bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Centriole and PCM cooperatively recruit CEP192 to spindle poles to
2 promote bipolar spindle assembly
3
4 Takumi Chinen1,†,*, Kaho Yamazaki1,†, Kaho Hashimoto1, Ken Fujii2,3, Koki
5 Watanabe1, Yutaka Takeda1, Shohei Yamamoto1,4, Yuka Nozaki2, Yuki Tsuchiya2,3,
6 Daisuke Takao1 and Daiju Kitagawa1,2,3,*
7
8 1Department of Physiological Chemistry, Graduate school of Pharmaceutical Science, 9 The University of Tokyo, Bunkyo, Tokyo 113-0033, Japan. 10 2Department of Molecular Genetics, Division of Centrosome Biology, National Institute 11 of Genetics, Mishima, Shizuoka 411-8540, Japan. 12 3Department of Genetics, School of Life Science, The Graduate University for 13 Advanced Studies (SOKENDAI), Mishima, Shizuoka 411-8540, Japan. 14 4Graduate Program in Bioscience, Graduate School of Science, University of Tokyo, 15 Hongo, Tokyo 113-0033, Japan. 16 †Equal contribution 17 *Correspondence: TC ([email protected]) and DK 18 ([email protected]).
19
1 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 The pericentriolar material (PCM) that accumulates around the centriole expands
2 during mitosis and nucleates microtubules. While centrosomes facilitate bipolar
3 spindle formation, the individual functions of the centriole and PCM in mitosis
4 remain elusive. Herein, we show the redundant roles of the centriole and PCM in
5 bipolar spindle formation in human cells. Upon depletion of the PCM scaffold
6 components, pericentrin and CDK5RAP2, centrioles remained able to recruit
7 CEP192 onto their walls, which was sufficient for bipolar spindle formation. In
8 contrast, through centriole removal, we found that pericentrin and CDK5RAP2
9 recruited CEP192 at the acentriolar spindle pole and facilitated bipolar spindle
10 formation in mitotic cells with one centrosome. Furthermore, the chemical
11 perturbation of polo-like kinase 1, a critical kinase for PCM assembly, efficiently
12 suppressed the proliferation of various cancer cell lines from which centrioles were
13 removed. Overall, these data suggest that the centriole and PCM cooperatively
14 recruit CEP192 to spindle poles and facilitate bipolar spindle formation in human
15 cells.
2 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Introduction
2 Centrosomes nucleate and anchor microtubules, thereby facilitating efficient spindle
3 formation and chromosome segregation during mitosis(Moritz et al., 1995; Kollman et
4 al., 2011; Woodruff et al., 2017). The microtubule-organizing activity of centrosomes
5 depends on the pericentriolar material (PCM) that surrounds one or two centrioles(Hyman,
6 2014). Abnormalities in centrosome organization and function lead to chromosomal
7 segregation errors; several mutations in centrosomal proteins have also been implicated
8 in the development of diseases such as cancer(Nigg and Raff, 2009; Gönczy, 2015). In
9 addition, PCM disorganization directly causes chromosome mis-segregation(Watanabe
10 et al., 2019; Cosenza et al., 2017). Therefore, elucidating the function and organization
11 of centrosome in mitosis will contribute to a better understanding of the mechanisms
12 through which centrosomes dictate the spindle structure and support accurate
13 chromosome segregation.
14 PCM contains a large number of proteins, such as the γ-tubulin ring complex
15 (γ-TuRC), CDK5RAP2, CEP192, and pericentrin. During the G2/M transition, CEP192
16 recruits Aurora A and polo-like kinase 1 (PLK1) to centrosomes in a pericentrin-
17 dependent manner; subsequently, CEP192 activates these kinases to promote microtubule
18 nucleation and centrosome separation(Joukov et al., 2014). CEP192 also supports the
19 organization of other PCM components for efficient bipolar spindle assembly(Gomez-
20 Ferreria et al., 2007). PLK1 phosphorylates pericentrin to further recruit other PCM
21 components to centrosomes, thereby increasing the microtubule nucleation activity of the
22 centrosome during mitosis(Lee and Rhee, 2011). Microtubule nucleation activity depends
3 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 on γ-TuRC(Zheng et al., 1995; Wieczorek et al., 2020; Liu et al., 2020; Consolati et al.,
2 2020; Moritz et al., 1995; Kollman et al., 2011), the activity of which is upregulated by
3 the binding of CDK5RAP2 to γ-TuRC(Choi et al., 2010; Hanafusa et al., 2015). In
4 addition to their functions in microtubule nucleation, previous studies have described
5 pericentrin and CDK5RAP2 regulating spindle pole focusing and spindle orientation
6 through the regulation of motor proteins or other spindle pole proteins(Lee and Rhee,
7 2010; Chavali et al., 2016; Tungadi et al., 2017; Chen et al., 2014).
8 During the G2/M phase, PCM expands around the pair of centrioles that form
9 the structural core of the centrosome, and increases its ability to nucleate microtubules.
10 In Drosophila and Caenorhabditis elegans, it has been reported that the centrioles
11 regulate the architecture and dynamics of PCM(Kirkham et al., 2003; Conduit et al., 2010;
12 Erpf et al., 2019; Cabral et al., 2019; Sir et al., 2013; Alvarez-Rodrigo et al., 2019;
13 Conduit et al., 2014). In addition, it has been shown that PCM disorganization causes
14 precocious centriole disengagement during mitosis(Seo et al., 2015; Kim et al., 2015,
15 2019; Watanabe et al., 2019), which can result in impairment of spindle pole
16 integrity(Watanabe et al., 2019). This cross-reactive interplay between centrioles and
17 PCM complicates the analysis of the individual function of PCM at spindle poles
18 independent from the involvement of centriolar machinery. The centriole-independent
19 functions of PCM have been partially characterized in the acentriolar meiotic spindles of
20 mouse oocytes. During meiotic spindle formation in mice, acentriolar microtubule-
21 organizing centers are formed and merge into two equal spindle poles(Clift and Schuh,
22 2015; Schuh and Ellenberg, 2007). Conditional knockout of pericentrin induces spindle
4 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 instability and severe meiotic errors that lead to pronounced female subfertility in mouse
2 oocytes. These findings suggest that pericentrin assists in organizing functional spindle
3 poles to achieve faithful chromosome segregation(Baumann et al., 2017). However, as
4 the system of meiosis is particularly unique compared with that of mitosis, it is unclear
5 whether acentrosomal spindle formation pathways can be directly compared between
6 oocytes and somatic cells.
7 To evaluate the distinct functions of PCM in human somatic cells
8 independently of centrioles, it is important to utilize an assay system that enables the
9 analysis of mitotic spindles that lack centrioles. As centriole duplication requires
10 PLK4(Habedanck et al., 2005; Bettencourt-Dias et al., 2005), its specific inhibitor
11 centrinone can be used to remove centrioles(Wong et al., 2015). Treatment with
12 centrinone leads to progressive loss of centrioles and generates mitotic spindles with one
13 or zero centrosomes. Using this strategy, we have previously shown the critical roles of
14 NuMA in the spindle bipolarization in early mitosis of cells without centrosomes(Chinen
15 et al., 2020). Similarly, by using mitotic cells with one centrosome, Dudka et al. recently
16 reported that centrosomes regulate the length of K-fibers, and thereby alter their dynamics
17 in HURP-dependent manner(Dudka et al., 2019).
18 In this study, we show the redundant roles of the centriole and PCM in bipolar
19 spindle formation in human cells. When PCM assembly was inhibited by depletion of the
20 PCM scaffold proteins pericentrin and CDK5RAP2, we found that CEP192 remained at
21 the centriole wall, where it presumably promoted bipolar spindle formation. Furthermore,
22 we induced the formation of mitotic spindles with only one centrosome by treating human
5 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 cells with centrinone. We found that the one-centrosome cells formed a bipolar spindle
2 that accumulated PCM components, including CEP192, at the acentriolar pole. In such
3 cells, depletion of pericentrin or CDK5RAP2 compromised the formation of the
4 acentriolar pole and significantly prolonged mitotic progression. In contrast, the artificial
5 accumulation of PCM components at the acentriolar pole accelerated the mitotic
6 progression in one-centrosome cells. These results demonstrate that the centriole and
7 PCM cooperatively assemble CEP192 at the spindle poles and facilitate bipolar spindle
8 formation in human cells.
9
10
6 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Results
2 CEP192 at the centriolar wall is sufficient for organizing mitotic spindle poles
3 To understand the functions of PCM in bipolar spindle formation in human cells, we
4 depleted the main components of PCM, such as CEP192, pericentrin, and CDK5RAP2,
5 and observed mitotic progression in HeLa cells. As previously described, the depletion
6 of CEP192 caused severe defects in bipolar spindle formation and prolonged mitotic
7 duration (Fig. 1A, B). On the other hand, double depletion of pericentrin and CDK5RAP2
8 or their individual depletion had a limited effect on mitotic duration (Fig. 1A, B, 2C, and
9 S1G). These results suggest that CEP192, but not pericentrin or CDK5RAP2, is critical
10 for mitotic progression. It has been suggested that pericentrin and CDK5RAP2
11 cooperatively recruit PCM components, including CEP192, at centrosomes(Kim and
12 Rhee, 2014). Therefore, we observed the amount and localization of CEP192 at
13 centrosomes upon depletion of pericentrin and CDK5RAP2. We found that a certain
14 quantity of CEP192 remained at centrosomes in pericentrin/CDK5RAP2 double-depleted
15 cells (Fig. 1C and D). To further understand this mechanism, we used gated stimulated
16 emission depletion (STED) microscopy to analyze the detailed localization pattern of
17 CEP192 at centrosomes in pericentrin/CDK5RAP2 double-depleted cells (Fig. 1E–G).
18 Centrioles were marked by poly-glutamylated centriolar microtubules. In control cells,
19 CEP192 was detectable in the PCM clouds that surrounded mother centrioles (Fig. 1E–
20 G). In contrast, in pericentrin/CDK5RAP2 double-depleted cells, the reduced quantity of
21 CEP192 was detectable only on centriole walls. These results raise the possibility that
7 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 CEP192 at the centriolar wall, rather than in the PCM cloud, is crucial for the
2 microtubule-organizing center function of centrosomes.
3
4 Cells with one centrosome form a bipolar spindle that accumulates PCM
5 components at the acentriolar pole
6 To understand the functions of PCM independently of centrioles in human cells, we next
7 induced the formation of mitotic spindles with one or zero centrosomes by treating HeLa
8 cells with the PLK4 inhibitors centrinone or centrinone B (Fig. 2A and B). Centrosomes
9 were marked by polyglutamylated centriolar microtubules or centrin to determine their
10 number. We depleted PCM components CEP192, pericentrin, and CDK5RAP2 in one-
11 or zero-centrosome cells, and observed their mitotic progression using live cell imaging.
12 As described above, the depletion of CEP192, but not pericentrin or CDK5RAP2,
13 prolonged mitosis in cells with two centrosomes (Figs. 2C, S1A–G). On the other hand,
14 interestingly, we found that depletion of pericentrin or CDK5RAP2, as well as CEP192,
15 significantly prolonged mitotic duration in one-centrosome cells (Figs. 2D, S1H). In
16 contrast, we found that depletion of pericentrin, CDK5RAP2, or CEP192 had a limited
17 effect on mitotic progression in zero-centrosome cells (Figs. 2E, S1I). These results
18 suggest that pericentrin and CDK5RAP2 are important for mitotic progression in one-
19 centrosome cells, but not in two- or zero-centrosome cells.
20 We further analyzed the localization patterns of PCM proteins at spindle poles
21 using immunofluorescence microscopy (Figs. 2F, G, S2A–D). We found that the
22 acentriolar spindle poles of one-centrosome cells incorporate a detectable amount of PCM
8 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 components, such as pericentrin, CDK5RAP2, CEP192, and γ-tubulin (Figs. 2F, G, S2A)
2 but not CEP152 or CPAP (Figs. 2G and S2A). In this study, we termed the acentriolar
3 spindle pole that contains PCM the ‘PCM-pole’. In contrast, most spindle poles of zero-
4 centrosome cells lacked PCM components, as previously described (Figs. 2F, G, S2A)
5 (Chinen et al., 2020). PCM components were consistently detectable at the acentriolar
6 spindle poles in one-centrosome cells of various human cell lines (Fig. S2B). Furthermore,
7 the PCM-pole was similarly observed in one-centrosome cells induced by SAS6-
8 depletion using the auxin-inducible degron (AID) system (Fig. S2C, D)(Yoshiba et al.,
9 2019), suggesting that this phenotype was not a specific result of PLK4 inhibition.
10 We next examined whether the PCM-pole nucleates microtubules using a
11 microtubule regrowth analysis. For this analysis, we immunostained the microtubule end
12 binding protein 1 (EB1), which marks growing microtubule plus ends. When restarting
13 the microtubule nucleation, the EB1 signals started developing around both centriolar and
14 PCM-poles, with PCM-poles nucleating less microtubules (Fig. S2E). Thus, PCM-poles
15 possess microtubule nucleation activity, although this activity appears slightly lower than
16 that of centriolar poles. Collectively, these results suggest that one-centrosome cells
17 assemble PCM at the acentriolar spindle pole, which harbors microtubule nucleation
18 activity (Fig. 2H).
19
20 The PCM-pole is formed by either split of the PCM from the centriolar pole or
21 accumulation of PCM
9 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 To understand the mechanism of PCM recruitment to the acentriolar pole in one-
2 centrosome cells, we used time-lapse fluorescence microscopy to track the dynamics of
3 endogenous pericentrin or CDK5RAP2 tagged with mCherry as markers of PCM. This
4 strategy revealed that, at first, pericentrin accumulated at centriolar poles in early mitosis.
5 Subsequently, one-centrosome cells formed pericentrin-positive PCM-poles by either
6 splitting of the PCM from the centriolar pole or de novo accumulation of PCM (38.5%
7 and 51.9%, respectively) (Fig. 3A, B, D). These PCM-poles disappeared after cytokinesis
8 (Fig. 3A, B, E), consistent with the observation that PCM proteins are disassembled after
9 mitotic exit(Woodruff et al., 2014). On the other hand, a detectable amount of pericentrin
10 did not accumulate at the acentriolar spindle poles in most zero-centrosome cells (Fig.
11 3C, D). Taken together, these observations suggest that one-centrosome cells initially
12 accumulate PCM proteins around centrioles and subsequently generate the acentriolar
13 pole by splitting and/or by recruiting PCM components on the opposite side for bipolar
14 spindle formation (Fig. 3F).
15
16 CDK5RAP2 and pericentrin are crucial for the bipolar spindle formation in one-
17 centrosome cells
18 We next analyzed the specific role of PCM in cell division in one-centrosome cells.
19 However, it is difficult to analyze the specific roles of some PCM-pole components.
20 Among those appeared to localize at PCM-poles (Fig. 2F, G, S2A), for example, γ-tubulin
21 also localizes along the whole spindle and regulates several pathways of microtubule
22 nucleation in mitosis(Lecland and Lüders, 2014; Teixido-Travesa et al., 2012). In
10 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 addition, CEP192 is required for bipolar spindle formation in cells with two
2 centrosomes(Zhu et al., 2008; Joukov et al., 2014). On the other hand, depletion of the
3 PCM scaffold proteins CDK5RAP2 and pericentrin are known to have little effect on
4 spindle formation in two- or zero-centrosome cells (Fig. 2C-E, S1G-I). Therefore, we
5 selected CDK5RAP2 and pericentrin for further analysis of PCM-poles in one-
6 centrosome cells.
7 We found that depletion of CDK5RAP2 or pericentrin caused arrest of one-
8 centrosome cells in mitosis with monopolar spindles; however, this effect was not
9 observed in two-centrosome cells (Fig. 4A, B). These results indicate that CDK5RAP2
10 and pericentrin play an important role in bipolar spindle formation specifically in one-
11 centrosome cells, but not in two-centrosome cells. To further investigate this process, we
12 tracked the dynamics of spindle poles in one-centrosome cells using time-lapse
13 observation of NuMA tagged with mCherry. Upon depletion of CDK5RAP2 or
14 pericentrin, the separation of two NuMA foci was normally detectable in early mitosis
15 (Fig. 4C, D), while the time from nuclear envelope breakdown to cytokinesis was
16 prolonged (Fig. 4C–F). In addition, immunofluorescence analysis revealed that, in the
17 pericentrin or CDK5RAP2-depleted HeLa cells with one-centrosome, the degree of
18 CEP192 localization at the acentrosomal spindle poles was reduced (Fig. 4G). These
19 results indicate that PCM scaffold proteins CDK5RAP2 and pericentrin are crucial for
20 the recruitment of CEP192 at the acentrosomal spindle pole and bipolar spindle formation,
21 but are likely dispensable for the early step of spindle pole generation in one-centrosome
22 cells.
11 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 To verify whether pericentrin and CDK5RAP2 are important for bipolar
2 spindle formation in other human cell lines with one centrosome, we observed the spindle
3 structure of RPE1 and A549 cells upon depletion of pericentrin or CDK5RAP2. Through
4 immunostaining, we found that in cells with one centrosome, depletion of pericentrin or
5 CDK5RAP2 induced the formation of monopolar spindles (Fig. S3A–D). These results
6 further support the conclusion that PCM proteins are required for bipolar spindle
7 formation in one-centrosome cells.
8
9 Depletion of CEP57 promotes accumulation of PCM components at PCM-poles and
10 facilitates bipolar spindle formation in one-centrosome cells
11 Next, we sought to further analyze the importance of PCM components at PCM-poles for
12 cell division in one-centrosome cells. Since siRNA-mediated depletion reduces the total
13 expression level of CDK5RAP2 and pericentrin, it is difficult to analyze the function of
14 the PCM components specifically at PCM-poles (Fig. 4). Therefore, we used another
15 approach to indirectly manipulate the amount of PCM components at PCM-poles:
16 depleting CEP57. CEP57 provides a critical interface between the centriole and PCM,
17 and depletion of CEP57 induces the fragmentation of PCM proteins in early mitosis of
18 human cells(Watanabe et al., 2019). Given that 38.5% of one-centrosome cells assembled
19 PCM-poles by splitting PCM from the centrosome (Fig. 3A, D), we hypothesized that,
20 upon CEP57 depletion, the PCM that is dissociated from the centrosome could be
21 incorporated into the acentriolar pole in one-centrosome cells. As expected, the amount
22 of pericentrin at PCM-poles was significantly increased, presumably due to the increased
12 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 PCM fragmentation at centriolar poles after CEP57 depletion (Fig. 5A–C). Subsequently,
2 to analyze the effect of CEP57 depletion on the mitotic processes of one-centrosome cells,
3 we performed time-lapse imaging of NuMA and microtubules. We found that depletion
4 of CEP57 promoted bipolar spindle formation more efficiently than in control cells, and
5 thereby shortened the mitotic duration (Fig. 5D–F). Under this condition, CEP57-
6 depleted cells with one centrosome formed two separate NuMA foci, similar to siControl-
7 treated one-centrosome cells, but established a bipolar spindle formation more efficiently
8 (Fig. 5E, G). Overall, these results suggest that accumulation of PCM components at
9 PCM-poles facilitates the bipolar spindle formation in one-centrosome cells.
10
11 Pericentrin is crucial for bipolar spindle elongation in cells with two centrosomes
12 Although pericentrin and CDK5RAP2 are dispensable for efficient mitotic progression in
13 cells with two centrosomes (Fig. 1A, B, 2C, S1G), the detailed functions of these PCM
14 components in bipolar spindle formation have not been carefully examined. We
15 subsequently analyzed the spindle length upon depletion of pericentrin or CDK5RAP2 in
16 HeLa cells. We found that depletion of pericentrin significantly reduced the spindle
17 length compared with that of control cells, whereas depletion of CDK5RAP2 had a
18 limited effect on the spindle length (Fig. 6A, B). To further investigate this defect upon
19 depletion of pericentrin, we performed live cell imaging of mitotic spindle formation in
20 HeLa and HCT116 cells. Depletion of pericentrin delayed the elongation of two spindle
21 poles (Fig. 6E, F, S4A, B). These results suggest that pericentrin supports spindle
22 elongation. In line with this result, immunofluorescence analysis revealed that, in the
13 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 pericentrin-depleted HeLa cells, the degree of CEP192 localization at the spindle poles
2 was reduced; however, this was not observed in CDK5RAP2-depleted cells (Fig. 6C, D).
3 This observation implies that pericentrin more efficiently recruits CEP192 to centrosomes,
4 thereby facilitating spindle elongation.
5 Furthermore, we tested the effect of depletion of pericentrin on the spindle
6 elongation of various cell types. The spindle length in pericentrin-depleted A549, U2OS,
7 A431, and PANC1 cells was significantly shorter than that noted in control cells (Fig. 6G,
8 S4C, F–H). On the other hand, in some cell types (RPE1, GI1, SKOV3), the spindle
9 length upon depletion of pericentrin was not altered compared with that observed in
10 control cells (Fig. S4C–F). These results suggest that pericentrin is required for efficient
11 spindle elongation in certain cell lines with two centrosomes.
12
13 The activity of PLK1 is crucial for PCM-pole assembly and bipolar spindle
14 formation in one-centrosome cells
15 The accumulation of PCM components at centrosomes in mitosis is regulated by PLK1
16 activity(Haren et al., 2009; Lee and Rhee, 2011; Joukov et al., 2014). However, we found
17 that PLK1 and phosphorylated PLK1 were not detected at most PCM-poles in one-
18 centrosome cells (Fig. 7A–D). To determine if PLK1 was required for PCM-pole
19 assembly and subsequent bipolar spindle formation, we treated cells with a low dose of
20 the PLK1 inhibitor BI 2536 (1 nM) and observed the amount of pericentrin at the
21 centriolar pole and the spindle structure. Treatment of two-centrosome cells with a low
22 dose of the PLK1 inhibitor caused chromosome congression errors and a slight reduction
14 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 of pericentrin at centrosomes, but did not affect bipolar spindle formation (Fig. 7E–G).
2 In contrast, in one-centrosome cells, PLK1 inhibition prevented PCM-pole formation and
3 led to the formation of monopolar spindles (Fig. 7E, F). In addition, PLK1 inhibition
4 greatly reduced the level of pericentrin at the centriolar pole compared with the level
5 recorded in two-centrosome cells (Fig. 7G). Together, these results suggest that PLK1
6 activity is crucial for PCM-pole assembly and subsequent bipolar spindle formation in
7 one-centrosome cells.
8
9 Dual inhibition of PLK1 and PLK4 prevents cell growth in a wide variety of cancer
10 cell lines
11 Mitotic spindle formation is a common target of anti-cancer drugs(Dumontet and Jordan,
12 2010; Tischer and Gergely, 2019; Henriques et al., 2019). Since the dual inhibition of
13 PLK1 and PLK4 (PLK1+4i) efficiently prevented bipolar spindle formation in one-
14 centrosome cells (Fig. 7E, F), we further tested the potential of PLK1+4i as an anticancer
15 strategy. PLK1+4i efficiently prevented HeLa cell growth (Fig. 8A). The half maximal
16 inhibitory concentration (IC50) value of the PLK1 inhibitor against HeLa cells was 1.1
17 nM (Table S2). Using both PLK1 and PLK4 inhibitors decreased the IC50 value to 0.6
18 nM (Table S2). Therefore, inhibition of both PLK1 and PLK4 has an additive effect on
19 the growth suppression of HeLa cells. Under these conditions, after depletion of
20 centrosomes, most of HeLa cells started to die due to prolonged mitosis (Fig. 6B, C, S6).
21 The results suggest that the toxicity of PLK1+4i may be caused by inhibition of PCM-
22 pole formation. Furthermore, PLK1+4i-treated cells showed cleavage of the apoptosis
15 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 marker poly(ADP-ribose)-polymerase 1 (PARP1), suggesting that this drug combination
2 induces apoptosis in mitosis (Fig. 6D). In addition, we assessed the effect of PLK1+4i in
3 19 cancer cell lines. The PLK1 inhibitor suppressed the proliferation of cancer cell lines
4 to different extents (IC50 values in Table S1). U2OS, K562, and HMV-II cells showed
5 approximately 10-fold higher resistance against the PLK1 inhibitor compared with HeLa
6 cells. However, PLK1+4i efficiently prevented the growth of various cancer cell lines,
7 including PLK1 inhibitor-resistant cell lines such as U2OS and K562 (15 cell lines:
8 IC50[−centrinone B]/IC50[+centrinone B] ≥ 1.5) (Fig. 6E and Table 1). Overall, these
9 results suggest that dual inhibition of PLK1 and PLK4 would be an effective drug target
10 against cancer proliferation.
16 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Discussion
2 In this study, we show that the centriole and PCM cooperate to recruit CEP192 at the
3 spindle pole to facilitate bipolar spindle formation in human cells. We found that, even in
4 cells in which PCM assembly was suppressed, CEP192 at the centriole wall efficiently
5 promoted bipolar spindle assembly (Fig. 1). Furthermore, cells with one centrosome
6 formed a bipolar spindle with a PCM-pole, which accumulates PCM proteins (including
7 CEP192) at the opposite side of the centriolar spindle pole (Fig. 2–3). Consistently, the
8 PCM-pole assembly is critical for cell division in one-centrosome cells (Fig. 4–5).
9 Overall, the findings in this study illustrate that the centriole and PCM cooperatively
10 promote bipolar spindle assembly through recruitment of CEP192 to the spindle pole in
11 human somatic cells (Fig. 9). In addition, based on this evidence, we propose that dual
12 inhibition of centriole duplication and a critical mitotic kinase PLK1 would be an
13 attractive target for anti-cancer strategies (Fig. 7–8).
14 In interphase cells, CEP192 localizes at the centrioles and regulates the
15 microtubule nucleation activity of centrosomes(O’Rourke et al., 2014). In the G2/M
16 phase, CEP192 is further recruited to PCM clouds by pericentrin(Joukov et al., 2014),
17 promoting mitotic spindle formation. In pericentrin/CDK5RAP2 double-depleted cells,
18 although the CEP192 localization was restricted on the centriolar wall, these cells
19 efficiently completed mitosis (Fig. 1C–F). These results suggest that a fraction of CEP192
20 at the centriolar wall is sufficient for its function in mitosis. A previous study suggested
21 that CEP192 supports the sequential activation of PLK1 and aurora kinase A (AURKA)
22 at centrosomes(Joukov et al., 2014). Moreover, it has been shown that phosphorylated
17 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 AURKA interacts with TPX2 and promotes spindle assembly(Joukov and De Nicolo,
2 2018). It is therefore possible that CEP192 at the centriole wall sufficiently activates the
3 PLK1-AURKA pathway, thereby facilitating bipolar spindle formation.
4 We found that one-centrosome cells efficiently assembled PCM-poles (Fig. 2F,
5 G, S2A-D). On the other hand, intriguingly, most zero-centrosome cells failed to
6 assemble PCM proteins at the acentriolar poles (Chinen et al., 2020). How does this
7 difference occur? In one-centrosome cells, PLK1 was localized only at centriolar poles,
8 but not at PCM-poles (Fig. 7A–D). However, the PLK1 kinase activity is somehow
9 necessary for the assembly of PCM-poles. It is possible that phosphorylation events at
10 the centriole driven by the activity of PLK1 may provide a pool of PCM for the generation
11 of the PCM-pole. In contrast, zero-centrosome cells do not have the platform components
12 (e.g., centrioles) for PCM assembly. Previous research indicated that, in zero-centrosome
13 cells, the activity of PLK1 in the cytoplasm was significantly increased(Takeda et al.,
14 2020). However, in such cells, the PCM-pole was not assembled at the spindle
15 poles(Takeda et al., 2020). Together, these observations suggest that the centriole itself
16 is important for PCM assembly in human cells.
17 Knockdown experiments further revealed that CDK5RAP2 and pericentrin are
18 crucial for cell division in one-centrosome cells. In addition, depletion of CEP57
19 augmented the assembly of PCM-poles, and facilitated mitotic progression in one-
20 centrosome cells. These results indicate that the PCM proteins are required for PCM-pole
21 formation in one-centrosome cells, and also raised the possibility that the balance of PCM
22 quantities between two spindle poles may be a critical factor for proper mitotic
18 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 progression in human cells. In line with this notion, it has been shown that in primary
2 human malignancies, centrosome abnormalities such as centriole rosettes are frequently
3 observed(Cosenza et al., 2017). These extra centrioles could lead to a greater
4 accumulation of PCM proteins at the one centrosome, thereby increasing the nucleation
5 of microtubules at this spindle pole and resulting in chromosome missegregation and
6 aneuploidy. Our assay system may be useful for analyzing the balance of PCM quantities
7 and the resulting microtubule nucleation between two spindle poles.
8 Based on the vulnerabilities of one-centrosome cells described above, our study
9 also highlights the potential of dual inhibition of centriole duplication and PCM assembly
10 as an attractive drug target for cancer therapies. The PLK1 inhibitor efficiently suppressed
11 both PCM maturation and subsequent PCM-pole formation in one-centrosome cells. In
12 this way, a low dose of PLK1 inhibitor efficiently suppressed cell division in one-
13 centrosome cells, but not in two-centrosome cells (Fig. 8B, C). Previous clinical trials of
14 PLK1 inhibitors have not been successful. Therefore, several studies have been
15 performed to improve PLK1 inhibitor toxicity through combination with other inhibitors,
16 such as α/β-tubulin inhibitors(Stehle et al., 2015; Weiß et al., 2015). In this study, the
17 dual inhibition strategy, which inhibits both PLK1 and PLK4, provided an alternative
18 approach to targeting PLK1 in the development of anticancer drugs. Interestingly,
19 treatment with centrinone did not strongly alter the toxicity of microtubule inhibitors
20 (Table S2). This result suggests that the strong toxicity caused by the dual inhibition of
21 PLK1 and PLK4 was not merely due to an additive effect in mitosis, but rather the specific
22 inhibition of both centrosomal and acentrosomal spindle assembly machinery. In addition,
19 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 recently, it was suggested that decreased centrosome numbers are associated with poorer
2 response to chemotherapy and an increased invasive capacity of tumor cells in ovarian
3 cancer(Morretton et al., 2019). Therefore, our strategy to suppress PCM assembly in
4 centrosome-reduced cells may be an attractive method for targeting ovarian cancer cells
5 that have a reduced number of centrosomes.
6
20 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 References
2 Alvarez-Rodrigo, I., T.L. Steinacker, S. Saurya, P.T. Conduit, J. Baumbach, Z.A.
3 Novak, M.G. Aydogan, A. Wainman, and J.W. Raff. 2019. Evidence that a
4 positive feedback loop drives centrosome maturation in fly embryos. Elife. 8:1–31.
5 doi:10.7554/eLife.50130.
6 Baumann, C., X. Wang, L. Yang, and M.M. Viveiros. 2017. Error-prone meiotic
7 division and subfertility in mice with oocyte-conditional knockdown of pericentrin.
8 J. Cell Sci. 130:1251–1262. doi:10.1242/jcs.196188.
9 Bettencourt-Dias, M., A. Rodrigues-Martins, L. Carpenter, M. Riparbelli, L. Lehmann,
10 M.K. Gatt, N. Carmo, F. Balloux, G. Callaini, and D.M. Glover. 2005. SAK/PLK4
11 is required for centriole duplication and flagella development. Curr. Biol. 15:2199–
12 2207. doi:10.1016/j.cub.2005.11.042.
13 Cabral, G., T. Laos, J. Dumont, and A. Dammermann. 2019. Differential Requirements
14 for Centrioles in Mitotic Centrosome Growth and Maintenance. Dev. Cell. 50:355-
15 366.e6. doi:10.1016/j.devcel.2019.06.004.
16 Chavali, P.L., G. Chandrasekaran, A.R. Barr, P. Tátrai, C. Taylor, E.K. Papachristou,
17 C.G. Woods, S. Chavali, and F. Gergely. 2016. A CEP215–HSET complex links
18 centrosomes with spindle poles and drives centrosome clustering in cancer. Nat.
19 Commun. 7:11005. doi:10.1038/ncomms11005.
20 Chen, C.-T., H. Hehnly, Q. Yu, D. Farkas, G. Zheng, S.D. Redick, H.-F. Hung, R.
21 Samtani, A. Jurczyk, S. Akbarian, C. Wise, A. Jackson, M. Bober, Y. Guo, C. Lo,
22 and S. Doxsey. 2014. A Unique Set of Centrosome Proteins Requires Pericentrin
21 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 for Spindle-Pole Localization and Spindle Orientation. Curr. Biol. 24:2327–2334.
2 doi:10.1016/j.cub.2014.08.029.
3 Chinen, T., S. Yamamoto, Y. Takeda, K. Watanabe, K. Kuroki, K. Hashimoto, D.
4 Takao, and D. Kitagawa. 2020. NuMA assemblies organize microtubule asters to
5 establish spindle bipolarity in acentrosomal human cells. EMBO J. 39:e102378.
6 doi:10.15252/embj.2019102378.
7 Choi, Y., P. Liu, S.K. Sze, C. Dai, and R.Z. Qi. 2010. CDK5RAP2 stimulates
8 microtubule nucleation by the γ-tubulin ring complex. J. Cell Biol. 191:1089–
9 1095. doi:10.1083/jcb.201007030.
10 Clift, D., and M. Schuh. 2015. A three-step MTOC fragmentation mechanism facilitates
11 bipolar spindle assembly in mouse oocytes. Nat. Commun. 6:7217.
12 doi:10.1038/ncomms8217.
13 Conduit, P.T., K. Brunk, J. Dobbelaere, C.I. Dix, E.P. Lucas, and J.W. Raff. 2010.
14 Centrioles Regulate Centrosome Size by Controlling the Rate of Cnn Incorporation
15 into the PCM. Curr. Biol. 20:2178–2186. doi:10.1016/j.cub.2010.11.011.
16 Conduit, P.T., J.H. Richens, A. Wainman, J. Holder, C.C. Vicente, M.B. Pratt, C.I. Dix,
17 Z.A. Novak, I.M. Dobbie, L. Schermelleh, and J.W. Raff. 2014. A molecular
18 mechanism of mitotic centrosome assembly in Drosophila. 1–23.
19 doi:10.7554/eLife.03399.
20 Consolati, T., J. Locke, J. Roostalu, Z.A. Chen, J. Gannon, J. Asthana, W.M. Lim, F.
21 Martino, M.A. Cvetkovic, J. Rappsilber, A. Costa, and T. Surrey. 2020.
22 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Microtubule Nucleation Properties of Single Human γTuRCs Explained by Their
2 Cryo-EM Structure. Dev. Cell. 53:603-617.e8. doi:10.1016/j.devcel.2020.04.019.
3 Cosenza, M.R., A. Cazzola, A. Rossberg, N.L. Schieber, G. Konotop, E. Bausch, A.
4 Slynko, T. Holland-Letz, M.S. Raab, T. Dubash, H. Glimm, S. Poppelreuther, C.
5 Herold-Mende, Y. Schwab, and A. Krämer. 2017. Asymmetric Centriole Numbers
6 at Spindle Poles Cause Chromosome Missegregation in Cancer. Cell Rep.
7 20:1906–1920. doi:10.1016/j.celrep.2017.08.005.
8 Dudka, D., C. Castrogiovanni, N. Liaudet, H. Vassal, and P. Meraldi. 2019. Spindle-
9 Length-Dependent HURP Localization Allows Centrosomes to Control
10 Kinetochore-Fiber Plus-End Dynamics. Curr. Biol. 29:3563-3578.e6.
11 doi:10.1016/j.cub.2019.08.061.
12 Dumontet, C., and M.A. Jordan. 2010. Microtubule-binding agents: a dynamic field of
13 cancer therapeutics. Nat. Rev. Drug Discov. 9:790–803. doi:10.1038/nrd3253.
14 Erpf, A.C., L. Stenzel, N. Memar, M. Antoniolli, M. Osepashvili, R. Schnabel, B.
15 Conradt, and T. Mikeladze-Dvali. 2019. PCMD-1 Organizes Centrosome Matrix
16 Assembly in C. elegans. Curr. Biol. 29:1324-1336.e6.
17 doi:10.1016/j.cub.2019.03.029.
18 Gomez-Ferreria, M.A., U. Rath, D.W. Buster, S.K. Chanda, J.S. Caldwell, D.R. Rines,
19 and D.J. Sharp. 2007. Human Cep192 Is Required for Mitotic Centrosome and
20 Spindle Assembly. Curr. Biol. 17:1960–1966. doi:10.1016/j.cub.2007.10.019.
21 Gönczy, P. 2015. Centrosomes and cancer: revisiting a long-standing relationship. Nat.
22 Rev. Cancer. 15:639–652. doi:10.1038/nrc3995.
23 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Habedanck, R., Y.D. Stierhof, C.J. Wilkinson, and E.A. Nigg. 2005. The Polo kinase
2 Plk4 functions in centriole duplication. Nat. Cell Biol. 7:1140–1146.
3 doi:10.1038/ncb1320.
4 Hanafusa, H., S. Kedashiro, M. Tezuka, M. Funatsu, S. Usami, F. Toyoshima, and K.
5 Matsumoto. 2015. PLK1-dependent activation of LRRK1 regulates spindle
6 orientation by phosphorylating CDK5RAP2. Nat. Cell Biol. 17:1024–1035.
7 doi:10.1038/ncb3204.
8 Haren, L., T. Stearns, and J. Lüders. 2009. Plk1-Dependent Recruitment of γ-Tubulin
9 Complexes to Mitotic Centrosomes Involves Multiple PCM Components. PLoS
10 One. 4:e5976. doi:10.1371/journal.pone.0005976.
11 Henriques, A.C., D. Ribeiro, J. Pedrosa, B. Sarmento, P.M.A. Silva, and H. Bousbaa.
12 2019. Mitosis inhibitors in anticancer therapy: When blocking the exit becomes a
13 solution. Cancer Lett. 440–441:64–81. doi:10.1016/j.canlet.2018.10.005.
14 Hyman, A.A. 2014. Pericentriolar material structure and dynamics. Philos. Trans. R.
15 Soc. Lond. B. Biol. Sci. 369. doi:10.1098/rstb.2013.0459.
16 Joukov, V., and A. De Nicolo. 2018. Aurora-PLK1 cascades as key signaling modules
17 in the regulation of mitosis. Sci. Signal. 11:eaar4195.
18 doi:10.1126/scisignal.aar4195.
19 Joukov, V., J.C. Walter, and A. De Nicolo. 2014. The Cep192-Organized Aurora A-
20 Plk1 Cascade Is Essential for Centrosome Cycle and Bipolar Spindle Assembly.
21 Mol. Cell. 55:578–591. doi:10.1016/j.molcel.2014.06.016.
24 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Kim, J., J. Kim, and K. Rhee. 2019. PCNT is critical for the association and conversion
2 of centrioles to centrosomes during mitosis. J. Cell Sci. 132:jcs225789.
3 doi:10.1242/jcs.225789.
4 Kim, J., K. Lee, and K. Rhee. 2015. PLK1 regulation of PCNT cleavage ensures fidelity
5 of centriole separation during mitotic exit. Nat. Commun. 6:10076.
6 doi:10.1038/ncomms10076.
7 Kim, S., and K. Rhee. 2014. Importance of the CEP215-Pericentrin Interaction for
8 Centrosome Maturation during Mitosis. PLoS One. 9:e87016.
9 doi:10.1371/journal.pone.0087016.
10 Kirkham, M., T. Müller-Reichert, K. Oegema, S. Grill, and A.A. Hyman. 2003. SAS-4
11 Is a C. elegans Centriolar Protein that Controls Centrosome Size. Cell. 112:575–
12 587. doi:10.1016/S0092-8674(03)00117-X.
13 Kollman, J.M., A. Merdes, L. Mourey, and D.A. Agard. 2011. Microtubule nucleation
14 by γ-tubulin complexes. Nat. Rev. Mol. Cell Biol. 12:709–721.
15 doi:10.1038/nrm3209.
16 Lecland, N., and J. Lüders. 2014. The dynamics of microtubule minus ends in the
17 human mitotic spindle. Nat. Cell Biol. 16:770–778. doi:10.1038/ncb2996.
18 Lee, K., and K. Rhee. 2011. PLK1 phosphorylation of pericentrin initiates centrosome
19 maturation at the onset of mitosis. J. Cell Biol. 195:1093–1101.
20 doi:10.1083/jcb.201106093.
25 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Lee, S., and K. Rhee. 2010. CEP215 is involved in the dynein-dependent accumulation
2 of pericentriolar matrix proteins for spindle pole formation. Cell Cycle. 9:775–784.
3 doi:10.4161/cc.9.4.10667.
4 Liu, P., E. Zupa, A. Neuner, A. Böhler, J. Loerke, D. Flemming, T. Ruppert, T. Rudack,
5 C. Peter, C. Spahn, O.J. Gruss, S. Pfeffer, and E. Schiebel. 2020. Insights into the
6 assembly and activation of the microtubule nucleator γ-TuRC. Nature. 578:467–
7 471. doi:10.1038/s41586-019-1896-6.
8 Moritz, M., M.B. Braunfeld, J.W. Sedat, B. Alberts, and D.A. Agard. 1995.
9 Microtubule nucleation by γ-tubulin-containing rings in the centrosome. Nature.
10 378:638–640. doi:10.1038/378638a0.
11 Morretton, J.-P., A. Herbette, C. Cosson, B. Mboup, A. Latouche, P. Gestraud, T.
12 Popova, M.-H. Stern, F. Nemati, D. Decaudin, G. Bataillon, V. Becette, D.
13 Meseure, A. Nicolas, O. Mariani, C. Bonneau, J. Barbazan, A. Vincent-Salomon,
14 F. Mechta-Grigoriou, S.R. Roman, R. Rouzier, X. Sastre-Garau, O. Goundiam, and
15 R. Basto. 2019. Centrosome amplification favours survival and impairs ovarian
16 cancer progression. bioRxiv. 623983. doi:10.1101/623983.
17 Natsume, T., T. Kiyomitsu, Y. Saga, and M.T. Kanemaki. 2016. Rapid Protein
18 Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short
19 Homology Donors. Cell Rep. 15:210–218. doi:10.1016/j.celrep.2016.03.001.
20 Nigg, E.A., and J.W. Raff. 2009. Centrioles, Centrosomes, and Cilia in Health and
21 Disease. Cell. 139:663–678. doi:10.1016/j.cell.2009.10.036.
26 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 O’Rourke, B.P., M.A. Gomez-Ferreria, R.H. Berk, A.M.U. Hackl, M.P. Nicholas, S.C.
2 O’Rourke, L. Pelletier, and D.J. Sharp. 2014. Cep192 controls the balance of
3 centrosome and non-centrosomal microtubules during interphase. PLoS One. 9.
4 doi:10.1371/journal.pone.0101001.
5 Schuh, M., and J. Ellenberg. 2007. Self-Organization of MTOCs Replaces Centrosome
6 Function during Acentrosomal Spindle Assembly in Live Mouse Oocytes. Cell.
7 130:484–498. doi:10.1016/j.cell.2007.06.025.
8 Seo, M.Y., W. Jang, and K. Rhee. 2015. Integrity of the Pericentriolar Material Is
9 Essential for Maintaining Centriole Association during M Phase. PLoS One.
10 10:e0138905. doi:10.1371/journal.pone.0138905.
11 Sir, J., M. Pütz, O. Daly, C.G. Morrison, M. Dunning, J. V Kilmartin, and F. Gergely.
12 2013. Loss of centrioles causes chromosomal instability in vertebrate somatic cells.
13 J. Cell Biol. 203:747–756. doi:10.1083/jcb.201309038.
14 Stehle, A., M. Hugle, and S. Fulda. 2015. Eribulin synergizes with Polo-like kinase 1
15 inhibitors to induce apoptosis in rhabdomyosarcoma. Cancer Lett. 365:37–46.
16 doi:10.1016/j.canlet.2015.04.011.
17 Takeda, Y., K. Yamazaki, K. Hashimoto, K. Watanabe, T. Chinen, and D. Kitagawa.
18 2020. The centriole protein CEP76 negatively regulates PLK1 activity in the
19 cytoplasm for proper mitotic progression. J. Cell Sci. jcs.241281.
20 doi:10.1242/jcs.241281.
27 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Teixido-Travesa, N., J. Roig, and J. Luders. 2012. The where, when and how of
2 microtubule nucleation - one ring to rule them all. J. Cell Sci. 125:4445–4456.
3 doi:10.1242/jcs.106971.
4 Tischer, J., and F. Gergely. 2019. Anti-mitotic therapies in cancer. J. Cell Biol. 218:10–
5 11. doi:10.1083/jcb.201808077.
6 Tsuchiya, Y., S. Yoshiba, A. Gupta, K. Watanabe, and D. Kitagawa. 2016. Cep295 is a
7 conserved scaffold protein required for generation of a bona fide mother centriole.
8 Nat. Commun. 7:12567. doi:10.1038/ncomms12567.
9 Tungadi, E.A., A. Ito, T. Kiyomitsu, and G. Goshima. 2017. Human microcephaly
10 ASPM protein is a spindle pole-focusing factor that functions redundantly with
11 CDK5RAP2. J. Cell Sci. 130:3676–3684. doi:10.1242/jcs.203703.
12 Watanabe, K., D. Takao, K.K. Ito, M. Takahashi, and D. Kitagawa. 2019. The Cep57-
13 pericentrin module organizes PCM expansion and centriole engagement. Nat.
14 Commun. 10:931. doi:10.1038/s41467-019-08862-2.
15 Weiß, L.M., M. Hugle, S. Romero, and S. Fulda. 2015. Synergistic induction of
16 apoptosis by a polo-like kinase 1 inhibitor and microtubule-interfering drugs in
17 Ewing sarcoma cells. Int. J. Cancer. n/a-n/a. doi:10.1002/ijc.29725.
18 Wieczorek, M., L. Urnavicius, S.-C. Ti, K.R. Molloy, B.T. Chait, and T.M. Kapoor.
19 2020. Asymmetric Molecular Architecture of the Human γ-Tubulin Ring Complex.
20 Cell. 180:165-175.e16. doi:10.1016/j.cell.2019.12.007.
21 Wong, Y.L., J. V Anzola, R.L. Davis, M. Yoon, A. Motamedi, A. Kroll, C.P. Seo, J.E.
22 Hsia, S.K. Kim, J.W. Mitchell, B.J. Mitchell, A. Desai, T.C. Gahman, A.K. Shiau,
28 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 and K. Oegema. 2015. Reversible centriole depletion with an inhibitor of Polo-like
2 kinase 4. Science (80-. ). 348:1155–1160. doi:10.1126/science.aaa5111.
3 Woodruff, J.B., B. Ferreira Gomes, P.O. Widlund, J. Mahamid, A. Honigmann, and
4 A.A. Hyman. 2017. The Centrosome Is a Selective Condensate that Nucleates
5 Microtubules by Concentrating Tubulin. Cell. 169:1066-1077.e10.
6 doi:10.1016/j.cell.2017.05.028.
7 Woodruff, J.B., O. Wueseke, and A.A. Hyman. 2014. Pericentriolar material structure
8 and dynamics. Phil. Trans. R. Soc. B. 369:20130459.
9 Yoshiba, S., Y. Tsuchiya, M. Ohta, A. Gupta, G. Shiratsuchi, Y. Nozaki, T. Ashikawa,
10 T. Fujiwara, T. Natsume, M.T. Kanemaki, and D. Kitagawa. 2019. HsSAS-6-
11 dependent cartwheel assembly ensures stabilization of centriole intermediates. J.
12 Cell Sci. 132:jcs217521. doi:10.1242/jcs.217521.
13 Zheng, Y., M.L. Wong, B. Alberts, and T. Mitchison. 1995. Nucleation of microtubule
14 assembly by a γ-tubulin-containing ring complex. Nature. 378:578–583.
15 doi:10.1038/378578a0.
16 Zhu, F., S. Lawo, A. Bird, D. Pinchev, A. Ralph, C. Richter, T. Müller-Reichert, R.
17 Kittler, A.A. Hyman, and L. Pelletier. 2008. The Mammalian SPD-2 Ortholog
18 Cep192 Regulates Centrosome Biogenesis. Curr. Biol. 18:136–141.
19 doi:10.1016/j.cub.2007.12.055.
20
21
29 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Acknowledgements
2 We thank the Kitagawa lab members for fruitful discussions. We thank Dr. Andrew Shiau
3 and Dr. Karen Oegema at Ludwig Institute for Cancer Research for providing centrinone
4 B. We are also thankful to Dr. Y. Nagumo for providing the SKOV-3 cells. This work
5 was supported by JSPS KAKENHI grants (Grant numbers: 24687026, 19H05651,
6 16H06168, 18K14705, and 17J02833) from the Ministry of Education, Science, Sports
7 and Culture of Japan, Takeda Science Foundation, Mochida Memorial foundation, and
8 Daiichi Sankyo Foundation of Life Science.
9
10 Author contributions
11 T.C. and D.K. designed the study; T.C., K.Y., K.F., K.W., Y.T., and Y.N. performed the
12 experiments; and T.C., K.Y., K.H., S.Y., Y.T., and D.K. designed the experiments. T.C.,
13 K.Y., Y.T., and D.T. analyzed the data; T.C., K.Y., and D.K. wrote the manuscript, which
14 was reviewed by all authors.
15
16 Competing financial interests
17 The authors declare no competing financial interests.
18
19
30 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Methods
2 Cell culture and transfection
3 HeLa and U2OS cells were obtained from the ECACC (European Collection of
4 Authenticated Cell Cultures). These cell lines were authenticated by Short Tandem
5 Repeat (STR) profiling at the ECACC. HeLa cells stably expressing EGFP-centrin1 have
6 been previously described(Tsuchiya et al., 2016). HeLa cells expressing pericentrin
7 endogenously tagged with mCherry were generated using the CRISPR/Cas9 system, as
8 previously described, with slight modifications(Natsume et al., 2016). GuideRNA oligos
9 (Pericentrin_gRNA_F: CACCGCTGTTTAATCATCGGGTGGC and
10 Pericentrin_gRNA_R: AAACGCCACCCGATGATTAAACAGC) were hybridized and
11 cloned into the BbsI site of pX330 (Addgene). To construct the donor plasmid for
12 homology-directed repair, the homology arms of the Pericentrin locus (chr21:47864730-
13 47865813) were amplified (pBS2_Pericentrin C-ter_InsF:
14 GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and
15 pBS2_Pericentrin C-ter_InsR:
16 CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA
17 of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A
18 BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle
19 of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F:
20 TACTTCAAAGAAATCTTGCCACCCGATGATTAAACAGGGATCCATAAAATG
21 TCATGGCTCTTTCCTGCGA, Pericentrin C-ter silent BamHI_R:
31 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 GCCATGACATTTTATGGATCCCTGTTTAATCATCGGGTGGCAAGATTTCTTT
2 GAAGTAGAATCTGCATATAAATAAAAATGAGG). The mCherry cassette
3 containing a hygromycin-resistant gene was introduced into the BamHI site in the middle
4 of the homology arms. The plasmids were introduced into the HeLa cell line stably
5 expressing EGFP-centrin1(Tsuchiya et al., 2016) and isolated using the limited dilution
6 method with hygromycin. Saos-2, A549, DAUDI, RAJI, HL60, K562, MKN45, MKN1,
7 DU145, PC-3, PANC-1, GI-1, A431, HMV-II, and MCF-7 were obtained from the
8 RIKEN BioResource Research Center. These cell lines were authenticated by STR
9 profiling at the RIKEN BioResource Research Center. HCT116 cells were obtained from
10 the American Type Culture Collection (ATCC CCL-247). HCT116 CMVOsTIR1
11 HsSAS6–AID have been previously described(Yoshiba et al., 2019). HCT116 cell lines
12 were cultured in McCoy’s 5A medium (Thermo Fisher Scientific) supplemented with
13 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml
14 streptomycin. SKOV-3 was provided Dr. Yoko Nagumo. HeLa, U2OS, A549, GI-1, and
15 A431 cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal
16 bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin at 37 °C in a 5%
17 CO2 atmosphere. Saos-2, DAUDI, RAJI, HL60, MKN45, MKN1, DU145, PC-3, PANC-
18 1, and SKOV-3 cells were cultured in RPMI1680 medium containing 10% fetal bovine
19 serum, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a 5%
20 CO2 atmosphere. K562 and HMV-II cells were cultured in Ham’s F12 medium
21 containing 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin at
22 37 °C in a 5% CO2 atmosphere. MCF-7 cells were cultured in MEM medium containing
32 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 10% fetal bovine serum, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 μg/ml
2 streptomycin at 37 °C in a 5% CO2 atmosphere. Transfection of siRNA constructs was
3 conducted using Lipofectamine RNAiMAX (Life Technologies). Unless otherwise noted,
4 the transfected cells were analyzed 48 h after transfection with siRNA.
5
6 RNA interference
7 The following siRNAs were used: Silencer Select siRNA (Life Technologies) against
8 CEP57 (s18692), CEP192 (s226819), CDK5RAP2 (s31429, s31430), pericentrin (s10136,
9 s10138), and negative control #1 (4390843).
10
11 Chemicals
12 The following chemicals were used in this study: Centrinone (PLK4 inhibitor, MedChem
13 Express, HY-18682), Centrinone B (PLK4 inhibitor, gift from Dr. Andrew Shiau and Dr.
14 Karen Oegema), BI2536 (PLK1 inhibitor, A10134; AdooQ), proTAME (APC/C inhibitor,
15 I-440, Boston Biochem), Cytochalasin B (actin inhibitor, Wako, 036-17553), paclitaxel
16 (/-tubulin stabilizer: Wako, 163-18614), SiR-Tubulin (Microtubule probe, CY-SC002;
17 SPIROCHROME).
18
19 Antibodies
20 The following primary antibodies were used in this study: rabbit polyclonal antibodies
33 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 against CDK5RAP2 (IHC00063: immunofluorescence [IF] 1:500, Western Blotting
2 [WB] 1:1000; Bethyl Laboratories), Cep192 (A302–324A, IF 1:1,000, WB 1:1000;
3 Bethyl Laboratories), Cep152 (A302–480A, IF 1:1,000; Bethyl Laboratories), CP110
4 (12780–1-AP, IF 1:1,000; Proteintech), CPAP/CENP-J (11517-1-AP, IF 1:100;
5 Proteintech), and α-tubulin (PM054, IF 1:300; MBL); mouse monoclonal antibodies
6 against γ-tubulin (GTU88) (T6557, IF 1:1,000; Sigma–Aldrich), Polyglutamylation
7 Modification (GT335, mAb) (AG-20B-0020-C100, IF 1:1,000; AdipoGen), α-tubulin
8 (T5168, IF 1:1,000; Sigma-Aldrich), HSP90 (610419, WB 1:5000; BD Biosciences)
9 pericentrin (ab4448, WB 1:1,000; Abcam) and pericentrin (ab28144, IF 1:1,000; Abcam).
10 Fluorescein isothiocyanate-labeled anti-GFP was purchased from Abcam (ab6662, IF
11 1:250 or 1:500). Alexa 488-labeled Cep152 (A302–480A, IF 1:250; Bethyl Laboratories)
12 was generated with Alexa Fluor labeling kits (Life Technologies) and used for three color
13 staining. The following secondary antibodies were used: Alexa Fluor 488 goat anti-mouse
14 IgG (H+L) (A-11001, 1:500; Molecular Probes), Alexa Fluor 555 goat anti-rabbit IgG
15 (H+L) (A-21428, 1:500; Molecular Probes), and Alexa Fluor 647 goat anti-mouse IgG
16 (ab150115, 1:500; Abcam).
17
18 Sample preparations for immunostaining
19 Cells were treated with 100 nM of centrinone or 500 nM of centrinone B for 1–3 days to
20 induce acentrosomal cells (Fig. 2A, B, F, G, S2A, B). To observe the microtubule
21 nucleation from PCM-poles (Fig. S2E), firstly, HeLa cells expressing pericentrin-
34 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 mCherry and EGFP-centrin1 were treated with 100 nM of centrinone for two days. Then,
2 cells were arrested in metaphase through treatment with 20 M of proTAME for 4 h and
3 incubated on ice for 1 h to depolymerize microtubules. Subsequently, cells were
4 incubated at 25 °C for 5 min. For the Sas-6 depletion experiments using the AID system
5 (Fig. S2C, D), the cells were incubated with 50 μM of indole-3-acetic acid (IAA) for two
6 days. To observe CEP192 localization at acentriolar poles (Fig. 4G), cells were treated
7 with 100 nM of centrinone and siRNA for two days. Then, cells were arrested in
8 metaphase through treatment with 20 M of proTAME for 6 h. To examine the effect of
9 siRNA on acentriolar cells (Fig. 4A, B, 5A, B, G, S3), cells were treated with 100 nM of
10 centrinone or 500 nM of centrinone B and siRNA for two days. For the chemical
11 perturbation experiments (Fig. 7E–G, 8D), cells were treated with 100 nM of centrinone
12 and BI 2536 for two days.
13
14 Western blotting
15 For preparation of total cell lysates, cells were lysed in 1× SDS sample buffer. SDS–
16 PAGE was performed using 6 or 10% polyacrylamide gels, followed by transfer on
17 Immobilon-P membrane (Millipore Corporation). Blocking was performed in 2.5% skim
18 milk in PBS containing 0.02% Tween (PBS-T) for 30 min at room temperature. The
19 membrane was probed with the primary antibodies for 12-18 h at 4℃, washed with PBS-
20 T three times. After that, the membrane was incubated with HRP-conjugated secondary
21 antibodies for 1 h at room temperature and washed with PBS-T three times. The signals
35 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 were detected with ECL Prime/Select reagents (GE Healthcare) or Chemi-Lumi One
2 Ultra (Nacalai Tesque) via the ChemiDoc XRSþ system (Bio-Rad).
3
4 Sample preparations for live-cell imaging
5 For live cell imaging, HeLa cells stably expressing EGFP-centrin1, HeLa cells expressing
6 pericentrin-mCherry and EGFP-centrin1, HeLa cells expressing CDK5RAP2-mCherry
7 and EGFP-centrin1, HeLa cells expressing mCherry–NuMA and EGFP–centrin1 were
8 cultured in 35-mm glass-bottom dishes (#627870; Greiner Bio-One) or 24-well
9 SENSOPLATE (#662892; Greiner Bio-One) at 37 °C in a 5% CO2 atmosphere.
10 To observe the dynamics of PCM (Fig. 3A–E) in one-centrosome or zero-
11 centrosome cells, cells were treated with 500 nM of centrinone B. To test the effect of
12 depletion of PCM proteins or CEP57 on one-centrosome cells (Fig. 4C–F, 5D–F), cells
13 were treated with siRNA with 100 nM of centrinone for two days. To test the effect of
14 drug combinations on mitotic cell fate (Fig. 8B, C, S5), the cell cycle progression of HeLa
15 cells expressing pericentrin-mCherry and EGFP-centrin1 was observed in the presence
16 of 100 nM centrinone and 1 nM BI 2536. To simultaneously observe one-centrosome
17 cells and zero-centrosome cells (Fig. S2C-E, S1G-I), after two days of treatment with
18 0.1% DMSO or 100 nM centrinone (to enrich zero-centrosome cells), HeLa cells
19 expressing EGFP-centrin1 were treated with siRNA with 0.1% DMSO or 100 nM of
20 centrinone. Prior to imaging, cells were incubated with 100 nM of SiR-Tubulin for 4 h to
21 visualize the microtubules.
36 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Microscopy for immunofluorescence analyses
3 For immunofluorescence analyses, the cells cultured on coverslips (No. 1; Matsunami)
4 were fixed using methanol at −20 °C for 7 min and washed with PBS. The cells were
5 permeabilized after fixation with PBS/0.05% TritonX-100 (PBSX) for 5 min, and blocked
6 in 1% BSA in PBSX for 30 min at room temperature. The cells were then incubated with
7 primary antibodies for 7–24 h at 4 °C, washed thrice with PBSX, and incubated with
8 secondary antibodies and 0.2 μg ml−1 Hoechst 33258 (DOJINDO) for 45–60 min at room
9 temperature. The cells were washed thrice with PBSX and mounted onto glass slides.
10 We counted the number of spindle patterns using a DeltaVision Personal DV-
11 SoftWoRx system (Applied Precision) or an Axioplan2 fluorescence microscope (Carl
12 Zeiss). Confocal microscopy images were captured by the Leica TCS SP8 system. For
13 deconvolution for confocal microcopy images, Huygens essential software (Scientific
14 Volume Imaging) was used.
15 STED images were taken using a Leica TCS SP8 STED 3X system with a Leica
16 HCPL APO 100 × /1.40 oil STED WHITE and a 660 nm laser line for depletion. Scan
17 speed was set to 100 Hz with 5× line averaging in a 512 × 80 px format (pixel size 15–
18 20 nm). The Z interval was set to 180 nm. The STED images were processed by
19 deconvolution using the Huygens Professional software (SVI).
37 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Maximum intensity z-projections of a representative picture for each condition
2 were generated using the FIJI distribution of the ImageJ software. The number and step
3 sizes of z-planes are described in the figure legends.
4
5 Microscopy for live imaging
6 A Confocal Scanner Box, Cell Voyager CV1000 (Yokogawa Electric Corp.) equipped
7 with a 60 × oil immersion objective or CQ1 Benchtop High-Content Analysis System
8 equipped with a 40× objective was used for live cell imaging. Imaging was initiated after
9 the addition of drugs or 24–48 h after transfection, and images were acquired every
10 10 min for 24–48 h. Maximum intensity z-projections of representative images for each
11 condition were generated using the FIJI distribution of the ImageJ software. The number
12 and step sizes of z-planes are described in the figure legends.
13
14 Cell viability
15 Cell viability was determined using the WST-8 assay. Exponentially growing cells (1 ×
16 103 cells/well in a 96-well plate) were treated with compounds for three (Fig. 8A, Table
17 S2) or four (Fig. 8E, Table S1) days. WST-8 assay reagents (DOJINDO) were added to
18 the culture. After several hours of incubation, the absorbance at 450 nm was measured
19 with FilterMax F3 & F5 Multi-Mode Microplate Readers (Molecular Devices). After
20 subtracting the background (blank well), cell viability (control %) was determined.
38 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1
2 Statistical analysis
3 Statistical analyses were performed using the GraphPad Prism 7 software. Except for
4 Fig. 6B, p-values were determined by non-parametric methods (Mann–Whitney U-test
5 or Kruskal–Wallis test). P-value in Fig. 6B was determined by One-way ANOVA with
6 Tukey’s multiple comparisons test Details are described in the figure legends.
7
8 Data availability
9 The data supporting the findings of this study are available from the corresponding
10 authors upon request.
39 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure legends
2 Figure 1. CEP192 at centriolar wall, but not the expanded PCM mediated by
3 pericentrin and CDK5RAP2, is sufficient for bipolar spindle formation
4 (A) Time-lapse observation of the structure of microtubules upon siRNA treatment
5 against the indicated proteins. HeLa cells expressing EGFP-centrin1 and pericentrin-
6 mCherry were observed with a 40× objective. Gray represent SiR-tubulin, respectively.
7 Z-projections: 10 planes, 2.2 µm apart. Scale bar, 10 µm. Time zero corresponds to
8 nuclear envelope break down (NEBD). (B) Mitotic duration, the time required from
9 NEBD to cytokinesis, in (A). Line and error bars represent the mean and SD (N ≥ 50 cells
10 from two independent experiments). Kruskal–Wallis test was used to determine the
11 significance of the difference. *P < 0.05. (C) The localization of PCM proteins in mitotic
12 spindles of the cells in which the indicated protein was depleted. Red and green represent
13 PCM proteins (CDK5RAP2, Cep192 or PCNT) and GT335, respectively. Z-projections
14 of 10 sections, every 0.3 m. Scale bar, 1 m. (D) The signal intensity of PCM proteins
15 on mitotic centrosomes of fixed HeLa cells was analyzed (N>45 for each condition). Line
16 and error bars represent median with interquartile range. Kruskal–Wallis test was used to
17 determine the significance of the difference. *P < 0.05, **P < 0.0001. (E) STED images
18 showing centriolar distribution of Cep192 in PCNT/CDK5RAP2 double-depleted cells.
19 HeLa cells were treated with control siRNA or PCNT/CDK5RAP2 siRNA for 48 h and
20 stained with the indicated antibodies. Scale bar, 1 m. (F, G) Representative line intensity
21 profiles (F) and measured diameters (G) of GT335 and Cep192. The line profiles were
22 measured along the dotted lines in (E). The profiles were fitted with double Gaussian
40 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 curves and the distances between the half-maximal intensity points at the far ends were
2 measured as the diameters (schematically indicated with dotted lines and arrows in the
3 profiles; fitted curves are not shown). Horizontal bars and error bars in the plots for the
4 diameters represent median and interquartile range. N = 18 (for siControl) or 22 (for
5 siPCNT/CDK5RAP2) centrosomes; data from two independent experiments were pooled.
6 Mann–Whitney U-test was used to determine the significance of the difference. *P <
7 0.0001.
8
9
41 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 2. Cells with one centrosome can organize bipolar spindles in mitosis by
2 forming a PCM-positive acentriolar spindle pole (PCM-pole).
3 (A) Schematic illustration of centrinone-induced removal of centriole. (B) DMSO-treated
4 control mitotic spindles (two centrosomes) and centrinone B-treated centrosome-depleted
5 spindles (one or zero centrosomes). Green, red, and blue represent GT335
6 (polyglutamylated centriole microtubules), α-tubulin, and DNA, respectively. Z-
7 projections: 12 planes, each 0.13 m apart. Scale bar, 5 m. (C-E) Mitotic duration, the
8 time required from NEBD to cytokinesis, in DMSO-treated two-centrosome (C),
9 centrinone-treated one-centrosome (D) and zero-centrosome (E) cells, in Fig (S1G-I).
10 Line and error bars represent the mean and SD (N ≥ 20 cells from two independent
11 experiments). Kruskal–Wallis test was used to determine the significance of the
12 difference. *P < 0.05, **P < 0.005, *** P < 0.0001. (F) Distribution of centrosomal
13 factors in centriolar and acentriolar spindle poles. DMSO-treated control mitotic spindles
14 (two centrosomes) and centrinone-treated mitotic spindles (one or zero centrosome) in
15 HeLa cells. Green, red, and blue represent GT335, the protein of interest (Pericentrin,
16 CDK5RAP2, or CEP192), and DNA, respectively. Z-projections: 21 sections, every 1
42 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 m. Scale bar, 10 m. (G) Quantification of pole patterns in (F). Values are presented as
2 mean percentages from two independent experiments (N = 25 for each experiment). (H)
3 Schematic illustration of PCM localization at spindle poles in two-, one- or zero-
4 centrosome cells.
5
6
43 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 3. The PCM-pole is formed by splitting PCM from the centriolar pole or by
2 accumulation of PCM components.
3 (A–D) HeLa cells expressing EGFP-centrin1 and pericentrin-mCherry were observed
4 with a 60× objective. Magenta and green represent pericentrin and centrin, respectively.
5 Z projections: 20 planes, 1.2 m apart. Scale bar, 10 m. Time zero corresponds to the
6 beginning of mitotic cell rounding. (A) Splitting of the PCM components from the
7 centriolar pole in one-centrosome cells. Arrowheads indicate the PCM at the acentriolar
8 spindle pole. (B) PCM accumulation in one-centrosome cells. Arrowheads indicate the
9 accumulation of PCM at acentriolar spindle poles. (C) Cell division in zero-centrosome
10 cells without accumulation of PCM. (D) Quantification of patterns of PCM dynamics in
11 (A–C). Values are percentages of the total cells from 52 (for one-centrosome cells) or 24
12 (for zero-centrosome cells) cells from two independent experiments. (E) Averaged time
13 courses of pericentrin-mCherry or CDK5RAP2-mCherry signals at the centriolar spindle
14 pole and PCM-pole of 10 cells. Time course data were aligned at PCM-pole formation (0
15 h). Error bars, SD; A.U., arbitrary units. (F) Schematic illustration of PCM-pole
44 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 formation by splitting PCM from the centriolar spindle pole or by accumulation of PCM
2 components.
3
45 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 4. Pericentrin and CDK5RAP2 are crucial for spindle elongation and spindle
2 bipolarization of one-centrosome cells.
3 (A) Mitotic spindle structures upon siRNA treatment with or without 500 nM of CentB.
4 Green, red, and blue represent GT335, α-tubulin, and DNA, respectively. Z-projections:
5 5 planes, 0.3 m apart. Scale bar, 5 m. (B) Frequency of mitotic spindle structures after
6 siRNA treatment against the indicated proteins in (A). Values are presented as mean
7 percentages. N > 86, data from two independent experiments were pooled. (C) Time-
8 lapse observation of the structure of NuMA and microtubules upon siRNA treatment
9 against the indicated proteins. Centrinone-treated one-centrosome HeLa cells expressing
10 EGFP-centrin1 and pericentrin-mCherry were observed with a 40× objective. Red, green,
11 and gray represent NuMA, centrin, and, SiR-tubulin, respectively. Z-projections: 10
12 planes, 2.2 m apart. Scale bar, 10 m. Time zero corresponds to nuclear envelope break
13 down (NEBD). Arrowheads indicate the separated two NuMA foci. (D) The time required
14 for the initial establishment of two poles of NuMA in (C). Line and error bars represent
15 the mean and SD (N ≥ 60 cells from three independent experiments). Kruskal–Wallis
16 test was used to determine the significance of the difference. n.s., not significantly
46 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 different (P > 0.05). (E) Mitotic duration, the time required from NEBD to cytokinesis,
2 in (C). Line and error bars represent the mean and SD (N ≥ 60 cells from three
3 independent experiments). Kruskal–Wallis test was used to determine the significance of
4 the difference. *P < 0.01, **P < 0.001. (F) Table of the times from nuclear envelope
5 break down (NEBD) to cytokinesis in (E). (G) The signal intensity of CEP192 on
6 acentrosomal spindle poles. Line and error bars represent the mean and SD (N ≥ 46 cells
7 from two independent experiments). Kruskal–Wallis test was used to determine the
8 significance of the difference. *P < 0.0001.
9
47 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 5. CEP57 depletion leads to an increase of PCM at the acentriolar pole and
2 facilitates spindle bipolarization in one-centrosome cells.
3 (A) Mitotic spindle pole structures of one-centrosome cells upon CEP57 depletion. Green,
4 red, and blue represent centrin, pericentrin, and DNA, respectively. Z-projections: 20
5 planes, 0.5 m apart. Scale bar, 5 m. (B) The signal intensity of pericentrin on
6 centrosomes or PCM-poles in (A). Line and error bars represent the mean and SD (N ≥
7 50 cells from two independent experiments). Kruskal–Wallis test was used to determine
8 the significance of the difference. *P < 0.01. (C) Schematic illustration of CEP57-
9 depletion-induced pericentrin accumulation at the PCM-pole. (D) Time-lapse observation
10 of NuMA structures and microtubules upon CEP57 depletion. Centrinone-treated one-
11 centrosome HeLa cells expressing EGFP-centrin1 and pericentrin-mCherry were
12 observed with a 40× objective. Red, green, and gray represent NuMA, centrin, and SiR-
13 tubulin, respectively. Z-projections: 10 planes, 2.2 m apart. Scale bar, 10 m. Time zero
14 corresponds to mitotic onset. (E) The time required for the initial establishment of two
15 poles of NuMA in (D). Line and error bars represent the mean and SD (N ≥ 50 cells from
16 two independent experiments). The Mann–Whitney U‐test (two‐tailed) was used to obtain
17 a P-value. n.s., not significantly different (P > 0.05). (F) Mitotic duration, the time
48 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 required from nuclear envelope break down (NEBD) to cytokinesis, in (D). Line and error
2 bars represent the mean and SD (N ≥ 50 cells from two independent experiments). The
3 Mann–Whitney U‐test (two‐tailed) was used to obtain a P-value. *P < 0.0001. (G)
4 Frequency of mitotic spindle structures upon CEP57 depletion. Values are presented as
5 mean percentages ± SD (N = 6, triplicates, two independent experiments, at least 29
6 spindles in each assay).
7
49 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 6. Pericentrin is crucial for the bipolar spindle elongation in cells with two
2 centrosomes.
3 (A) Mitotic spindle structures upon treatment with siRNA in cells with two centrosomes.
4 Red and blue represent α-tubulin and DNA, respectively. Z-projections: 21 planes, 1 m
5 apart. Scale bar, 5 m. (B) Quantification spindle length of HeLa cells (N > 14, triplicates,
6 from two independent experiments). Line and error bars represent the mean and SD. One-
7 way ANOVA with Tukey’s multiple comparisons test was used to determine the
8 significance of the difference. *P < 0.005. (C) CEP192 observed in two-centrosome cells.
9 Red, and blue represent GT335, CEP192, and DNA, respectively. Z-projections: 20
10 planes, 0.5 m apart. Scale bar, 5 m. (D) The signal intensity of CEP192 on centrosomes
11 in (C). Line and error bars represent the mean and SD (N ≥ 50 cells from two independent
12 experiments). Kruskal–Wallis test was used to determine the significance of the
13 difference. *P < 0.0001. n.s., not significantly different. (E) Time-lapse observation of
14 the structure of microtubules upon depletion of pericentrin in HeLa cells were observed
15 with a 40× objective. Gray represent SiR-tubulin, respectively. Z-projections: 10 planes,
16 2.2 m apart. Scale bar, 10 m. Time zero corresponds to nuclear envelope break down
17 (NEBD). (F) Averaged time courses of the pole length at each time point in (E). The
50 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 length between two poles of spindle was measured from 40 cells from two independent
2 experiments. Time course data were aligned at the time of the NEBD (0 min). Error bars,
3 SD. (G) Mitotic spindle structures of A549 and U2OS cells. Red, and blue represent α-
4 tubulin, and DNA, respectively. Z-projections: 31 planes, 0.5 m apart. Scale bar, 10 m.
5 Quantification spindle length of A549 (H) and U2OS (I) cells (N > 40 from two
6 independent experiments). Line and error bars represent the mean and SD. The Mann–
7 Whitney U‐test (two‐tailed) was used to obtain a P-value. *P < 0.005, **P < 0.0001.
8
51 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 7. PLK1 is crucial for PCM-pole formation and bipolar spindle formation in
2 one-centrosome cells.
3 (A, B) PLK1 and phosphorylated PLK1 observed in one-centrosome cells. (A) Red, green,
4 and blue represent PLK1, GT335, and DNA, respectively. Z-projections: 20 planes, 1 m
5 apart. Scale bar, 10 m. (B) Frequency of localization of PLK1 in (A). Values are
6 presented as mean percentages from two independent experiments (N > 40 from two
7 experiments). (C) Red, green, and blue represent phosphorylated PLK1, centrin, and
8 DNA, respectively. Z-projections of 20 sections, every 1 m. Scale bar, 5 m. (D)
9 Frequency of localization of phosphorylated PLK1 in (A). Values are presented as mean
10 percentages from triplicates (N > 40 from two experiments). (E) Mitotic spindle
11 structures upon PLK1 inhibition with or without 100 nM of centrinone. HeLa cells
12 expressing EGFP-centrin1 and Pericentrin-mCherry were observed with a 63× objective.
13 Green, red, gray, and blue represent GFP (centrin1), RFP (Pericentrin), α-tubulin, and
14 DNA, respectively. Z-projections: 10 planes, 0.3 m apart. Scale bar, 5 m. (F)
15 Frequency of mitotic spindle structures in (A). Values are mean percentages from two
16 independent experiments (N = 50 for each experiment). (G) The signal intensity of
52 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Pericentrin on centrin foci of fixed mitotic HeLa cells expressing EGFP-centrin1 and
2 Pericentrin-mCherry (N > 45 for each condition). Line and error bars represent median
3 with interquartile range. Kruskal–Wallis test was used to determine the significance of
4 the difference. *P < 0.05, **P < 0.0001.
5
53 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 8. Dual inhibition of PLK1 and PLK4 prevents cancer cell proliferation.
2 (A) Dual inhibition of PLK1 and PLK4 induced cell death in HeLa cells. Cell viability
3 (% of DMSO or CentB mono-treatment) was determined after treatment with CentB and
4 various concentrations of PLK1 inhibitor. (B) Mitotic cell fate of individual cells upon
5 PLK1 and PLK4 dual inhibition. After centrosome depletion, treatment with a low dose
6 of PLK1 inhibitor induced cell death. The mitotic cell fate of HeLa cells expressing
7 EGFP-centrin1 and pericentrin-mCherry after treatment with 100 nM of centrinone, 1 nM
8 of BI2536, or 100 nM of centrinone + 1 nM of BI2536 was observed compared to DMSO
9 alone (solvent control). Cells were observed with a 60× objective. Z-projections: 30
10 planes, 1 m apart. Scale bar, 5 m. Time zero corresponds to the beginning of mitotic
11 cell rounding. (C) Frequency of mitotic events in (B). Values are presented as percentages.
12 N = 205 (for DMSO control, two centrosomes), 211 (for BI, two centrosomes), 107 (for
13 centrinone, two centrosomes), 92 (for centrinone + BI, two centrosomes), 205 (for
14 centrinone, one centrosome), 60 (for centrinone + BI, one centrosome) cells; data from
15 two independent experiments were pooled. (D) Dual inhibition of PLK1 and PLK4
16 induced the cleavage of PARP. HeLa cells were treated with the drugs for 48 h and PARP
17 cleavage was analyzed by western blotting. The concentrations of centrinone and BI 2536 54 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 were 100 nM and 1 nM, respectively. (E) Dual inhibition of both PLK1 and PLK4 in
2 various cancer cell lines. After four days of treatment with 500 nM of centrinone B and
3 various concentrations of BI2536 (0, 0.1, 0.5, 1, 2, 5, 10, or 20 nM), cell viability (% of
4 DMSO control) was determined and is shown as a heat map. The ratios between IC50
5 values ( centrinone B) are shown below the heat map. Exact IC50 values are provided in
6 Table 1.
7
55 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Figure 9. The Centriole and PCM cooperate to recruit CEP192 to the spindle pole
2 to facilitate bipolar spindle formation
3 Schematic illustration of the assembly of CEP192 at the spindle pole by the centriole and
4 PCM in human cells. For details, see the Discussion section.
5
56 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplementary Figure 1. Depletion of PCM components in two-, one-, and zero-
2 centrosome cells.
3 (A-C) Western blot analysis of the efficiency of protein depletion of CEP192 (A),
4 CDK5RAP2 (B) and pericentrin (C) after 48 h of siRNA transfection in HeLa cells. (D-
5 F) Quantification of depleted centrosomal CEP192 (D), CDK5RAP2 (E) and pericentrin
6 The Mann–Whitney U‐test (two‐tailed) was used to obtain a P-value. (P < 0.0001). (G-
7 I). Time-lapse observation of the structure of microtubules upon siRNA treatment against
8 the indicated proteins. DMSO-treated two-centrosome (G), centrinone-treated one-
9 centrosome (H), and centrinone-treated zero-centrosome (I) HeLa cells expressing
10 EGFP-centrin1 and pericentrin-mCherry were observed with a 40× objective. Gray
11 represent SiR-tubulin, respectively. Z-projections: 10 planes, 2.2 m apart. Scale bar, 10
12 m. Time zero corresponds to nuclear envelope break down (NEBD).
13
14
15
57 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplementary Figure 2. Distribution of centrosomal factors in centriolar and
2 acentriolar spindle poles.
3 (A–D) Distribution of centrosomal factors in centriolar and acentriolar spindle poles. (A)
4 DMSO-treated control mitotic spindles (two centrosomes) and centrinone-treated
5 spindles (one or zero centrosomes) of HeLa cells. Green, red, and blue represent GT335,
6 protein of interest (γ-tubulin, CEP152, or CPAP), and DNA, respectively. Z-projections:
7 21 planes, 1 m apart. Scale bar, 10 m. (B) PCM-poles were observed in various cells.
8 Magenta, cyan, and blue represent CEP192, GT335, and DNA, respectively. Z-
9 projections: 40 planes, 0.3 m apart. Scale bar, 5 m. (C) PCM-poles were observed in
10 one-centrosome spindles induced by SAS6 depletion. Red, green, and blue represent
11 centrin, pericentrin, and DNA, respectively. Scale bar, 5 m. (D) Quantification of pole
12 patterns in (C). Values are presented as mean percentages from three independent
13 experiments (N = 20 for each experiment). (E) Microtubule nucleation from the PCM-
14 pole. Following treatment with ice, microtubule nucleation (5 min at 25°C) was observed
15 in one-centrosome cells. Gray, red, green, and blue in the merged image represent EB1,
58 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 pericentrin, centrin, and DNA, respectively. Z-projections: 21 planes, 1 m apart. Scale
2 bar, 5 μm.
3
4
59 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplementary Figure 3. Pericentrin and CDK5RAP2 are crucial for the cell
2 division of one-centrosome cells.
3 (A-D) Mitotic spindle structures in siPCM-treated RPE1 (A) and A549 (C) cells. After a
4 2-day siRNA treatment with or without 100 nM of centrinone, mitotic spindle structures
5 were observed with a 63× objective. Green, red, and blue represent GT335, α-tubulin,
6 and DNA, respectively. Z projections: 31 planes, 0.5 m apart. Scale bar, 10 m.
7 Frequency of mitotic spindle structures in RPE1 (B) and A549 (D) cells. Values are mean
8 percentages from two independent experiments (N > 20 for each experiment).
9
10
11
60 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplementary Figure 4. Pericentrin is critical for proper spindle elongation in two-
2 centrosome cells.
3 (A) Time-lapse observation of the structure of microtubules upon siRNA treatment
4 against the indicated proteins. HCT116 cells were observed with a 40× objective. Gray
5 represent SiR-tubulin, respectively. Z-projections: 10 planes, 2.2 m apart. Scale bar, 10
6 m. Time zero corresponds to nuclear envelope break down (NEBD). (B) Averaged time
7 courses of the pole length at each time point in (A). The length between two poles of
8 spindle was measured from 40 cells from two independent experiments. Time course data
9 were aligned at the time of the NEBD (0 min). Error bars, SD. (C) The time required for
10 the establishment of two spindle poles in (A). Line and error bars represent the mean and
11 SD (N ≥ 75 cells from two independent experiments). The Mann–Whitney U‐test (two‐
12 tailed) was used to obtain a P-value. (P < 0.05). (D) Mitotic spindle structures of RPE1,
13 GI1, SKOV3, A431 and PANC1 cells. Red, and blue represent α-tubulin, and DNA,
14 respectively. Z-projections: 31 planes, 0.5 m apart. Scale bar, 10 m. (E-I)
15 Quantification spindle length (N > 40 from two independent experiments) in (D). Line
61 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 and error bars represent the mean and SD. The Mann–Whitney U‐test (two‐tailed) was
2 used to obtain a P-value. (P < 0.0005). n.s., not significantly different.
3
62 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Supplementary Figure 5. Dual inhibition of PLK1 and PLK4 prolongs mitosis and
2 induces cell death in one-centrosome HeLa cells.
3 Each plot shows the cumulative percentage of cell division or cell death in mitosis at each
4 time point of Fig. 6B, C. N = 205 (for DMSO control, two centrosomes), 211 (for BI, two
5 centrosomes), 107 (for centrinone, two centrosomes), 92 (for centrinone + BI, two
6 centrosomes), 205 (for centrinone, one centrosome), 60 (for centrinone + BI, one
7 centrosome) cells; data from two independent experiments were pooled.
8 9
10
11
12
63 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Table S1. IC50 values of BI 2536 against the growth of various cancer cells with or 2 without centrinone B (CentB).
IC50 values IC50 values
of BI2536 of BI2536 Ratio of IC50 values Cell line Type of cancer (nM) (nM) (−CentB/+CentB) (−CentB) (+CentB) HeLa Cervical cancer 1.1 ± 0.1 0.4 ± 0.2 2.8 U2OS Osteosarcoma 11.0 ± 3.9 3.6 ± 0.6 3.1 Saos-2 Osteosarcoma 2.1 ± 0.4 0.8 ± 0.3 2.6 A549 Lung carcinoma 2.3 ± 0.6 1.1 ± 0.2 2.1 DAUDI Burkitt lymphoma 3.5 ± 0.6 1.4 ± 0.3 2.5 RAJI Burkitt lymphoma 4.5 ± 0.9 1.0 ± 0.1 4.5 Not Not HL60 Leukemia Not determined determined determined K562 Leukemia 13.4 ± 0.5 2.1 ± 0.6 6.4 MKN45 Gastric cancer 4.7 ± 1.3 2.4 ± 0.3 2.0 MKN1 Gastric cancer 4.1 ± 0.9 3.4 ± 1.3 1.2 Prostate carcinoma brain DU145 3.1 ± 0.7 1.2 ± 0.4 2.6 metastasis Prostate carcinoma bone PC-3 3.7 ± 1.8 2.0 ± 0.9 1.9 metastasis PANC-1 Pancreatic carcinoma 3.3 ± 0.8 2.2 ± 0.6 1.5 GI-1 Glioma 3.5 ± 0.2 2.4 ± 0.4 1.5 HCT116 Colon cancer 5.7 ± 4.0 3.2 ± 1.6 1.8 SKOV-3 Ovarian cancer 2.9 ± 0.6 1.7 ± 0.3 1.7 A431 Epidermoid carcinoma 2.5 ± 0.5 2.0 ± 0.9 1.3 HMV-II Melanoma 10.6 ± 3.0 7.6 ± 4.3 1.4 MCF-7 Breast adenocarcinoma 6.4 ± 1.6 4.3 ± 1.3 1.5
64 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Various cancer cells were treated with BI 2536 with or without 500 nM of centrinone B
2 for four days and their viabilities were determined using the WST-8 assay. IC50 values
3 and the ratio between IC50 values (CentB) are shown. Related to Fig. 6E.
4
5 Table S2. IC50 values of mitotic inhibitors against the growth of HeLa cells with or
6 without centrinone B (CentB).
Ratio of IC50 IC50 values (- IC50 values Compounds (Targets) values (- CentB) (+CentB) CentB/+CentB) BI2536 (PLK1) 1.1 nM 0.6 nM 1.8 Cytochalasin B (-actin) 1.5 M 1.6 M 0.9 Paclitaxel (-tubulin) 1.8 nM 1.7 nM 1.1
7 HeLa cells were treated with several compounds with or without 500 nM of centrinone B
8 for 3 days and their viabilities were determined by WST-8 assay. IC50 values (average
9 from at least two independent assays) and the ratio between IC50 values (CentB) were
10 shown.
11
65
bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Figure 1, Chinen, Yamazaki et al A 2-centrosome (min) B -10 0 NEBD 10 20 30 40 n.s. 500 *
● siControl 400 ● ● -10 0 60 120 190 220 300 ● ●●●●●●●● ●● ● ●●● 200 ●● ●●● ● ●●●● ●● ●●●● ● 100 ●●● ●●●● ●●● ●●●●●●●●●●●●●●●●●●● ●●● ●●●●●●●●●●●●●● siCEP192 ●●●●●●●●●●●●●●●●●●●●●●●● ● ●●●●●●●●●●●●●●●● ●●●● ●●●●●●● Time from NEBD from Time
to cytokinesis(min) to 0 -10 0 10 20 30 40 siControl siPericentrin /CDK5RAP2 siControl siCEP192 Time from NEBD to cytokinesis (min) SiR-Tubulin siCEP192 siPericentrin * /CDK5RAP2 ** C siPericentrin D 2.0 ** siControl siCEP192 /CDK5RAP2 1.0 /GT335 CEP192
0 siPericentrin.CDK5RAP2 ** ** ** CDK5RAP2 1.0 /GT335
CDK5RAP2 0 **
CEP192 ** 1.0 **
0.5 /GT335
Pericentrin 0 Pericentrin
GT335 siControl siCEP192 siPericentrin /CDK5RAP2 E F siControl G GT335 MERGE GT335 CEP192 1.2 0.4 n.s. 1 m) 0.8 µ 0.3 0.6 GT335 0.2 0.4 CEP192 0.1 Diameter ( Diameter 0.2 0 siControl 0 CEP192 0.2 0.7 1.2 * 0.8
siPericentrin/CDK5RAP2 m)
1.2 µ 0.6 1 0.4 0.8 0.2
GT335 ( Diameter 0.6 0 0.4 CEP192 0.2 siPericentrin /CDK5RAP2 0 0.2 0.7 1.2 siControl siPericentrin
Diameter (µm) /CDK5RAP2 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 2, Chinen, Yamazaki et al
A Centrosomes 2 1 0 Centrinone B
2~3days Fixation & IF
Centrosome GT335 a-Tubulin DNA Cell
E C 2-centrosome D 1-centrosome 0-centrosome n.s. * n.s. n.s. * * n.s. * * * n.s. 500 1400 * 1200 ● ● ● ● ● ● 1200 1000 400 ● ● ●● 1000 ● ● ● 800 ● ● 300 ●● 800 ● ●● ● ●● ● ●●● ● 600 ●● ● ● ●● ● ● ●●● 600 ●● ● ● 200 ●●●● ● ● ●● ●● ● ● ● ●● ●● ● ●● ●● ● ● ●● ●●● ●●●● ● ● ●● ● ● ● 400 ● ●●●● ● ●●● ●● ●●●● ● ● ●●●● ● ● ● ● 400 ● ●●● ● ●● ● ●●●●●● ●● ● ●●● ● ●● ●●●● ●● ●●● ●●● ● ● ●●●● ●●●●●●● ●● ●● ●●●● ●●● ● ●●●● ●● ●● ● 100 ● ●●●● ●●●● ●●●● ●●●● ●●●●● ● ●●● ●●●●● ●●●● ●● ●●●●● ●●●●●●● ●● ●●●●●●●●●●●● ●●●●●● ●●●●●● ●●●● ●●● ●●●● 200 ●● ●●● ●●●●●●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● 200 ●●●●●●●● ●●● ● ●●●●● ●●●●● ●●●●●● ●●●●● ●●●●●●●●●●● ●●●●●●●● ●●●●●●●●●●●● ●●●● ●●●● ●●●●● ●●● ●●●●●●●●● ●●●●●● 0 0 ● ● 0 ● Time from NEBD Time from NEBD Time from NEBD to citokinesis (min) to citokinesis (min) to citokinesis (min) siControl siControl siControl siCep192 siCep192 siCep192 siPericentrin siPericentrin siPericentrin siCDK5RAP2 siCDK5RAP2 siCDK5RAP2
10 um F Centrosomes G Centrosomes PCM 2 1 0 1 0 Centriole
PCM at acentriolar pole
Pericentrin No PCM at acentriolar pole
1-centrosome 0-centrosome 100 100
CDK5RAP2 80 80 60 60 40 40 Cells(%) 20 20
CEP192 0 0 GT335 DNA CPAP CPAP Tubulin Tubulin - - CEP152 CEP192 CEP152 CEP192
H Centrosomes γ γ Pericentrin Pericentrin 2 1 0 CDK5RAP2 CDK5RAP2
PCM Centriole bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Figure 3, Chinen, Yamazaki et al A 1-centrosome (min): Split -10 10 50 60 70 80 140 150 MERGE Centrin Pericentrin
B 1-centrosome (min): Accumulation 50 60 110 120 150 160 170 Pattern 1 Pattern
0 30 50 90 170 230 240 Pattern 2 Pattern
EGFP-Centrin Pericentrin-mCherry
C 0-centrosome (min): No accumulation 0 30 60 90 150 200 250
EGFP-Centrin Pericentrin-mCherry D Pole split E 1-centrosome Accumulation Pericentrin CDK5RAP2 No accumulation 7000 10000 6000 100 8000 5000 Centriolar pole 80 6000 60 4000 PCM-pole 40 3000 4000 20 2000 Cells(%)
Fluorescence (AU) Fluorescence 2000 0 1000 1 0 0 0 0 1 2 3 4 Centrosomes 0 1 2 3 4 Time after PCM-pole formation (h) F Accumulation of PCM
PCM Centriole Split of PCM C A Figure 4, Chinen, Yamazaki D G 1-centrosome 2-centrosome siPericentrinsiCDK5RAP2 siControl Time from NEBD to establishment 1 Bipolar Bipolar - - - - 10 10 10 centrosome (min)
of NuMA two foci (min) siControl
CEP192 at acentriolar pole 100 150 200 50 0
(normalized to siControl signal) bioRxiv preprint 0 1 2 3 preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. ● 1 1 ● ● ● ● ● ● ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● ● centrosome centrosome ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●
siControl ● ● ● ● ● ● ● ● ● siControl n.s ● ● ● ● 0 0 0 ● * ● siCDK5RAP2 ● ● n.s ● ● ● ● ● . ● ● ● ● Monopolar Bipolar ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● * ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● doi: ● ● siCDK5RAP2 ● ● ● . ● ●
siCDK5RAP2 ● ● ● ● ● ● ● ● ● ● ● ● ● https://doi.org/10.1101/2020.11.10.377341 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● GT335 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●
● siPericentrin ● ● ● ●
siPericentrin ● ● ● ● ● NuMA 10 20 10 E a siPericentrin two foci two - Monopolar Bipolar
Time from NEBD Tubulin to cytokinesis (min) al et 1000 1500 500 0 130 100 50 DNA 1 ● ● - ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● centrosome ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● EGFP ● ●
siControl ● ● ● ** ● ● ● ● ● ● ● ● ● ● ● ● * ● ● ● ● ● B ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siCDK5RAP2 ● - Centrin 240 170 ; 80 ● ● this versionpostedNovember11,2020. ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●
● Cells (%) ● ● ● ●
siPericentrin 100 20 40 60 80 0 mCherry F
siPericentrin siCDK5RAP2 siControl Sample siControl Centrosomes 360 260 150 2 siCDK5RAP2 - NuMA siPericentrin siControl SiR 1 430 320 240 siCDK5RAP2 - 395.1 437.2 290.0 cytokinesis Time from NEBDto Tubulin siPericentrin The copyrightholderforthis ± ± ± congression chromosome Bipolar with Monopolar Bipolar Others 246.6 min 296.4 min 169.9 min - like error bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Figure 5, Chinen, Yamazaki et al A B C 1-centrosome 1-centrosome PCM Centriole siControl siCEP57 2.52.5 * siControl
● 2.02.0 ● ● ● ●●● ●●
intensity ● ●● ●●●● ● ● 1.51.5 ● ● ●●● ●● ●● ●● ●●●●● ● ●●●●●● ●●● ●●●● ● ●●● ●● ●●● ●●●● ●● 1.0 ●●●●●● ●●●● ● ●●●●● 1.0 ●●●● ● ●●● ●● ● ●● ● ●● ●●● ● ●●● ●● ●●●● ●● ●●●●●● ● ● ● ●●● ●● ●●●●●● ● ●●●● ● ●●●●● ●●● ●● ● ●●● ● ●●●● ●●●● ●●●● ●● ●●● ● ● ● ●● ●●●●●● ●●●●● ●●●●● ●●●●● ●●●●●● ●● ● ●● ●● ●●●● ●● ●●●●● (control ratio) ● ● ●● ● 0.5 ● ●●●●●● ●●●●●● ● ●●●●● 0.5 ●●● ● ●● ●●●●● ●●●●●●● PCNT intensity ● ●●●●●●●●● ●● ●●● ●●●●●●●●●●● ● ●●● ●●●● ●●●● ●●●● (controlratio) ●●●●●● ●●● ●●● ●●●●●●● ●●●●● ● ●● ● ●●● 0.00 ●●●● siCEP57
Pericentrin
maginification pole
pole
-
-
PCM Centrin Pericentrin DNA PCM
centriolar.pole PCM accumulation
Centriolar pole Centriolar
acentriolar.pole
Centriolar pole Centriolar
centriolar.pole.1
centriolar.pole.2
acentriolar.pole.1 acentriolar.pole.2 at PCM-pole siControl siCEP57
D 1-centrosome (min)
-10 0 30 80 110 160 220 siControl
-10 0 20 50 80 120 140 siCEP57
EGFP-Centrin mCherry-NuMA SiR-Tubulin
E 1-centrosome F 1-centrosome G 1-centrosome n.s. * 120 100
250 ● ● 800 ● ● 80 200 ● ● 600 ● ● ● Bipolar 150 ● 60 ● ● ● 400 ●●● ●● ● ● ● ● ● ● ● 100 ● ● ● ●●●● Monopolar ● ● -like ● ●● ●●●● ● ● ●●●●● ● ● ● ● ●●●●●● ●●●● ●●●●●● 40 ● ●● ●●● ●●● ●●●●● ●●●●●●●● ●●●● ●●● ●●●● ●●●● ● ●●●●●● ●●●●● ●●● 200 ●● ●● ●●●●● Cells(%) 50 ●●●● ●●●●●●● ●●●● ●●●●● ●●●●●●●● ●●●●●●●● ● ●●● ●●● ● Others ●●●●●● ●●●●●●●● ●●●●●●● ●●● ●● ● ●●●●●●●● ●●●●● ●●●●●●●●●●●● ●●●●●●●●●●●●●●●● ●●●●●●●●●●●● ●●●●●●●●●● ●●●●●●●●● ●●●●●●●●●●●● ●●●●●●●●●● ● ●●●●●● ●●●●●● 0 ●●●●●● ●●●● ●●●●●●●●●●●● 0 20 Time from NEBD
to cytokinesis (min)
of NuMA (min) two foci 0
Time from NEBD to establishment
siControl
siControl
siCEP57
siControl
siCEP57
siControl sicep57.1
sicep57.2
sicep57.1
sicep57.2
siCEP57
siControl Figure 6, Chinen, Yamazaki C A G E HeLa HeLa siPericentrin siControl
- - 2-centrosome 2-centrosome siPericentrin siControl 2 10 10 - centrosome (min) HeLa Bipolar Bipolar bioRxiv preprint A549 siControl preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. siControl 2 - centrosome 0 0 a doi: - Tubulin U2OS https://doi.org/10.1101/2020.11.10.377341 10 10 Bipolar Bipolar DNA siCDK5RAP2 siCDK5RAP2 et al et 30 30 H Spindle length (µm) 10 15 20 25 0 5 GT335 2 50 50 - ● centrosome ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Bipolar ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● A549 ● siControl ● siPericentrin * * siPericentrin CEP192 a ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● - ● ● ● ● ● ● ● ● ● ● ● ● ● ; ● ● ● SiR ● ● ● Tubulin
siPericentrin this versionpostedNovember11,2020. 60 60 - Tubulin DNA I DNA Spindle length (µm) 10 15 20 25 0 5 2 - F D B centrosome CEP192CEP192 intensity intensity ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● CEP192 intensity ● ● ● ● ● ● ● ● ● ● ● U2OS ● ● ● ● ● ●
● Spindle length (µm) ● siControl ● CEP192 (control (control intensity ratio) ratio) 10 15 20 siControl
* (control ratio) 0 5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0 0.0 (control0.5 ratio) 1.0 1.5 2.0 0.0 0.5 ● ● ● ● ● ● ● ● ● ● ●
● Spindle length (µm) ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 1.0 1.5 2.0 0.0 0.5 ● ● ● ● ● 0 2 2 siPericentrin 10 12 Time from NEBD(min) from Time 2 - - 0 2 4 6 8 centrosome HeLa centrosome HeLa - centrosome HeLa 10 The copyrightholderforthis ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 20 ● ● ●
siControl ● ● ● ● ● ● ● ● ● siControl ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● n.s ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siControl ● ● ● ● ● ● ● ● ● siControl ● ● siPericentrin ● ● ● ● ● siControl ● ● . ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 30 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● * ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● * ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siCDK5RAP2 ● ● ● ● ● ● ● ●
siCDK5RAP2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●
● siCDK5RAP2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siCDK5RAP2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siCDK5RAP2 ● 40 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●
siPericentrin ● ● ● ● ● ● ● ● ● ●
siPericentrin ● ● ●
● siPericentrin ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 50 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siPericentrin ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● siPericentrin ● bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Figure 7, Chinen, Yamazaki et al A B C D 120 120 1-centrosome 100 1-centrosome 100 80 80 60 60 40 40 Cells(%) Cells(%) 20 20 0 0 + - + - pPLK1 at PLK1 at acentriolar pole DNA GT335 PLK1 acentriolar pole DNA Centrin pPLK1
BI 2536 + E DMSO BI 2536 1 nM Centrinone 100 nM Centrinone
PCM-pole
DNA Centrin Pericentrin a-Tubulin
F G * * 100 2.5 Bipolar * 80 Bipolar with 2.0 chromosome
60 congression error intensity 1.5 40
Cells(%) Monopolar 1.0 20
(control ratio) (control 0.5
Others polecentriolar at 0 BI 2536 - + - + Pericentrin 0 Centrinone - - + + BI 2536 - + - + 2 1 Centrinone - - + + Centrosomes 2 1 Centrosomes bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Figure 8, Chinen, Yamazaki et al
A Centrinone B - B Centrinone 100 nM + BI 2536 1 nM (min) Cell division Centrinone B + 0 15 30 60 75 140 120
100 celldivision st 2-centrosome 80 1 60 Mitotic cell death 40 0 300 600 900 1320 20 Cell(control%) growth 0 0.1 1 10 celldivision nd 1-centrosome BI 2536 (nM) 2
C Mitotic cell death D Cell division BI 2536 - + - + 100 Centrinone - - + +
PARP 50 100 Cleaved PARP 75 0 100 BI 2536 - + - + - + HSP90 75 Centrinone - - + + + + kDa 2 1 Centrosomes
1
3
-
-
2
II
7
-
- E -
3
-
1
-
HeLa
U2OS
Saos
A549
DAUDI
RAJI
HL60
K562
MKN45
MKN1
DU145
PC
PANC
GI
HCT116
SKOV
A431
HMV
MCF
Centrinone B - + - + - + - + - + - + - + - + - + - + - + - + - + - + - + - + - + - + - + Growth (%) 120 100 80 60
BI 2536 2536 BI 40
concentration 20 0 Sensitivity 2.8 3.1 2.6 2.1 2.5 4.5 ND 6.4 2.0 1.2 2.6 1.9 1.5 1.5 1.8 1.7 1.3 1.4 1.5 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Figure 9, Chinen, Yamazaki et al
A model for bipolar spindle formation redundantly supported by centriole and PCM 2-centrosome cell
Centriole recruits CEP192 to centriolar wall
PCM (Pericentrin, CDK5RAP2) Centriole CEP192 Pericentrin and CDK5RAP2 recruit CEP192 to PCM bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Supporting figure 1, Related to Fig 2.
A siCEP192: - + B siCDK5RAP2: - + C siPericentrin: - + Pericentrin CEP192 240 CDK5RAP2 240 HSP90 75 240 HSP90 75 HSP90 75 D E F * * * 3 3 3
● ● ● ● ●● ●● ●● ● 2 2 ● 2 ● ●● ● ● ● ● ●● ●● ●● ●● ●●● ● ●●● ● ● ● ● ●● ●● ● ●●● ●● ● ●●●●● ●● ● ●●●● ● ●●● ●●●● ●●●● ●● ●●● ●●●●●●● ●● ● ●●●● 1 ●●●●●● ● 1 ●●●● 1 ●● ●● ●●●●●●●●● ●●●● ●●●●●● ● ●●●●● ● ●●● ●●●●● ● ●● ●● ●●●●●●●●●● ●●●● ●●●● ● ●●● ●●●● ●●●●● ●●●● ●●●● ●● ●●● ● ● ●●●●●●● ●●●● ●●●● ●●●●●●●●●●●● ●●● ●●● ●● ●●●●●●●●●●●●●●●●●●●●●●● ● ●● ●●● ●●●●●●●●●● ●●●●●●●●●●● ●● ●●●●●●●●●●● ●●●●●●●●● ●●●●●●●●●● ●●●●●● 0 0 ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● 0 CEP192 at centrosomes centrosomes at CEP192 Pericentrin at centrosomes centrosomes at Pericentrin CDK5RAP2 at centrosomes centrosomes at CDK5RAP2 (normalized to siControl signal) siControl to (normalized (normalized to siControl signal) siControl to (normalized (normalized to siControl signal) siControl to (normalized siControl siControl siControl siCEP192 siPericentrin siCDK5RAP2
G 2-centrosome HeLa (min) H 1-centrosome HeLa (min) siControl
siControl -10 0 10 20 40 -10 0 30 140 190
-10 0 70 100 150 -10 0 120 180 240 siCEP192 siCEP192 - - RAP2 RAP2 siCDK5 -10 0 10 20 40 siCDK5 -10 0 90 220 280
-10 0 10 20 40 -10 0 140 330 390 siPericentrin EGFP-centrin1 SiR-Tubulin siPericentrin EGFP-centrin1 SiR-Tubulin
I 0-centrosome HeLa (min)
siControl -10 0 50 100 160
-10 0 60 170 240 siCEP192 - RAP2
siCDK5 -10 0 30 90 160
-10 0 40 150 180
siPericentrin EGFP-centrin1 SiR-Tubulin bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Supporting figure 2, Related to Fig 2. A B Centrosomes 1-centrosome 2 1 0 A431 PC3 DU145 Tubulin - γ
PANC-1 MCF-7 A549 CEP152
GT335 CEP192 DNA CPAP
GT335 DNA
C D 120 E 1-centrosome HCT116 100 SAS6-AID On ice MT regrowth 5 min 80 1-centrosome 60 40 Cells(%) 20 0 + - Centrin Pericentrin EB1 DNA Centrin DNA Pericentrin at Pericentrin acentriolar pole bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Supporting figure 3, Related to Fig 4.
A RPE1 B RPE1 RPE1 Centrosomes 2-centrosome 1-centrosome 2 1 100 100
80 80
60 60 siControl Bipolar 40 others40 others Cells (%) Cells (%) Monopolar-like Monopolar-likeMonopolar-like 20 20 Others Bipolar Bipolar 0 0 siCEP192 - siControl siControl siCEP192 siCEP192 RAP2 siCDK5 siPericentrin siPericentrin siCDK5RAP2 siCDK5RAP2 siPericentrin GT335 a-Tubulin DNA
C A549 D A549 A549 Centrosomes 2-centrosome 1-centrosome 2 1 100 100
80 80
60 60
siControl Bipolar 40 others40 others Cells (%) Cells (%) Monopolar-like Monopolar-like Monopolar-like 20 20 Others Bipolar Bipolar 0 0 siCEP192 - siControl siControl siCEP192 siCEP192 RAP2 siCDK5 siPericentrin siPericentrin siCDK5RAP2 siCDK5RAP2 siPericentrin GT335 a-Tubulin DNA bioRxiv preprint doi: https://doi.org/10.1101/2020.11.10.377341; this version posted November 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Supporting figure 4, Related to Fig 6.
A 2-centrosome HCT116 2-centrosome HCT116(min) B siControl siPericentrin -10 0 10 20 30 40 15
siControl 10
-10 0 10 20 30 40 5
0 0 10 20 30 40 siPericentrin
SiR-Tubulin Spindle length (µm) Time from NEBD (min) C 2-centrosome
RPE1 GI1 SKOV3 A431 PANC1 siControl siPericentrin
a-Tubulin DNA
D RPE1 E GI1 F SKOV3 G A431 H PANC1 n.s. n.s. n.s. * * 25 25 25 25 25 ● ●● ●● 20 20 20 ● 20 20 ● ●● ● ● ●● ● ● ● ● ● ●●●●● ● ● ● ● ● ●● ●● ● ● ● ● ●●● ● ●●●●● ●●● ● ● 15 ●● ● 15 ● 15 ● ●● 15 ●●●● 15 ●● ●● ●●● ●●● ● ●●● ●●●● ●●●●●● ●●● ● ● ●●●●● ●●●●● ● ● ●●● ●●●● ●●●●●●●● ●●●● ●●●●● ●●●●●● ●●●●●● ●●●●● ●●●●●●● ●● ●● ●●●● ●●●● ●●● ●● ●●●● ●● ●●●●●●● ●●● ●● ● ●●●● ●●●●●●●● ●● ●●●●● ●●● ●●●● ●●●● ●● ●● ● ●●●●●●●● ●● ●●● ●● ●● ●●●● ●● ●● ● ●● ●●● ●●●● ● ●●● ●●●● ●●●●● ● ● ●● 10 ● 10 ●● ●●● 10 10 ●● 10 ●● ● ●● ● ● ●● ● ● ● ● ●● ● ●●● ● ● ●●● ●●● ● ● ●● ●● ●● ● ● ● ● ● ●● ● ● ● ●●●●● ● ● ● ● ● ●● ● ●●● ● ● ● ● ● ●● 5 5 ● 5 ● 5 5 ● ● ● ● ● ● ● 0 0 0 0 0 ● ●●● Spindle length (µm) Spindle length (µm) Spindle length (µm) Spindle length (µm) Spindle length (µm) siControl siControl siControl siControl siControl siPericentrin siPericentrin siPericentrin siPericentrin siPericentrin Supporting figure 5, Related to Fig 8. B A 2 1 - Event in mitosis (%) - Event in mitosis (%) 100 100 centrosome centrosome 50 50 0 0 bioRxiv preprint 0 0 preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. Centrinone DMSO 1000 1000 Time Time after mitotic entry (min) doi: 2000 2000 https://doi.org/10.1101/2020.11.10.377341 100 50 0 100 50 Centrinone 0 0 0 Time Time after mitotic entry (min) BI 2536 1000 1000 2000 + BI 2536 + BI 2000 100 50 0 0 ; Centrinone this versionpostedNovember11,2020. 1000 Mitotic cell Mitoticdeath cell Cell division Cell 2000 100 50 Centrinone 0 0 1000 + BI 2536 + BI 2000 The copyrightholderforthis