DOCSLIB.ORG

HSP70 Is Required for the Proper Assembly of Pericentriolar Material

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HSP70 Is Required for the Proper Assembly of Pericentriolar Material Fang et al. Cell Div (2019) 14:4 https://doi.org/10.1186/s13008-019-0047-7 Cell Division RESEARCH Open Access HSP70 is required for the proper assembly of pericentriolar material and function of mitotic centrosomes Chieh‑Ting Fang1,2, Hsiao‑Hui Kuo2, Shao‑Chun Hsu2 and Ling‑Huei Yih2* Abstract Background: At the onset of mitosis, the centrosome expands and matures, acquiring enhanced activities for microtubule nucleation and assembly of a functional bipolar mitotic spindle. However, the mechanisms that regulate centrosome expansion and maturation are largely unknown. Previously, we demonstrated in an immortalized human cell line CGL2 and cancer cell line HeLa that the inducible form of heat shock protein 70 (HSP70) accumulates at the mitotic centrosome and is required for centrosome maturation and bipolar spindle assembly. Results: In this study, we further show that HSP70 accumulated at the spindle pole in a PLK1‑dependent manner. HSP70 colocalized with pericentrin (PCNT), CEP215 and γ‑tubulin at the spindle pole and was required for the 3D assembly of these three proteins, which supports mitotic centrosome function. Loss of HSP70 disrupted mitotic cen‑ trosome structure, reduced pericentriolar material recruitment and induced fragmentation of spindle poles. In addi‑ tion, HSP70 was necessary for the interaction between PCNT and CEP215 and also facilitated PLK1 accumulation and function at the spindle pole. Furthermore, we found that HSP70 chaperone activity is required for PCNT accumulation at the mitotic centrosome and assembly of mitotic spindles. Conclusion: Our current results demonstrate that HSP70 is required for the accurate assembly of the pericentriolar material and proper functioning of mitotic centrosomes. Keywords: HSP70, Mitotic centrosome, Pericentriolar material, Spindle pole Background Te centrosome is duplicated during S phase along with Te centrosome is a structurally complex and function- DNA replication, yielding two centrosomes that nucle- ally diverse organelle that regulates various cellular pro- ate extensive MT arrays and form the two poles of the cesses. It consists of a pair of barrel-shaped structures mitotic spindle [2]. Importantly, from late S phase to called centrioles and a surrounding protein complex, mitotic onset, the two fully duplicated centrosomes which is referred to as the pericentriolar material (PCM). exhibit enhanced recruitment of PCM components that Te PCM contains hundreds of proteins, including sign- are essential for MT nucleation, a process termed cen- aling molecules, cell cycle regulators and crucial micro- trosome maturation. In this process, PCM components tubule (MT)-nucleating factors. Te combined function accumulate at the existing centrosome and expand into of these proteins makes the centrosome the major MT- a greatly enlarged and intermingled matrix structure to organizing center (MTOC), which coordinates all MT- enhance MT nucleation capacity and promote the assem- related functions, including cell shape, cell polarity, bly of a functional bipolar spindle [3–5]. Inaccurate accu- mobility, intracellular trafcking and cell division [1]. mulation of PCM components at the centrosome results in a functionally compromised mitotic centrosome with *Correspondence: [email protected] multipolar or disorganized spindles that may further pro- 2 Institute of Cellular and Organismic Biology, Academia Sinica, Taipei 115, mote mitotic arrest, cell death and/or aneuploidy [6, 7]. Taiwan Full list of author information is available at the end of the article © The Author(s) 2019. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/ publi cdoma in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Fang et al. Cell Div (2019) 14:4 Page 2 of 17 Previous studies using subdifraction resolution folding, oligomerization, trafcking, disaggregation, and microscopy and fuorescence recovery after photobleach- proteasomal or autophagic degradation. Among the wide ing have revealed that PCM components adopt either a variety of HSPs, HSP70 family members form a central concentric toroidal or an extending fber-like organi- hub of the chaperone networks that cooperatively utilize zation to form a thin layer of PCM at the interphase various chaperones and co-chaperones to regulate all centrosome; these structures then undergo extensive aspects of cellular proteostasis, especially protein qual- rearrangement, continuous replenishment, local trafck- ity control in certain organelles [24, 25]. HSP70 members ing, massive accumulation and expansion, and occupy in S. cerevisiae were proposed to control the oligomeric distinct subdomains within the dramatically enlarged state of Cin8 motor protein to regulate spindle length mitotic PCM matrix [3, 4, 8–13]. While the mecha- [26]. In mammalian cells, HSP70 mainly exists in consti- nisms that precisely regulate the behaviors of PCM tutive form (HSC70) and inducible form. Te inducible components are not clearly understood, several major HSP70 (thereafter HSP70) is phosphorylated by NEK6, contributors have been identifed. For example, Polo which targets HSP70 to the mitotic spindle where it like kinase 1 (PLK1) is a master mitotic kinase that is maintains kinetochore-MT stability and supports centro- known to phosphorylate multiple PCM substrates and some clustering [27, 28]. Additionally, HSP70 was also drive several steps of centrosome maturation [14–16]. shown to protect centrosome and spindle integrity when Additionally, pericentrin (PCNT) and CEP215 and their overexpressed, likely by preventing proteasomal degra- respective homologues in various model organism are dation of centrosomal proteins in the heat-shocked cells putative scafold proteins that are thought to physically [29, 30]. Tus, the importance of HSP70 in the mitotic interact at the maturing centrosome, providing a proper centrosome is well established, and some evidence sug- platform to recruit other PCMs [15, 17–19]. In the PCM gests that it may exert chaperone activities on centro- matrix, PCNT phosphorylation by PLK1 was shown some components to regulate centrosome maturation. to increase recruitment of MT nucleating factors, such We have previously demonstrated that HSP70 as NEDD1 and γ-tubulin, whose accumulation is also (encoded by genes HSPA1A and HSPA1B) localizes to PLK1-dependent [15, 17]. Notably, PLK1 activity persists the mitotic spindle poles and is required for maintenance throughout mitosis to ensure continuous replenishment of centrosome integrity, MT nucleation, mitotic spindle of PCM components, including PLK1 itself, suggesting assembly, mitotic progression, and cell viability [31]. In a highly dynamic and interdependent orchestration of this study, we further employed subdifraction resolution PCM components at the functional mitotic centrosome microscopy to examine the roles of HSP70 in the struc- [20, 21]. Despite these major advances in understanding ture and function of the mitotic centrosome. We found centrosome maturation, the highly organized regulatory that HSP70 cooperates with PLK1, PCNT, and CEP215 mechanisms governing the concentration and exchange to support their accumulation and proper 3D assembly, of these and other proteins at the mitotic centrosome and this action appears to be required for complete mat- are still largely unknown. Improper accumulation of uration of a fully functional mitotic centrosome. γ-tubulin has been implicated in abnormal spindle for- mation and human malignancies [22, 23]. Moreover, Results blocking PLK1 activity in the mitotic cells with already HSP70 accumulates at the spindle pole matured centrosomes reduces PCNT and γ-tubulin in a PLK1‑dependent manner and colocalizes with PCNT, accumulation [21], while mutant PLK1 with an altered CEP215 and γ‑tubulin exchange rate at the mitotic centrosome induces mitotic Based on our previous study, which used immunofuo- arrest [20]. Mutant PCNT that cannot be phosphoryl- rescence staining to reveal that HSP70 localizes to the ated by PLK1 fails to recruit multiple PCM components, spindle poles during mitosis [31], we frst investigated including PLK1 itself [15], while mutations that abol- how the localization of HSP70 at the spindle pole is reg- ish interaction between PCNT and CEP215 disrupt the ulated. Phosphorylation of HSP70 at various residues recruitment of themselves and γ-tubulin, inducing the has been shown to regulate its function [27, 32, 33], so formation of defective mitotic centrosomes and spindles we screened a series of kinase inhibitors to test whether [17]. Together, these data imply that delicate proteostatic they may afect the accumulation of HSP70 at the spin- control of PCM components is important for deter- dle pole. Te PLK inhibitor III (an inhibitor of PLK mem- mining the proper function of a fully matured mitotic bers) and BI2536 (an inhibitor of PLK1 [34]) dramatically centrosome. reduced the intensity of HSP70 at the spindle poles Molecular chaperones, such as heat shock proteins (Fig. 1A, B). Tis result is consistent with previous stud- (HSPs), are major orchestrators of the cellular proteo-
Load more

Recommended publications
  • Old Data and Friends Improve with Age: Advancements with the Updated Tools of Genenetwork
    bioRxiv preprint doi: https://doi.org/10.1101/2021.05.24.445383; this version posted May 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Old data and friends improve with age: Advancements with the updated tools of GeneNetwork Alisha Chunduri1, David G. Ashbrook2 1Department of Biotechnology, Chaitanya Bharathi Institute of Technology, Hyderabad 500075, India 2Department of Genetics, Genomics and Informatics, University of Tennessee Health Science Center, Memphis, TN 38163, USA Abstract Understanding gene-by-environment interactions is important across biology, particularly behaviour. Families of isogenic strains are excellently placed, as the same genome can be tested in multiple environments. The BXD’s recent expansion to 140 strains makes them the largest family of murine isogenic genomes, and therefore give great power to detect QTL. Indefinite reproducible genometypes can be leveraged; old data can be reanalysed with emerging tools to produce novel biological insights. To highlight the importance of reanalyses, we obtained drug- and behavioural-phenotypes from Philip et al. 2010, and reanalysed their data with new genotypes from sequencing, and new models (GEMMA and R/qtl2). We discover QTL on chromosomes 3, 5, 9, 11, and 14, not found in the original study. We narrowed down the candidate genes based on their ability to alter gene expression and/or protein function, using cis-eQTL analysis, and variants predicted to be deleterious. Co-expression analysis (‘gene friends’) and human PheWAS were used to further narrow candidates.
    [Show full text]
  • The Basal Bodies of Chlamydomonas Reinhardtii Susan K
    Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4].
    [Show full text]
  • Par6c Is at the Mother Centriole and Controls Centrosomal Protein
    860 Research Article Par6c is at the mother centriole and controls centrosomal protein composition through a Par6a-dependent pathway Vale´rian Dormoy, Kati Tormanen and Christine Su¨ tterlin* Department of Developmental and Cell Biology, University of California, Irvine, Irvine, CA 92697-2300, USA *Author for correspondence ([email protected]) Accepted 3 December 2012 Journal of Cell Science 126, 860–870 ß 2013. Published by The Company of Biologists Ltd doi: 10.1242/jcs.121186 Summary The centrosome contains two centrioles that differ in age, protein composition and function. This non-membrane bound organelle is known to regulate microtubule organization in dividing cells and ciliogenesis in quiescent cells. These specific roles depend on protein appendages at the older, or mother, centriole. In this study, we identified the polarity protein partitioning defective 6 homolog gamma (Par6c) as a novel component of the mother centriole. This specific localization required the Par6c C-terminus, but was independent of intact microtubules, the dynein/dynactin complex and the components of the PAR polarity complex. Par6c depletion resulted in altered centrosomal protein composition, with the loss of a large number of proteins, including Par6a and p150Glued, from the centrosome. As a consequence, there were defects in ciliogenesis, microtubule organization and centrosome reorientation during migration. Par6c interacted with Par3 and aPKC, but these proteins were not required for the regulation of centrosomal protein composition. Par6c also associated with Par6a, which controls protein recruitment to the centrosome through p150Glued. Our study is the first to identify Par6c as a component of the mother centriole and to report a role of a mother centriole protein in the regulation of centrosomal protein composition.
    [Show full text]
  • Supplemental Information Proximity Interactions Among Centrosome
    Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl
    [Show full text]
  • Ninein, a Microtubule Minus-End Anchoring Protein 3015 Analysis As Described Previously (Henderson Et Al., 1994)
    Journal of Cell Science 113, 3013-3023 (2000) 3013 Printed in Great Britain © The Company of Biologists Limited 2000 JCS1634 Microtubule minus-end anchorage at centrosomal and non-centrosomal sites: the role of ninein Mette M. Mogensen1,*, Azer Malik1, Matthieu Piel2, Veronique Bouckson-Castaing2 and Michel Bornens2 1Department of Anatomy and Physiology, MSI/WTB complex, Dow Street, University of Dundee, Dundee, DD1 5EH, UK 2Institute Curie, UMR 144-CNRS, 26 Rue d’Ulm, 75248 Paris Cedex 05, France *Author for correspondence (e-mail: [email protected]) Accepted 14 June; published on WWW 9 August 2000 SUMMARY The novel concept of a centrosomal anchoring complex, epithelial cells, where the vast majority of the microtubule which is distinct from the γ-tubulin nucleating complex, has minus-ends are associated with apical non-centrosomal previously been proposed following studies on cochlear sites, suggests that it is not directly involved in microtubule epithelial cells. In this investigation we present evidence nucleation. Ninein seems to play an important role in the from two different cell systems which suggests that the positioning and anchorage of the microtubule minus-ends centrosomal protein ninein is a strong candidate for the in these epithelial cells. Evidence is presented which proposed anchoring complex. suggests that ninein is released from the centrosome, Ninein has recently been observed in cultured fibroblast translocated with the microtubules, and is responsible for cells to localise primarily to the post-mitotic mother the anchorage of microtubule minus-ends to the apical centriole, which is the focus for a classic radial microtubule sites. We propose that ninein is a non-nucleating array.
    [Show full text]
  • Downloaded from Bioscientifica.Com at 10/04/2021 03:09:50PM Via Free Access
    242 S-M Ho et al. Regulation of centrosome 24:2 83–96 Research duplication by BPA analogues Bisphenol A and its analogues disrupt centrosome cycle and microtubule dynamics in prostate cancer Shuk-Mei Ho1,2,3,4, Rahul Rao1, Sarah To1,5,6, Emma Schoch1 and Pheruza Tarapore1,2,3 1Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA 2Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA Correspondence 3Cincinnati Cancer Center, Cincinnati, Ohio, USA should be addressed 4Cincinnati Veteran Affairs Hospital Medical Center, Cincinnati, Ohio, USA to S-M Ho or P Tarapore 5Center for Cancer Research, Hudson Institute of Medical Research, Clayton, Victoria, Australia Email 6Monash University, Clayton, Victoria, Australia [email protected] or [email protected] Abstract Humans are increasingly exposed to structural analogues of bisphenol A (BPA), as Key Words BPA is being replaced by these compounds in BPA-free consumer products. We have f endocrine-disrupting previously shown that chronic and developmental exposure to BPA is associated with chemicals increased prostate cancer (PCa) risk in human and animal models. Here, we examine f bisphenol A analogues whether exposure of PCa cells (LNCaP, C4-2) to low-dose BPA and its structural analogues f BPA (BPS, BPF, BPAF, TBBPA, DMBPA and TMBPA) affects centrosome amplification (CA), f BPS a hallmark of cancer initiation and progression. We found that exposure to BPA, BPS, f BPF DMBPA and TBBPA, in descending order, increased the number of cells with CA, in a non- f TBBPA Endocrine-Related Cancer Endocrine-Related monotonic dose–response manner.
    [Show full text]
  • The Emerging Role of Ncrnas and RNA-Binding Proteins in Mitotic Apparatus Formation
    non-coding RNA Review The Emerging Role of ncRNAs and RNA-Binding Proteins in Mitotic Apparatus Formation Kei K. Ito, Koki Watanabe and Daiju Kitagawa * Department of Physiological Chemistry, Graduate School of Pharmaceutical Science, The University of Tokyo, Bunkyo, Tokyo 113-0033, Japan; [email protected] (K.K.I.); [email protected] (K.W.) * Correspondence: [email protected] Received: 11 November 2019; Accepted: 13 March 2020; Published: 20 March 2020 Abstract: Mounting experimental evidence shows that non-coding RNAs (ncRNAs) serve a wide variety of biological functions. Recent studies suggest that a part of ncRNAs are critically important for supporting the structure of subcellular architectures. Here, we summarize the current literature demonstrating the role of ncRNAs and RNA-binding proteins in regulating the assembly of mitotic apparatus, especially focusing on centrosomes, kinetochores, and mitotic spindles. Keywords: ncRNA; centrosome; kinetochore; mitotic spindle 1. Introduction Non-coding RNAs (ncRNAs) are defined as a class of RNA molecules that are transcribed from genomic DNA, but not translated into proteins. They are mainly classified into the following two categories according to their length—small RNA (<200 nt) and long non-coding RNA (lncRNA) (>200 nt). Small RNAs include traditional RNA molecules, such as transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PIWI-interacting RNA (piRNA), and micro RNA (miRNA), and they have been studied extensively [1]. Research on lncRNA is behind that on small RNA despite that recent transcriptome analysis has revealed that more than 120,000 lncRNAs are generated from the human genome [2–4].
    [Show full text]
  • CEP63 Deficiency Promotes P53-Dependent Microcephaly and Reveals a Role for the Centrosome in Meiotic Recombination
    ARTICLE Received 25 Mar 2015 | Accepted 30 May 2015 | Published 9 Jul 2015 DOI: 10.1038/ncomms8676 CEP63 deficiency promotes p53-dependent microcephaly and reveals a role for the centrosome in meiotic recombination Marko Marjanovic´1,2, Carlos Sa´nchez-Huertas1,*, Berta Terre´1,*, Rocı´oGo´mez3, Jan Frederik Scheel4,w, Sarai Pacheco5,6, Philip A. Knobel1, Ana Martı´nez-Marchal5,6, Suvi Aivio1, Lluı´s Palenzuela1, Uwe Wolfrum4, Peter J. McKinnon7, Jose´ A. Suja3, Ignasi Roig5,6, Vincenzo Costanzo8, Jens Lu¨ders1 & Travis H. Stracker1 CEP63 is a centrosomal protein that facilitates centriole duplication and is regulated by the DNA damage response. Mutations in CEP63 cause Seckel syndrome, a human disease characterized by microcephaly and dwarfism. Here we demonstrate that Cep63-deficient mice recapitulate Seckel syndrome pathology. The attrition of neural progenitor cells involves p53-dependent cell death, and brain size is rescued by the deletion of p53. Cell death is not the result of an aberrant DNA damage response but is triggered by centrosome-based mitotic errors. In addition, Cep63 loss severely impairs meiotic recombination, leading to profound male infertility. Cep63-deficient spermatocytes display numerical and structural centrosome aberrations, chromosome entanglements and defective telomere clustering, suggesting that a reduction in centrosome-mediated chromosome movements underlies recombination failure. Our results provide novel insight into the molecular pathology of microcephaly and establish a role for the centrosome in meiotic recombination. 1 Institute for Research in Biomedicine (IRB Barcelona), Barcelona 08028, Spain. 2 Division of Molecular Medicine, Rud–er Bosˇkovic´ Institute, Zagreb 10000, Croatia. 3 Departamento de Biologı´a, Edificio de Biolo´gicas, Universidad Auto´noma de Madrid, Madrid 28049, Spain.
    [Show full text]
  • PCM1 Is Necessary for Focal Ciliary Integrity and Is a Candidate for Severe Schizophrenia
    ARTICLE https://doi.org/10.1038/s41467-020-19637-5 OPEN PCM1 is necessary for focal ciliary integrity and is a candidate for severe schizophrenia Tanner O. Monroe 1,2, Melanie E. Garrett3, Maria Kousi4, Ramona M. Rodriguiz5,6, Sungjin Moon7, Yushi Bai8, Steven C. Brodar8, Karen L. Soldano3, Jeremiah Savage9, Thomas F. Hansen10,11, Donna M. Muzny12,13, Richard A. Gibbs12,13, Lawrence Barak8, Patrick F. Sullivan14,15,16, Allison E. Ashley-Koch 3, ✉ Akira Sawa 17,18,19,20, William C. Wetsel 5,6,8,21, Thomas Werge 10,11,22,23 & Nicholas Katsanis 1,2 1234567890():,; The neuronal primary cilium and centriolar satellites have functions in neurogenesis, but little is known about their roles in the postnatal brain. We show that ablation of pericentriolar material 1 in the mouse leads to progressive ciliary, anatomical, psychomotor, and cognitive abnormalities. RNAseq reveals changes in amine- and G-protein coupled receptor pathways. The physiological relevance of this phenotype is supported by decreased available dopamine D2 receptor (D2R) levels and the failure of antipsychotic drugs to rescue adult behavioral defects. Immunoprecipitations show an association with Pcm1 and D2Rs. Finally, we sequence PCM1 in two human cohorts with severe schizophrenia. Systematic modeling of all discovered rare alleles by zebrafish in vivo complementation reveals an enrichment for pathogenic alleles. Our data emphasize a role for the pericentriolar material in the postnatal brain, with progressive degenerative ciliary and behavioral phenotypes; and they support a contributory role for PCM1 in some individuals diagnosed with schizophrenia. 1 Department of Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Pericentrin Polyclonal Antibody Catalog Number:22271-1-AP 1 Publications
    For Research Use Only Pericentrin Polyclonal antibody Catalog Number:22271-1-AP 1 Publications www.ptglab.com Catalog Number: GenBank Accession Number: Purification Method: Basic Information 22271-1-AP NM_006031 Antigen affinity purification Size: GeneID (NCBI): Recommended Dilutions: 150UL , Concentration: 800 μg/ml by 5116 IF 1:50-1:500 Nanodrop and 360 μg/ml by Bradford Full Name: method using BSA as the standard; pericentrin Source: Calculated MW: Rabbit 378 kDa Isotype: IgG Applications Tested Applications: Positive Controls: IF,ELISA IF : MDCK cells, Cited Applications: IF Species Specificity: human, Canine Cited Species: human PCNT, also named as KIAA0402, PCNT2, Pericentrin-B and Kendrin, is an integral component of the filamentous Background Information matrix of the centrosome involved in the initial establishment of organized microtubule arrays in both mitosis and meiosis. PCNT plays a role, together with DISC1, in the microtubule network formation. Is an integral component of the pericentriolar material (PCM). PCNT is a marker of centrosome. Defects in PCNT are the cause of microcephalic osteodysplastic primordial dwarfism type 2 (MOPD2). The antibody is specific to PCNT, and it can recognize isoform 1 and 2. Notable Publications Author Pubmed ID Journal Application Won-Jing Wang 26609813 Elife IF Storage: Storage Store at -20°C. Stable for one year after shipment. Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. Aliquoting is unnecessary for -20ºC storage For technical support and original validation data for this product please contact: This product is exclusively available under Proteintech T: 1 (888) 4PTGLAB (1-888-478-4522) (toll free E: [email protected] Group brand and is not available to purchase from any in USA), or 1(312) 455-8498 (outside USA) W: ptglab.com other manufacturer.
    [Show full text]
  • An Exome-Wide Sequencing Study of Lipid Response to High-Fat Meal and Fenofibrate in Caucasians from the GOLDN Cohort
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 An exome-wide sequencing study of lipid response to high-fat meal and fenofibrate in Caucasians from the GOLDN cohort Xin Geng Ping An Mary F. Feitosa Michael A. Province et al. Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Supplemental Material can be found at: http://www.jlr.org/content/suppl/2018/02/20/jlr.P080333.DC1 .html patient-oriented and epidemiological research An exome-wide sequencing study of lipid response to high-fat meal and fenofibrate in Caucasians from the GOLDN cohort Xin Geng,* Marguerite R. Irvin,† Bertha Hidalgo,† Stella Aslibekyan,† Vinodh Srinivasasainagendra,§ Ping An,‡ Alexis C. Frazier-Wood,|| Hemant K. Tiwari,§ Tushar Dave,# Kathleen Ryan,# Jose M. Ordovas,$,**,†† Robert J. Straka,§§ Mary F. Feitosa,‡ Paul N. Hopkins,‡‡ Ingrid Borecki,|| || Michael A. Province,‡ Braxton D. Mitchell,# Donna K. Arnett,1,## and Degui Zhi1,*,$$ School of Biomedical Informatics* and School of Public Health,$$ The University of Texas Health Downloaded from Science Center at Houston, Houston, TX 77030; Departments of Epidemiology† and Biostatistics,§ University of Alabama at Birmingham, Birmingham, AL 35233; Division of Statistical Genomics, Department of Genetics,‡ Washington University School of Medicine, St. Louis, MO 63110; US Department of Agriculture/Agricultural Research Service Children’s Nutrition Research Center,|| Baylor College of Medicine, Houston, TX 77030; Department of Medicine, Division
    [Show full text]