. Species Borders - Ecological and Evolutionary

Perspectives. Trends Ecol. Evol. 9(6): 223-227. doi: 10.1016/0169-5347(94)90248-8.

Hollingsworth, P.M., Forrest, L.L., Spouge, J.L., Hajibabaei, M., Ratnasingham, S., van der

Bank, M., Chase, M.W., Cowan, R.S., Erickson, D.L., Fazekas, A.J., Graham, S.W.,

James, K.E., Kim, K.J., Kress, W.J., Schneider, H., van AlphenStahl, J., Barrett, S.C.H.,

van den Berg, C., Bogarin, D., Burgess, K.S., Cameron, K.M., Carine, M., Chacon, J.,

Clark, A., Clarkson, J.J., Conrad, F., Devey, D.S., Ford, C.S., Hedderson, T.A.J.,

Hollingsworth, M.L., Husband, B.C., Kelly, L.J., Kesanakurti, P.R., Kim, J.S., Kim,

Y.D., Lahaye, R., Lee, H.L., Long, D.G., Madrinan, S., Maurin, O., Meusnier, I.,

Newmaster, S.G., Park, C.W., Percy, D.M., Petersen, G., Richardson, J.E., Salazar, G.A.,

Savolainen, V., Seberg, O., Wilkinson, M.J., Yi, D.K., and Little, D.P. 2009. A DNA

barcode for land plants. PNAS 106(31): 12794-12797. doi_10.1073_pnas.0905845106.

Holloway, R.G., and Bryant, V.M., Jr. 1984. Picea glauca Pollen from Late Glacial Deposits in

Central Texas. Palynology, 8: 21-32.

Hunter, M.L., and Hutchinson, A. 1994. The virtues and shortcomings of parochialism -

conserving species that are locally rare, but globally common. Conserv. Biol. 8(4): 1163-

1165. doi: 10.1046/j.1523-1739.1994.08041163.x.

Jackson, S.T., and Overpeck, J.T. 2000. Responses of plant populations and communities to

environmental changes of the late Quaternary. Paleobiology, 26(4): 194-220. doi:

10.1666/0094-8373(2000)26[194:ROPPAC]2.0.CO;2.

Jackson, S.T., and Singer, D.K. 1997. Climate change and the development of coastal plain

disjunctions in the central Great Lakes region. Rhodora, 99(898): 101-117.

Jackson, S.T., Webb, R.S., Anderson, K.H., Overpeck, J.T., Webb, T., Williams, J.W., and

Hansen, B.C.S. 2000. Vegetation and environment in Eastern North America during the

Last Glacial Maximum. Quaternary Sci. Rev. 19(6): 489-508. doi: 10.1016/S0277-

3791(99)00093-1.

Keddy, P.A. 1981. Vegetation with Atlantic Coastal-Plain Affinities in Axe Lake, near Georgian

Bay, Ontario. Can. Field Nat. 95(3): 241-248.

Keddy, P.A. 1983. Shoreline Vegetation in Axe Lake, Ontario - Effects of Exposure on Zonation

Patterns. Ecology, 64(2): 331-344. doi: 10.2307/1937080.

Kress, W.J., and Erickson, D.L. 2007. A Two-Locus Global DNA Barcode for Land Plants: The

Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region. PLoS One

2(6): 10. doi:10.1371/journal.pone.0000508.

Lesica, P., and Allendorf, F.W. 1995. When Are Peripheral-Populations Valuable for

Conservation. Conserv. Biol. 9(4): 753-760. doi: 10.1046/j.1523-1739.1995.09040753.x.

Lewis, J.V., and Kummel, H.B. 1940. The geology of New Jersey, N.J. Dep. Conservation and

Development, Bull. 50,Geologic series.

Lomolino, M. V., Riddle B.R. and Brown, J. H. 2006. Biogeography, Third Edition, 278-286,

Sinauer Associates, Sunderland.

Mathews, K.G., Dunne, N., York, E., and Struwe, L. 2009. A Phylogenetic Analysis and

Taxonomic Revision of Bartonia (Gentianaceae: Gentianeae), Based on Molecular and

Morphological Evidence. Syst. Bot. 34(1): 162-172.

Nantel, P., and Gagnon, D. 1999. Variability in the dynamics of northern peripheral versus

southern populations of two clonal plant species, Helianthus divaricatus and Rhus

aromatica. J. Ecol. 87(5): 748-760. doi: 10.1046/j.1365-2745.1999.00388.x.

NatureServe. 2003. NatureServe Explorer: An online encyclopedia of life [web application].

Version 1.8. NatureServe, Arlington, Virginia. Available

http://www.natureserve.org/explorer. (Accessed 9 March, 2011).

Nylander, J.A. 2004. MrModelTest 2.3. Evolutionary Biology Centre, Uppsala University.

Pan, J., Zhang, D., and Sang, T. 2007. Molecular phylogenetic evidence for the origin of a

diploid hybrid of Paeonia (Paeoniaceae). Am. J. Bot. 94(3): 400-408. doi:

10.3732/ajb.94.3.400.

Peattie, D.C. 1922. The Atlantic coastal plain element in the flora of the Great Lakes, Rhodora,

24 (57-70): 80-8.

Rajora, O.P., DeVerno, L., Mosseler, A., and Innes, D.J. 1998. Genetic diversity and population

structure of disjunct Newfoundland and central Ontario populations of eastern white pine

(Pinus strobus). Can. J. Botany, 76(3): 500-508.

Reznicek, A.A. 1994. The Disjunct Coastal-Plain Flora in the Great-Lakes Region. Biol. Conser.

68(3): 203-215. doi 10.1016/0006-3207(94)90408-1.

Row, J.R., Brooks, R.J., MacKinnon, C.A., Lawson, A., Crother, B.I., White, M., and Lougheed,

S.C. 2011. Approximate Bayesian computation reveals the factors that influence genetic

diversity and population structure of foxsnakes. J. Evolution. Biol. 24(11): 2364-2377.

doi: 10.1111/j.1420-9101.2011.02362.x.

Sang, T., Crawford, D.J., and Stuessy, T.F. 1997. Chloroplast DNA phylogeny, reticulate

evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 84(8): 1120-

1136.URL: http://www.jstor.org/stable/2446155.

Schonswetter, P., Tribsch, A., and Niklfeld, H. 2003. Phylogeography of the high alpine cushion

plant Androsace alpina (Primulaceae) in the European Alps. Plant Biology 5(6): 623-630.

doi: 10.1055/s-2003-44686.

Simmons, M.P., and Ochoterena, H. 2000. Gaps as characters in sequence-based phylogenetic

analyses. Syst. Bot. 49(2): 369-381.

Simurda, M.C., Marshall, D.C., and Knox, J.S. 2005. Phylogeography of the narrow endemic,

Helenium virginicum (Asteraceae), based upon ITS sequence comparisons. Syst. Bot.

30(4): 887-898. doi: 10.1600/036364405775097725.

Soltis, D.E., Morris, A.B., McLachlan, J.S., Manos, P.S., and Soltis, P.S. 2006. Comparative

phylogeography of unglaciated eastern North America. Mol. Ecol. 15(14): 4261-4293.

doi: 10.1111/j.1365-294X.2006.03061.x.

Soltis, P.S., and Gitzendanner, M.A. 1999. Molecular systematics and the conservation of rare

species. Conserv. Biol.13(3): 471-483. doi: 10.1046/j.1523-1739.1999.97286.x.

Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J. 1991. Universal Primers for Amplification of 3

Noncoding Regions of Chloroplast DNA. Plant Mol. Biol. 17(5): 1105-1109. doi:

10.1007/BF00037152.

Templeton, A.R., Crandall, K.A., and Sing, C.F. 1992. A Cladistic-Analysis of Phenotypic

Associations with Haplotypes Inferred from Restriction Endonuclease Mapping and

DNA-Sequence Data .3. Cladogram Estimation. Genetics, 132(2): 619-633.

Thiv, M., Struwe, L., and Kadereit, J.W. 1999. The phylogenetic relationships and evolution of

the Canarian laurel forest endemic Ixanthus viscosus (Aiton) Griseb. (Gentianaceae):

evidence from matK and ITS sequences, and floral morphology and anatomy. Plant Syst.

Evol. 218(3-4): 299-317. doi: 10.1007/BF01089233.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. 1994. Clustal-W - Improving the Sensitivity of

Progressive Multiple Sequence Alignment through Sequence Weighting, Position-

Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Res. 22(22): 4673-

4680. doi: 10.1093/nar/22.22.4673.

Vachon, N., and Freeland, J.R. Phylogeographic inferences from chloroplast DNA: quantifying

the effects of mutations in repetitive and non-repetitive sequences. Mol. Ecol. Resour.

11(2): 279-285. doi: 10.1111/j.1755-0998.2010.02921.x. von Hagen, K.B., and Kadereit, J.W. 2001. The phylogeny of Gentianella (Gentianaceae) and its

colonization of the southern hemisphere as revealed by nuclear and chloroplast DNA

sequence variation. Org. Divers. Evol. 1(1): 61-79. doi: 10.1078/1439-6092-00005. von Hagen, K.B., and Kadereit, J.W. 2002. Phylogeny and flower evolution of the Swertiinae

(Gentianaceae-Gentianeae): Homoplasy and the principle of variable proportions.

Systematic Botany 27(3): 548-572. doi: 10.1043/0363-6445-27.3.548.

Waltari, E., Hijmans, R.J., Peterson, A.T., Nyari, A.S., Perkins, S.L., and Guralnick, R.P. 2007.

Locating Pleistocene Refugia: Comparing Phylogeographic and Ecological Niche Model

Predictions. PLoS One 2(7). doi:10.1371/journal.pone.0000563.

Whitehead, D.R. 1972. Approaches to Disjunct Populations: The Contribution of Palynology.

Annals of the Missouri Botanical Garden 59(2): 125-137.

Whitlock, B.A., Hale, A.M., and Groff, P.A. 2010. Intraspecific Inversions Pose a Challenge for

the trnH-psbA Plant DNA Barcode. Plos One 5(7). doi: 0.1371/journal.pone.0011533.

Willi, Y., Van Buskirk, J., and Hoffmann, A.A. 2006. Limits to the adaptive potential of small

populations. Annu. Rev. Ecol. Evol. Syst.37: 433-458.

doi: 10.1146/annurev.ecolsys.37.091305.110145.

Yesson, C., Toomey, N.H., and Culham, A. 2008. Cyclamen: time, sea and speciation

biogeography using a temporally calibrated phylogeny. J. Biogeogr. 36(7): 1234-1252.

Doi: 10.1111/j.1365-2699.2008.01971.x.

Yuan, Y.M., Wohlhauser, S., Moller, M., Klackenberg, J., Callmander, M.W., and Kupfer, P.

2005. Phylogeny and biogeography of Exacum (Gentianaceae): A disjunctive distribution

in the Indian Ocean Basin resulted from long distance dispersal and extensive radiation.

Systematic Biol. 54(1): 21-34. doi: 10.1080/10635150590905867.

Table 2.1 Locations and sample sizes of Bartonia spp. and outgroups that were sequenced in this study. See Figure 2.1 for map of locations.

Species Samples Locality

B. paniculata subsp. paniculata 1 New Jersey, NJ, USA

2 Austin's Wetland, ON, Canada

10 Axe Lake, ON, Canada

5 Bala Bog, ON, Canada

10 MacTier Bog, ON, Canada

5 Medora Fen, ON, Canada

2 O'Donnell Point, ON, Canada

B. paniculata subsp. iodandra 1 Newfoundland, Canada

B. texana 1 Louisiana, USA

B. virginica 1 North Carolina, USA

2 Torrance Barrens, ON, Canada

B. verna 1 North Carolina, USA

Obolaria virginica 1 North Carolina, USA

Gentianella quinquefolia 1 North Carolina, USA

Table 2.2 Primers used for cpDNA amplification in Bartonia spp., G. quinquefolia and O. virginica

Sequence Region Primer sequence (5’ to 3’) length bp. Reference

Hollingsworth et rbcL rbcLa_f ATGTCACCACAAACAGAGACTAAAGC 543 al. 2009; Kress and rbcLa_rev GTAAAATCAAGTCCACCRCG Ericsson 2007 matK 1198F: CTGTGTTAGATATACGAATACC 456 1581R: CTTGATACCTAACATAATGCAT Thiv et al. 1999 trnH-psbA psbAF: GTTATGCATGAACGTAATGCTC 453 trnHR: CGCGCATGGTGGATTCACAAATC Sang et al. 1997 trnL-trnF UAA F: CGAAATCGGTAGACGCTACG 823 Taberlet et GAA R: ATI'TGAACTGGTGACACGAG al.1991 Taberlet et trnT-trnL UGU F: CATTACAAATGCGATGCTCT 694-792 al.1991 UAA R: TCTACCGATTTCGCCATATC

Table 2.3 PCR conditions used for cpDNA amplification

Region PCR conditions

Initial Denaturation Annealing Extension Final No. of

denaturation temp./time temp./time temp./time extension cycles

temp./time temp./time

rbcL 94°C/120s 94°C/30s 54°C/60s 72°C/60s 72°C/600s 30

matK 94°C/120s 94°C/60s 49°C/60s 72°C/90s 72°C/420s 26

trnH-psbA 94°C/120s 94°C/60s 51°C/60s 72°C/120s 72°C/420s 30

trnL-trnF 95°C/120s 95°C/60s 53°C/50s 72°C/120s 72°C/420s 30

trnT-trnL 94°C/120s 94°C/60s 52°C/40s 72°C/40s 72°C/420s 30

Table 2.4 Best-fit models of nucleotide substitution for each of the five cpDNA regions selected under the Akaike information criterion (AIC).

DNA REGION rbcL trnT-trnL trnL-trnF matK trnH-psbA

Model HKY GTR+I GTR+G GTR GTR

Length of the Alignment 543 942 881 402 476

(bp)

Table 2.5 Node calibration points resulted from the matK and trnL-trnF analyses. For each node, mean ages (in My), standard deviation (SD) and the lowest and the largest percentile of the

Highest Posterior Density (HPD) are presented.

Diverged nodes Mean Ages (Mya) SD HPD 2.5% HPD 97.5% matK Frasera 9.567 4.384 7.043 19.774 Obolaria-Gentianella 6.787 5.114 0.654 18.613 Tree Root 17.082 11.253 7.900 43.426 trnL-trnF Frasera 8.966 2.954 7.033 16.129 Obolaria-Gentianella 7.674 4.698 0.992 18.408 Tree Root 17.129 10.841 7.995 41.118

Table 2.6 TRMC estimates and confidence intervals 95% HPD (confidence index)

Diverged nodes Mean Ages (Mya) SD HPD 2.5% HPD 97.5% B.p.paniculata Ontario 0.166 0.093 0.038 0.381 B.p.paniculata USA 0.534 0.178 0.226 0.903 B.paniculata 2.461 0.649 1.382 3.846 B.virginica 0.133 0.085 0.027 0.334 Bartonia Ingroup 6.884 1.082 5.012 9.139 Obolaria-Gentianella 9.506 1.693 7.230 13.384 Tree Root 18.526 1.518 17.146 22.247

Figure 2.1Map showing the locations where Bartonia was sampled for this study. On the main map Canadian B. paniculata subsp. paniculata populations are labelled with their location (O’Donnell,

Austin Lake, Bala and Medora), and the two locations from which Canadian B. virginica was sampled are also identified. On the inset map the Newfoundland and USA sample locations are labelled with the relevant species’ names. For full site names, see Table 2.1.

Figure 2.2 Chronogram based on five cpDNA regions combined, of the genus Bartonia calibrated with G. quinquefolia and O. virginica outgroups. Mean values for ages of nodes are represented on top left, inside of the clades while posterior probability support values for the HDP confidence interval are represented outside of the clades.

Med1=Medora1, Med2=Medora2, Bptex= B. paniculata subsp. texana and BppUSA= B. paniculata subsp. paniculata (Table 2.1, Figure 2.1). Each solid black circle or fork represents a single mutation.

Connections that encompass multiple mutations are shortened by horizontal lines, and the numbers adjacent to these lines represent the number of mutations that the shortcut spans.

APPENDIX 2

Appendix 2.3 trnL-trnF cladogram and chronogram of the genus Bartonia calibrated with Frasera outgroups: ages of nodes (My) are represented on the time axis while posterior probability support values for each node are represented outside of the clades.

Appendix 2.4 Summary of DNA sequences that were used in this study

Species Subspecies Abr. Location Genebank number

trnL-trnF matK trnH-psbA trnT-trnL rbcL

B.paniculata paniculata Bpp 7UA1 Austin Lake KF501343 KF496038 KF543746 KF527850 KF496003

B.paniculata paniculata Bpp 7UA2 Austin Lake KF501344 KF496039 KF543747 KF527851 KF496004

B.paniculata paniculata Bpp 8AA3 Axe Lake KF501346 KF496040 KF543748 KF527852 KF496005

B.paniculata paniculata Bpp 8AA4 Axe Lake KF501347 KF496041 KF543778 KF527853 KF496006

B.paniculata paniculata Bpp 8AB3 Axe Lake KF501348 KF496042 KF543749 KF527854 KF496007

B.paniculata paniculata Bpp 8AB5 Axe Lake KF501349 KF496043 KF543750 KF527855 KF496008

B.paniculata paniculata Bpp 8AC1 Axe Lake KF501350 KF496044 KF543751 KF527856 KF496009

B.paniculata paniculata Bpp 8AC6 Axe Lake KF501351 KF496045 KF543752 KF527857 KF496010

B.paniculata paniculata Bpp 8AC10 Axe Lake KF501352 KF496046 KF543753 KF527858 KF496011

B.paniculata paniculata Bpp 7BA3 Bala KF501353 KF496048 KF543754 KF527859 KF496012

B.paniculata paniculata Bpp 7BA5 Bala KF501354 KF496049 KF543755 KF527860 KF496013

B.paniculata paniculata Bpp 7BA7 Bala KF501355 KF496050 KF543756 KF527861 KF496014

B.paniculata paniculata Bpp 7BA8 Bala KF501356 KF496051 KF543757 KF527862 KF496015

B.paniculata paniculata Bpp 8MA1 MacTier KF501357 KF496052 KF543758 KF527863 KF496016

B.paniculata paniculata Bpp 8MA3 MacTier KF501358 KF496053 KF543759 KF527864 KF496017

B.paniculata paniculata Bpp 8MA4 MacTier KF501359 KF496054 KF543760 KF527865 KF496018

B.paniculata paniculata Bpp 8MA5 MacTier KF501360 KF496055 KF543761 KF527866 KF496019

B.paniculata paniculata Bpp8MA10 MacTier KF501361 KF496056 KF543762 KF527867 KF496020

B.paniculata paniculata Bpp 8MB1 MacTier KF501362 KF496057 KF543763 KF527868 KF496021

B.paniculata paniculata Bpp 8MB3 MacTier KF501363 KF496058 KF543764 KF527869 KF496022

B.paniculata paniculata Bpp 8MB6 MacTier KF501364 KF496059 KF543765 KF527870 KF496023

B.paniculata paniculata Bpp 7EA1 Medora KF501365 KF496060 KF543766 KF527871 KF496024

B.paniculata paniculata Bpp 7EA2 Medora KF501366 KF496061 KF543767 KF527872 KF496037

B.paniculata paniculata Bpp 7OA1 O'Donnell KF501367 KF496062 KF543768 KF527873 KF496025

B.paniculata paniculata Bpp 7OA2 O'Donnell KF501368 KF496063 KF543769 KF527874 KF496026

B.paniculata paniculata Bpp 9OA2 O'Donnell KF501369 KF496064 KF543770 KF527875 KF496027

B.paniculata paniculata Bpp USA New Jersey EU834125 KF496065 TBC KF527876 KF496028

Bonnie

B.paniculata iodandra Bpi USA Bay,New EU834126 KF496066 NA KF527877 KF496029

Foundland

B.paniculata texana Btex USA Caddo Parish EU834124 KF496067 KF543772 KF527878 KF496030

B.virginica Bvir USA Jackson EU834127 KF496068 KF543775 KF527879 KF496031

Torrance

B.virginica Bvir BV1 Barrens KF501370 KF496069 KF543773 KF527880 KF496032

Torrance

B.virginica Bvir BV5 Barrens KF501371 KF496070 KF543774 KF527881 KF496033

Brunswick Co.

B.verna Bver USA N. Carolina EU834128 KF496071 KF543776 KF527882 KF496003

G.quinquefolia Gqui Jackson EU834123 KF496072 KF543777 KF527871 KF496004

O.virginica Ovir N. Carolina AJ315201 KF501352 NA NA KF496005

Frasera tubulosa NCBI NA AJ408030 NA NA NA

F.parryi NCBI NA AJ408029 NA NA NA

F.albicaulis NCBI NA AJ406325 NA NA NA

AJ315187 NA NA

F.albomarginata NCBI AJ315233 NA NA NA NA

AJ315230 HM460851 NA NA

AJ315276 HM460849 NA NA

F.speciosa NCBI NA NA HM460848 NA NA

3 CHAPTER 3

CONTRASTING PATTERNS OF PHYLOGEOGRAPHY IN DISJUNCT POPULATIONS OF THREE PLANT SPECIES IN THE GREAT LAKES REGION

Authorship: Ciotir C, Jennifer Coughlan, Jill Hamilton, Christopher Eckert and Joanna

Freeland

Abstract

A third of the rare vascular plant species in Ontario occur as disjunct populations, but their potential genetic novelty relative to core populations has seldom been explored. We tested the prediction of genetic novelty in disjunct populations in the Great Lakes region for three species: 1) Empetrum nigrum, which was compared to northern core populations in BC, northern

Ontario and NFL. 2) Sporobolus heterolepis, a vulnerable species in Ontario, which was compared to core populations in the western Canadian prairies; and 3) Carex richardsonii, which was compared to core populations in the western Canadian and central US prairies. Chloroplast

DNA sequences revealed minimal genetic differences between disjunct and core populations in

S. heterolepis and E. nigrum, reflecting in each of these species a recent divergence that postdated the Last Glacial Maximum (LGM). In contrast, C. richardsonii revealed a pattern not previously found in Great Lakes disjuncts: genetic similarity of disjunct and core populations combined with genetic novelty in both regions. The data from this and previous studies lead us to conclude that in the majority of species so far examined, disjunct populations around the Great

Lakes share a recent common ancestor with their core populations; however, exceptions to this rule mean that genetic similarity between core and disjunct populations should not be assumed.

Keywords disjunct populations, alvar, conservation, genetic differentiation, genetic diversity,

Empetrum nigrum, Sporobolus heterolepis, Carex richardsonii 55

Introduction

Ongoing changes in climate, geology, ecology, and selection pressures mean that the geographical distributions of most species have varied considerably over time. Historical glacial-interglacial cycles in particular induced landscape modifications that altered the ranges of species and influenced the distribution of genetic variation across landscapes (Hewitt, 2000). In

North America, species ranges changed significantly over the past 20 000 years following the

Last Glacial Maximum (LGM) and subsequent climatic oscillations (Pielou, 1991). Most temperate species survived in glacial refugia, and later dispersed from these refugia to deglaciated areas, where many have persisted as a series of populations distributed across the landscape. Although such populations are commonly separated by relatively short distances, there is sometimes a gap of several hundred kilometres between a species’ core set of populations and a subset of one or more populations that are known as disjuncts (Brown et al.

1996).

Disjunct populations often occur towards the limits of species’ geographical distributions

(Bunnell and Squires, 2004). Disjunct populations may be genetically distinct from core populations due to founder effects or bottlenecks followed by genetic drift (Fant et al. 2014;

Lönn and Prentice, 2002; Vucetich and Waite, 2003), and possibly also local adaptation to particular environmental conditions (Lesica and Allendorf, 1995). Disjunct populations are often considered important from a conservation perspective because if they are locally adapted to marginal ecological and climatic conditions, they may facilitate the successful response of a species to climate change (Hampe and Petit, 2005; Coyne and Orr, 2004; Pamilo and Savolainen,

1999). At the same time, the conservation management of disjunct populations can be controversial because in many cases the core populations are relatively abundant (Hunter and

Hutchinson, 1994). Relatively few studies have assessed the genetic novelty of disjunct 56

populations relative to core populations; of those that have, some have found substantial genetic divergence between the two (e.g. Ciotir et al. 2013; Jones et al. 2001; Lammi et al. 1992), although other studies have found no evidence of genetic divergence (Allen et al. 1996; Guries and Ledig, 1982). Additional studies are needed because quantifying the genetic novelty of disjunct populations can be important both for understanding the evolutionary significance of disjunct populations, and for assessing their conservation value (Hunter and Hutchinson, 1994;

Lesica and Allendorf, 1995).

Around the Great Lakes region of North America, disjunct populations of many species that reside in habitats such as alvar, shore and bog communities have unclear origins (Argus et al. 1987; Reznicek, 1994). However, it is widely believed that they arose as a result of climatic change and associated shifts in range distribution during the postglacial colonisation that followed deglaciation of the Great Lakes region ~15,000-10,000 years ago (Catling and

Brownell, 1995; Ehlers and Gibbard, 2003). Many disjunct populations around the Great Lakes occur in alvar communities, and belong to species with core populations that are in boreal forests or prairie ecosystems (Catling and Brownell, 1995; Catling, 1975). Whether or not Great Lakes disjunct populations are genetically distinct from their respective core populations is difficult to predict. One recent study of a disjunct coastal Atlantic plain (CAP) floristic element, Bartonia paniculata subsp. paniculata, growing near Lake Ontario revealed substantial genetic divergence between disjunct and core haplotypes that likely preceded postglacial colonisation (Ciotir et al.

2013). In contrast, two studies on prairie species with disjunct populations around the Great

Lakes - foxsnakes (Pantherophis gloydi and P. vulpina) and prairie smoke (Geum trifolium) - revealed little divergence between core and disjunct populations, and concluded that disjuncts originated ~5000ya during a mid-Holocene climatic cooling period that caused prairie range

contraction and a subsequent vicariant split of core and disjunct populations (Row et al. 2011;

Hamilton and Eckert 2007).

In this study we investigated the genetic similarity of disjunct and core populations from three species, each of which has disjunct populations in the Great Lakes region, and core populations in prairie and/or northern boreal regions: Empetrum nigrum, S. heterolepis, and C. richardsonii. Empetrum nigrum is a low, creeping evergreen shrub that establishes as a ground layer in many boreal forests and persists as core populations through circumboreal habitats of tundra and taiga in the North American arctic (USDA Forest Service, 1992). In Eastern North

America E. nigrum also occurs as disjunct populations in southern hilly locations of New

England, USA, and the northern shores of Lake Superior, Canada (Penskar and Crispin, 2009).

Sporobolus heterolepis (Prairie dropseed) is a perennial bunch grass reaching 30 to 70 cm in height (Hitchcock, 1971), and although it specializes in prairie/savannah habitats (Oldham,

1999), it may also occur in oak barrens, northern fens, and boreal and mixed wood forests

(Engstrom, 2004 and references therein). Carex richardsonii (Richardson’s sedge) is a perennial small densely clumped sedge reaching ~25 cm (Higman and Penskar, 2002) that is common in prairies, alvar, bedrock glades, and rocky shoreline communities, although it also occurs in remnant oak savanna areas, open woodlands, floodplain edges and boreal forests (Ball et al.

2003; Dunlop, 2002). Sporobolus heterolepis and C. richardsonii each has core populations in prairies throughout western Canada and the mid-west United States (USDA, 2010). Sporobolus heterolepis reaches its northernmost point at roughly 53° north latitude in Saskatchewan, while

C. richardsonii extends into more northerly latitudes in Saskatchewan, Alberta, British Columbia and the Northwestern Territories (Engstrom, 2004; Ball et al. 2003; Higman and Penskar, 2002).

Each of these species also has disjunct populations in alvars around the Great Lakes region of

Ontario, Canada, and adjacent areas in the USA states of Michigan, Ohio, and New York

(Brownell and Riley 2000). In this study we compared chloroplast DNA haplotypes from disjunct and core populations from each of E. nigrum, S. heterolepis, and C. richardsonii to test the hypothesis that the Great Lakes disjunct populations of three species with different life histories and different core distributions each arose following a relatively recent postglacial vicariant split of formerly continuous populations. We therefore predicted that there would be little genetic differentiation among core and disjunct populations within each species.

Material and methods

This study was based on a combination of fresh and herbaria samples (see Appendix 3.1) for herbaria voucher numbers and Figures 3.1, 3.2 and 3.3 for sample locations). Empetrum nigrum core populations were sampled in Canada from northern British Columbia and northern

Ontario, and a peripheral population was sampled from Newfoundland, eastern Canada.

Disjunct E. nigrum populations were sampled from southern Ontario, Canada (Figure 3.1).

Sporobolus heterolepis core populations were sampled from prairies in central Canada, and disjunct populations were sampled from alvars in Ontario and New York (Figure 3.2). Carex richardsonii core populations were sampled from the central and eastern US prairies, and from the western prairies of Canada, whereas disjunct populations were sampled from alvars near two of the Great Lakes (Figure 3.3). For each species, disjunct and core populations were separated by a minimum distance of approximately 650-1500 km. More detailed information about locations is provided in Figures 3.1 to 3.3 and Appendix 3.1.

For all three species, fresh and herbarium material was collected as leaf samples. Fresh leaf material was dried in silica beads before extraction. For each sample, approximately 10-30 mg of dried leaf material was ground in a mixer mill (Retsch MM300; Retsch, Newtown,

Pennsylvania, USA), and genomic DNA was extracted using E.Z.N.A. Plant DNA Mini Kits

(Omega Bio-Tek, Norcross, Georgia, and USA), following manufacturer’s instructions, and eluted into a final volume of 100 µL.

All species were characterized on the basis of DNA sequences from a non-coding chloroplast region (trnT-trnL spacer) using primers developed by Taberlet et al. (1991). This

DNA region was found to be the most variable chloroplast region based on a pilot study that compared trnT-trnL, trnL intron-trnL-trnF spacer and trnH-psbA spacer for all three species (C.

Ciotir, unpublished data). PCR amplifications used an Eppendorf Mastercycler EP gradient

(Mississauga, Ontario, Canada) and a cocktail that included 1x Taq reaction Buffer, 2mM

MgSO4, 200 μM dNTPs, 0.6μM of each primer, 13.30 μL Nanopure H2O, 2.5U of High Purity

Taq polymerase (UBI Life Sciences Ltd., Saskatoon, SK, Canada), 1.2 μL (100%) of BSA additive and approximately 10ng DNA in a final volume of 25 μL. PCR cycling parameters are given in Table 3.1. Unincorporated primer and dNTPs were removed from PCR products by incubating samples with 10U exonuclease I (Fermentas International Inc.) plus 2U shrimp alkaline phosphatase (Fermentas) for 15 minutes at 15°C followed by 15 minutes at 80°C.

Purified products were sequenced in both directions using a BigDye Terminator v3.1 Cycle

Sequencing Kit (Applied Biosystems, Foster City, California, USA). Sequencing reactions were run on a DNA Analyser 3730xl ABI (Applied Biosystems).

Nucleotide sequences were edited and assembled using Seqman (DNASTAR LaserGene

5) software (Madison, WI, USA 2001). All sequences (Appendix 3.1) were imported into

BioEdit Software (Hall, 1999). For each species, sequences were aligned using CLUSTALW

(Thompson et al. 1994) with subsequent manual adjustments. Alignments were a maximum length of 787bp in Empetrum nigrum, 755bp in Sporobolus heterolepis, and 698 bp in Carex richardsonii. Haplotype richness and number of private haplotypes were calculated manually and with a rarefaction test (ADZE 1.0, Szpiech et al. 2008) based on the smallest sample size.

Parsimony networks were reconstructed for each species using TCS software (Clement et al. 2000). We coded each indel as one mutation. For E. nigrum and S. heterolepis the analyses were set in TCS software using 95% statistical parsimony and gaps as the fifth state (Templeton et al. 1992). For C. richardsonii, the stringency of statistical parsimony was decreased to 93% to accommodate the numbers of mutations between haplotypes. For each species we generated a network that was based on the entire sequence. We then searched for repetitive regions

(microsatellites and minisatellites), which we found in S. heterolepis and C. richardsonii, and generated an additional network for each of these two species from which repetitive sequences were excluded. This was done in order to assess the potential influence of homoplasy which is more common in repetitive sequences, and also to assess the influence on our network of mutations in relatively rapidly evolving sequences (repetitive regions) that may be more indicative of relatively recent evolutionary change (Vachon and Freeland, 2011; Freeland and

Vachon, 2012).

Results

trnT-trnL sequences were successfully amplified from twelve samples of Empetrum nigrum, nineteen samples of S. heterolepis and forty samples of Carex richardsonii (Appendix

3.1). Empetrum nigrum lacked indels. All S. heterolepis and C. richardsonii microsatellite indels were in the form of mononucleotide repeats. In addition, C. richardsonii sequences had

minisatellite indels of varying lengths (8-184bp) which caused the total sequence lengths to vary from 420 to 698bp.

Three haplotypes were identified from the 12 E. nigrum samples. One of these sequences was found in the majority (ten) of samples, and those originated from both core (northern

Ontario, British Columbia) and disjunct (Great Lakes region) populations. The remaining two haplotypes were each found in a single individual, one from northern Ontario and the other from

Newfoundland (Figure 3.1 and Figure 3.4). Haplotypes differed from each other by a maximum of two mutations.

Eight haplotypes were identified from the 20 S. heterolepis samples: three haplotypes were from disjunct alvar populations, and five were from core prairie populations (Figure 3.5A).

Some disjunct haplotypes were more closely related to prairie haplotypes (minimum of one mutation) than to other disjunct haplotypes (1-3 mutations). In the network from which repetitive sequences were excluded, only three haplotypes remained, separated by a maximum of two mutations (Figure 3.5B). One of these haplotypes was found in the majority (18) of samples, and these were from both disjunct and core populations (Figure 3.5B).

In Carex richardsonii, 16 haplotypes were identified from the 41 samples: four haplotype were from disjunct alvar populations, eleven were from core prairie populations, and one was found in both prairie and alvar populations (Figure 3.3 and Figure 3.6A). Haplotypes from disjunct alvar populations were separated by 1-13 mutations, and therefore did not form a discrete cluster.

The haplotypes from the core populations were also separated by both high and low numbers of mutations, and were distributed around the network (Figure 3.6). The most common haplotype was found in 9 samples from both core and disjunct populations (Figure 3.6). The removal of repetitive sequences did not alter the number of haplotypes, and did not substantially alter the network other than an overall reduction in the numbers of mutations that differentiated haplotypes (Figure 3.6B).

Discussion:

In North America, many temperate species from formerly glaciated areas experienced alterations in their ranges after the Last Glacial Maximum (LGM) (Soltis et al. 2006; Hewitt,

2004). The Great Lakes region now represents the range periphery of many disjunct species that established during postglacial colonisation (Argus, 1987). In this study we assessed the genetic similarity of disjunct Great Lakes populations with a subset of core populations from three species: Empetrum nigrum, Sporobolus heterolepis, and Carex richardsonii. Although the three species have in common disjunct populations around the Great Lakes, they are dissimilar in many ways, including their current distributions, their ecology, and their life history. This study therefore represents an important addition to our understanding of the origin and genetic novelty of disjunct populations in the Great Lakes region. Our prediction that disjunct populations are genetically similar to core populations was largely, but not entirely, supported by our data, as discussed below.

Empetrum nigrum is a northerly species that has overall low levels of diversity and haplotypes that are distributed across very broad geographic ranges. The low haplotype diversity

suggests that populations across Canada were established following dispersal from a single glacial refuge. Pollen records indicate that E. nigrum co-existed periglacially within spruce parklands between 17 000-12 000ya (Williams et al. 2001; Jacobson et al. 1987; Overpeck et al.

1992). By 11600ya, these biomes reached Ontario following glacial retreat (Fuller, 1997 and references therein). The expansion of these biomes was halted between 10 500-9500ya, when a sudden climatic warming induced massive extinctions (Pielou, 1991; Ritchie, 1987). Only few pockets of periglacial boreal flora were conserved as relict populations in the vicinity of areas still glaciated at the time (Strong & Hills, 2005; Pielou, 1991; Ritchie & MacDonald, 1986).

Today, such areas are considered interglacial southern cryptic refugia for cold adapted northern species situated at lower latitudes, and they harbour relict populations of many formerly widespread cold-adapted Pleistocene taxa at the southern limit of their range (Stewart et al.

2009). For cold-adapted northern species, cryptic interglacial southern refugia were first documented from pollen records of the arctic plant Mountain Avens (Dryas octopetala) recovered from the vicinity of Lake Superior (Porsild, 1947).Cryptic southern refugia seem plausible because Lake Superior remained glaciated at the beginning of the Holocene and therefore its southern periglacial area could have served as a refuge for many northern species

(Pielou, 1991). Molecular data subsequently identified southern cryptic interglacial refugia for other cold-adapted species such as dwarf birch Betula nana, rock ptarmigan Lagopus mutus

(Holder et al. 1999) and Arctic hare Lepus timidus (Stewart and Lister, 2001).

The disjunct populations of E. nigrum around the Great Lakes may therefore have been the source of E. nigrum that occupy what we now consider to be its core distribution. Regardless of the location of the glacial refuge that harboured E. nigrum in Canada, the high genetic similarity among populations, including the widespread distribution of identical haplotypes,

reflects relatively rapid dispersal across very broad spatial scales. Recent studies in E. nigrum across the northern hemisphere similarly detected low genetic differentiation and little phylogeographic structuring between populations from circumboreal Asia, North America, and

Europe (Popp et al. 2011; Alsos et al. 2007; Chung et al. 2013). Recurrent long distance dispersal mediated by mammals and birds has likely contributed to the dispersal of E. nigrum haplotypes across broad geographic scales, particularly when migratory birds are the agents of dispersal (Popp et al. 2011; Chung, 2013). We conclude that disjunct and core populations of E. nigrum in North America shared a recent common ancestor and a common refuge during the

Last Glacial Maximum, and we therefore found no evidence of genetic novelty in disjunct populations.

Sporobolus heterolepis lives in oak-hickory, ponderosa pine, and prairie ecosystems

(Snyder 1992). Our comparison between disjunct and core populations from this species revealed a haplotype network of closely related lineages within which haplotypes from disjunct populations were equidistant to haplotypes from both core and disjunct populations. Once repetitive sequences were removed from the data set, we were able to identify only three haplotypes, each separated by either one or two mutations. The most common of these three haplotypes was found in both core and disjunct populations. The elimination of multiple haplotypes once repetitive sequences had been removed suggests that much of the divergence among haplotypes occurred relatively recently, because mutation rates in repetitive sequences are normally much higher than in non-repetitive sequences (Vachon and Freeland 2011 and references therein). We therefore conclude that the split between disjunct and core populations of S. heterolepis is a relatively recent event, postdating the Last Glacial Maximum. This conclusion supports the ’prairies expansion-contraction’ hypothesis, which states that disjunct

populations are relicts of a recent prairie expansion into the Great Lakes region during a postglacial warming period ∼5000ya (Transeau 1935; Reznicek & Maycock 1983). Similar conclusions were previously reached in studies of prairie species with disjunct populations in

Great Lakes alvars, which concluded that the disjunct populations arose following the expansion of the western prairies into the eastern alvar habitats during the Hypsithermal climatic optimum, around 7,000- 5,000ya (Row et al. 2011; Hamilton and Eckert, 2007). Thus, we suggest that the most likely scenario was that disjunct populations of S. heterolepis around the Great Lakes arose following relatively recent vicariant events, specifically the contraction of the prairies.

Overall, our results from C. richardsonii revealed a much older and more complex evolutionary history than either of the other two species in this study. As with S. heterolepis, C. richardsonii is a prairie species, although the range of C. richardsonii extends further north than that of S. heterolepis. As noted earlier, the ’prairies expansion-contraction’ hypothesis proposes that disjuncts are relicts of a recent prairie expansion into the Great Lakes region during a postglacial warming period ∼5000ya (Transeau 1935; Reznicek & Maycock 1983). We found one haplotype common to Minnesota (prairies) and Manitoulin Island (disjunct alvar), which reflects a very recent common ancestor for these two regions. Expansion of eastern prairies into alvars from Ontario and Michigan could be explained by the existence of a dry period around 10

000- 8 700ya in Lake Huron, when the mainland and islands were connected (Szeicz &

MacDonald 1991; Reznicek & Maycock 1983; Transeau 1935). A similar genetic pattern was found in G. triflorum, between alvar populations and eastern prairie populations from Minnesota

(Hamilton and Eckert, 2007). However, although shared and closely-related haplotypes between disjunct and core populations suggest recent vicariant events, there are also a number of divergent haplotypes within and between core and disjunct regions. These genetic distinctions

persist, albeit with a reduction in the numbers of mutations, even after repetitive, and hence relatively rapidly evolving, sequences have been removed from the data set, which suggests that many of the haplotypes did not recently diverge from one another (Figure 3.6A and Figure 3.6B).

One potential explanation for this pattern is that C. richardsonii persisted in multiple refugia during recent glacial cycles. It is also possible that small core populations persisted periglacially south of the Wisconsinan ice sheet in spruce parklands from where they colonised alvars when the glaciers retreated. Similar patterns have been suggested for white spruce (Huesser et al.

2002; Ritchie 1987; Ritchie and MacDonald, 1986) and for spruce, jack pine and fir (Dyke,

2005; Bennett, 1993). Thus, periglacial core populations mixed within pockets of boreal forest at the front of the ice sheet could have remained distinct from other populations for prolonged periods of time, and therefore have accumulated significant levels of divergence from other core and disjunct populations.

Even if C. richardsonii maintained multiple divergent genetic lineages in multiple refugia, dispersal since that time has been widespread. Within disjunct populations, haplotypes differ by up to 12 mutations, and are even more divergent within core populations. Mixing of divergent haplotypes suggests effective dispersal. Although C. richardsonii has a very short life cycle and its flowering and fruiting periods collectively span a short period of time in the spring, it may disperse over long distances by wind due to floating wings present on its fruits (King et al.

2009; Dunlop, 2002). In addition to wind dispersal efficient dispersal by birds (Mueller and van der Valk, 2002; Catling et al. 1990; Schmid, 1986) and rodents (MacCracken et al. 1985) has also been documented in C. richardsonii. Overall, we have found essentially no evidence of genetic distinction between core and disjunct populations of E. nigrum and S. heterolepis.

However, there was evidence of some genetic novelty in both core and disjunct populations of C.

richardsonii: although there was high genetic similarity between some disjunct and core haplotypes, other divergent lineages were unique to one region or the other. Further research will be needed in order to better elucidate the evolutionary history of C. richardsonii in eastern

North America.

Prior to this study, relatively few Great Lakes disjuncts had been compared to their core populations, and mixed results were found in those that had: some were genetically similar to core populations (Row et al. 2011; Hamilton and Eckert, 2007; Simurda et al. 2005), whereas in at least one case there was evidence of genetic novelty in disjunct populations (Ciotir et al.

2013). In this study we compared three species that have substantially different current distributions, and also differ with respect to ecological and life history traits. Two of these (E. nigrum and S. heterolepis) provided no evidence of genetic novelty in disjunct populations. The third species, C. richardsonii, revealed a pattern not previously found in Great Lakes disjuncts: genetic similarity of disjunct and core populations combined with genetic novelty in both regions. An important caveat to this study, however, is that we have not looked at adaptive genes, and so cannot rule out the possibility of differential adaptation in core versus disjunct populations, which can occur rapidly among plant populations (Pannell and Fields 2014; Orsini et al. 2013; Freeland et al. 2010). Future studies should therefore compare adaptive, functional genes between disjunct and core populations; for now, the data from this and previous studies lead us to conclude that disjunct populations around the Great Lakes, in most cases, share a recent common ancestor with their core populations, although exceptions to this rule mean that genetic similarity between core and disjunct populations should not be assumed ( Ciotir et al.

2013; Row et al. 2011; Hamilton and Eckert, 2007; Coleman 2007; Simurda et al. 2005).

References

Allen GA, Antos JA, Worley AC, Suttill TA, and Hebda RJ. 1996. Morphological and genetic

variation in disjunct populations of the avalanche lily Erythronium montanum. Canadian

Journal of Botany-Revue Canadienne De Botanique 74: 403-412.

Alsos IG, Eidesen PB, Ehrich D, Skrede I, Westergaard K, Jacobsen GH, Landvik JY, Taberlet

P, and Brochmann C. 2007. Frequent long-distance plant colonization in the changing

Arctic. Science 316: 1606-1609.

Argus GW, Pryer KM, and White, D J (1987) Atlas of the Rare Vascular Plants of Ontario.

National Museum of Natural Sciences, Ottawa, Ontario.

Ball PW, Reznicek AA, Murray DF. 2003. Flora of North America. Volume 23. Online version

(http://www.efloras.org/florataxon.aspx?flora_id=1&taxon_id=242357432) (Accessed

May 14, 2014).

Bennett KD. 1993. Holocene forest dynamics with respect to southern Ontario. Review of

Palaeobotany and Palynology 79: 69-81.

Birky CW, Fuerst P, and Maruyama T. 1989. Organelle gene diversity under migration,

mutation, and drift - equilibrium expectations, approach to equilibrium, effects of

heteroplasmic cells, and comparison to nuclear genes. Genetics 121: 613-627.

Brown JH, Stevens GC, and Kaufman DM. 1996. The geographic range: Size, shape, boundaries,

and internal structure. Annual Review of Ecology and Systematics 27: 597-623.

Brownell VR, Riley JL.2000. The alvars of Ontario: significant alvar areas in the Ontario Great

Lakes Region. Federation of Ontario Naturalists, Don Mills, Ontario.

Bunnell FL and Squires KA. 2004. Plagued by a plethora of peripherals: refining guidelines for

peripheral taxa, Proceedings of the species at risk pathways to recovery conference.

Species at Risk 2004 Pathways to recovery Conference Organizing Committee, Victoria,

B.C.

Catling PM, Reznicek AA, and Crins WJ. 1990. Systematics and ecology of the genus Carex

(Cyperaceae) - introduction. Canadian Journal of Botany-Revue Canadienne De

Botanique 68: 1405-1408.

Catling PM. 1995. The extent of confinement of vascular plants to alvars in Southern Ontario.

Canadian Field-Naturalist 109: 172-181.

Catling PM. 2009. Composition, phytogeography, and relict status of the Vascular Flora of

alvars and cliff tops southwest of Great Slave Lake, Northwest Territories, Canada.

Rhodora 111: 189-208.

Chung MY, Lopez-Pujol J, Moon MO, Chung JM, Kim CS, Sun BY, Kim KJ, and Chung MG.

2013. Comparison of genetic diversity in the two arctic-alpine plants Diapensia

lapponica var. obovata (Diapensiaceae) and Empetrum nigrum var. japonicum

(Empetraceae) between Sakhalin in Russian Far East and Jeju Island in Korea, the

southernmost edge of their distribution range. Population Ecology 55: 159-172.

Ciotir C, Yesson C, and Freeland J. 2013. The evolutionary history and conservation value of

disjunct Bartonia paniculata subsp. paniculata (Branched Bartonia) populations in

Canada. Botany-Botanique 91: 605-613.

Clement M, Posada D, and Crandall KA. 2000. TCS: a computer program to estimate gene

genealogies. Molecular Ecology 9: 1657-1659.

Coleman MJ. 2007. The conservation genetics of two endangered plants of Ontario, Canada,

Cirsium pitcheri and Isoetes engelmannii, using nuclear and chloroplast DNA. M.Sc.

thesis, Trent University, Peterborough, Ontario.

Coyne, JA and Orr HA. 2004. Speciation. Sinauer Associates, Sunderland, Massachusetts.

Ehlers J, and Gibbard PL. 2003. Extent and chronology of glaciations. Quaternary Science

Reviews 22: 1561-1568.

Engstrom B. 2004. Sporobolus heterolepis (Prairie Dropseed) Conservation and research plan for

New England. New England Wild Flower Society, Framingham,

Massachusetts, USA.

Fant JB, Havens K, Keller JM, Radosavljevic A, and Yates ED. 2014. The influence of

contemporary and historic landscape features on the genetic structure of the sand dune

endemic, Cirsium pitcheri (Asteraceae). Heredity 112: 519-530.

Freeland JR, Biss P, Conrad KF, and Silvertown J. 2010. Selection pressures have caused

genome-wide population differentiation of Anthoxanthum odoratum despite the potential

for high gene flow. Journal of Evolutionary Biology 23: 776-782.

Fuller JL. 1997. Holocene forest dynamics in southern Ontario, Canada: fine-resolution pollen

data. Canadian Journal of Botany-Revue Canadienne De Botanique 75: 1714-1727.

Freeland J, and Vachon N. 2012. Repetitive sequences in phylogeographic inference: a reply to

Saltonstall and Lambertini (2012). Molecular Ecology Resources 12: 586-589.

Guries RP, and Ledig FT. 1982. Genetic diversity and population-Structure in Pitch pine (Pinus

rigida Mill). Evolution 36: 387-402.

Hall TA. 1999. Bioedit: a user friendly biological sequence alignment editor and analysis

program for Windows 95/98NT. Nucl. Acids. Symp. Ser.41: 95-98.

Hamilton JA, and Eckert C. 2007. Population genetic consequences of geographic disjunction: a

prairie plant isolated on Great Lakes alvars. Molecular Ecology 16: 1649-1660.

Heusser L, Maenza-Gmelch T, Lowell T and Hinnefeld R. 2002. Late Wisconsin periglacial

environments of the southern margin of the Laurentide Ice Sheet reconstructed from

pollen analyses. Journal of Quaternary Science 17: 773-780.

Higman PJ, and Penskar MR. 2002. Special plant abstract for Carex richardsonii R. Br.

(http://mnfi.anr.msu.edu/abstracts/botany/carex_richardsonii.pdf).

Hitchcock AS. 1971. Manual of the Grasses of the United States. Second Edition, revised by

Agnes Chase. Two volumes. Dover Publications, New York, New York,

USA.

Hunter ML, and Hutchinson A. 1994. The virtues and shortcomings of parochialism - conserving

species that are locally rare, but globally common. Conservation Biology 8: 1163-1165.

Holder K, Montgomerie R and Friesen VL. 1999. A test of the glacial refugium hypothesis using

patterns of mitochondrial and nuclear DNA sequence variation in rock ptarmigan

(Lagopus mutus). Evolution 53: 1936-1950.

Jacobson G L, Webb JrT III, and Grimm E C. 1987. Patterns and rates of vegetation change

during the deglaciation of eastern North America. Pp. 277-288 in Ruddiman WF and

Wright HE Jr., eds. North America and adjacent oceans during the last deglaciation.

Geology of North America, Vol. K-3. Geological Society of America, Boulder,

Colorado.

Jones B, Gliddon C, and Good JEG. 2001. The conservation of variation in geographically

peripheral populations: Lloydia serotina (Liliaceae) in Britain. Biological Conservation

101: 147-156.

Hampe A, and Petit RJ. 2005. Conserving biodiversity under climate change: the rear edge

matters. Ecology Letters 8: 461-467.

Hewitt GM. 2000. The genetic legacy of the Quaternary ice ages. Nature 405: 907-913

Hewitt GM. 2004. A climate for colonization. Heredity 92: 1-2.

Kirk H, and Freeland JR. 2011. Applications and implications of neutral versus non-neutral

markers in molecular ecology. International Journal of Molecular Sciences 12: 3966-

3988.

Lammi A, Siikamaki P, and Mustajarvi K. 1999. Genetic diversity, population size, and fitness in

central and peripheral populations of a rare plant Lychnis viscaria. Conservation Biology

13: 1069-1078.

Lesica P, and Allendorf FW. 1995. When are peripheral-populations valuable for conservation.

Conservation Biology 9: 753-760.

Lönn M, and Prentice HC. 2002. Gene diversity and demographic turnover in central and

peripheral populations of the perennial herb Gypsophila fastigiata. Oikos 99: 489-498.

Overpeck JT, Webb RS, and Webb T. 1992. Mapping eastern North-American vegetation change

of the past 18 Ka - no-analogs and the future. Geology 20: 1071-1074.

MacCracken JG, Uresk DW, and Hansen RM. 1985. Rodent-Vegetation Relationships in

Southeastern Montana. Northwest Science 59: 272-278.

Mueller MH, and van der Valk AG. 2002. The potential role of ducks in wetland seed dispersal.

Wetlands 22: 170-178.

Orsini L, Vanoverbeke J, Swillen I, Mergeay J, and De Meester L. 2013. Drivers of population

genetic differentiation in the wild: isolation by dispersal limitation, isolation by

adaptation and isolation by colonization. Molecular Ecology 22: 5983-5999.

Pamilo P, and Savolainen O. 1999. Post-glacial colonization, drift, local selection and

conservation value of populations: a northern perspective. Hereditas 130: 229-238.

Pannell JR, and Fields PD. 2014. Evolution in subdivided plant populations: concepts, recent

advances and future directions. New Phytologist 201: 417-432.

Penskar MR, and Crispin SR. 2009. Special Plant Abstract for Empetrum nigrum (black

crowberry). Michigan Natural Features Inventory. Lansing, MI. 3 pp.

(http://mnfi.anr.msu.edu/abstracts/botany/Empetrum_nigrum.pdf). (accessed June14,

2014).

Pielou EC.1991. After the Ice Age: the return of life to glaciated North America. The University

of Chicago Press, Chicago, Illinois.

Popp M, Mirre V, and Brochmann C. 2011. A single Mid-Pleistocene long-distance dispersal by

a bird can explain the extreme bipolar disjunction in crowberries (Empetrum).

Proceedings of the National Academy of Sciences of the United States of America 108:

6520-6525.

Porsild AE.1947. The genus Dryas in North America. Canadian Field Naturalist, 61, 175–192.

Reznicek AA, and Maycock PF. 1983. Composition of an isolated prairie in Central Ontario.

Canadian Journal of Botany-Revue Canadienne De Botanique 61: 3107-3116.

Reznicek AA. 1994. The Disjunct coastal-plain flora in the Great-Lakes Region. Biological

Conservation 68: 203-215.

Ritchie JC, and MacDonald GM. 1986. The patterns of post-glacial spread of white Spruce.

Journal of Biogeography 13: 527-540.

Ritchie, JC. 1987. Postglacial vegetation of Canada. Cambridge University Press, Cambridge,

US.

Row JR, Brooks RJ, MacKinnon CA, Lawson A, Crother BI, White M, and Lougheed SC. 2011.

Approximate Bayesian computation reveals the factors that influence genetic diversity

and population structure of foxsnakes. Journal of Evolutionary Biology 24: 2364-2377.

Simurda MC, Marshall DC, and Knox JS. 2005. Phylogeography of the narrow endemic,

Helenium virginicum (Asteraceae), based upon ITS sequence comparisons. Syst. Bot.

30(4): 887-898.

Soltis DE, Morris AB, McLachlan JS, Manos PS, and Soltis PS. 2006. Comparative

phylogeography of unglaciated eastern North America. Molecular Ecology 15: 4261-

4293.

Snyder SA. 1992. Sporobolus heterolepis. In: Fire Effects Information System,U.S. Department

of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences

Laboratory (Producer). Available: http://www.fs.fed.us/database/feis/ (2014, October 15).

Szpiech ZA, Jakobsson M, Rosenberg NA. 2008. ADZE: A rarefaction approach for counting

alleles private to combinations of populations. Bioinformatics 24: 2498–2504.

Stewart JR, and Lister AM. 2001. Cryptic northern refugia and the origins of the modern biota.

Trends in Ecology & Evolution 16: 608-613.

Stewart JR, Lister AM, Barnes I, and Dalen L. 2009. Refugia revisited: individualistic responses

of species in space and time. Proceedings of the Royal Society Biological Sciences 277:

661-671.

Strong WL, and Hills LV. 2005. Late-glacial and Holocene palaeovegetation zonal

reconstruction for central and north-central North America. Journal of Biogeography 32:

1043-1062.

Szeicz JM, and Macdonald GM. 1991. Postglacial vegetation history of oak savanna in Southern

Ontario. Canadian Journal of Botany-Revue Canadienne De Botanique 69: 1507-1519.

Templeton AR, Crandall KA, and Sing CF. 1992. A cladistic analysis of phenotypic associations

with haplotypes inferred from restriction endonuclease mapping and DNA-sequence data

cladogram estimation. Genetics 132: 619-633.

Thompson JD, Higgins DG, and Gibson TJ. 1994. Clustal-W - improving the sensitivity of

progressive multiple sequence alignment through sequence weighting, position-specific

gap penalties and weight matrix Choice. Nucleic Acids Research 22: 4673-4680.

Transeau EN. 1905. Forest centers of Eastern America. The American Naturalist 39: 875-889.

USDA. 2010. Sporobolus heterolepis (http://plants.usda.gov/core/profile?symbol=sphe)

Vachon N, and Freeland JR. 2011. Phylogeographic inferences from chloroplast DNA:

quantifying the effects of mutations in repetitive and non-repetitive sequences. Molecular

Ecology Resources 11: 279-285.

Vucetich JA, and Waite TA . 2003. Spatial patterns of demography and genetic processes across

the species' range: Null hypotheses for landscape conservation genetics. Conservation

Genetics 4: 639-645.

Williams JW, Shuman BN, and Webb T. 2001. Dissimilarity analyses of late-Quaternary

vegetation and climate in eastern North America. Ecology 82: 3346-3362.

Table 3.1 PCR conditions used for trnT-trnL DNA amplification. trnT-trnL PCR conditions

Initial Denaturation Annealing Extension Final No. of

denaturation temp./time temp./time temp./time extension cycles

temp./time temp./time

E. nigrum 94°C/120s 94°C/60s 55°C/30s 72°C/90s 72°C/420s 30

S. heterolepis 94°C/120s 94°C/60s 55°C/60s 72°C/120s 72°C/420s 30

C.richardsonii 95°C/120s 95°C/60s 54°C/50s 72°C/120s 72°C/420s 32

Population n π h Hr Hp Disjunct 3 0.00021 0.167 1 0 Core 9 1.66667 0.666667

Table 3.3 S. heterolepis cpDNA nucleotide diversity (π), and haplotype diversity (h) are calculated for all samples Haplotype richness (Hr) and private haplotype counts (Hp) are standardized to the smallest sample size for both disjunct (g=11) and core (g=9) samples using ADZE rarefaction.

Population n π h Hr Hp Disjunct 11 0.00058 0.416 2.81818 2.81818 Core 9 5 5

Table 3.4 C. richardsonii cpDNA nucleotide diversity (π) and haplotype diversity (h) are calculated for all samples. Haplotype richness (Hr) and private haplotype counts (Hp) are standardized to the smallest sample size for both disjunct (g=16) and core (g=23) samples using ADZE rarefaction.

Population n π h Hr Hp Disjuncts 16 0.01919 0.926 5 4.03652 Core 25 9.72806 8.76458

America shows the geographic range of S. heterolepis in dark grey shading and the black square shows the range of core and disjunct populations sampled in this study. For more information on haplotype provenances see Appendix 3.1.

Figure 3.3 Sample locations and haplotype distribution in Carex richardsonii.

Abbreviations are identical to the haplotypes networks and indicate the province for the prairie core population or the location for disjunct alvar populations. Black circles represent haplotypes that were found only in core populations from the Canadian prairies and grey circles represent samples from the alvar disjunct populations. Haplotypes coloured half black half grey represent shared haplotypes between prairie and alvar haplotypes: SD=South Dakota, SK=Saskatchewan,

MB=Manitoba, MI=Michigan, MN=Minnesota, B=Bruce Peninsula (Ontario). In the inset map of North America, the grey shading shows the geographic range of C. richardsonii. For more information on haplotype provenances see Appendix 3.

Figure 3.4 TCS maximum parsimony network showing the relationships among

Empetrum nigrum haplotypes. Black haplotypes are sampled from central populations (ON2 &

NFL1). The haplotype coloured half black and half grey is identical in some of the central populations (BC & ON1) and in all the disjunct populations (Lake Superior). Haplotype abbreviations correspond to their geographic locations: BC=British Colombia; ON=Ontario;

NFL=Newfoundland. For more information on haplotype provenances see Appendix 3.1.

B A

Figure 3.5 TCS maximum parsimony networks showing the relationships among

Sporobolus heterolepis haplotypes, with A) mutations in repetitive regions included, and B) mutations in repetitive regions excluded. Black haplotypes are sampled from central populations and grey haplotypes are sampled from disjunct populations. The haplotype coloured half black and half grey is identical in some of the central and some of the disjunct populations. Haplotype abbreviations correspond to their geographic locations: ON=Ontario, MB1=Manitoba; NY=New

York; SK=Saskatchewan. For more information on haplotype provenances see Appendix 3.1.

A B

Figure 3.6 TCS maximum parsimony networks showing the relationships among Carex richardsonii haplotypes, with A) mutations in repetitive regions included, and B) mutations in repetitive regions excluded. Black haplotypes are sampled from central populations, grey haplotypes represent samples from disjunct populations and haplotypes coloured half black and half grey are identical in some of the central and in some of the disjunct populations. Haplotypes coloured half black half grey represent shared haplotypes between prairie and alvar haplotypes:

AB=Alberta; B=Bruce Peninsula (Ontario), Ontario, K=Komoka, Ontario, MB=Manitoba,

MI=Michigan, MN=Minnesota, SD=South Dakota, SK=Saskatchewan. For more information on haplotype provenances see Appendix 3.1.

APPENDIX 3

Appendix 3.1 Summary of DNA sequences used in this study.

Abbreviations: AB=Alberta; BC=British Colombia; B=Bruce Peninsula (Ontario); K=Komoka

(Ontario); SD=South Dakota, SK=Saskatchewan, MB=Manitoba, MI=Michigan,

MN=Minnesota, ON =Ontario; NFL=Newfoundland; NY=New York; Herbaria abbreviations:

CAN: Canadian Museum of Nature; GUELPH=Guelph University; MNR=Ministry of Natural

Resources.

Sample trnT-

# Species Type Date Haplotype Location Lat Long trnL

BC1/ON1/Lake ON, Pukaskwa National Park, Ouiseau Bay, Lake

1 E. nigrum Fresh 2009 Superior Superior 48.3971281 -86.196397 TBC

BC1/ON1/Lake ON, Pukaskwa National Park, Sewell Point, Lake

2 E. nigrum Fresh 2009 Superior Superior 48.4491273 -86.238395 TBC

BC1/ON1/Lake

3 E. nigrum Fresh 2009 Superior ON, James Bay 51.703 -80.583 TBC

BC1/ON1/Lake

4 E. nigrum Fresh 2009 Superior ON, James Bay 51.703 -80.583 TBC

BC1/ON1/Lake

5 E. nigrum Fresh 2009 Superior ON, James Bay 51.703 -80.583 TBC

BC1/ON1/Lake

6 E. nigrum Fresh 2009 Superior ON, Paradise Island, Thunder Bay 48.599296 -87.866321 TBC

7 E. nigrum MNR 1992 NFL NFL, St. Barbe South 51.22 -56.750447 TBC

BC1/ON1/Lake

8 E. nigrum Fresh 2010 Superior ON, Peawanuck, Hudson Bay 55.01704627 -85.423071 TBC

BC1/ON1/Lake

9 E. nigrum Fresh 2010 Superior Hudson Bay 54.68893038 -84.25797 TBC

10 E. nigrum Fresh 2010 ON2 Winisk River, Hudson Bay 54.91223099 -85.478643 TBC

BC1/ON1/Lake

11 E. nigrum Fresh 2011 Superior British Columbia 58.762319 -123.86689 TBC

BC1/ON1/Lake

12 E. nigrum Fresh 2011 Superior British Columbia 58.728917 -123.83143 TBC

13 S. heterolepis Fresh 2002 NY New York, Alvars 44.09763889 -76.082861 TBC

14 S. heterolepis Fresh 2002 NY New York, Alvars 44.096 -76.082194 TBC

15 S. heterolepis Fresh 2002 NY New York, Alvars 44.096 -76.082194 TBC

16 S. heterolepis Fresh 2002 NY New York, Alvars 44.096 -76.082194 TBC

17 S. heterolepis Fresh 2002 ON2 Bruce Alvars, Ontario 45.19019444 -81.59075 TBC

18 S. heterolepis Fresh 2002 ON2 Bruce Alvars, Ontario 45.19019444 -81.59075 TBC

19 S. heterolepis Fresh 2002 ON2 Bruce Alvars, Ontario 45.31413889 -81.571639 TBC

20 S. heterolepis Fresh 2002 ON2 Bruce Alvars, Ontario 45.31413889 -81.571639 TBC

21 S. heterolepis Fresh 2002 ON2 Manitoulin Alvars, Ontario 45.79225 -82.751639 TBC

22 S. heterolepis Fresh 2002 ON2 Ontario 45.79225 -82.751639 TBC

23 S. heterolepis Fresh 2003 SK1 Manitoba, Prairie 50.76725 -100.23272 TBC

24 S. heterolepis Fresh 2003 SK1 Manitoba, Prairie 50.76725 -100.23272 TBC

25 S. heterolepis Fresh 2002 ON1 Ontario, Manitoulin Island 46.00883333 -81.795417 TBC

CAN-

26 S. heterolepis 578973 1986 SK4 Souris River Saskatoon 52.113664 -106.59413 TBC

CAN-

27 S. heterolepis 199838 1918 MB1 Manitoba (Brandon) 49.844263 -99.952439 TBC

CAN-

28 S. heterolepis 209072 1951 SK1 Manitoba (Birtle) 50.421809 101.04523 TBC

CAN-

29 S. heterolepis 578251 1995 SK1 Saskatchewan (Whitewood) 50.329521 -102.26659 TBC

CAN-

30 S. heterolepis 579097 1986 SK3 Saskatoon (Souris River Valley) 52.157712 -106.63882 TBC

CAN-

31 S. heterolepis 525529 1986 SK2 Saskatchewan (Carievale) 49.173096 -101.62554 TBC

CAN-

32 S. heterolepis 224885 1953 SK1 Manitoba (Lyleton) 49.05753 -101.17782 TBC

33 C. richardsonii Fresh 2002 B2 Ontario, Bruce Alvars 45.19019444 -81.59075 TBC

34 C. richardsonii Fresh 2002 B2 Ontario, Bruce Alvars 45.31413889 -81.571639 TBC

35 C. richardsonii Fresh 2002 B2 Ontario, Bruce Alvars 45.31413889 -81.571639 TBC

36 C. richardsonii Fresh 2002 B2 Ontario, Bruce Alvars 44.9125555 -81.03813 TBC

37 C. richardsonii Fresh 2002 MN1/Manitoulin Ontario, Manitoulin Island 45.79225 -82.751639 TBC

38 C. richardsonii Fresh 2002 MN1/Manitoulin Ontario, Manitoulin Island 45.79225 -82.751639 TBC

39 C. richardsonii Fresh 2002 MN1/Manitoulin Ontario, Manitoulin Island 45.79225 -82.751639 TBC

40 C. richardsonii Fresh 2002 MN1/Manitoulin Ontario, Manitoulin Island 46.02152778 -81.769472 TBC

41 C. richardsonii Fresh 2002 MN1/Manitoulin Ontario, Manitoulin Island 46.02152778 -81.769472 TBC

42 C. richardsonii Fresh 2002 MN1/Manitoulin Ontario, Manitoulin Island 46.02152778 -81.769472 TBC

43 C. richardsonii Fresh 2002 K1 Ontario, London Komoka 42.867426 -81.423919 TBC

GUELPH-

44 C. richardsonii 86049 1996 B1/MI Bruce Alvars, Ontario 45.2066642 -81.598048 TBC

GUELPH-

45 C. richardsonii 92686 2000 B1/MI Bruce Alvars, Ontario 45.154878 -81.522398 TBC

46 C. richardsonii Fresh 2003 B3 Bruce Alvars, Ontario unknown unknown TBC

47 C. richardsonii Fresh 2003 B3 Bruce Alvars, Ontario unknown unknown TBC

48 C. richardsonii Fresh 2003 B3 Maxton Plain Alvars, Michigan 46 -83 TBC

49 C. richardsonii Fresh 2003 AB2/MB2 Manitoba, Prairie 50.775 -100.21492 TBC

50 C. richardsonii Fresh 2003 AB2/MB2 Manitoba, Prairie 50.775 -100.21492 TBC

51 C. richardsonii Fresh 2003 MB1/SD1 Manitoba, Prairie 50.775 -100.21492 TBC

52 C. richardsonii Fresh 2003 MB4 Manitoba, Prairie 50.767248 -100.23272 TBC

53 C. richardsonii Fresh 2003 MB4 Manitoba, Prairie 50.767248 -100.23272 TBC

54 C. richardsonii Fresh 2003 MB4 Manitoba, Prairie 50.767248 -100.23272 TBC

55 C. richardsonii Fresh 2003 MB3/SK5 Riding Mtn National Park 50.76725 -100.23253 TBC

56 C. richardsonii Fresh 2002 SK3 Nisbet Forest Reserve 51.95894444 -109.19375 TBC

57 C. richardsonii Fresh 2002 MB3/SK5 Nisbet Forest Reserve 51.95894444 -109.19375 TBC

58 C. richardsonii Fresh 2002 SK4 Nisbet Forest Reserve 51.95894444 -109.19375 TBC

59 C. richardsonii Fresh 2002 SK1 Nisbet Forest Reserve 52.93344444 -106.06356 TBC

60 C. richardsonii Fresh 2002 SK2 Nisbet Forest Reserve 52.93344444 -106.06356 TBC

61 C. richardsonii Fresh 2002 MN1/Manitoulin Mound Prairie, Minnesota 43.76666667 -91.45 TBC

62 C. richardsonii Fresh 2002 MN1/Manitoulin Mound Prairie, Minnesota 43.76666667 -91.45 TBC

63 C. richardsonii Fresh 2002 MN1/Manitoulin Mound Prairie, Minnesota 43.76666667 -91.45 TBC

64 C. richardsonii Fresh 2003 MN2 Lost Valley Prairie, Minnesota 44.79847222 -92.826472 TBC

65 C. richardsonii Fresh 2003 MN2 Lost Valley Prairie, Minnesota 44.79847222 -92.826472 TBC

66 C. richardsonii Fresh 2003 MN3 Spring Creek Prairie, Minnesota 44.55138889 -92.6 TBC

67 C. richardsonii Fresh 2003 MN3 Spring Creek Prairie, Minnesota 44.55138889 -92.6 TBC

68 C. richardsonii Fresh 2002 AB2/MB2 Clyde Fen, Bouchard Lake, AB 54.148164 -113.631 TBC

69 C. richardsonii Fresh 2002 AB2/MB2 Clyde Fen, Bouchard Lake, AB 54.148164 -113.631 TBC

70 C. richardsonii Fresh 2002 AB1 Clyde Fen, Bouchard Lake, AB 54.148164 -113.631 TBC

71 C. richardsonii Fresh 2002 AB2/MB2 Winterburn Woods, Sand dunes AB 53.54021 -113.64501 TBC

72 C. richardsonii Fresh 2003 MB1/SD1 South Dakota 43.65133333 -103.421 TBC

73 C. richardsonii Fresh 2003 MB1/SD1 South Dakota 43.65133333 -103.421 TBC

4 CHAPTER 4

INTERCONTINENTAL DISPERSAL OF TYPHA ANGUSTIFOLIA AND TYPHA LATIFOLIA BETWEEN EUROPE AND NORTH AMERICA HAS IMPLICATIONS FOR TYPHA INVASIONS

A version of this chapter has been published

Ciotir, C. Kirk, H. Row, J. and Freeland J.R. 2013 Intercontinental dispersal of Typha angustifolia and T. latifolia between Europe and North America has implications for Typha invasions, Biological Invasions15:6, 1377-1390, DOI 10.1007/s10530-012-0377-8.

Abstract

The full effects of biological invasions may be underestimated in many areas because of cryptogenic species, which are those that can be identified as neither native nor introduced. In

North America, the cattails Typha latifolia, T. angustifolia, and their hybrid T. x glauca are increasingly aggressive invaders of wetlands. There is a widespread belief that T. latifolia is native to North America and T. angustifolia was introduced from Europe, although there has so far been little empirical support for the latter claim. We used microsatellite data and chloroplast

DNA sequences to compare T. latifolia and T. angustifolia genotypes from eastern North

America and Europe. In both species, our data revealed a high level of genetic similarity between North American and European populations that is indicative of relatively recent intercontinental dispersal. More specifically, the most likely scenario suggested by Approximate

Bayesian Computation was an introduction of T. angustifolia from Europe to North America.

We discuss the potential importance of our findings in the context of hybridization, novel genomes, and increasingly invasive behaviour in North American Typha spp.

Introduction

Biological invasions can be facilitated by a number of factors including high levels of phenotypic plasticity (Davidson et al. 2011), propagule pressure (Simberloff 2009), reproductive strategies (Hayes and Barry 2008), and rapid evolutionary change (Kanarek and Webb 2010).

Despite this knowledge, we are still lacking a comprehensive explanation for why a few introduced species become successful invaders while the majority either perish or maintain very restricted distributions. One group of potential invaders that remains difficult to study is cryptogenic species, which are species that cannot clearly be identified as either native or introduced (Carlton 1996). Cryptogenic species can make an appreciable contribution to local biota (e.g. Cowie 2001; Ruiz et al. 1999; Wasson et al. 2001), and hamper our ability to assess the frequencies and impacts of biological invasions.

Wetlands are among those habitats that are most susceptible to bioinvasions: although no more than 6% of the earth's land mass is wetland, 24% of the world's most invasive plants are wetland species (Zedler and Kercher 2004). In many parts of North America, cattails (Typha latifolia, T. angustifolia and their hybrid, T. x glauca) have been identified as increasingly aggressive invaders of wetlands (Shih and Finkelstein 2008; Tulbure et al. 2007; Tuchman et al.

2009). Typha angustifolia and T. x glauca are considered the most invasive of the three

(Finkelstein et al. 2005; Galatowitsch et al. 1999; Grace and Harrison 1986; Wilcox et al. 2008), although pollen and herbarium records from eastern North America show that despite a period of enhanced range increase in T. angustifolia in the early to mid-20th century, T. angustifolia and T. latifolia subsequently increased at the same rate (Shih and Finkelstein 2008). Typha latifolia and

T. angustifolia are now sympatric across a broad area in North America, and their hybrid, T. x

glauca, is commonly identified in areas where the parental species co-exist (reviewed in

Galatowitsch et al. 1999; see also Kirk et al. 2011a; Travis et al. 2010).

Typha latifolia is widely regarded as native to both North America and Europe (Grace and Harrison 1986), but there is uncertainty regarding the origin of T. angustifolia in North

America. An apparent confinement of T. angustifolia to the eastern seaboard until the 19th century, followed by more recent range expansions northwards and westwards, led Stuckey and

Salamon (1987) to suggest in an abstract that T. angustifolia was brought to North America by early European settlers. However, pollen and herbarium data suggest that T. angustifolia may have been present but uncommon in North America prior to European settlement, although similarities between T. angustifolia and Sparganium pollen introduce some uncertainty to this conclusion (Shih and Finkelstein 2008). Therefore, although T. angustifolia is widely reported as an introduced species (e.g. Selbo and Snow 2004; Travis et al. 2010), the evidence for this remains equivocal, and it should therefore be considered a cryptogenic species.

The possibilities that North American T. angustifolia either pre-dated or coincided with

European settlement need not be mutually exclusive. The common reed (Phragmites australis) is native to North America, but a cryptic invasion by a European lineage in the 18th century subsequently led to a widespread invasion in North America (Galatowitsch et al. 1999; Kirk et al. 2011b). Invasive P. australis is highly competitive with other plants, including its native

North American conspecific, and is particularly well adapted to nutrient enriched environments, possibly because of its historic distribution in eutrophic Eurasian wetlands (Holdredge et al.

2010; Mozdzer and Zieman 2010). A cryptic invasion therefore introduced into North America a

P. australis lineage that seems particularly well suited to habitats that have suffered from

relatively high levels of anthropogenic disturbance, and this in turn has facilitated a widespread and growing bioinvasion by the common reed.

There is some evidence that invasion of North American wetlands by Typha is most pronounced in areas with high levels of anthropogenic disturbance (Boers and Zedler 2008;

Herrick and Wolf 2005; Trebitz and Taylor 2007; Vaccaro et al. 2009). Our goals were therefore twofold: 1) determine whether North American T. angustifolia is in fact an introduction from

Europe, and 2) investigate the possibility of a cryptic introduction of T. latifolia from Europe to

North America. Source populations and cryptic biological introductions can be most clearly identified from molecular genetic data (Blakeslee et al. 2008; Geller et al. 1997; Holsbeek et al.

2010) and we therefore used a combination of microsatellite markers and chloroplast DNA

(cpDNA) sequences from Typha stands sampled in North America and Europe to test these hypotheses. Introductions of Typha from Europe to North America could have very important implications for wetland invasions following admixture, hybridization, and the ongoing creation of novel genomes (Culley and Hardiman 2009; Roman 2006; Schierenbeck and Ellstrand 2009).

Methods

Sampling and DNA extraction

In the summers of 2008, 2009, and 2010, Typha samples were collected from sites in

North America (eastern Canada and northeastern USA) and Europe (see Appendix 4.1 for locations). Sampling was both opportunistic (e.g. roadside) and directed (e.g. visiting parks and wetlands). Sampling was not random because sites were chosen partly on the basis of visibility

and accessibility; however, the methods for identifying sites and collecting leaf samples were the same throughout the sampled range. Samples collected within stands were separated by a minimum of two meters to decrease the likelihood of sampling multiple ramets from a single genet. Between 1 and 10 samples were collected from each site, with more samples collected from larger stands. Our approach of sampling fewer individuals from more populations was partly based on our desire to sample from a broad geographical range, and partly because clonal reproduction is common in Typha (Grace and Harrison 1986) and therefore increasing the sample size from each site, particularly the smaller stands, should greatly increase the number of ramets per genet. No a priori species assignments were made at the time of collection because

T. angustifolia, T. latifolia, and T. x glauca demonstrate some overlap in leaf width which, outside the flowering season, is the most diagnostic species characteristic (Kuehn et al. 1999;

Olson et al. 2009); however, when possible we sampled from a representative range of morphological characters within each site.

The youngest leaf tip, approximately 7 cm long, was taken from each sampled plant and immediately placed in a plastic bag with Sorbead orange silica beads (eCompressedair,

Oklahoma, USA) for desiccation. Leaf tissues were stored at -20° C upon return to the lab.

From each sample a section of dried leaf tissue approximately three cm in length was ground into a semi-fine powder in a MM 300 Retsch mixer mill (Haan, Germany). DNA was then extracted using E.Z.N.A. spin column kits (Omega Bio-Tek, Inc., Georgia, USA) according to the manufacturer’s instructions for dried specimens, and eluted in a final volume of 100 μl buffer.

cpDNA sequencing

As a pilot test, we compared the intraspecific variability of three non-coding and one coding chloroplast region among six T. angustifolia and T. latifolia samples that were collected from sites spanning the maximum geographic range of our samples (species were identified on the basis of microsatellite loci; see below). The three non-coding regions were trnT-trnL, trnL- trnF and trnH-psbA. trnT-trnL and trnL-trnF were amplified using the primers described in

Taberlet et al. (1991) and an annealing temperature of 52C and 53C, respectively. trnH-psbA was amplified using the primers described in Sang et al. (1997) and an annealing temperature of

51C. The coding region matK was amplified using the primers described in Cuenoud et al.

(2002) and an annealing temperature of 49C. Each PCR reaction included 1X Taq reaction buffer (UBI Life Sciences), 2mM MgSO4, 0.2mM dNTPs, 0.2μM each primer, 2.5U HP Taq

(UBI Life Sciences) 1.2 μL(100%) of BSA, and approximately 10ng DNA in a total volume of

25 μL. The matK reaction also included 1.4 μL DMSO 100%. Reactions were done in an

Eppendorf Mastercycler epgradient. Samples were initially denatured at 94°C for two minutes, followed by 30 cycles of one minute denaturing at 94°C, 50 s annealing at the appropriate temperature (see above), and 2 min of extension at 72°C. This was followed by a final extension at 72°C for seven min. Excess primer and dNTPs were removed by incubating the amplified products with 10 U exonuclease I (Fermentas) and 2U shrimp alkaline phosphatase (Fermentas) for 15 minutes at 37°C followed by 15 minutes at 80°C. Purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). Bidirectional sequencing reactions were run on a 3730xl ABI (Applied Biosystems, USA). Nucleotide sequences were edited and assembled using Seqman (DNASTAR LaserGene 5) software

(Madison, WI, USA, 2001), and then aligned using CLUSTALX (Thompson et al. 1997). Based

on the results of this preliminary comparison, three of the regions (trnT-trnL, trnH-psbA, and matK) were considered uninformative for this particular study (see Results) and were excluded from further analyses. The remaining cpDNA region, trnL-trnF, was characterized from a total of 11 European and 27 North American T. latifolia, 13 European and 17 North American T. angustifolia, and two T. domingensis (See Appendix 4.1 for the provenances of sequenced individuals). In one haplotype, a 23bp indel was re-coded to represent a single mutational event; all other mutations were either nucleotide substitutions or single base indels (see below).

Sequences were then imported into Phylip (Felsenstein 2005) and a DNA parsimony tree based on all haplotypes was reconstructed using 5000 bootstrap replicates.

Microsatellite data were generated from European and North American Typha samples which, according to their morphological features, were likely to include representatives of both latifolia and angustifolia (see below). We genotyped samples at six microsatellite loci (TA3,

TA5, TA7, TA8, TA16, TA20; Tsyusko-Omeltchenko et al. 2003) using a Mastercycler epgradient thermal cycler (Eppendorf). Either the forward or reverse primer was fluorescently labelled with hex (TA3F, TA5R), fam (TA8F, TA16R, TA20F), or ned (TA7F). Amplifications were performed as one multiplex (TA5-TA7) and four single reactions, each in a total volume of 10 μl. All reactions included 1.0 mM MgSO4, 0.3 mM dNTPs, 2 U taq (HP taq, UBI Life Sciences), and approximately 10 ng DNA. The multiplex PCR included 1.4 μM (TA5) or 0.6 μM (TA7) of each primer, and employed a touchdown PCR protocol following (Tsyusko-Omeltchenko et al. 2003).

Locus TA3 was also amplified using a touchdown program following Tsyusko-Omeltchenko et al. (2003). The remaining loci were each amplified with annealing temperatures of 55o C (TA3,

0.8 μM primer), 60o C (TA8, 0.6 μM primer), 57o C (TA20, 1.2 μM primer) or 50.8o C (TA16, 1.2

μM primer) in cycles that began with 2 min denaturation at 96o C followed by 30 cycles of 20 s

denaturation at 96o C, 30 s annealing at appropriate temperatures (see above), and 1 min extension at 72o C. The final stage was a 10 min extension at 72o C. Genotyping was carried out on a 3730 DNA Analyzer (Applied Biosystems). Fragments were sized using GeneMarker® software v1.6 (SoftGenetics), with ROX 500 (Applied Biosystems) size standard for reference.

Previous studies have identified species-specific alleles that differentiate T. latifolia from

T. angustifolia (Kirk et al. 2011a; Snow et al. 2010). Individuals that had one species-specific allele from each parental species at one or more loci were identified as hybrids or backcrosses, and removed from the data set. This left us with a total of 259 seemingly ‘pure’ T. latifolia (189 from North America, 70 from Europe), and 131 seemingly ‘pure’ T. angustifolia (92 from North

America, 39 from Europe) (see Appendix 4.1 for sample provenances). The effective number of alleles for each group was calculated in GenAlEx v. 6.4 (Peakall and Smouse 2006). A principal co-ordinate analysis (PCoA) was conducted for each species, using the algorithm of

Orloci (1978), based on a pairwise genetic distance matrix that was calculated in GenAl-Ex v.

6.4 (Peakall and Smouse, 2006) according to the method of Huff et al. (1993). In addition, a

Bayesian model-based analysis was performed for each species to infer population structure using Structure version 2.3 (Falush et al. 2007; Pritchard et al. 2000). Data were analyzed using an admixture ancestry model with correlated allele frequencies to estimate the posterior probabilities L (K) of K groups and the individual percentages of membership assigned to them according to their multilocus profiles (Falush et al. 2007). We examined the probabilities for a range of K (K = 1–10), using a burn-in period and a run length of the Markov Chain Monte Carlo

(MCMC) of 30,000 and 100,000 iterations, respectively. Based on a trial run, we found that longer burn-ins and MCMC did not change the results. Five runs were carried out for each value

of K. We calculated DK according to Evanno et al. (2005), and used Distruct (Rosenberg 2004) to graphically report our results.

Given the overall high genetic similarity between North American and European populations of both T. angustifolia and T. latifolia (see below), we used Approximate Bayesian computation (ABC) to compare the likelihood of three possible introduction scenarios for each species: (1) a single colonization event of a native North American lineage into Europe (invasion a), (2) a single colonization event of a native European lineage into North America (invasion b), and (3) cryptic intercontinental movement of two native lineages (Figure 4.1). Although there are a myriad of other possible models, we felt these 3 represent the most likely scenarios and it is unlikely we would have the power to distinguish more complex models (e.g. including gene flow with population expansion). For each model we ran 400,000 coalescent simulations using

ABCsampler (part of ABCtoolbox; Wegmann et al. 2010) combined with SIMCOAL2 (Laval and Excoffier 2004) with parameter values randomly chosen from a set prior distribution (Table

4.1). We assumed that intercontinental movement would have arisen due to European colonization into North America and thus occurred within the last 400 years. We also assumed a

1 year generation time for Typha (Dickerman and Wetzel 1985) when setting the prior distribution. We did not have a firm expectation for either the effective population sizes of current and ancestral Typha populations or for the splitting time of North American and

European lineages in the cryptic movement model. We therefore log transformed these values and allowed the prior distributions to vary over several orders of magnitude (Table 4.1). Mean microsatellite mutation rates were given wide prior distributions based on common plant microsatellite mutation rates (Vigouroux et al. 2002). Lastly, we assumed a Generalized

Stepwise Mutation (GSM) model, which allows for the insertion or deletion of more than 1

repeat. The probability of the size of the insertion or deletion was determined by a geometric distribution with the variance around a 1 repeat insert controlled by p, which we allowed to vary between 0 (strict stepwise) and 0.5 (larger insertions and deletions allowed) (Laval and Excoffier

2004).

For the observed data and each generated simulation we calculated two different sets of summary statistics. In the full set we used alrsumstat (command-line version of Arlequin 3.5;

Excoffier and Lischer 2010) to calculate the mean and standard deviation for 3 standard measures of genetic diversity across the 6 microsatellite loci in each population: (1) number of alleles, (2) the allelic range (in number of stepwise mutations), and (3) expected heterozygosity.

We also calculated the mean and standard deviation for the modified Garza-Williams index

(NGW) (ratio of number of alleles to allelic range; Excoffier et al. 2005; Garza and Williamson

2001) across populations, which should be sensitive to a population bottleneck. Lastly, we calculated four different measures of pairwise differentiation between North American and

European populations: FST, Nei’s average raw number of nucleotide differences between populations (Nei and Li 1979), Goldstein’s genetic distance (dl)2 for microsatellites (Goldstein et al. 1995) and Jost’s DST (Jost 2008). In a reduced summary statistic set, we used only mean values for diversity summary statistics (did not include standard deviation) and instead of using the absolute NGW values, we subtracted the NGW from population 2 from the population 1

NGW to create a single statistic. This value should be 0 for the cryptic movement model and have opposite signs for each of the two invasion scenarios, because only one population has gone through a bottleneck.

We compared the observed to generated summary statistics and constructed the posterior distribution using 2 different methods. First we used a simple rejection method, which calculates

the Euclidean distance between the observed and generated statistics and accepts the closest simulations based on the set tolerance rate (e.g. a tolerance of 0.01 accepts the closest 1 percent)

(Pritchard et al., 2000). Second, we used a non-linear regression method based on neural networks, using the default parameters in R (see below), to correct for the imperfect and non- linear fit between the observed and generated summary statistics (Blum and Francois 2010). For each method we conducted a cross-validation using three different tolerance rates (0.01, 0.0025,

0.001) and the two different sets of summary statistics described above to calculate a correct classification rate for each method and determine the best combination of parameters for distinguishing between the 3 different scenarios (invasion a, invasion b, cryptic movement). This analysis randomly selects generated simulations as pseudo-observed statistics and calculates the most likely model for each using the ABC approach. Because the correct model is known, a correct classification rate can then be determined. For this analysis we selected 25 generated simulations from each scenario as the pseudo-observed dataset and determined a correct classification rate (percentage of simulations for which the correct model was chosen) for each scenario dataset using each method and tolerance rate.

Using the parameters with the highest correct classification rate we determined the likelihood of each scenario through Bayes factors, which represent the ratio of acceptance rates

(i.e. the likelihood of one scenario versus another). In the non-linear regression method, observations that are closer to the observed statistics are given a higher weight through a kernel smoothing factor (Franҫois et al. 2008). Lastly, we used posterior predictive checks to determine if the observed summary statistics were within the posterior predictive distribution for each summary statistic of the chosen scenario. We compared observed and generated datasets and

validated the models using the abc package (Csillery et al. 2012) in R (R Development Core

Team 2009).

Results cpDNA haplotypes

The matK and trnH-psbA chloroplast regions were considered uninformative for this study because they showed no sequence variability in T. angustifolia and/or T. latifolia. The trnT-trnL region was excluded because its variability was largely attributable to multiple repetitive sequences (minisatellites and microsatellites) which were difficult to align with confidence; in addition, owing to their high potential for homoplasy, repetitive regions may introduce uncertainty into phylogeographic reconstructions (Vachon and Freeland 2011;

Freeland and Vachon 2012). The trnT-trnL region, which varied within and between species, ranged in size from 824 to 850 bp. With the exception of the 23 bp indel that was recoded as a single mutation (see ‘‘Methods’’), all mutations were either nucleotide substitutions or single bp indels. Two of the mutations were in repetitive regions, but no haplotypes were identified solely on the basis of these mutations. We identified a total of 11 haplotypes: six within T. latifolia, three within T. angustifolia, and two within T. domingensis (GenBank Accession numbers

JX508601-JX508611). The phylogenetic relationships among species and haplotypes are shown in Figure 4.2. Within T. latifolia, four haplotypes were found only in North American individuals, one haplotype was found in a single European individual, and the remaining—and most common—haplotype was shared between North America and Europe. Within T. angustifolia, one haplotype was limited to a single European individual, one haplotype was identified in three North American individuals, and the third and most common haplotype was shared between Europe and North America.

100

Microsatellite genotypes

The effective number of alleles, averaged across loci, was 1.75 ± 0.274 for North

American T. latifolia, 1.47 ± 0.072 for European T. latifolia, 2.0 ± 0.103 for North American T. angustifolia, and 3.2 ± 0.291 for European T. angustifolia. The results of the PCoA are shown in

Figure 4.3. For both species, European and North American clusters in the PCoA show some overlap. Seven of the multilocus genotypes identified in T. latifolia were found in plants from both North America and Europe, although in T. angustifolia each genotype was restricted to a single continent. The results of the Structure analyses, specifically the lnP(D) and delta K graphs, show that the most likely value of K for each species is two (Figure 4.4 and Figure 4.5).

In each species, the two Structure groups correspond broadly with the continents from which samples were collected. In T. angustifolia, 79% of individuals collected in Europe were identified as being in the predominantly European group, and 94% of North American samples were identified as being in the predominantly North American group. In T. latifolia, 90% of individuals collected in Europe were identified as being in the predominantly European group, and 73% of samples collected in North America were identified as being in the predominantly

North American group.

One locus (TA5) showed evidence of not mutating in a stepwise fashion (single bp differences) for a small number of individuals (3 T. angustifolia and 5 T. latifolia), and thus these individuals were removed prior to calculating observed summary statistics for the ABC analysis.

Overall, the cross-validation suggested the reduced set of summary sets were better at distinguishing between the 3 scenarios and the rejection method with a strict tolerance (0.001) had the highest correct classification rate (cryptic movement: 88%, invasion a: 92%; invasion b:

84%) ; cryptic movement: 88%). When using non-linear regression, the reduced summary statistics and medium tolerance (0.0025) led to the highest correct classification rate for this 101

method (cryptic movement: 72%; invasion a: 92%; invasion b: 76%), but was still lower than using the rejection method. Because of some discrepancies in results for the different methods we present both of these parameter combinations below.

When using the rejection method for T. angustifolia, 73% of the retained simulations were from invasion b (invasion of North America from Europe), 27% were cryptic movement and 0.02 percent were from invasion a. This led to Bayes factors of 2.74 and 182.50 when comparing invasion b to the cryptic movement and invasion a respectively, suggesting an outright rejection of invasion a and a modest improvement in fit of the invasion b model over the cryptic movement model. When using non-linear regression, however, the posterior model probabilities suggested the cryptic movement model was most likely with Bayes factors of 30.08 and 4052.32 when comparing the cryptic movement model to invasion b and invasion a, suggesting it had a much improved fit over the other two models. When using the full summary statistics the patterns were the same (rejection suggesting invasion b and non-linear regression suggesting cryptic movement). The observed summary statistics were within the posterior predictive distribution for both models with the exception of the large allelic range for the

European population. This could be attributable to some loci mutating under a non-stepwise mutation model (larger than 2 bp inserts) or to unsampled populations.

Forty-three percent of the retained simulations for T. latifolia were from the invasion a

(invasion of Europe from North America) model, 43% were from invasion b, and 14% were from the cryptic movement. This led to Bayes factors of 1 when comparing the invasion models and 3 when comparing either invasion model to the cryptic movement model. When using non- linear regression, invasion a was the most likely model with Bayes factors of 1.70 and 2.86 in comparison with the invasion b and cryptic movement model, respectively. When using the full

102

summary statistics both methods also suggested an invasion a scenario with slightly higher

Bayes factors (ranging from 2.15 to 3.87). Posterior predictive checks suggested that some summary statistics (allelic range, number of alleles) were outside of the posterior predictive distribution for the invasion a model, suggesting the possibility that none of the models provide an accurate representation of the true scenario.

Discussion

The origin of Typha dates back to the Cretaceous period (Bremer 2000), although geographical distributions over time are not well known. The pollen record suggests that Typha has been present in North America since before the Last Glacial Maximum (Sawada et al. 2003).

In England, Typha fossils have been dated to the Lower Oligocene (a minimum of 23 mya)

(Collinson 1983). If populations from two allopatric regions have evolved independently for a prolonged period of time, a combination of genetic drift and natural selection should have led to genetic differentiation between the two (Cerny and Hebert 1999; Nies and Reusch 2005). This should be particularly true when differentiation is inferred from relatively rapidly evolving, putatively neutral loci such as microsatellites. Alternatively, if populations from two continents show little genetic divergence, we may conclude that they have only recently become reproductively isolated, in which case dispersal between continents must also have been relatively recent. Introduced species provide numerous examples of recent intercontinental dispersal, and they typically show a relatively modest degree of intercontinental genetic divergence that is normally attributable to the founder effects that are associated with most introductions (Dupont et al. 2011; Grapputo et al. 2005; Plut et al. 2011).

The data that we have presented in this study provide several lines of evidence that suggest relatively recent dispersal of T. angustifolia and T. latifolia between North America and

103

Europe. Although the sequence divergence among Typha cpDNA haplotypes is overall low, as evidenced by the fact that only two of the four regions that we investigated showed variability within both species, trnL-trnF does vary within Typha spp., and most of this variation is in non- repetitive regions and so should therefore not be unduly influenced by homoplasy (Freeland and

Vachon 2012). In both species the most common cpDNA haplotype was found on both continents. Additional haplotypes were found on only one or the other continent but our sample sizes prevent us from ruling out the possibility that broader sampling would uncover all haplotypes on both continents. In the absence of relatively recent intercontinental dispersal, we would expect all haplotypes identified from variable genetic regions to be restricted to one or the other continent (Freeland et al. 2000; Westergaard et al. 2011).

Microsatellite data also suggest recent divergence between North American and

European populations. The principal components analyses that we generated for this study should show clear intercontinental genetic differentiation for both T. angustifolia and T. latifolia if populations on the two continents had evolved independently for tens or even hundreds of thousands of years, in other words if they currently reside in their native range. However, each

Typha species showed a degree of intercontinental differentiation that is comparable to, or lower than, that between known source and introduced populations on the two continents in other taxomic groups (e.g. Colautti et al. 2005; Plut et al. 2011; Schrey et al. 2011). The existence of identical genotypes in European and North American T. latifolia also suggests very recent shared ancestry.

The results of our Structure analyses provide evidence of two genetic clusters in each species that broadly correspond to North America and Europe, with some European plants assigned to the North American cluster and vice versa. These results could be explained by

104

recent bidirectional intercontinental movement, or by scenarios in which plants that are native to only one continent have recently colonized the other continent. Under the model of bidirectional intercontinental movement, the majority of plants on each continent would be native, and the genetic clusters identified by Structure would correspond to long-standing evolutionary splits.

Under the models that propose plants as being native to only one or the other continent, the genetic clusters identified by Structure could be explained by a founder effect associated with intercontinental dispersal and colonization. The ABC analysis compared the likelihoods of each scenario, and when using the rejection method, which had the highest power to distinguish between the models, the most likely scenario in T. angustifolia was an introduction into North

America from Europe following European settlement. This result, however, was not consistent across all of the methods tested and so the cryptic movement scenario, although less likely, cannot be entirely ruled out. As discussed in our introduction, the idea that T. angustifolia may not be native to North America is not a new one, although our study is the first to provide evidence in support of this claim.

ABC analysis also suggested the possibility that T. latifolia is a relatively recent introduction from North America to Europe. This is a more surprising result, because T. latifolia is considered native to Europe, and therefore putatively introduced T. latifolia would presumably have had to outcompete and replace native plants. Although this is not impossible, it is not the most parsimonious explanation and posterior predictive checks suggested none of our tested scenarios provided a good fit for the observed data. At this time, we conclude that while our data undoubtedly show high degrees of genetic similarity between European and North American T. latifolia, further investigation using additional markers, and a broader sampling strategy, is necessary before we can conclude that North America is the source of European T. latifolia. For

105

both species, a larger sample and a greater number of genetic markers will increase the power to distinguish between the different models and to test more complex scenarios. Indeed, our posterior predictive checks for both species suggest some complexity that is not accounted for in our models.

Typha angustifolia and T. x glauca are frequently identified as the most invasive cattails in North America (Tulbure et al. 2007; Tuchman et al. 2009), although from the mid-20th century onwards, T. latifolia has been increasing its distribution in North America at roughly the same rate as T. angustifolia (Shih and Finkelstein 2008). Typha angustifolia and T. latifolia frequently hybridize in eastern North America (Kirk et al. 2011a; Travis et al. 2010), and there is some evidence of evolutionary change within the species complex, including unexpectedly synchronous flowering times in the two parental species (Ball and Freeland, in review), a lack of niche segregation between the parental species (McKenzie-Gopsill et al. 2012), and regular backcrossing of hybrids (Kirk et al. 2011a; Travis et al. 2010) that were previously reported as sterile (Dugle and Copps 1972; Smith 1967). A combination of intercontinental dispersal, hybridization, and admixture can make important contributions to evolutionary change, although such patterns have yet to be elucidated in Typha spp. However, this study does make an important start by providing strong evidence that both species have experienced relatively recent intercontinental dispersal.

More specifically, our data support the hypothesis that in North America, T. angustifolia is an introduced species; although we cannot definitively rule out cryptic bidirectional intercontinental dispersal (a scenario that would result in introduced lineages on both continents), the ABC analyses suggest that an introduction from Europe to North America is the most likely explanation for high intercontinental genetic similarity in this species. Introduction from Europe

106

to North America can have a number of implications for the increasingly invasive behaviour of

North American T. angustifolia. For example, some highly successful invasive lineages are novel hybrids of formerly allopatric lineages (Gaskin and Schaal 2002; Lavergne and Molofsky

2007; Schaal et al. 2003). Such admixture is an increasingly recognized feature of invasions

(e.g. Kolbe et al. 2007; Turgeon et al. 2011) because it can lead to hybrid vigour which can substantially increase fitness and potentially result in rapid biological invasions (Keller, Taylor

2010; Schierenbeck, Ellstrand 2009; Turgeon et al. 2011; Verhoeven et al. 2011; Whitney,

Gabler 2008). In the case of North American Typha, admixture would be in addition to the hybridization and backcrossing that have already been documented, and the potential for novel genomes is therefore exceedingly high. The contribution of genetic diversity to evolutionary potential has been demonstrated in a number of studies (reviewed in Kirk and Freeland 2011; see also Markert et al. 2010; Pujol and Pannell 2008). Future studies on North American Typha should therefore pay attention to the possibility that admixture and hybridization are promoting rapid evolution within this species complex. More generally, this study adds to the growing body of literature which suggests that cryptic long-distance movements are making important contributions to biological invasions around the world.

Acknowledgements

Many thanks to Doug Ball, Nicole Vachon, Jennifer Paul, Amber Olson, Jennifer

Coughlan, Eva Conrad and William Conrad for providing some of the samples that were used in this study and assisting with field work. Financial support for this work came from the Natural

Science and Engineering Research Council and Trent University.

107

References

Blakeslee AMH, Byers JE, Lesser MP (2008) Solving cryptogenic histories using host and

parasite molecular genetics: the resolution of Littorina littorea's North American origin.

Mol. Ecol. 17:3684-3696

Blum MGB, Franҫois O (2010) Non-linear regression models for Approximate Bayesian

Computation. Stat Comp 20:63-73

Boers AM, Zedler JB (2008) Stabilized water levels and Typha invasiveness. Wetlands 28:676-

685

Bremer K (2000) Early Cretaceous lineages of monocot flowering plants. Proc Natl Acad Sci

USA 97:4707-4711

Carlton JT (1996) Biological invasions and cryptogenic species. Ecology 77:1653-1655

Cerny M, Hebert PDN (1999) Intercontinental allozyme differentiation among four Holarctic

Daphnia species. Limnol Oceanog 44:1381-1387

Colautti RI, Manca M, Viljanen M, et al. (2005) Invasion genetics of the Eurasian spiny

waterflea: evidence for bottlenecks and gene flow using microsatellites. Mol. Ecol.

14:1869-1879

Collinson ME (1983) Palaeofloristic assemblages and palaeoecology of the Lower Oligocene

Bembridge Marls, Hamstead Ledge, Isle of Wight. Bot J Linn Soc 86:177-225

Cowie RH (2001) Decline and homogenization of Pacific faunas: the land snails of American

Samoa. Biol Cons 99:207-222

Csillery K, Francois O, Blum MGB (2012) abc: an R package for approximate Bayesian

computation (ABC). Methods Ecol Evol 3:475-479

108

Cuenoud P, Savolainen V, Chatrou LW, Powell M, Grayer RJ, Chase MW (2002) Molecular

phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and

matK DNA sequences. Am J Bot 89:132-144

Culley TM, Hardiman NA (2009) The role of intraspecific hybridization in the evolution of

invasiveness: a case study of the ornamental pear tree Pyrus calleryana. Biol Inv11:1107-

1119

Davidson AM, Jennions M, Nicotra AB (2011) Do invasive species show higher phenotypic

plasticity than native species and, if so, is it adaptive? A meta-analysis. Ecol. Lett 14:419-

431

Dickerman JA, Wetzel RG (1985) Clonal growth in Typha latifolia: Population dynamics and

demography of the ramets. J Ecol 73:535-552

Dugle JR, Copps TP (1972) Pollen characteristics of Manitoba cattails. The Can Field Nat,

86:33-40

Dupont L, Viard F, Davis MH, et al (2011) Pathways of spread of the introduced ascidian Styela

clava (Tunicata) in Northern Europe, as revealed by microsatellite markers. Biol Inv

12:2707-2721

Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the

software STRUCTURE: a simulation study. Mol Ecol 14:2611-2620

Excoffier L, Estoup A, Cornuet JM (2005) Bayesian analysis of an admixture model with

mutations and arbitrarily linked markers. Genetics 169:1727-1738

Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: a new series of programs to perform

population genetics analyses under Linux and Windows. Mol Ecol Res 10:564-567

109

Falush D, Stephens M, Pritchard JK (2007) Inference of population structure using multilocus

genotype data: dominant markers and null alleles. Mol Ecol Notes 7:574-578

Felsenstein J (2005) PHYLIP (Phylogeny Inference Package) version 3.6. Department of

Genome Sciences, University of Washington, Seattle.

Finkelstein SA, Peros MC, Davis AM (2005) Late Holocene paleoenvironmental change in a

Great Lakes coastal wetland: integrating pollen and diatom datasets. J Paleolimnol 33:1–

François O, Blum MGB, Jakobsson M et al. (2008) Demographic history of European

populations of Arabidopsis thaliana. PLoS Genet 4(5):e1000075

Freeland JR, Vachon N (2012) Repetitive sequences in phylogeographic inference: a reply to

Saltonstall and Lambertini (2012). Mol Ecol Res 12:586–589

Freeland JR, Romualdi C, Okamura B (2000) Gene flow and genetic diversity: a comparison of

freshwater bryozoans populations in Europe and North America. Heredity 85:498–508

Galatowitsch SM, Anderson NO, Ascher PD (1999) Invasiveness in wetland plants in temperate

North America. Wetlands 19:733–755

Garza JC, Williamson EG (2001) Detection of reduction in population size using data from

microsatellite loci. Mol Ecol 10:305–318

Gaskin JF, Schaal BA (2002) Hybrid Tamarix widespread in US invasion and undetected in

native Asian range. Proc Nat Acad Sci USA 99:11256–11259

Geller JB, Walton ED, Grosholz ED et al (1997) Cryptic invasions of the crab Carcinus detected

by molecular phylogeography. Mol Ecol 6:901–906

Goldstein JC, Ruiz-Linares A, Cavalli-Sforza LL et al (1995) Genetic absolute dating based on

microsatellites and the origin of modern humans. PNAS 92:6723–6727

110

Grace JB, Harrison JS (1986) The Biology of Canadian Weeds.73. Typha latifolia L., Typha

angustifolia L. and Typha x glauca Godr. Can J Plant Sci 66:361–379

Grapputo A, Boman S, Lindstrom L, Lyytinen A, Mappes J (2005) The voyage of an invasive

species across continents: genetic diversity of North American and European Colorado

potato beetle populations. Mol Ecol 14:4207–4219

Hayes KR, Barry SC (2008) Are there any consistent predictors of invasion success? Biol Inv

10:483–506

Herrick BM, Wolf AT (2005) Invasive plant species in diked vs. undiked Great Lakes wetlands.

J Gt Lakes Res 31:277–287

Holdredge C, Bertness MD, von Wettberg E, Silliman B (2010) Nutrient enrichment enhances

hidden differences in phenotype to drive a cryptic plant invasion. Oikos 119:1776–1784

Holsbeek G, Mergeay J, Volckaert FAM, De Meester L (2010) Genetic detection of multiple

exotic water frog species in Belgium illustrates the need for monitoring and immediate

action. Biol Inv 12:1459–1463

Huff DR, Peakall R, Smouse PE (1993) RAPD variation within and among natural populations

of outcrossing buffalograss [Buchloe dactyloides (Nutt) Engelm]. Theor Appl Genet

86:927–934

Jost L (2008) G(ST) and its relatives do not measure differentiation. Mol Ecol 17:4015–4026

Kanarek AR, Webb CT (2010) Allee effects, adaptive evolution, and invasion success. Evol

Appl 3:122–135

Keller SR, Taylor DR (2010) Genomic admixture increases fitness during a biological invasion.

J Evol Biol 23:1720–1731

111

Kirk H, Freeland JR (2011) Applications and implications of neutral versus non-neutral markers

in molecular ecology. Int J Mol Sci 12:3966–3988

Kirk H, Connelly C, Freeland JR (2011a) Molecular genetic data reveal hybridization between

Typha angustifolia and T. latifolia across a broad spatial scale in eastern North

America. Aquat Bot 95:189–193

Kirk H, Paul J, Straka J, Freeland JR (2011b) Long distance dispersal and high genetic diversity

are implicated in the invasive spread of the common reed in north-eastern North America.

Am J Bot 98:1180–1190

Kolbe JJ, Glor RE, Schettino LR, Lara AC, Larson A, Losos JB (2007) Multiple sources,

admixture, and genetic variation in introduced Anolis lizard populations. Cons Biol

21:1612–1625

Kuehn MM, Minor JE, White BN (1999) An examination of hybridization between the cattail

species Typha latifolia and Typha angustifolia using random amplified polymorphic

DNA and chloroplast DNA markers. Mol Ecol 8:1981–1990

Laval G, Excoffier L (2004) SIMCOAL 2.0: a program to simulate genomic diversity over large

recombining regions in a subdivided population with a complex history. Bioinformatics

20:2485–2487

Lavergne S, Molofsky J (2007) Increased genetic variation and evolutionary potential drive the

success of an invasive grass. PNAS 104:3883–3888

Markert JA, Champlin DM, Gutjahr-Gobell R, Grear JS, Kuhn A, McGreevy TJ, Roth A, Bagley

MJ, Nacci DE (2010) Population genetic diversity and fitness in multiple environments.

BMC Evol Biol 10:205

112

McKenzie-Gopsill A, Kirk H, Van Drunen W, Freeland JR, Dorken ME (2012) No evidence for

niche segregation in a North American cattail (Typha) species complex. Ecol

Evol 2:952–961

Mozdzer TJ, Zieman JC (2010) Ecophysiological differences between genetic lineages facilitate

the invasion of non-native Phragmites australis in North American Atlantic

coast wetlands. J Ecol 98:451–458

Nei M, Li WH (1979) Mathematical model for studying the genetic variation in terms of

restriction endonucleoases. PNAS 76:5269–5273

Nies G, Reusch TBH (2005) Evolutionary divergence and possible incipient speciation in post-

glacial populations of a cosmopolitan aquatic plant. J Evol Biol 18:19–26

Olson A, Paul J, Freeland JR (2009) Habitat preferences of cattail species and hybrids (Typha

spp.) in eastern Canada. Aquat Bot 91:67–70

Orloci L (1978) Multivariate Analysis in Vegetation research. Junk, The Hague

Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic

software for teaching and research. Mol Ecol Notes 6:288–295

Plut K, Paul J, Ciotir C, Freeland JR (2011) Origin of non-native Phragmites australis in North

America, a common wetland invader. Fund Appl Limnol 179(2):121–129

Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus

genotype data. Genetics 155:945–959

Pujol B, Pannell JR (2008) Reduced responses to selection after species range expansion.

Science 321:96.

R Development Core Team (2009) R: a language and environment for statistical computing. R

Foundation for Statistical Computing, Vienna.

113

Roman J (2006) Diluting the founder effect: cryptic invasions expand a marine invader’s range.

Proc R Soc B-Biol Sci 273:2453–2459

Rosenberg NA (2004) DISTRUCT: a program for the graphical display of population structure.

Mol Ecol Notes 4:137–138

Ruiz GM, Fofonoff P, Hines AH, Grosholz ED (1999) Non-indigenous species as stressors in

estuarine and marine communities: assessing invasion impacts and interactions. Limnol

Oceanog 44:950–972

Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution, and

biogeography of Paeonia (Paeoniaceae). Am J Bot 84:1120–1136

Sawada M, Viau AE, Gajewski K (2003) The biogeography of aquatic macrophytes in North

America since the last glacial maximum. J Biogeogr 30:999–1017

Schaal BA, Gaskin JF, Caicedo AL (2003) Phylogeography, haplotype trees, and invasive plant

species. J Hered 94:197–204

Schierenbeck KA, Ellstrand NC (2009) Hybridization and the evolution of invasiveness in plants

and other organisms. Biol Inv 11:1093–1105

Schrey AW, Grispo M, Awad M, Cook MB, McCoy ED, Mushinsky HR, Albayrak T, Bensch S,

Burke T, Butler LK, Dor R, Fokidis HB, Jensen H, Imboma T, Kessler-Rios MM, Marzal

A, Stewart IR, Westerdahl H, Westneat DF, Zehtindjiev P, Martin LB (2011) Broad-scale

latitudinal patterns of genetic diversity among native European and introduced house

sparrow (Passer domesticus) populations. Mol Ecol 20:1133–1143

Selbo SM, Snow AA (2004) The potential for hybridization between Typha angustifolia and

Typha latifolia in a constructed wetland. Aquat Bot 78:361–369

114

Shih JG, Finkelstein SA (2008) Range dynamics and invasive tendencies in Typha latifolia and

Typha angustifolia in Eastern North America derived from herbarium and pollen records.

Wetlands 28:1–16

Simberloff D (2009) The role of propagule pressure in biological invasions. Ann Rev Ecol Evol

Syst 40:81–102

Smith SG (1967) Experimental and natural hybrids in North American Typha (Typhaceae). Am

Mid Nat 78:257–287

Snow AA, Travis SE, Wildova R, Fér T,Sweeney PM, Marburger JE, Windels S, Kubátová B,

Goldberg DE, Mutegi E (2010) Species-specific SSR alleles for studies of hybrid

cattails (Typha latifolia x T. angustifolia; Typhaceae) in North America. Am J Bot

97:2061–2067

Stuckey RL, Salamon DP (1987) Typha angustifolia in North America—a foreigner

masquerading as a native. Ohio J Sci 87:4

Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of 3

noncoding regions of chloroplast DNA. Plant Mol Biol 17:1105–1109

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X

windows interface: flexible strategies for multiple sequence alignment aided by quality

analysis tools. Nucl Acids Res 25:4876–4882

Travis SE, Marburger JE, Windels S, Kubátová B (2010) Hybridization dynamics of invasive

cattail (Typhaceae) stands in the Western Great Lakes Region of North America: a

molecular analysis. J Ecol 98:7–16

115

Trebitz AS, Taylor DL (2007) Exotic and invasive aquatic plants in Great Lakes coastal

wetlands: distribution and relation to watershed land use and plant richness and cover. J

Gt Lakes Res 33:705–721

Tsyusko-Omeltchenko OV, Schable NA, Smith MH, Glenn TC (2003) Microsatellite loci

isolated from narrow-leaved cattail Typha angustifolia. Mol Ecol Notes 3:535–538

Tuchman NC, Larkin DJ, Geddes P, Wildova R, Jankowski K, Goldberg DE (2009) Patterns of

environmental change associated with Typha x glauca invasion in a Great Lakes

coastal wetland. Wetlands 29:964–975

Tulbure MG, Johnston CA, Auger DL (2007) Rapid invasion of a Great Lakes coastal wetland

by non-native Phragmites australis and Typha. J Gt Lakes Res 33:269–279

Turgeon J, Tayeh A, Facon B, Lombaert E, De Clercq P, Berkvens N, Lundgren JG, Estoup A

(2011) Experimental evidence for the phenotypic impact of admixture between

wild and biocontrol Asian ladybird (Harmonia axyridis) involved in the European

invasion. J Evol Biol 24: 1044–1052

Vaccaro LE, Bedford BL, Johnston CA (2009) Litter accumulation promotes dominance of

invasive species of cattails (Typha spp.) in Lake Ontario wetlands. Wetlands 29:

1036–1048

Vachon N, Freeland JR (2011) Phylogeographic inferences from chloroplast DNA: quantifying

the effects of mutations in repetitive and non-repetitive sequences. Mol Ecol Res 11:279–

285

Verhoeven KJF, Macel M, Wolfe LM, Biere A (2011) Population admixture, biological

invasions and the balance between local adaptation and inbreeding depression. Proc

R Soc B-Biol Sci 278:2–8

116

Vigouroux Y, Jaqueth JS, Matsuoka Y, Smith OS, Beavis WD, Smith JSC, Doebley J (2002)

Rate and pattern of mutation at microsatellite loci in maize. Mol Biol Evol 19: 1251–

1260

Wasson K, Zabin CJ, Bedinger L, Diaz MC, Pearse JS (2001) Biological invasions of estuaries

without international shipping: the importance of intraregional transport. Biol Conserv

102:143–153

Wegmann D, Leuenberger C, Neuenschwander S, Excoffier L (2010) ABCtoolbox: a versatile

toolkit for approximate Bayesian computations. BMC Bioinf 11:116

Westergaard KB, Alsos IG, Popp M, Engelskjøn T, Flatberg KI, Brochmann C (2011) Glacial

survival may matter after all: nunatak signatures in the rare European populations of two

west-arctic species. Mol Ecol 20:376–393

Whitney KD, Gabler CA (2008) Rapid evolution in introduced species, ‘invasive traits’ and

recipient communities: challenges for predicting invasive potential. Div Dist 14: 569–580

Wilcox DA, Kowalski KP, Hoare HL et al (2008) Cattail invasion of sedge/grass meadows in

Lake Ontario: photointerpretation analysis of sixteen wetlands over five decades. J Gt

Lakes Res 34:301–323

Zedler JB, Kercher S (2004) Causes and consequences of invasive plants in wetlands:

opportunities, opportunists, and outcomes. Crit Rev Plant Sci 23:431–452

117

Table 4.1 Demographic parameters and prior distributions used in invasion models

Parameter Description *Cryptic *NA *Europe Lower Upper Movement Invasion Invasion N.NA Log of current North American X X X 3 5 effective population size N.Eur Log of current North American X X X 3 5 effective population size Mig Amount of migration (proportion X 0.00001 0.01 of immigrants) T.Mig Beginning of migration between X 50 400 Europe and North America T.Invade Time of invasion X X 50 400 T.Split Log of the time of split between X 4 6 European and North American populations N.Found Number of founding individuals X X 10 500 N.Ancestral Log of ancestral population size X X X 3 6 Mutation Mean mutation rate of X X X 1.4 x 10-4 1.1 x 10-3 microsatellite loci * An ‘X’ in the column indicates parameter was included in the model

118

119

120

Figure 4.3 Principal components analyses showing the genetic similarity of European and

North American genotypes in a) T. latifolia and b) T. angustifolia. In T. angustifolia, the first axis explained 26.7% of the variation and the second axis explained 21.5% of the variation. In T. latifolia, the first axis explained 30.3% of the variation and the second axis explained 21.0% of the variation.

121

– 10.

122

– 10.

123

APPENDIX 4

Appendix 4.1 Stand locations and sample sizes of T. angustifolia, T. latifolia, and T. domingensis plants that were included in this study.

Location Latitude (N) Longitude Sample size for cpDNA microsatellite haplotypes data T. latifolia Europe United Kingdom Coalville 52°46’ 01°21’W 4 H6 London 51°23’ 00°03’E 1 H6 Netherlands Elburg Canal 52°28’ 05°50’E 2 H6 Haarlem South 52°23’ 04°39’E 1 H6 Leiden 52°09’ 04°27’E 4 France Clairmarais 50°45’ 02°18’E 10 H6 Aire des Etangs 46°42’ 01°35’E 3 Cabano Mairie 43°32’ 04°21’E 2 Montcalm 43°34’ 04°18’E 3 Spain La Serra 42°07’ 02°26’E 2 H6, H7 Italy Sabaudia 45°56’ 12°32’E 2 H6 (x2) Austria Klagenfurt 46°38’ 14°22’E 3 H6 Hungary Gyor 47°47’ 17°19’E H6 Tatabanya Centre 47°35’ 18°23’E 6 Budapest 47°46’ 17°19’E 12 Romania Carei 47°41’ 22°37’E 4 Ciuperceni 47°51’ 22°58’E 5 Darabani 48°10’ 26°37’E 5 Hudesti 47°52’ 26°21’E 1 North America Ontario Peterborough 44°17’ 78°16’W 54 H6 Lakefield 44°26’ 78°16’W 36 Presqu’ile 43°59’ 77°43’W 2 H6 Wainfleet Bog 42°54’ 79°17’W 1 H6 Ottawa 45°27’ 75°42’W 1 H8 Big Creek 42°35’ 80°26’W 3 H9 Quebec Montmagny 47°03’ 70°23’W H8 Quebec City 46°40’ 71°20’W 4 H8 La Pocatiere 47°22’ 70°03’W 2 H8 St. Madeleine 45°46’ 73°07’W 4 H8 Montreal 45°35’ 73°07’W 6 Villeroy 46°23’ 71°50’W 4 New Brunswick Edmunston 47°18’ 68°20’W 4 H8 (x2) Sackville 45°55’ 64°20’W 3 H11 Young’s Cove 45°56’ 65°49’W 10 H8 Woodstock 46°09’ 67°42’W 8 H10 Nova Scotia Gaspereau River 45°04’ 64°19’W 2 H8 Windsor 45°00’ 64°08’W 3 H8 Terra Beata 44°23’ 64°15’W 5 H6 Annapolis Royal 44°44’ 65°30’W 5 H11 Heckman’s Island 44°23’ 64°14’W 6 H8 2nd Peninsula 44°23’ 64°17’W 9 H8 (x2) 124

Blue Rocks 44°21’ 64°14’W 2 H8 Indian Point 44°27’ 64°19’W H8 Maine Gorham 43°40’ 70°26’W 7 H6 (x2) Standish 43°47’ 70°33’W 8 H6 (x2) T. latifolia Total 259 H6 = 18 H7 = 1 H8 = 15 H9 = 1 H10 = 1 H11 = 2

T. angustifolia Europe United Kingdom London 51°23’ 00°03’E 7 H1 (x2) Exact provenance H1 unknown Netherlands Elburg Canal 52°28’ 05°50’E 3 H1 Spaardam 52°24’ 04°40’E 3 H1 France Clairmarais 50°45’ 02°18’E 5 H1 Montcalm 43°34’ 04°18’E H1 Aire des Etangs 46°42’ 01°35’E H1 Cabano Mairie 43°32’ 04°21’E 1 Hungary Tatabanya Centre 47°35’ 18°23’E 6 H1 Budapest 47°46’ 17°19’E 4 Romania Carei 47°41’ 22°37’E 9 H1 (x3) Ciuperceni 47°51’ 22°58’E H3 Darabani 48°10’ 26°37’E 1 North America Ontario Port Dover 42°47’ 80°12’W 3 H1 (x2) Wainfleet Bog 42°54’ 79°18’W 2 H1 Peterborough 44°17’ 78°17’W 37 H1 (x3) Dwyer Hill 45°12’ 76°02’W 5 H2 (x2) Lakefield 44°26 78°16’W 29 H2 Turkey Point 42°40’ 80°19’W 2 H1 Quebec Montmagny 47°03’ 70°23’W 2 H1 (x2) Villeroy 46°23’ 71°50’W 3 H1 Rigaud 45°29’ 74°19’W 2 H1 New Brunswick Edmunston 47°22’ 68°20’W 2 H1 Moncton 46°05’ 64°46’W 3 Nova Scotia Terra Beata 44°23’ 64°15’W H1 Second Paradise 44°24’ 64°16’W 2 H1 T. angustifolia 131 H1 = 26 Total H2 = 3 H3 = 1 T. domingensis Spain St. Jaume de Llierca 42°13’W 02°36’E H4, H5 T. domingensis H4 = 1 Total H5 = 1

125

5 CHAPTER 5

PRELIMINARY CHARACTERIZATION OF TYPHA LATIFOLIA AND T. ANGUSTIFOLIA FROM NORTH AMERICA AND EUROPE BASED ON NOVEL MICROSSATELLITE MARKERS IDENTIFIED THROUGH NEXT-GENERATION SEQUENCING

A version of this chapter has been published

Ciotir C., Dorken M. and Freeland J. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Journal of Fundamental Applied Limnology, Vol. 182/3,

247–252.

126

Abstract

Typha spp. comprise an increasingly aggressive species complex in North American wetlands. Complicated patterns of dispersal and hybridization challenge the elucidation of microevolutionary processes within this species complex, and therefore additional molecular markers are desirable. Microsatellite loci were identified in a broad-leaved cattail (Typha latifolia) using Roche 454 pyrosequencing technology. Nine of these loci were optimized, and all proved to be polymorphic within 76 samples of North American and European T. latifolia, having 2-17 alleles per locus. Seven of these loci were also amplified in 46 Typha angustifolia individuals from North America and Europe, and four were polymorphic, having 2-9 alleles per locus. Overall, allelic diversity was higher in T. latifolia than in T. angustifolia, a finding that contradicts earlier studies and identifies a need to investigate the potential influence of ascertainment bias. Multiple loci appeared to have species-specific and continent-specific alleles, although broader geographical studies are required for confirmation of these trends. This suite of markers, along with those previously characterized, will help to elucidate patterns of

Typha dispersal within and between continents. In addition, they will facilitate studies of parentage, clonality, hybridization and admixture in this broadly distributed species complex.

Key words: Typha dispersal, microevolutionary processes, polymorphic molecular markers, microsatellite loci, parentage, clonality, hybridization, admixture.

127

Introduction

In northeastern North America (NA), Typha latifolia, T. angustifolia, and their hybrid T.

× glauca are increasingly aggressive members of wetland communities (Tulbure et al. 2007,

Smith 1987). Typha latifolia is native to NA and Eurasia (Grace & Harrison 1986), whereas T. angustifolia was most likely introduced to NA from Europe (Ciotir et al. 2013). Hybridization, backcrossing, and recent intercontinental dispersal of both T. latifolia and T. angustifolia complicate the elucidation of microevolutionary processes in this species complex (Ciotir et al.

2013, Kirk et al. 2011, Snow et al. 2010). Untangling these processes will require a suite of polymorphic molecular markers.

Traditional screening methods previously identified 11 microsatellite loci in T. angustifolia, all of which proved to be polymorphic in both T. angustifolia and T. latifolia

(Tsyusko et al. 2003). Although these markers have helped researchers to infer patterns of phylogeography (Ciotir et al. 2013), hybridization (Snow et al. 2010, Kirk et al. 2011) and ecology (Travis et al. 2010, Ball & Freeland 2013), they lack the collective level of polymorphism necessary for deciphering some population- and species-level patterns. Six of the markers developed by Tsyusko-Omeltchenko (2003) have alleles that differentiate between T. angustifolia and T. latifolia and have therefore facilitated the identification of hybrid and backcrossed individuals (Kirk et al. 2011, Snow et al. 2010, Travis et al. 2010). However, although these loci have provided important insights into the phylogeography and population genetics of T. latifolia and T. angustifolia, they lack the collective level of polymorphism that is needed for unambiguous conclusions. For example, identical multilocus genotypes in T. latifolia based on the six most variable microsatellite loci were found in NA and Europe (Ciotir et al.

2013), and additional markers are required before we can determine how recently these individuals shared a common ancestor. In addition, the existing markers were identified from a 128

T. angustifolia library (Tsyusko-Omeltchenko et al. 2003), and ascertainment bias (Vowles &

Amos 2006) may contribute to the lower levels of genetic diversity that were found in T. latifolia compared to T. angustifolia (Kirk et al. 2011, Snow et al. 2010, Tsysko et al. 2006, Tsysko et al.

2005, Tsysko-Omeltchenko et al. 2003).

Next-generation sequencing (NGS) provides revolutionary high-throughput technology for sequencing and genotyping (Zalapa et al. 2012, Malausa et al. 2011, Csencsics et al. 2010).

More specifically, NGS can deliver large numbers of sequences with potential microsatellite loci within a short period of time, and at a reasonable price (Csencsics et al. 2010, Ragoussis, 2009).

In addition, many of the sequences generated by a shotgun NGS approach comprise multiple assembled consensus sequences, which are repeated and therefore highly reliable. For these reasons, we used Roche 454 pyrosequencing technology to identify additional microsatellite loci in T. latifolia, which we then tested for cross-species amplification in T. angustifolia, and assessed their polymorphism in both species based on samples that were collected across broad geographical regions.

Material and Methods

Following the methods outlined in Kirk et al. (2011), DNA was extracted from a T. latifolia leaf collected in Ontario, Canada, and resuspended at a concentration of 12 ng/ml.

Genomic DNA was sequenced in a single shot-gun pyrosequencing reaction on a Roche 454 GS

Junior (Hoffman La-Roche Ltd., Basel, Switzerland), using a full plate PicoTiterPlate Kit.

Sequence data were compiled into contigs in GS Assembler v. 2.5p1/2.5.3 following the manufacturer’s protocol. In order to maximize the reliability of our sequence data, only the multiple consensus contigs from the GS assembly were explored for microsatellite repeats.

MSATCOMMANDER 0.8.2 (Faircloth 2007) was used with default settings to identify di-, tri-,

129

and tetranucleotide loci with a minimum of six, four, and four tandem repeats, respectively, within the consensus contigs assembly. The output file was exported to Microsoft Excel and the resulting SSR repeats were manually filtered according to their category.

A local database library was assembled in BioEdit, and included the NGS output consensus sequences, the chloroplast genome of T. latifolia (Guisinger et al. 2009), and the sequences of eleven microsatellite loci downloaded from NCBI: AF536546-AF536557

(Tsyusko-Omeltchenko et al. 2003). We verified the uniqueness of our microsatellite loci and we discriminated between the nuclear and chloroplast DNA (cpDNA) by performing a local

BLAST search algorithm on this library. We also discarded the cpDNA repeats from our selected loci. Primer pairs were designed using the online version of Primer3Plus Version: 2.3.0

(Utergasser et al. 2007). Primers were designed to amplify products that were 200-450bp in length, using an optimal annealing temperature of between 57°C and 64°C.

Nine of the fifteen loci that met our requirements (Table 5.1) were optimized in T. latifolia using an Eppendorf Mastercycler EPgradient (Mississauga, Ontario, Canada). The PCR

Master Mix included 1× Taq reaction Buffer (UBI Life Sciences Ltd., Saskatoon, SK, Canada),

2mM MgSO4 (UBI Life Sciences), 20 μM dNTPs (Invitrogen®), 20 μM of each primer,

(including a fluorescently labelled forward primer; Table 5.1), 4.5 μL Nanopure H2O, 2.5 U of

High Purity Taq polymerase (UBI Life Sciences), and approximately 10 ng DNA in a final volume of 10 μL. Amplifications used either touchdown PCR (loci TL 209, TL 213, TL 247, TL

305, TL 322, TL 368 and TL 442) or simple PCR reactions (loci TL 45 and TL146). Cycling conditions for touchdown PCRs began with 2 min of denaturation at 96°C, followed by 5 cycles of 96°C for 20s, 64°C for 50s and 72 °C for 60s. These were followed by 21 cycles of touchdown PCR at 96°C for 20s, 64°C for 50s (decreasing to 55°C by 0.5°C/cycle), and 72°C for

130

60s. Next were 5 cycles of 96°C for 20s, 55°C for 50s, and 72°C for 60s with a final extension at 72°C for 10min. Cycling conditions for simple PCR reactions included an initial denaturation at 96°C for 160s, followed by 30 cycles of 96°C for 20s, 60°C for 50s, and 72°C for 60s with a final extension at 72°C for 10min. Seven of the nine loci optimized in T. latifolia could also be optimized in T. angustifolia (Table 5.1).

To test the degree of polymorphism and the allelic diversity of the newly developed loci, seventy-six samples of T. latifolia and 46 samples of T. angustifolia from Europe and North

America were genotyped (Figure 5.1); each of these had been previously identified to species using established methods (Snow et al. 2010, Kirk et al. 2011). Genotyping was carried out on a

3730xl ABI (Applied Biosystems) with internal lane Rox 500 size standards (Applied

Biosystems, USA). Electropherograms were analysed using GENEMARKER (SoftGenetics,

State College, Pennsylvania). Allelic richness (AR) was calculated for each locus using the software FSTAT v. 2.9.3.2 (Goudet 1995).

Results and Discussion

Our NGS run produced a total of 78 317 sequence reads with an average length of 236 bp

(ranging from 40bp to 593 bp). Of these, 19 123 sequences were assembled into 1358 contigs with an average length of 1139bp (ranging from 29 369 bp to 100bp). 52 681 reads were singletons which we did not explore for SSR loci. A total of 68 consensus contigs with tandem repeats were identified. No hexanucleotide repeats were detected. We manually discarded the

16 contigs with interrupted (imperfect) repeats and the 10 contigs with mononucleotides. The remaining 42 sequences comprised 21 dinucleotide, 18 trinucleotide, and 3 tetranucleotide repeats. Sixteen of these contigs were from the cp genome and therefore were discarded. Of the remaining 26 sequences with di- and trinucleotide repeats, only fifteen had sufficient flanking

131

sequences to allow for primer design. We were unable to amplify any DNA from three of the 15 loci. Following amplification, two additional primer pairs generated multiple bands and were therefore discarded. Only the loci that could be optimized in T. latifolia were screened in T. angustifolia. One locus (TL 258) was discarded from use in both species because of unclear electropherograms; more PCR optimization will be needed to obtain scoreable alleles in this locus.

In T. latifolia, the nine optimized loci were polymorphic, having 2 to 17 alleles per locus. In T. angustifolia, only seven microsatellite loci were successfully cross-amplified. Four of these loci were polymorphic, having 2 to 8 alleles per locus, while the remaining three loci were monomorphic (Table 5.2). The allelic richness (AR) was higher in Europe than in NA for both of the species (Table 5.2). We identified a total of 46 alleles in T. latifolia and 26 alleles in T. angustifolia; see Table 5.2 for the allele size ranges in each locus for each species. In T. latifolia,

16 alleles were found only in Europe and 11 alleles were found only in NA, whereas 19 alleles were found in both continents. In T. angustifolia, 2 alleles were found only in NA, 13 alleles were found only in Europe, and 11 other alleles were found on both continents. Of those loci that amplified alleles in both species, three generated what appear to be species-specific alleles

(TL146, TL213, and TL305).

Our study is a part of the rapid growing literature that use NGS methods to rapidly identify microsatellite repeats throughout the genome (Carvalho et al. 2012, Singham et al. 2012,

Dobeš & Scheffknecht 2012, Karan et al. 2012 and Malausa et al. 2011). We chose to use a conservative approach when identifying microsatellite loci because we based our search only on consensus assembled sequences to maximize the reliability of flanking sequences and hence primer design. If single reads of the non-assembled sequences were included, additional loci

132

would be detected. Nevertheless, even when a conservative approach of selecting loci from the consensus assembly was used, nine newly identified microsatellite loci in T. latifolia that show polymorphism were identified within a relatively short period of time.

The microsatellite markers that we identified have potential applications in a range of future Typha studies. For example, the allele sizes for T. latifolia and T. angustifolia do not overlap at three loci (TL146, TL 213 and TL 305; Table 5.2) which suggests that they could be used in future studies of hybridization. In addition, the intraspecific ranges in allele sizes varied between continents at a number of loci, which suggests the possibility of future applications of these markers to phylogeographic studies. It is also worth noting that population studies based on the microsatellites that were developed for T. angustifolia identified fewer alleles in T. latifolia compared to T. angustifolia (Ciotir et al. 2012, Kirk et al. 2011, Snow et al. 2010, Travis et al. 2010). In this study, calculations of allelic richness based on the seven loci that were optimized in both species were in most cases higher in T. latifolia compared to T. angustifolia.

Previously, the higher genetic diversity in T. angustifolia versus T. latifolia led to conclusions of greater dispersal and higher outcrossing in T. angustifolia (Tsyusko et al. 2005,Tsyusko et al.

2006). However, our data suggest that one or both sets of conclusions (i.e. ours or those of

Tysusko et al. 2006) may have been influenced by ascertainment bias, and further research should investigate this possibility. The microsatellite loci that we identified from T. latifolia make a useful addition to the suite of molecular markers currently available for use in Typha spp.

By combining this study with that of Tsyusko-Omeltchenko et al. (2003), researchers now have access to up to twenty microsatellite loci for further work on the population genetics of Typha spp.

133

Acknowledgments

Thanks to Victoria Campbell, Doug Ball, and Heather Kirk for assistance with DNA extractions. Many thanks to Mike Donaldson for the Python Blast searches. Financial support for this project was provided by the Natural Science and Engineering Research Council

(NSERC), Trent University and the Jack Matthews international scholarship.

Conflict of Interest

The authors declare no conflict of interest.

References

Ball D. & Freeland J.R., 2013: Synchronous flowering times and asymmetrical hybridization in Typha latifolia and T. angustifolia in northeastern North America.- Aquat. Bot.

104: 224-227

Carvalho, D. C., Hammer, M. P. & Beheregaray, L. B., 2012: Isolation and PCR- multiplex genotyping of 18 novel microsatellite markers for the threatened southern pygmy perch (Nannoperca australis). Conserv. Genet. Res. 4:15-17.

Ciotir, C., Kirk, J., Row, J. & Freeland J.R., 2013. Intercontinental dispersal of Typha angustifolia and T. latifolia between Europe and North America has implications for Typha invasions. Biol. Invasions.

Csencsics, D., Brodbeck, S. & Holderegger, R., 2010: Cost-effective, species-specific microsatellite development for the endangered Dwarf Bulrush (Typha minima) using Next-

Generation Sequencing technology. - J. Hered. 101:789-793.

Dobeš, C., & Scheffknecht, S., 2012: Isolation and characterization of microsatellite loci for the Potentilla core group (Rosaceae) using 454 sequencing. Mol. Ecol. Resour. 12:726-739.

134

Faircloth, B. C., 2008: MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. -Mol. Ecol. Resour. 8: 92-94.

Goudet, J., 1995: FSTAT (Version 1.2): A computer program to calculate F-statistics. - J.

Hered. 86: 485-486.

Grace, J. B. & Harrison, J. S., 1986: The Biology of Canadian Weeds .73. Typha latifolia

L., Typha angustifolia L., and Typha × glauca Godr. -Can. J. Plant Sci. 66: 361-379.

Guisinger, M. M., Chumley, T. W., Kuehl, J. V., Boore, J. L. & Jansen, R. K., 2010:

Implications of the plastid genome sequence of Typha (Typhaceae, Poales) for understanding genome evolution in Poaceae. -J. Mol. Evol. 70:149-166.

Karan, M., Evans, D. S., Reilly, D., Schulte, K., Wright, C., Innes, D., Holton, T. A.,

Nikles, D. G. & Dickinson G. R., 2012: Rapid microsatellite marker development for African mahogany (Khaya senegalensis, Meliaceae) using next-generation sequencing and assessment of its intra-specific genetic diversity. -Mol. Ecol. Res. 12: 344-353.

Kirk, H., Connolly, C. & Freeland, J.R., 2011: Molecular genetic data reveal hybridization between Typha angustifolia and Typha latifolia across a broad spatial scale in eastern North America. -Aquat. Bot. 95: 189-193.

Malausa, T. Gilles, A., Meglecz, E., Blanquart, H., Duthoy, S., Costedoat, C., Dubut, V.,

Pech, N., Castagnone-Sereno, P., Delye, C., Feau, N., Frey, P., Gauthier, P., Guillemaud, T.,

Hazard, L., Le Corre, V., Lung-Escarmant, B., Male, P. J. G., Ferreira, S. & Martin, J. F., 2011:

High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Mol. - Ecol. Res. 11: 638-644.

Ragoussis J., 2009: Genotyping technologies for genetic research. -Annu. Rev. Genomics and Human Genetics, pp. 117-133.

135

Singham, G.V., Vargo, E.L., Booth, W., Othman, A.S. & Lee, C.Y., 2012: Polymorphic microsatellite loci from an indigenous Asian Fungus-growing termite, Macrotermes gilvus

(Blattodea: Termitidae) and cross amplification in related taxa. -Environ. Entomol. 41: 426-431.

Smith S.G., 2000: Typhaceae A. L. Jussieu. In Flora of North America Editorial

Committee (Eds.) Flora of North America North of Mexico, 22: Magnoliophyta: Alismatidae

Arecidae, Commelinidae (in Part), and Zingiberidae. New York and Oxford. On-line version.

Smith, S. G., 1967: Experimental and natural hybrids in North American Typha

(Typhaceae). - Am. Midl. Nat.78: 257-287.

Snow, A. A., Travis, S. E., Wildova, R., Fer, T., Sweeney, P. M., Marburger, J. E., Windels, S.,

Kubatova, B., Goldberg, D. E. & Mutegi, E., 2010 Species-specific SSR alleles for

studies of hybrid cattails (Typha latifolia x T. angustifolia; Typhaceae) in North America.

-Am. J. Bot. 97: 2061-2067.

Travis, S. E., Marburger, J. E., Windels, S. & Kubatova, B., 2010: Hybridization dynamics of

invasive cattail (Typhaceae) stands in the Western Great Lakes Region of North America:

a molecular analysis. - J. Ecol. 98: 7-16.

Tsyusko-Omeltchenko, O. V., Schable, N. A., Smith, M. H. & Glenn, T. C., 2003: Microsatellite

loci isolated from narrow-leaved cattail Typha angustifolia. -Mol. Ecol. Notes, 3: 535-

538.

Tsyusko, O. V., Smith, M. H., Sharitz, R. R. & Glenn, T. C., 2005: Genetic and clonal diversity

of two cattail species, Typha latifolia and T. angustifolia (Typhaceae), from Ukraine. -

Am. J. Bot. 92: 1161-1169.

Tsyusko, O. V., Smith, M. H., Oleksyk, T. K., Goryanaya, J. & Glenn, T. C., 2006: Genetics of

cattails in radioactively contaminated areas around Chernobyl. Mol. Ecol. 15:2611-2625.

136

Tulbure M.G., Johnston C.A. & Auger D.L., 2007: Rapid invasion of a Great Lakes coastal

wetland by non-native Phragmites australis and Typha. - J. Great Lakes Res. 33: 269-

279.

Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R. & Leunissen, J. A. M., 2007:

Primer3Plus, an enhanced web interface to Primer3. -Nucleic Acids Res. 35: W71-W74.

Vowles E.J. & Amos W., 2006: Quantifying ascertainment bias and species-specific length

differences in human and chimpanzee microsatellites using genome sequences. -Mol.

Biol. Evol. 23: 598-607.

Zalapa J.E., Cuevas H., Zhu H.Y., Steffan, S., Senalik, D., Zeldin, E., McCown, B., Harbut, R. &

Simon, P., 2012: Using Next-Generation Sequencing approaches to isolate simple

sequence repeat (SSR) loci in the Plant Sciences. Am. J. Bot. 99: 193-208.

137

Locus Primer sequences (5'-3') Repeat Ta (°C) No. alleles Size of the Genebank

motif T.l. T.a. T.l. T.a. sequenced allele (bp) accession no. TL 45 F: HEX CCTTGTGAAATCCTTGTACTG (AAT)4 60 60 3 1 369 KC820655 R: TAGATGAAGGGAGAAGTGGA TL 146 F:HEX GGACTACGGTCCTTCTTTTT (AT)7 61.5 60 17 8 368 KC820656 R: TGACAAGCACATTATTGACTTT TL 209 F: HEX TGTCCTTTTTGTGTCACTTG (AG)6 64 - 3 - 392 KC820657 R: TGCGTTATAGATGATATGGTTT TL 213 F: HEX AGCACTTTTCGCATTTTG (CT)9 64 62 8 2 251 KC820658 R: ATTACAGTTTCTTGGCTTGC TL 247 F: FAM AGGCTAGCTAATAAGCCCTAA (AAT)4 60 - 2 - 203 KC820659 R: TCGAATACCCTTGAGAATGT TL 305 F: FAM CTTACCAGTTCCAAATTCCA (CT)6 61 60 7 6 333 KC820660 R: AGCATGCTTAACAACCAAGT TL 322 F: FAM TCATAGGCATCTCACATCAA (CTT)4 60 60 3 1 237 KC820661 R: TAGATGAAGGGAGAAGTGGA TL 368 F:HEX ATTATTCCCTTGCAGACCA (GT)8 60 60 3 9 240 KC820662 R: GAATTGAAGTCCTCCTATCAAA TL 442 F: HEX AGTTGGTGTTACATGCATCC (CT)12 62 60 3 1 213 KC820663 R: AGAGAGAGAGAGAGGGCTTG

138

Table 5.2 Results of initial primer screening in T. latifolia (nine loci) and T. angustifolia (seven loci) from North America (NA) and Europe (EU). N= number of individuals.

T. latifolia T. angustifolia Locu Allele size No. of Allelic Locu Allele size No. of Allelic s range Alleles Richness s range Alleles Richness NA (N=45) NA (N=25) TL45 369-373 2 1.475 TL45 369 1 1 TL146 365-402 7 6.91 TL146 356-360 3 2.81 TL209 389-391 2 2 TL209 x x x TL213 232-241 5 3.942 TL213 229-231 2 2 TL247 184 1 1 TL247 x x x TL305 328-335 3 2.728 TL305 311-321 5 4.607 TL322 224-235 3 2.588 TL322 235 1 1 TL368 243-245 2 1.929 TL368 240-245 4 4 TL442 194-198 2 2 TL442 196 1 1 EU (N=31) EU (N=21) TL45 369-383 2 1.903 TL45 369 1 1 TL146 363-406 13 12.604 TL146 334-360 5 4.996 TL209 389-393 3 3 TL209 x x x TL213 232-245 6 5.897 TL213 229-231 2 2 TL247 184-194 2 1.903 TL247 x x x TL305 331-343 6 6 TL305 313-323 5 4.995 TL322 224-235 3 2.93 TL322 235 1 1 TL368 236-245 3 3 TL368 236-255 7 7 TL442 194-198 3 2.992 TL442 196 1 1

139

Figure 5.1 Collecting sites for samples included in this study: T. latifolia (dark circles) and T. angustifolia (dark triangles)

140

6 CHAPTER 6

CONTRASTING PATTERNS OF GLOBAL PHYLOGEOGRAPHY IN THREE INCREASINGLY DOMINANT CATTAIL SPECIES (TYPHA ANGUSTIFOLIA, T. DOMINGENSIS, AND T. LATIFOLIA)

Authorship: Claudia Ciotir and Joanna Freeland

Abstract

Cattails (Typha spp.) are important components of wetlands around the world, although in recent years they have become increasingly dominant in many regions. We investigated the global phylogeographic patterns of three widespread cattail species, T. angustifolia, T. domingensis, and Typha latifolia with the aims of 1) reconstructing the phylogeography and evolutionary diversification of each species, and 2) quantifying the extent to which non-native species or lineages have been introduced into novel geographic areas. Typha angustifolia and T. domingensis both appear to be paraphyletic, have experienced multiple intercontinental dispersal events combined with both relatively ancient and recent diversification, and show little evidence of continental phylogeographic structuring. Typha latifolia, on the other hand, is monophyletic, shows strong continental phylogeographic structuring, and has experienced relatively few intercontinental movements. The current phylogeographic patterns in these cattail species has been shaped by continental diversification across varying temporal scales, combined with multiple intercontinental dispersal events. The existence of identical haplotypes on multiple continents means that intercontinental dispersal has at times been relatively recent, and this could facilitate biological invasions, either directly or following intraspecific admixture or interspecific hybridization. By combining spatial and temporal perspectives, we have gained insight into the diversification and global movements of three Typha spp., which in turn may help us to understand their growing dominance in wetlands.

141

Keywords: cryptic introduction - haplotype network – hybridization - invasive species - long- distance dispersal - phylogenetics

Introduction

A recent summary of the milestones in phylogeographic research predicted that the field will “increasingly [become] the integrative and comparative multi-taxon endeavour that it was originally conceived to be” (Hickerson et al., 2010). Although a laudable goal, this will be possible only for communities and taxa for which we have the appropriate data. Aquatic plants comprise one of the most understudied taxonomic groups in phylogeography: according to a

2008 review, they were the subjects of less than 2% of all published phylogeographic studies

(Beheregaray, 2008). That same review also reported that only 6% of phylogeographic studies were of a global scale, i.e. based on samples from multiple continents or oceans (Beheregaray,

2008). It is therefore not surprising that although some phylogeographic studies of aquatic plants have been conducted at the regional or continental level (e.g. Chen et al., 2013; Sersic et al.,

2011, Dorken and Barrett, 2004), very few have been conducted at the global level. In addition to the academic interest, there are practical reasons why this gap in the literature should be filled: many aquatic plants are distributed across multiple continents, and a subset of these comprise biological invaders that threaten wetlands around the world (e.g. Khanna et al., 2012; Kirk et al.

2011; Chun, 2011). Although wetlands comprise no more than 6 % of the earth’s land mass, 24

% of the world’s most invasive plants are wetland species (Zedler & Kercher, 2004). This disproportionately high number of invasive wetland species can be at least partially explained by the high degree of interconnection among wetlands and other water bodies that promotes

142

dispersal, combined with the increased susceptibility to bioinvasions that can follow the substantial anthropogenic disturbance found in many wetlands (Zedler & Kercher, 2004; Brinson

& Malvarez, 2002; Mills et al., 1993).

Detection is the first step in understanding biological invasions. Introductions of non- native species (so-called blatant introductions; Lee, 2002) are normally easy to identify in the local flora from which they were previously absent. In contrast, introduced non-native lineages of native species (so-called cryptic introductions; Geller et.al. 2010) are normally much harder to detect because there is often high morphological similarity between native and introduced conspecific lineages. Cryptic introductions may therefore remain undetected for long periods of time and their consequences are likely underestimated worldwide (Blakeslee et al., 2008). While both blatant and cryptic introductions of genotypes can directly lead to invasions, each may also lead to invasions following intraspecific admixture and/or interspecific hybridization and the formation of novel recombinant genotypes (Schaal et al., 2003); indeed, hybridization and admixture are now recognized as important drivers in the evolution of invasiveness (Wolfe et al.,

2007; Wares et al., 2005). Cryptic introductions of conspecific non-native lineages have been previously documented in aquatic plants (Ciotir et al., 2013; Plut et al., 2011), although the frequency of such events across taxa is unknown. An improved understanding of the phylogeographic patterns of global aquatic plants would illuminate evolutionary histories while potentially identifying non-native lineages across the globe.

Cattails (Typha spp. (L)) are perennial semi-aquatic plants that are important components of wetland and marsh ecosystems in temperate and tropical regions of the northern and southern hemispheres, occurring in all major land masses except Greenland and Antarctica (Kim & Choi,

2011; Smith, 2000; Grace & Harrison, 1986). The three most widely distributed species, T.

143

angustifolia (narrow-leaf cattail), T. domingensis (southern cattail) and T. latifolia (broad-leaf cattail), have in recent decades become increasingly dominant in many parts of the world

(Parsons & Cumbertson, 2001; Galatowitsch et. al., 1999; Miao & Sklar, 1998; Grace &

Harrison, 1986). Although the three species are partially sympatric (Figure 6.1, 6.2 and 6.3), their latitudinal and altitudinal limits vary. Typha angustifolia reaches its northern limit around

51°N, and grows throughout temperate North America and Eurasia (Stevens & Hoag, 2000;

Smith, 2000; Grace & Harrison, 1986) at elevations up to 2000m (Hickman, 1993). It was introduced into North America and Australia (Ciotir et al., 2013; AVH, 2013), and is considered invasive in parts of North America (Galatowitsch et al., 1999). Typha domingensis is limited to the pantropical latitudes of Eurasia, North, Central and South America, southern Pacific Islands,

New Zealand, and Australia (Gupta, 2013; Smith, 2000; Briggs, 1987; Paczkowska, 1994), reaching its limits at around 40°N (Smith, 2000) and 1500m in altitude (Stevens & Hoag, 2006;

Vibrans, 2004; Hickman, 1993). It is considered introduced and invasive in Hawaii (USDA-

NRCS, 2014) and, although native to central and southern North America, is considered invasive in the Florida Everglades (Miao & Sklar, 1998) and California (Smith, 1967). Typha latifolia is more widely distributed, and tolerates more northerly latitudes and higher altitudes (up to 2300 m) than the other two species (Smith, 2000; Grace & Harrison, 1996). T. latifolia has a native range in temperate latitudes of Europe (USDA-ARS, 2005), North America (Sawada et al., 2003,

Smith, 2000), Africa (Geze, 1912) and Asia (Kun & Simpson, 2010), and has been introduced to

Australia (Parsons & Cumbertson, 2001; Briggs, 1987; Briggs & Johnston, 1968), New Zealand

(Pagad, 2006), Tasmania (Barnard, 1882), and the Caribbean (USDA-ARS, 2005). Australia

(Zedler & Kercher, 2004; Parsons & Cumbertson, 2001), New Zealand (Champion & Clayton,

144

2001), Tasmania (Parsons & Cumbertson, 2001), and Hawaii (HISC, 2013) consider T. latifolia an invasive species.

Intercontinental dispersal of Typha spp. has promoted the invasion of wetlands. As noted above, blatant introductions to multiple countries have led to biological invasions by Typha spp.

In addition, in North America the hybrid (T. x glauca) of introduced T. angustifolia and native T. latifolia is considered invasive in the Great Lakes and St. Lawrence Seaway regions of North

America (Freeland et al., 2013; Ciotir et al., 2013; Larkin et al., 2012; Travis et al., 2010;

Tuchman et al., 2009). However, it is unclear whether interspecific hybridization or intraspecific admixture is contributing to increasingly dominant Typha spp. in other parts of the world.

Before we can answer this question, we must first quantify the extent to which non-native species or lineages have been introduced into novel geographic areas. The goal of this study was therefore to elucidate phylogeographic patterns in T. angustifolia, T. domingensis, and T. latifolia, thereby obtaining insight into the evolutionary history and the frequency of intercontinental dispersal in each species. Evidence of long-distance dispersal and cryptic introduction could represent an important step in understanding the growing threats to wetlands around the world.

Material and methods

Sampling, DNA extraction, and DNA sequencing

This study was based on T. angustifolia, T. latifolia, and T. domingensis sequences from two sources. The first source was 55 samples collected specifically for this study from North

America, Europe, and Africa between 2007 and 2013, from which we identified 29 novel haplotypes (see below). The second source was 38 sequences previously published by Kim &

Choi (2011) which comprise 21 unique haplotypes. In addition, we obtained from Kim & Choi

145

(2011) 22 haplotypes from six additional Typha spp., and five haplotypes from five Sparganium spp. for use as outgroups in our phylogenetic analyses (see below). Sample locations and species identities are provided in Figure 6.1, 6.2 and 6.3, and Appendix 6.1. For the newly acquired sequences, a leaf tip of approximately 2cm from each sampled plant was dried in a bag of silica beads (Fisher Scientific), and stored at -20°C on return to the lab. Dried plant material was ground in a mixer mill (Retsch MM300; Retsch, Newtown, Pennsylvania, USA), and genomic

DNA was extracted from 10-30 mg dried tissue per plant using the E.Z.N.A spin column DNA plant mini kits (Omega Bio-Tek, Georgia, USA), eluted into a final volume of 100 µL.

From each collected sample, three chloroplast DNA (cpDNA) regions were amplified: trnL-trnF

(trnL gene, trnL intron, and trnL-F intergenic spacer), trnC-petN (intergenic spacer), and psbM- trnD (intergenic spacer). The trnL-trnF region was amplified using the primers ‘c’ and ‘f’ described in Taberlet et al. (1991). The trnC-petN and psbM-trnD regions were amplified using primers developed by Kim & Choi (2011). Each PCR reaction included 1 x Taq reaction buffer

(UBI Life Sciences), 2 mM MgSO4, 0.2 mM dNTPs, 20 µM each primer, 2.5U HP Taq (UBI

Life Sciences), 1.2 µL (100 %) of BSA, and approximately 10 ng DNA in a total volume of 25

µL. PCR reactions were performed in a Mastercycler epgradient thermal cycler (Eppendorf)

(Table 6.1), and PCR products were purified by incubating with 10U exonuclease I and 2U shrimp alkaline phosphatase (Fermentas International, Inc.) for 15 minutes at 15°C followed by

15 minutes at 80°C. Purified products were sequenced in both directions using a BigDye

Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, USA).

Sequencing reactions were carried out on a DNA Analyser 3730xl ABI (Applied Biosystems).

146

Sequence alignments and data analysis

Novel sequences were assembled and edited in Seqman (DNASTAR LaserGene 5,

Madison, WI, USA), and aligned with the previously published Typha and Sparganium sequences (GenBank Accession Nos. GU646680- GU646771; JF319445–JF319659; Kim &

Choi, 2011). The genus Sparganium was chosen as the outgroup because it is the closest sister group to the genus Typha (Bremer, 2000). All sequences were imported into BioEdit software

(Hall, 1999). Each region was aligned using CLUSTALW (Thompson et al., 1994) with subsequent manual adjustments, based on 30 sequences of each chloroplast region from T. angustifolia, 12 from T. domingensis, and 51 from T. latifolia. The three cpDNA regions were then appended in a single 3147 bp alignment. Duplicate sequences were removed, leaving 9 haplotypes from T. angustifolia (2 novel and 7 from Kim & Choi, 2011), 9 haplotypes from T. domingensis (5 novel and 4 from Kim & Choi, 2011) and 32 haplotypes from T. latifolia (22 novel and 10 from Kim & Choi, 2011). Phylogenetic analyses were performed on these haplotypes plus an additional 27 unique haplotypes from T. capensis, T. elephantina, T. laxmanni, T. minima, T. shuttleworthii, T. orientalis and the outgroup Sparganium (Appendix

6.1).

Bayesian inference was used to reconstruct the global phylogeny of Typha spp. in

MRBAYES ver. 3.2 (Huelsenbeck & Ronquist, 2001). Three Bayesian runs were generated with independent partitions for trnL-trnF, trnC-petN, and psbM-trnD according to their alignment lengths and models. The default prior and likelihood settings were used for all parameters except for the nucleotide substitution models which were set to models corresponding to each DNA region (Table 6.2). Models of nucleotide sequence substitution were generated by MrModeltest ver. 2.3 based on all variable sites and the good fit of Akaike Information Criterion (AIC)

(Nylander, 2004). Substitution model parameters and rates of substitution were allowed to vary 147

across partitions using ratepr = variable and the ‘unlink’ command. MCMC chain analyses were run for up to 50,000,000 iterations, sampling trees once every1000 iterations. Convergence of the four Markov chains and assessment of ‘burn-in’ values were determined by examining the average standard deviation of split frequencies and by plotting the likelihood values against the number of generations on a linear regression graph. Using a burnin value of 10% of the total number of trees, we generated the consensus tree and posterior probability values. Multiple output files were examined to assess the convergence between samples in Tracer ver.1.5.

(Rambaut & Drummond, 2008). The consensus trees were visualized in FigTree ver.1.3.1.

(Drummond & Rambaut, 2007).

Appended alignments of all sequences (i.e. duplicates were returned) of T. angustifolia,

T. domingensis, and T. latifolia were each used to generate two types of parsimony networks in

TCS ver. 1.21 (Clement et al., 2000). The analyses were set with 95% statistical parsimony and gaps as the fifth state (Templeton et al., 1992). For each species, the first network included sequences that comprised repetitive regions (microsatellites and minisatellites), and each indel was replaced with one nucleotide base, thus coding each indel as a single mutation. In the second network for each species, the repetitive regions were excluded in order to assess the potential influences of homoplasy, which is higher in repetitive sequences, and of recent mutations, which should accumulate more rapidly in repetitive regions owing to their relatively high mutation rate

(Vachon & Freeland, 2011; Freeland &Vachon, 2012).

Results

Phylogeny

The Bayesian 50% majority rule consensus tree reconstructed T. angustifolia and T. domingensis as paraphyletic species and T. latifolia as a monophyletic species (Figure 6.4).

148

Typha angustifolia is divided into one clade that comprises multiple lineages, plus one divergent haplotype (E4/N1). The former has two clusters: one with three Asian haplotypes, one North

American haplotype, and one haplotype that is dispersed across multiple continents, and the second with two European and one Asian haplotype. The divergent haplotype of T. angustifolia

(E4/N1) groups with T. capensis, T. elephantina and T. domingensis, and its nearest neighbour is

T. capensis. These relationships are supported in all analyses by high posterior probability values

(pp: 0.71-1). Two haplotypes are shared between continents: one between North America and

Europe (E4/N1), and the other between Asia, Europe, North America, and Australia

(A1/E1/N3/Au). In T. domingensis, two basal lineages represented by one North American haplotype (N3) and one haplotype shared between Africa and North America (Af2/N2) are intermediate to T. elephantina and the remaining T. domingensis sequences, which form a single clade comprising haplotypes from Asia, Africa, Europe and North America. The T. domingensis topology is supported by high posterior probability values (pp: 0.93-0.99). Two haplotypes are shared between continents: one between Europe and Australia (E4/Au) and the other between

Africa and North America (Af2/N2). For T. latifolia, the phylogeny recovered a single monophyletic clade with one Eurasian subclade that includes relatively young haplotypes from

Asia and eastern Europe, and one unresolved basal polytomy comprising haplotypes from western Europe, North America, and Australia (Figure 6.4). All relationships within T. latifolia were supported by high posterior probability values (pp: 0.99-1). Two haplotypes were shared between continents: one between North America and Australia (N2/Au), and the other between

North America and Europe (E9/N1). All relationships within T. latifolia are supported by high posterior probability values (pp: 0.99-1).

149

Networks

In T. angustifolia, the network with repetitive sequences included was based on nine haplotypes (Figure 6.5A). Seven of these were each found in only one continent: four in Asia

(A2-A5), one in North America (N2), and two in Europe (E2-E3). As noted earlier, two haplotypes were shared between continents. The divergent haplotype E4/N1, which rendered T. angustifolia paraphyletic in the phylogenetic tree, is separated from its closest neighbour by 14 mutations (Figure 6.5A). The network from which the repetitive sequences were excluded was based on only five haplotypes because two Asian and one shared haplotype were collapsed to a single haplotype (A1/A3/A5/E1/N3/Au), and two of the European haplotypes plus one Asian haplotype similarly become one haplotype (E2/E3/A4). The number of mutations between E4/N1 and its closest neighbour was reduced from 14 to 9 (Figure 6.5B).

In T. domingensis, the network with repetitive regions included was based on nine haplotypes (Figure 6.6A). Seven haplotypes were each found on a single continent: Asia (A1),

Africa (Af1), Europe (E1-E3) and North America (N1, N3) (Figure 6.6A). As noted earlier, two haplotypes were shared between continents. The network from which repetitive regions were excluded was based on seven haplotypes because haplotype A1 and Af1 collapsed into A1/Af1 and haplotypes E1 and E2 collapsed into E1/E2 (Figure 6.6B). The distances between the three most divergent haplotypes (N3, Af2/N2, E4/Au) and their nearest neighbours remained unchanged.

In T. latifolia, the network that included repetitive sequences was based on 32 haplotypes

(Figure 6.7A). There were two main groups of haplotypes separated from each other by 9 mutations: one North American-western European group and one Asian - eastern European group (Appendix 6.1; Figure 6.7A). As noted earlier, two haplotypes were shared between continents. In the network with repetitive sequences removed, the number of haplotypes was 150

reduced from 32 to 26. Haplotypes N3, N8, N11, N14 and N2/Au collapsed to a single haplotype, and all the Asian haplotypes collapsed to a single haplotype A*. Whereas in Figure

6.6A the eastern European haplotypes appear to have descended from Asian haplotypes, Figure

6.6B shows an eastern European haplotype (E6) that is intermediate to Asia and western Europe.

Most of the European haplotypes, including the shared haplotype E9/N1, remained distinct

(Figure 6.7B). The relatively large number of mutations separating the NA-European and

Eurasian clusters is lost, and the two haplotype clusters were essentially reduced to one group, although most haplotypes were from the same continent as most of their nearest neighbours

(Figure 6.7B).

Discussion

Although globally distributed species are among those that are most likely to become invasive due to their high dispersal and colonising capacity (Nikulina et al., 2007), global movements are often underestimated due to cryptic invasions (Lavoie et al., 1999; Geller et al.,

2010). In this study, we inferred the phylogenetic and phylogeographic relationships within and among three widely distributed cattail species, thereby gaining insight into the evolutionary diversification and intercontinental movements of T. angustifolia, T. domingensis, and T. latifolia.

Typha angustifolia

Our results clearly show that T. angustifolia is paraphyletic, with one divergent haplotype

(E4/N1) more closely related to T. domingensis, T. capensis and T. elephantina than to its conspecific lineages. This could be explained by ancient interspecific hybridization with T. capensis, and subsequent introgression of the chloroplast genome. Previous examples of introgression following ancient hybridization have been found in diverse taxa (Gross &

151

Rieseberg, 2005; Klymus et al., 2010). Alternatively, haplotype E4/N1 may belong to a cryptic species that closely resembles T. angustifolia. Paraphyly and cryptic species have often been identified from molecular data in taxa with cosmopolitan distributions (e.g. Nikulina et al., 2007;

Bickford et al., 2007; Lemmon et al., 2007). Further investigation is necessary before we can explain this highly divergent haplotype.

The substantial divergence between haplotype E4/N1 and the remaining T. angustifolia haplotypes is also supported by the networks, even after the removal of the relatively rapidly evolving repetitive regions (Figure 6.5A & 6.5B), which means that the divergence between these haplotypes was unlikely to be a recent occurrence (Vachon & Freeland, 2011). The remaining T. angustifolia haplotypes comprise closely related Asian, European and North

American haplotypes. After the removal of repetitive sequences only four haplotypes remained, suggesting that considerable diversification within T. angustifolia occurred relatively recently.

Multiple intercontinental movements have occurred. Typha angustifolia is not native to North

America (Ciotir et al., 2013), and the three haplotypes that were found in North America (N2,

E4/N1, A1/E1/N3/Au) are sufficiently divergent to represent at least two independent introductions, most likely from Eurasia (Figure 6.5A), which would mean that 3/9 haplotypes had been dispersed between continents (33%). One of the haplotypes introduced into North

America (A1/E1/N3/Au) seems also to have been cryptically introduced from Asia to Europe, where T. angustifolia is considered native (Geze, 1912; Cirujano, 2008), because it is embedded within the predominantly Asian cluster (Figure 6.5A). That same haplotype (A1/E1/N3/Au) was also blatantly introduced into Australia, where T. angustifolia was first recorded in 1943 (AVH,

2013). Our data collectively suggest recent diversification and multiple intercontinental dispersal events in T. angustifolia, leading to a clade of widespread, closely related haplotypes, plus a

152

single, highly divergent haplotype that requires further investigation. Introduced lineages and subsequent admixture or hybridization could help to explain why T. angustifolia is invasive in

North America (Travis et al., 2010; Grace & Harrison, 1986), and the cryptic long-distance movements that have occurred between several continents suggest that managers around the world should monitor this species for increasingly invasive tendencies.

Typha domingensis

Typha domingensis is paraphyletic, with one North American (N3) and one North

American/African (Af2/N2) haplotype marginally more closely related to T. elephantina than to the remaining T. domingensis haplotypes, which formed a monophyletic clade (Figure 6.4). The proximity of the paraphyletic clades to one another suggests that this pattern may be explained by incomplete lineage sorting following speciation. In the network that included repetitive regions, haplotypes N3 and Af2/N2, plus the third basal haplotype (E4/Au), were separated by substantial genetic distances from the remaining haplotypes (Figure 6.6A). The removal of the repetitive regions did not reduce the genetic distances involving the three most divergent haplotypes, and eliminated only two of the more recently diverged haplotypes (Figure 6.6B). The networks therefore suggest relatively ancient diversification of T. domingensis, plus relatively recent intercontinental movement based on the occurrence of an identical haplotype in both

North America and Africa (Af2/N2), and another in both Europe and Australia (E4/Au). In addition, although the ambiguous continental phylogeographic structure precludes the determination of haplotype origins, the divergence between haplotypes N1 and N3 means that at least one of these haplotypes was introduced into North America (Figure 6.6A & 6.6B); therefore, 3/9 haplotypes (33%) have been dispersed between continents. Typha domingensis is introduced and invasive in Hawaii (HISC, 2013), and invasive in Florida (Zedler & Kercher,

153

2004), southern California (Beare & Zedler, 1987), and Costa Rica (Osland et al., 2011). The multiple intercontinental movements of T. domingensis that we have identified suggest the possibility of future introductions – possibly leading to invasions – of this species.

Typha latifolia

The T. latifolia haplotypes identified a single monophyletic clade with continental phylogeographic structuring. A Eurasian subclade, represented by Asian and eastern European haplotypes, is nested within a basal polytomy of North American and western European haplotypes (Figure 6.4). The continental phylogeographic structuring is even more evident in the networks. The network with repetitive regions shows a distinct separation between two clusters:

Asia and eastern Europe versus North America and western Europe (Figure 6.7A). The latter cluster identifies North America as the most likely source of Australian T. latifolia, where it is considered an introduced and invasive species (Smith, 2000; ISSG, 2006; Parsons &

Cuthbertson, 2001). Once repetitive regions were removed, only one Asian haplotype was maintained and half of the North American haplotypes were subsumed (Figure 6.7B), suggesting recent diversification within each of those two continents, particularly Asia. An earlier study based on microsatellite data suggested that T. latifolia may have colonized Europe from North

America (Ciotir et al., 2013). In this study we sampled from a broader geographical range, and our results show two clusters: North America/eastern Europe, and Asia/western Europe (Figure

6.4 & Figure 6.7A). This pattern suggests dual colonization of Europe by T. latifolia: once from

Asia into eastern Europe, and once from North America into western Europe. Although the removal of repetitive sequences results in a loss of some resolution from the haplotype network, most haplotypes were from the same continent as most of their nearest neighbours, suggesting a relatively ancient endemism of haplotypes to continents. Furthermore, our data identify fewer

154

intercontinental dispersal events by T. latifolia compared to T. domingensis and T. angustifolia, as only 2/32 (6%) of T. latifolia haplotypes showed clear evidence of intercontinental dispersal, each occurring on more than one continent.

Conclusions

Collectively, our data reveal that continental diversification, intercontinental movement, and possibly ancient hybridization events have shaped the evolutionary and phylogeographic histories of T. angustifolia, T. domingensis, and T. latifolia. Typha angustifolia and T. domingensis are each paraphyletic, and each has limited phylogeographic structuring despite broad intercontinental distributions. A comparison with and without repetitive sequences suggests that lineages from each of these species represent a combination of relatively old and more recent divergence, and both recently and more historically diverged haplotypes now exhibit widespread intercontinental distributions. However, the paraphyletic split within T. angustifolia is much older than that within T. domingensis and, as noted earlier, the taxonomic status of the highly divergent T. angustifolia haplotype should be further investigated. In contrast, T. latifolia is monophyletic, has clearer phylogeographic structuring than the other two species, and has a much smaller proportion of haplotypes that exist on multiple continents. It is unknown whether this latter observation reflects relatively few intercontinental movements, or a relatively high degree of specialization and hence reduced ability of T. latifolia lineages to adapt to new environmental conditions. The clearer phylogenetic signals in T. latifolia may also have arisen because it has the most northerly distribution of the three species, and was therefore most likely to have been influenced throughout the glacial-interglacial cycles by range contractions and expansions that were likely associated with repeated bottlenecks and hence relatively rapid sorting of haplotypes within and among continents. Historically, Europe appears to have been

155

colonized by T. latifolia following two separate pathways: into the east via Asia, and into the west via North America.

Wetlands are particularly susceptible to biological invasions, including invasions by

Typha spp. (Zedler & Kercher, 2004; Brinson & Malvarez, 2002; Galatowitsch et al., 1999;

Mills et al., 1993). Hybrids and novel intraspecific admixtures have been repeatedly implicated in biological invasions (Schierenbeck & Ellstrand, 2009), including invasions by the hybrid

Typha x glauca (Freeland et al., 2013). Our study has identified numerous long-distance dispersal events and the introduction of non-native Typha lineages into multiple sites around the globe, and these events represent a potential threat to wetlands on several continents. Typha spp. can disperse as either seeds or rhizome fragments. In addition, they are sold for ornamental purposes in plant nurseries around the world, and non-native lineages from nurseries may also be planted during wetland restoration projects. The repeated dispersal of Typha spp. within and between continents is therefore likely attributable to a combination of accidental and deliberate introductions.

Acknowledgements

We are very grateful to Serena Caplins, Jennifer Coughlan, Sarah Dungan, Nicole

Vachon, Morgan Wehtje, Stan Yavno and Drs. Walter Wehtje, Heather Kirk, Chris Yesson and

Jonathan Mitchley for providing cattail samples during their field trips in North America, Europe and Africa. We are grateful to Dr. Jonathan Mitchley who provided shelter, transportation and logistics during the fieldtrip in UK and Europe. Special thanks to Dr. Chris Yesson for his contribution to the global map distributions, and for insightful biogeographic and phylogenetic advice. Many thanks to the Jack Matthews international scholarship at Trent University for

156

covering the costs of the European field trip. This study was funded by the Natural Sciences and

Engineering Council (NSERC), and Trent University.

References

AVH: Australia’s Virtual Herbarium. Available at: http://avh.chah.org.au. (Accessed on August

12, 2013).

Barnard J. 1882. Economic value of the aquatic plant Typha latifolia. Papers and Proceedings of

the Royal Society of Tasmania 163 -167.

Beare PA, Zedler JB. 1987. Cattail Invasion and Persistence in a Coastal Salt-Marsh - the Role

of Salinity Reduction. Estuaries 10: 165-170.

Beheregaray LB. 2008. Twenty years of phylogeography: the state of the field and the challenges

for the Southern Hemisphere. Molecular Ecology 17: 3754-3774.

Bickford D, Lohman DJ, Sodhi NS, Ng PKL, Meier R, Winker K, Ingram KK, Das I. 2007.

Cryptic species as a window on diversity and conservation. Trends in Ecology &

Evolution, 22, 148-155.

Blakeslee AMH, Byers JE, Lesser MP. 2008. Solving cryptogenic histories using host and

parasite molecular genetics: the resolution of Littorina littorea's North American origin.

Molecular Ecology, 17, 3684-3696.

Bremer K. 2000. Early Cretaceous lineages of monocot flowering plants. Proceedings of the

National Academy of Sciences of the United States of America, 97, 4707-4711.

Briggs BG, Johnston, L.A.S. 1968. The status and relationships of the Australian species of

Typha. Contr. New South Wales National. Herbarium, 4 (2), 57-78.

Briggs BG. 1987. Flora of Australia Online eds. Available at:

http://www.anbg.gov.au/abrs/online-resources/flora (Accessed June15, 2013).

157

Brinson MM, Malvarez AI. 2002. Temperate freshwater wetlands: types, status, and threats.

Environmental Conservation, 29, 115-133.

Champion PDC, Clayton, J.S. 2001. Border control for potential aquatic weeds. Stage 2. Weed

risk assessment. In: (ed. Department of Conservation, Wellington, New Zealand), 185,

pp. 1-30. Department of Conservation Science Publishing, Science & Research Unit.

Chen JM, Du ZY, Sun SS, Gituru RW, Wang QF. 2013. Chloroplast DNA phylogeography

reveals repeated range expansion in a widespread aquatic Herb Hippuris vulgaris in the

Qinghai-Tibetan plateau and adjacent areas. PLOS One, 8.

Chun YJ. 2011. Phenotypic plasticity of introduced versus native purple loosestrife: univariate

and multivariate reaction norm approaches. Biological Invasions, 13, 819-829.

Ciotir C, Kirk H, Row JR, Freeland JR. 2013. Intercontinental dispersal of Typha angustifolia

and T. latifolia between Europe and North America has implications for Typha invasions.

Biological Invasions, 15, 1377-1390.

Cirujano S. 2002. Typhaceae. In Flora Iberica. Edited by S.C. Bolibar. Real Jardín Botánico,

CSIC, Madrid. 18, pp. 259-266.

Clement M, Posada D, Crandall KA. 2000. TCS: a computer program to estimate gene

genealogies. Molecular Ecology, 9, 1657-1659.

Dorken ME and Barrett SCH. 2004. Chloroplast haplotype variation among monoecious and

dioecious populations of Sagittaria latifolia (Alismataceae) in eastern North America.

Molecular Ecology 13: 2699-2707

Drummond AJ, Rambaut A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees.

Bmc Evolutionary Biology, 7, 8.

158

Freeland J, Ciotir C, Kirk H. 2013. Regional differences in the abundance of native, introduced,

and hybrid Typha spp. in northeastern North America influence wetland invasions.

Biological Invasions, 15, 2651-2665.

Freeland J, Vachon N. 2012. Repetitive sequences in phylogeographic inference: a reply to

Saltonstall and Lambertini (2012). Molecular Ecology Resources, 12, 586-589.

Galatowitsch SM, Anderson NO, Ascher PD. 1999. Invasiveness in wetland plants in temperate

North America. Wetlands, 19, 733-755.

Geller JB, Darling JA, Carlton JT. 2010. Genetic Perspectives on Marine Biological Invasions.

Annual Review of Marine Science, 2:367-393.

Geze JB. 1912. Etudes Botanique et Agronomique sur les Typha et quelques autre plantes

palustres. Societe Anonyme D'Imprimerie de Villefranche-de-Rouergue.

Global Invasive Species Database (ISSG). 2006. Typha latifolia. Available at:

http://www.issg.org/database/species/ecology.asp?si=895&fr=1&sts=&lang=EN

Grace JB, Harrison JS. 1986. The Biology of Canadian Weeds .73. Typha latifolia L, Typha

angustifolia L. and Typha x glauca Godr. Canadian Journal of Plant Science, 66, 361-

379.

Gross BL, Rieseberg LH. 2005. The ecological genetics of homoploid hybrid speciation. Journal

of Heredity, 96, 241-252.

Gupta AK. 2013. Typha domingensis. In: IUCN 2013. IUCN Red List of Threatened Species

version 2013.1. www.iucnredlist.org. (Accessed on 12 August 2013).

Hall, T.A. 1999. BioEdit: a user friendly biological sequence alignment editor and analysis

program for Windows 95/98NT. Nucleic Acids Symposium 41, 95-98.

159

Hawaii Invasive Species Council (HISC) Available at:

http://www.hawaiiinvasivespecies.org/pests/cattail.html. (Accessed on August 12, 2013).

Hickerson MJ, Carstens BC, Cavender-Bares J, Crandall KA, Graham CH, Johnson JB, Rissler

L, Victoriano PF, Yoder AD. 2010. Phylogeography's past, present, and future: 10 years

after Avise, 2000. Molecular Phylogenetics and Evolution, 54, 291-301.

Hickman JC. 1993. The Jepson manual. Higher plants of California. University of California

Press. 1399 pp.

Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees.

Bioinformatics, 17, 754-755.

Khanna S, Santos MJ, Hestir EL, Ustin SL. 2012. Plant community dynamics relative to the

changing distribution of a highly invasive species, Eichhornia crassipes: a remote

sensing perspective. Biological Invasions, 14, 717-733.

Kim C, Choi HK. 2011. Molecular systematics and character evolution of Typha (Typhaceae)

inferred from nuclear and plastid DNA sequence data. Taxon, 60, 1417-1428.

Kirk H, Paul J, Straka J, Freeland JR. 2011. Long-Distance Dispersal and High Genetic Diversity

Are Implicated in the Invasive Spread of the Common Reed, Phragmites australis

(Poaceae), in Northeastern North America. American Journal of Botany, 98, 1180-1190.

Klymus KE, Humfeld SC, Marshall VT, Cannatella D, Gerhardt HC. 2010. Molecular patterns of

differentiation in canyon treefrogs (Hyla arenicolor): evidence for introgressive

hybridization with the Arizona treefrog (H. wrightorum) and correlations with

advertisement call differences. Journal of Evolutionary Biology, 23, 1425-1435.

160

Kun, S, Simpson, D. 2010. Flora of China, Typhaceae, 23, 161-163. Available at:

http://flora.huh.harvard.edu/china/mss/volume23/Flora_of_China_Vol_23_Typhaceae.pd

f (Accessed on January 07, 2014).

Larkin DJ, Freyman MJ, Lishawa SC, Geddes P, Tuchman NC. 2012. Mechanisms of dominance

by the invasive hybrid cattail Typha x glauca. Biological Invasions, 14, 65-77.

Lavoie DM, Smith LD, Ruiz GM. 1999. The potential for intracoastal transfer of non-indigenous

species in the ballast water of ships. Estuarine Coastal and Shelf Science, 48, 551-564.

Lee CE. 2002. Evolutionary genetics of invasive species. Trends in Ecology & Evolution, 17,

386-391.

Lemmon EM, Lemmon AR, Collins JT, Lee-Yaw JA, Cannatella DC. 2007. Phylogeny-based

delimitation of species boundaries and contact zones in the trilling chorus frogs

(Pseudacris). Molecular Phylogenetics and Evolution, 44, 1068-1082.

Miao SL, Sklar FH. 1998. Biomass and nutrient allocation of sawgrass and cattail along a

nutrient gradient in the Florida Everglades. Wetlands Ecol. Manage. 5: 245–263.

Mills EL, Leach JH, Carlton JT, and Secor CL. 1993. Exotic species in the Great-Lakes - a

history of biotic crises and anthropogenic introductions. Journal of Great Lakes

Research, 19, 1-54.

Nikulina EA, Hanel R, Schafer P. 2007. Cryptic speciation and paraphyly in the cosmopolitan

bryozoan Electra pilosa - Impact of the Tethys closing on species evolution. Molecular

Phylogenetics and Evolution, 45, 765-776.

Nylander JA. 2004. MrModelTest, version 2.3. Evolutionary Biology Centre, Uppsala

University, Uppsala, Sweden. Available at: https://github.com/nylander/MrModeltest2

161

Osland MJ, Gonzalez E, Richardson CJ. 2011. Restoring diversity after cattail expansion:

disturbance, resilience, and seasonality in a tropical dry wetland. Ecological Applications,

21, 715-728.

Paczkowska G. 1994. Typha domingensis in Western Australian Herbarium (1998–).

FloraBase—the Western Australian Flora. Department of Parks and Wildlife eds.

Available at: http://florabase.dpaw.wa.gov.au/

Parsons WT, Cuthbertson EG. 2001. Family Typhaceae. Noxious Weeds of Australia (ed. by

Csiro), pp. 145 -149. CSIRO Publishing.

Plut K, Paul J, Ciotir C, Major M, Freeland JR. 2011. Origin of non-native Phragmites australis

in North America, a common wetland invader. Fundamental and Applied Limnology,

179, 121-129.

Rambaut A, Drummond AJ. 2008. Tracer version 1.5. Available at:

http://tree.bio.ed.ac.uk/software/tracer/

Sawada M, Viau AE, Gajewski K. 2003. The biogeography of aquatic macrophytes in North

America since the last glacial maximum. Journal of Biogeography, 30, 999-1017.

Schierenbeck KA, Ellstrand NC. 2009. Hybridization and the evolution of invasiveness in plants

and other organisms. Biological Invasions, 11, 1093-1105.

Sersic AN, Cosacov A, Cocucci AA, Johnson LA, Pozner R, Avila LJ, Sites JW, Morando M.

2011. Emerging phylogeographical patterns of plants and terrestrial vertebrates from

Patagonia. Biological Journal of the Linnean Society, 103, 475-494.

Smith SG. 1967. Experimental and natural hybrids in North American Typha (Typhaceae).

American Midland Naturalist, 78, 257-287.

162

Smith SG. 2000. Typhaceae A. L. Jussieu. – In: Flora of North America. Editorial Committee

eds: Flora of North America North of Mexico, 22: Magnoliophyta: Alismatidae Arecidae,

Commelinidae (in Part), and Zingiberidae. – New York and Oxford. Online version,

Available at: http://www.efloras.org/florataxon.aspx?flora_id=1&taxon_id=10926

(Accessed on August 10, 2013).

Stevens M, Hoag C. 2000. USDA-NRCS Plant Guide, Narrow leaf cattail, Typha angustifolia L.,

National Plant Data Center and Idaho Plant Materials Center. Available at:

http://plants.usda.gov/plantguide/pdf/cs_tyan.pdf. (Accessed on June 25, 2013).

Stevens M, Hoag C. 2006. USDA- NRCS Plant Guide, Southern cattail, Typha domingensis

Pers., National Plant Data Center and Idaho Plant Materials Center. Available at:

http://plants.usda.gov/plantguide/pdf/cs_tydo.pdf. (Accessed on August 11, 2013).

Taberlet P, Fumagalli L, Wust-Saucy AG, Cosson JF. 1998. Universal primers for amplification

of three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17, 1105-

1109.

Templeton AR, Crandall KA, Sing CF. 1992. A cladistic-analysis of phenotypic associations

with haplotypes inferred from restriction endonuclease mapping and DNA-sequence data

.3. Cladogram estimation. Genetics, 132, 619-633.

Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal-W - Improving the sensitivity of

progressive multiple sequence alignment through sequence weighting, position-specific

gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673-4680.

Travis SE, Marburger JE, Windels S, Kubatova B. 2010. Hybridization dynamics of invasive

cattail (Typhaceae) stands in the Western Great Lakes Region of North America: a

molecular analysis. Journal of Ecology, 98, 7-16.

163

Tuchman NC, Larkin DJ, Geddes P, Wildova R, Jankowski K, Goldberg DE. 2009. Patterns of

environmental change associated with Typha x glauca Invasion in a Great Lakes coastal

wetland. Wetlands, 29, 964-975.

USDA-ARS. 2005. National Genetic Resources Program. Typha latifolia L. Germplasm

Resources Information Network - (GRIN) [Online Database]. National Germplasm

Resources Laboratory, Beltsville, Maryland. Available at: http://www.ars-grin.gov2/cgi-

bin/npgs/html/taxon.pl?101629 (Accessed on January 09, 2014).

USDA-NRCS. 2014. The PLANTS Database. Baton Rouge, USA: National Plant Data Center.

Available at: http://plants.usda.gov/core/profile?symbol=TYDO&mapType=nativity,

http://plants.usda.gov/ (Accessed on January 1st, 2014).

Vachon N, Freeland JR. 2011. Phylogeographic inferences from chloroplast DNA: quantifying

the effects of mutations in repetitive and non-repetitive sequences. Molecular Ecology

Resources, 11, 279-285.

Vibrans H. 2004. Malezas de México (on-line resource). Available at:

http://www.conabio.gob.mx/malezasdemexico/typhaceae/typha-

domingensis/fichas/pagina1.htm (Accessed on June15, 2013).

Wares JP, Hughes AR, Grosberg RK. 2005. Mechanisms that drive evolutionary change: insights

from species introductions and invasions. In Sax DF, Stachowicz JJ, Gaines SD, eds,

Species Invasions: Insights into Ecology, Evolution, and Biogeography. Sinauer

Associates: Sunderland, Massachusetts.

WCSP 2012. World Checklist of Selected Plant Families. Facilitated by the Royal Botanic

Gardens, Kew. Available at: http://apps.kew.org/wcsp/ Retrieved

164

http://apps.kew.org/wcsp/qsearch.do;jsessionid=283D2A09C393D2E8236F3EC6ED30D

AA4, (Accessed on September 5, 2012).

Wolfe LM, Blair AC, Penna BM. 2007. Does intraspecific hybridization contribute to the

evolution of invasiveness? an experimental test. Biological Invasions, 9, 515-521.

Zedler JB, Kercher S. 2004. Causes and consequences of invasive plants in wetlands:

Opportunities, opportunists, and outcomes. Critical Reviews in Plant Sciences, 23, 431-

452.

165

Table 6.1 PCR conditions used for amplifying the three cpDNA regions.

Region PCR conditions Initial Denaturation Annealing Extension Final No. of denaturation temp./time temp./time temp./time extension cycles temp./time temp./time trnL-trnF 94°C/120s 94°C/60s 55°C/60s 72°C/120s 72°C/420s 32 trnC-petN 95°C/240s 95°C/60s 59.5°C/60s 72°C/90s 72°C/420s 40 psbM-trnD 94°C/240s 94°C/60s 58°C/60s 72°C/90s 72°C/600s 40

Table 6.2 Best-fit models of nucleotide substitution and alignment length for the three cpDNA regions selected under the AIC.

DNA Region trnL-trnF trnC-petN psbM-trnD Bayesian Analyses Model of substitution GTR+I GTR+G GTR+I Length of the alignment (bp) 1006 1012 1129 Sequence number 77 (72/5) 77(72/5) 77 (ingroup/outgroup) (72/5)

166

Figure 6.1 Map of T. angustifolia indicating the sampling sites represented by black circles and the contemporary distribution areas represented in dark grey. Distribution information from WCSP, 2012; Kim & Choi, 2011; Ciotir et al., 2013.

167

Figure 6.2 Map of T. domingensis indicating the sampling sites represented by black circles and the contemporary distribution areas represented in dark grey. Distribution information from WCSP, 2012; Kim & Choi, 2011.

168

Figure 6.3 Map of T. latifolia indicating the sampling sites represented by black circles and the contemporary distribution areas represented in dark grey. Distribution information from

WCSP, 2012; Kim & Choi, 2011; Ciotir et al., 2013.

169

170

Europe. See Appendix 6.1 for more detailed information on locations.

171

A B

Figure 6.5 TCS networks for T. angustifolia. A) repetitive regions (microsatellites and minisatellites) included, B) repetitive regions excluded. Haplotype labels: A=Asia, E=Europe,

Af=Africa, Au=Australia and N= North America. Haplotypes are coloured according to their actual or inferred origin: white= North America, light grey= Asia, dark grey= Europe.

Haplotypes present in multiple continents are marked with thick line. Sizes of circles are proportional to haplotype frequencies.

172

A B

Figure 6.6 TCS networks for T. domingensis. A) included repetitive regions

(microsatellites and minisatellites) included, B) repetitive regions excluded. Haplotype labels:

A=Asia, E=Europe, Af=Africa, Au=Australia and N= North America. Haplotypes are coloured according to their actual or inferred origin: white= North America, light grey= Asia, dark grey=

Europe. Haplotypes present in multiple continents are marked with thick line. Sizes of circles are proportional to haplotype frequencies.

173

A B

Figure 6.7 TCS networks for T. latifolia: A) included repetitive regions (microsatellites and minisatellites) included, B) repetitive regions excluded. Haplotype labels: A=Asia,

E=Europe, Af=Africa, Au=Australia and N= North America. Haplotypes E4, E5, E6 were from eastern European (east of longitude 13°29.0.4.41", while haplotypes E1, E2, E3, E7, E8 and E9 were from western Europe (west of longitude 13°01.39.15"). Haplotypes are coloured according to their actual or inferred origin: white=North America, light grey=Asia, dark grey=Europe.

Haplotypes present in multiple continents are marked with thick line. Sizes of circles are proportional to haplotype frequencies. Haplotype A* represents the collapsed Asian haplotypes

A1-A7.

174

APPENDIX 6

Appendix 6.1 Haplotype identity of each sequence and the geographic locations from which each haplotype was recovered. Location: Kim & Choi, 20111, Ciotir & Freeland2. Abbreviations:

AB= Alberta, AK= Arkansas, BC= British Columbia, CA= California, Ca= Canada,

GA=Georgia, ID= Idaho, MA=Maine, MT= Montana, NS=Nova Scotia, ON=Ontario, OR=

Oregon, QC=Quebec, NB= New Brunswick, NC= North Carolina, SK=Saskatchewan, VA=

Virginia, WA=Washington. TBC= to be completed.

Haplotypes # seqs. Location Genebank Accession numbers T. angustifolia trnL-trnF trnC-petN psbM-trnD E2 1 EU (Finland) 1 JF319454 JF319604 JF319539 E3 2 EU (Finland) 1 JF319455 JF319605 JF319540 EU Poland) 1 JF319463 JF319613 JF319548 E4/N1 13 EU (UK) 2 TBC TBC TBC EU (UK) 2 TBC TBC TBC EU (France) 2 TBC TBC TBC EU (The TBC TBC TBC Netherlands) 2 NA (Canada,NS) 2 TBC TBC TBC NA (Canada,ON) 2 TBC TBC TBC NA (Canada,QC) 2 TBC TBC TBC NA (Canada,ON) 2 TBC TBC TBC NA (Canada,ON) 2 TBC TBC TBC NA (Canada,QC) 2 TBC TBC TBC NA (Canada,ON) 2 TBC TBC TBC NA (Canada,NB) 2 TBC TBC TBC NA (Canada,QC) 2 TBC TBC TBC N2 1 NA (US,GA) 2 TBC TBC TBC Au/E1/A1/N3 5 Australia1 JF319450 JF319600 JF319535

175

EU (Czech JF319453 JF319603 JF319538 Republic) 1 Japan1 JF319456 JF319606 JF319541 Korea1 JF319460 JF319610 JF319545 US1 JF319465 JF319615 JF319550 A2 1 Asia (China) 1 JF319451 JF319601 JF319536 A3 5 Asia (China) 1 JF319452 JF319602 JF319537 Asia (Korea) 1 JF319457 JF319607 JF319542 Asia (Korea) 1 JF319458 JF319608 JF319543 Asia (Korea) 1 JF319459 JF319609 JF319544 Asia (Russia) 1 JF319464 JF319614 JF319549 A4 1 Asia (Korea) 1 JF319461 JF319611 JF319546 A5 1 Asia (Korea) 1 JF319462 JF319612 JF319547 T. domingensis E1 1 EU (France) 2 TBC TBC TBC E2 1 EU (France) 2 TBC TBC TBC E3 1 EU (Italy) 2 TBC TBC TBC E4/Au 2 EU (Germany)1 JF319472 JF319622 JF319557 Australia1 JF319471 JF319621 JF319556 N1 1 NA (US) 1 JF319473 JF319623 JF319558 N3 1 NA (Mexico)2 TBC TBC TBC Af1 1 Africa (Algeria) 1 JF319470 JF319620 JF319555 Af2/N2 3 Africa (Tanzania)2 TBC TBC TBC NA (Cuba)2 TBC TBC TBC NA (US, NC) 2 TBC TBC TBC A1 1 Asia (Afganistan) 1 JF319469 JF319619 JF319554 T. latifolia E1 1 EU (Finland) 1 JF319480 JF319630 JF319565 E2 1 EU (France) 2 TBC TBC TBC E3 1 EU (UK) 2 TBC TBC TBC E4 1 EU (Romania) 2 TBC TBC TBC E5 1 EU (Romania) 2 TBC TBC TBC E6 1 EU (Romania) 2 TBC TBC TBC E7 1 EU (Italy) 2 TBC TBC TBC E8 2 EU (Italy) 2 TBC TBC TBC EU (Italy) 2 TBC TBC TBC

176

E9/N1 2 EU (Italy) 2 TBC TBC TBC NA (US, MA) TBC TBC TBC Au/N2 2 NA (US) 2 JF319492 JF319642 JF319577 Australia1 JF319477 JF319627 JF319562 N3 11 NA (Canada) 2 TBC TBC TBC NA (Canada, AB) 2 TBC TBC TBC NA (Canada, SK) 2 TBC TBC TBC NA (Canada) 1 JF319478 JF319628 JF319563 NA (US) 1 JF319491 JF319641 JF319576 NA (US) 1 JF319493 JF319643 JF319578 NA (US, NC) 2 TBC TBC TBC NA (US, CA) 2 TBC TBC TBC NA (US, OR) 2 TBC TBC TBC NA (US, WA) 2 TBC TBC TBC NA (US, ID) 2 TBC TBC TBC NA (US, MT) 2 TBC TBC TBC N4 1 NA (Mexico) 1 JF319489 JF319639 JF319574 N5 NA (Canada, NS) 2 TBC TBC TBC N6 NA (Canada,ON) 2 TBC TBC TBC N7 NA(Canada,BC) 2 TBC TBC TBC N8 4 NA (US, NC) 2 TBC TBC TBC NA (US,VA) 2 TBC TBC TBC NA (US,GA) 2 TBC TBC TBC NA (US,CA) 2 TBC TBC TBC N9 1 NA(US,AK) 2 TBC TBC TBC N10 1 NA(Canada,NB) 2 TBC TBC TBC N11 1 NA (US, SC) 2 TBC TBC TBC N12 1 NA(Canada,QC) 2 TBC TBC TBC N13 1 NA(Canada,NS) 2 TBC TBC TBC N14 1 NA (US,GA) 2 TBC TBC TBC N15 1 NA (US, NC) 2 TBC TBC TBC N16 1 NA(Canada,NB) 2 TBC TBC TBC N17 1 NA(Canada,QC) 2 TBC TBC TBC A1 Asia (China) 1 JF319479 JF319629 JF319564 A2 3 Asia (Japan) 1 JF319482 JF319632 JF319567 Asia (Korea) 1 JF319487 JF319637 JF319572

177

Asia (Russia) 1 JF319490 JF319640 JF319575 A3 1 Asia (Japan) 1 JF319482 JF319632 JF319567 A4 2 Asia (Japan) 1 JF319483 JF319633 JF319568 Asia (Korea) 1 JF319486 JF319636 JF319571 A5 1 Asia (Korea) 1 JF319484 JF319634 JF319569 A6 1 Asia (Korea) 1 JF319485 JF319635 JF319570 A7 1 Asia (Korea) 1 JF319488 JF319638 JF319573 T. capensis Af1 1 Africa1 JF319466 JF319616 JF319551 Af2 1 Africa1 JF319467 JF319617 JF319552 Af3 1 Africa1 JF319468 JF319618 JF319553 T. elephantina A1 1 Asia (China)1 JF319474 JF319624 JF319559 A2 1 Asia (India) 1 JF319475 JF319625 JF319560 A3 1 Asia (India) 1 JF319476 JF319626 JF319561 T. laxmannii A1 1 Asia (Korea) 1 JF319507 JF319657 JF319592 A2 1 Asia (Korea) 1 JF319508 JF319658 JF319593 A3 1 Asia (Russia) 1 JF319509 JF319659 JF319594 T. minima E1 1 EU(France) 1 JF319494 JF319644 JF319579 E2 1 EU(France) 1 JF319495 JF319645 JF319580 E3 1 EU(Germany) 1 JF319496 JF319646 JF319581 E4 1 EU(Italy) 1 JF319497 JF319647 JF319582 A1 1 Asia (Russia) 1 JF319498 JF319648 JF319583 T. orientalis Au 1 Australia1 JF319499 JF319649 JF319584 A1 1 Asia (Japan) 1 JF319500 JF319650 JF319585 A2 1 Asia (Korea) 1 JF319501 JF319651 JF319586 A3 1 Asia (Russia) 1 JF319503 JF319653 JF319588 A4 1 Asia (Korea) 1 JF319502 JF319652 JF319587 T. shuttleworthii E1 1 EU(France) 1 JF319504 JF319654 JF319589 E2 1 EU(Hungary) 1 JF319505 JF319655 JF319590 E3 1 EU(Romania) 1 JF319506 JF319656 JF319591

178

Sparganium spp. 1 S. emersum (A3) 1 Asia (Russia) JF319449 JF319599 JF319534 1 S. erectum (A1) 1 Asia (Korea) JF319446 JF319596 JF319531 S. eurycarpum 1 Asia (Russia) 1 JF319445 JF319595 JF319530 (A2) 1 S. fallax (A4) 1 Asia (Taiwan) JF319447 JF319597 JF319532 S. hyperboreum 1 Asia (Russia) 1 JF319448 JF319598 JF319533 (A5)

179

7 CHAPTER 7

GENERAL DISCUSSION

This thesis contributes insights into comparative phylogeographic histories of plant species with disjunct versus continuous distributions around the Great Lakes region in North

America, and it questions how contemporary distributions of species’ ranges in North America have been impacted by their evolutionary history. The Great Lakes region is a very dynamic geographic area, with a relatively recent history of colonization likely impacted by both the retreat of the glaciers and by human mediated dispersion. Although postglacial expansion and recolonisation were the most important processes influencing the current distribution of the majority of species in the northern hemisphere, the majority of contemporary species’ distribution around the Great Lakes is very similar to that of 7000-8000 years ago (Sawada et al.

2003). However, in the last 200 years, the Great Lakes region has experienced intense anthropogenic impacts that led to the introduction of non-native species. Non-native species around the Great Lakes have had a negative impact upon the local biodiversity and threaten to deplete native species that are historically present in the area.

The main question of this thesis was, how have historical and current processes shaped the current genetic distribution in species with disjunct ranges and in species with continuous ranges around the Great Lakes region? Understanding the historical and contemporary phylogeographic patterns of these species around the Great Lakes, is significant because disjunct populations might have arisen following historical processes that pre-date the most recent glaciation, while species with continuous distribution might have been affected by a combination of historical and contemporary events. Overall, evolutionary history is critical to understanding the genetic diversity accumulated in disjuncts and in continuously distributed species because it may provide insight into the conservation value of disjuncts and the need for management 180

planning of species with expanding ranges and invasive behaviours around the Great Lakes region.

In Chapter 1, I reviewed the literature on molecular markers and their applications to specific questions in phylogeographic studies such as unravelling macro and microevolutionary events. In Chapter 2, I compared sequences between disjunct (Canada) and core (USA) populations of B. paniculata subsp. paniculata. Disjunct populations are situated in the Great

Lakes region and have been previously designated as threatened in Canada but globally secure.

These data allowed me to compare the genetic similarity of disjunct populations to a sample from the core range in New Jersey and estimate divergence time from their most recent common ancestor based on Bayesian analyses. Phylogeographic patterns produced in this study contrasted with previous studies that had found disjunct and core populations to be genetically similar in

North America (Simurda et al. 2005; Hamilton and Eckert, 2007; Row et al. 2010). Although lineages within the disjunct populations shared a relatively recent common ancestor, the genetic divergence between plants from Ontario and New Jersey was substantially greater than expected for a consubspecific comparison. A coalescence-based analysis dated the most recent common ancestor of the Canadian and US populations at approximately 534, 000 years ago (ya) with the lower confidence estimate at 226 000 ya. These data revealed that the genetic differences between the disjunct and core B. paniculata subsp. paniculata populations are substantial, and their estimated divergence dates pre-date the Last Glacial Maximum by a substantial period of time. These findings provide important insight into the diverse processes that have resulted in numerous disjunct species in the Great Lakes region, and highlight a need for additional work on

Canadian B. paniculata subsp. paniculata taxonomy prior to a re-evaluation of its conservation value.

181

In Chapter 3, I used trnT-trnL chloroplast DNA region and phylogeographic analyses to test genetic novelty in disjunct populations in the Great Lakes region for three species: 1)

Empetrum nigrum, which was compared to northern core populations in British Columbia, northern Ontario and Newfoundland; 2) Sporobolus heterolepis, a vulnerable species in Ontario, which was compared to core populations in the western Canadian prairies; and 3) Carex richardsonii, which was compared to core populations in the western Canadian and central US prairies. Chloroplast DNA sequences showed different evolutionary histories in the three disjunct species. E. nigrum and S. heterolepis revealed minimal genetic differences between disjunct and core populations reflecting a recent divergence that post-dated the Last Glacial Maximum

(LGM). In Empetrum nigrum, chloroplast DNA sequences lacked the regional phylogeographic structure found in previous phylogeographic studies of arctic species with wide distributions

(Alsos et al. 2007; Popp et al. 2011). These results suggest that disjunct and core populations of

E. nigrum in North America shared a recent common ancestor and a common refuge during the

LGM, due to the lack of genetic novelty in disjunct populations. In S. heterolepis, a prairie species, haplotypes from disjunct populations were equidistant to haplotypes from both core and disjunct populations, and thus, indicate that disjunct populations around the Great Lakes arose following the LGM. These haplotype relationships were encountered in other prairie species and are likely due to relatively recent vicariant events that followed prairie expansion into the Great

Lakes region ∼5000ya (Transeau 1935; Reznicek and Maycock 1983). However, C. richardsonii, also a prairie species that extends further north than S. heterolepis, revealed two different genetic signatures, one similar to S. heterolepis with minimal genetic differences between some disjunct and core populations, and one with highly divergent haplotypes between some other disjunct and core populations, reflecting a divergence among disjunct and core

182

haplotypes that likely predated the LGM. Genetic novelty within and among disjunct and core populations suggests that many of the haplotypes did not recently diverge from one another and their most common recent ancestors likely persisted in multiple glacial refugia during recent glacial cycles. This phylogeographic pattern suggests that small core populations might have persisted periglacially south of the Wisconsinan ice sheet in spruce parklands from where they colonised the Great Lakes region when the glaciers retreated (Ritchie and MacDonald, 1986;

Ritchie 1987).

Analyses from Chapter 2 and 3 in conjunction with findings from previous phylogeographic studies (Simurda et al. 2005; Hamilton and Eckert, 2007; Row et al. 2011) suggest that in the majority of species so far examined, disjunct populations around the Great

Lakes share a recent common ancestor with their core populations. While previous studies reported low genetic divergence between North American disjunct and core populations, in my thesis two out of four disjunct species confirmed this pattern because disjunct populations were either genetically similar or identical to their core populations. However, in two other disjunct species (B. paniculata subsp. paniculata and C. richardsonii), substantial divergence has accumulated in disjunct populations since their isolation from the core populations. These results show that not all disjunct populations have similar evolutionary histories because they originated through different microevolutionary processes caused by different historical events (Simurda et al. 2005; Hamilton and Eckert, 2007; Row et al. 2011; Ciotir et al. 2013). The disjuncts in this study have life histories and ecological tolerances different from each other and thus, it is quite possible that during the past climatic oscillations, core populations were placed at different regional and temporal scales (Steward and Lister, 2001). Consequently, the different levels of genetic novelty accumulated within disjunct populations indicate that disjuncts arrived around

183

the Great Lakes at different times following either ancestral or recent vicariant events. This thesis is the first study to compare sequence divergence in multiple disjunct species with different geographic and ecological ranges around the Great Lakes and, contrary to the previous hypothesis that disjunct populations split recently from their closest core populations, it shows that not all disjunct populations have similar evolutionary histories with their core populations.

Different levels of genetic novelty in disjunct populations are relevant to their conservation value around the Great Lakes region. Future studies should look at adaptive genes to research whether the genetic novelty also confer differential adaptation to disjunct populations subsisting in novel habitats at the edge of the species ranges versus core populations from the central ranges.

Another goal of my thesis was to reconstruct the phylogeographic history of taxa that are continuously distributed around the Great Lakes region (Typha spp.), and determine whether they were native or introduced species in these areas because in recent years a large number of introduced species have been associated with transportation traffic around the Great Lakes region. Although the origin of Typha dates back to the Cretaceous period (Bremer 2000), geographical distributions over time are not well known, and the pollen record suggests that

Typha has been present in North America since before the LGM (Sawada et al. 2003). I hypothesised that T. latifolia is native to North America and T. angustifolia is introduced to

North America. In Chapter 4, I used a combination of microsatellite markers and chloroplast

(cpDNA) trnL-trnF DNA sequences from Typha stands sampled in North America and Europe.

Both species (T. latifolia and T. angustifolia) showed signatures of recent intercontinental exchange between Europe and North America around the eastern seaboard and the Great Lakes region. Approximate Bayesian Computation (ABC) analyses suggested that North American T. angustifolia was introduced from Europe to North America and T. latifolia may have colonized

184

Europe from North America. This study used genetic evidence to confirm that T. angustifolia is a non-native species in North America and to detect cryptic intercontinental exchange of non- native lineages of T. latifolia.

The findings of Chapter 4 suggest that microevolutionary processes of hybridization, introgression, and recent intercontinental dispersal of both T. latifolia and T. angustifolia complicate their phylogeographic patterns and need to be explored with additional cpDNA and nuclear molecular markers. In Chapter 5, I described the development of additional microsatellite markers, and identified species-specific and continent-specific alleles in T. latifolia and T. angustifolia. These additional markers along with those previously characterized could be useful to unravel recent patterns of dispersal within and between continents, to hybridization and admixture in this broadly distributed species complex, although many alleles co-occurred in both continents and thus the addition of nuclear SSR markers did not completely clarify the historical phylogeographic patterns. These results suggest that additional cpDNA markers and broader geographical studies are required to elucidate patterns of Typha dispersal within and between continents.

In Chapter 6, I reconstructed the phylogeography of three globally distributed Typha species (T. angustifolia, T. domingensis, and T. latifolia) using three cpDNA regions and samples from multiple continents. I hypothesised that multiple intercontinental introductions occur in

Typha species and I predicted that Typha species will have continental phylogeographic structure in their native ranges and will lack regional phylogeographic patterns in areas of introduction.

Although phylogenetic analyses indicate dissimilar phylogeographic histories for each species, each of them show blatant and cryptic movement of non-native lineages around the world and their potential sources of origin. The results of this study suggest that Typha angustifolia and T.

185

domingensis are each paraphyletic species with limited phylogeographic structuring despite broad intercontinental distributions. Both historically and more recently diverged haplotypes exhibit widespread intercontinental distributions without geographical relationships. However, the paraphyletic split within T. angustifolia is much older than that within T. domingensis and one highly divergent T. angustifolia haplotype suggest ancestral hybridization with other Typha species and cryptic speciation which should be further investigated. Typha latifolia is a monophyletic species with strong continental phylogeographic structuring and relatively few intercontinental movements. Historically, Europe appears to have been colonized by T. latifolia following two separate pathways: into the east via Asia, and into the west via North America.

The clearer phylogenetic signals in T. latifolia may also have arisen because it has the most northerly distribution of the three species, and was therefore most likely to have been influenced throughout the glacial-interglacial cycles by range contractions and expansions that were likely associated with repeated bottlenecks and hence relatively rapid sorting of haplotypes within and among continents. The current phylogeographic patterns in T. angustifolia, T. domingensis, and

T. latifolia suggest continental diversification across varying temporal scales combined with multiple intercontinental dispersal events. In a number of cases, intercontinental dispersal has been relatively recent likely due to anthropogenic influence, and this could facilitate biological invasions, either directly or following intraspecific admixture or interspecific hybridization.

Conjointly, Chapters 4, 5 and 6 combine spatial and temporal perspectives that show insights into the historical diversification of each of three Typha spp., and suggest contemporary genetic dispersal between continents likely caused by global movements and anthropogenic disturbance. Thus, in species with wide ranges, e.g. Typha spp., phylogeographic analyses helped reveal historical and contemporary phylogeographic patterns at global and regional scales. Initial

186

analyses based on chloroplast and nuclear markers across North America and Europe (Chapters 4 and 5), revealed relatively recent intercontinental dispersal but by enlarging the scale of sampling to a global range and by adding more chloroplast markers, it was possible to reconstruct the global phylogeography and historical evolutionary diversification for each species (Chapter 6).

Subsequently, these data disentangle the recent evolutionary history accumulated at the regional scale and confirm the historical presence of T. latifolia as native lineages around the Great

Lakes. All three Typha species support the predictions of multiple intercontinental introductions

(Chapter 6) and suggest that recent introduction of non-native lineages into novel geographic areas contribute to range expansion, intra- and interspecific hybridization, and increasingly aggressive behaviour.

From a practical point of view these findings are relevant to understand the rapid range expansion over the last 200 years of Typha spp. and suggest that their continuously increasing distributions around the Great Lakes could be at least partially explained by the contact between native and non-native lineages of T. latifolia and T. angustifolia and their conspecific hybrid T. x. glauca around the Great Lakes (Freeland et al. 2013). These evolutionary consequences are also associated with potential for admixture within and between Typha species (Roman 2006;

Culley and Hardiman 2009; Schierenbeck and Ellstrand 2009). Hybridization appears a driver involved in micro and macroevolutionary processes with formation of new species and increase in biodiversity (Rieseberg et al. 2007). Thus, introductions of Typha spp. from elsewhere to

North America have important implications for wetland invasions and future management measures.

From a theoretical point of view, the findings in my thesis help us to understand the microevolutionary processes that affected the history of species that colonised the Great Lakes

187

region since the LGM. Overall, my work integrates phylogeography and phylogenetics through multilocus and multispecies data within concepts of evolutionary theory and suggests that: 1) historical genetic processes in North American disjuncts reflect a range of processes including isolation by distance and genetic drift, 2) genetic novelty in disjunct populations may be relevant to their conservation value, 3) widespread species have continentally experienced ancient hybridization and interspecific gene flow, and recent founder events followed by regional geneflow, and 4) more recently, likely attributable to human mediated movement within and between continents, widespread species experience long distance dispersal. These findings suggest that despite their relatively recent arrival around the Great Lakes, plants have diverse evolutionary histories and mechanisms of diversification, and repeated intercontinental dispersal suggests that invasive plants will likely continue to expand their geographic ranges. Future studies should look at adaptive markers to reveal whether the high genetic divergence found in disjunct populations is connected to their adaptive potential to climatic changes. In Typha species, multiple genomes should be investigated in paraphyletic T. angustifolia and T. domingensis to determine which parental genomes contributed historically to their divergent lineages. In addition, analyses to detect whether invasive genotypes are admixtures between non- native and native lineages should be performed in areas of newly detected introductions and range expansions.

References

Alsos IG, Eidesen PB, Ehrich D, Skrede I, Westergaard K. 2007. Frequent long-distance plant

colonization in the changing Arctic. Science 316: 1606-1609.

Bremer K. 2000. Early Cretaceous lineages of monocot flowering plants. PNAS USA 97:4707-

4711

188

Ciotir C, Kirk H, Row JR, and Freeland JR. 2013. Intercontinental dispersal of Typha

angustifolia and T. latifolia between Europe and North America has implications for

Typha invasions. Biological Invasions 15: 1377-1390.

Culley TM, and Hardiman NA. 2009. The role of intraspecific hybridization in the evolution of

invasiveness: a case study of the ornamental pear tree Pyrus calleryana. Biological

Invasions 11: 1107-1119.

Ellstrand NC, and Schierenbeck KA. 2006. Hybridization as a stimulus for the evolution of

invasiveness in plants? Euphytica 148: 35-46.

Freeland J, Ciotir C, and Kirk H. 2013. Regional differences in the abundance of native,

introduced, and hybrid Typha spp. in northeastern North America influence wetland

invasions. Biological Invasions 15: 2651-2665.

Freeland JR, Kirk HR, Petersen S. 2010 Molecular Ecology (second edition). John Wiley &

Sons, Chichester.

Hamilton JA, and Eckert C. 2007. Population genetic consequences of geographic disjunction: a

prairie plant isolated on Great Lakes alvars. Molecular Ecology 16: 1649-1660.

Popp M, Mirre V, and Brochmann C. 2011. A single Mid-Pleistocene long-distance dispersal by

a bird can explain the extreme bipolar disjunction in crowberries (Empetrum).

Proceedings of the National Academy of Sciences of the United States of America 108:

6520-6525.

Reznicek AA, and Maycock PF. 1983. Composition of an isolated prairie in central Ontario.

Canadian Journal of Botany 61: 3107-3116.

189

Rieseberg LH, Kim SC, Randell RA, Whitney KD, Gross BL, Lexer C, and Clay K. 2007.

Hybridization and the colonization of novel habitats by annual sunflowers. Genetica 129:

149-165.

Ritchie JC, and MacDonald GM. 1986. The patterns of post-glacial spread of white spruce.

Journal of Biogeography 13: 527-540.

Ritchie, JC. 1987. Postglacial Vegetation of Canada. Cambridge University Press, Cambridge,

US.

Roman J. 2006. Diluting the Founder Effect: Cryptic Invasions Expand a Marine Invader's

Range. Proceedings: Biological Sciences 273: 2453-2459.

Row JR, Brooks RJ, MacKinnon CA, Lawson A, Crother BI, White M, and Lougheed SC. 2011.

Approximate Bayesian computation reveals the factors that influence genetic diversity

and population structure of foxsnakes. Journal of Evolutionary Biology 24: 2364-2377.

Sawada M, Viau AE, and Gajewski K. 2003. The biogeography of aquatic macrophytes in North

America since the last glacial maximum. Journal of Biogeography 30: 999-1017.

Schierenbeck KA, and Ellstrand NC. 2009. Hybridization and the evolution of invasiveness in

plants and other organisms. Biological Invasions 11: 1093-1105.

Simurda MC, Marshall DC, and Knox JS. 2005. Phylogeography of the narrow endemic,

Helenium virginicum (Asteraceae), based upon ITS sequence comparisons. Syst. Bot.

30(4): 887-898.

Stewart JR, and Lister AM. 2001. Cryptic northern refugia and the origins of the modern biota.

Trends in Ecology & Evolution 16: 608-613.

190

Stewart JR, Lister AM, Barnes I, and Dalen L. 2009. Refugia revisited: individualistic responses

of species in space and time. Proceedings of the Royal Society B-Biological Sciences

277: 661-671.

Transeau EN. 1905. Forest centers of Eastern America. The American Naturalist 39: 875-889.

191