Journal of Cell Science o:10.1242/jcs.129502 doi: 3223–3233 126, Science Cell of Journal 2013 April 10 Accepted ahrn .Sonnen F. Katharina duplication Plk4 centriole in and cooperate recruitment Cep152 and Cep192 Human Article Research tre prna’o mte etil’.Poern okin work centriole’) Pioneering centriole’). ‘daughter elegans centriole ‘mother pre-existing (termed Caenorhabditis or each of ‘parental’ procentriole base (termed proximal the a to orthogonally of assembly and Nigg 2009). 2011; Woods, al., and et Thornton notably Megraw 2009; 2012; Raff, diseases, Katsanis, and developmental al., Davis et 2011; of (Bettencourt-Dias dwarfism variety and have microcephaly studies ciliopathies, a are genetic proteins for centrosomal recently, and responsible More centriolar in 2002). mutations that Nigg, revealed Ganem 2009; 2008; al., al., et (Basto et have tumorigenesis for and structure in cilia implicated and/or important been of number long formation centrosome is the in for turn cells, Anomalies bodies flagella. differentiated in basal as and which function quiescent centrioles the spindle, In with bipolar segregation. associate chromosome the centrosomes motility; of and duplicated shape poles cell the During for mitosis, as (PCM). well during as transport material positioning, protein intracellular organelle for pericentriolar and a important is the centrosome in Each the as interphase, embedded cells. known centrioles animal matrix two of comprises centers the centrosome constitute microtubule-organizing Go Centrosomes as 2009). 2012; Raff, major serve and Bornens, Nigg and 2011; 2007; cycle Stearns, al., (Bettencourt- cell cilia et and every centrosomes Dias of in assembly the once for that platforms exactly structures duplicated microtubule-based are barrel-shaped, are Centrioles Introduction cycle. cell the during that duplication conclude centriole We and domain. Plk4 polo-box that of suggesting charged recruitment acids, positively centriole words: amino for binding the Key charged Plk4 crucial with negatively The is interactions in isoform. Cep152 rich largest electrostatic and the are on and Cep192 to respectively) Cep192 depends between specific 1–46, of is cooperation centrioles and Most Double-depletion that to cooperate. 190–240 extension Plk4. proteins (residues localization N-terminal two and Cep152 the an Plk4 Plk4. Cep152 and that through human mammalian indicating both Cep192 Plk4 of duplication, of of to binds recruitment centriole Cep192 regions recruitment as centriole recruitment that well centrosome the Here, its as show in in Spd-2. centrioles we underlying Cep192, role protein, to importantly, and binding distinct key mechanism Plk4 Cep152 a a abolishes the on proteins, completely plays rely mammalian but Cep152 Cep192 nematodes homologous duplication, whereas that two Asterless, centriole of demonstrate on roles We of depends the recruitment regulator explored Plk4 have key flies, we In a understood. not is is (Plk4) centrioles 4 kinase Polo-like Summary Germany Heidelberg, § 69117 1, Meyerhofstraße ` EMBL, address: *Present 2 1 rc .Nigg A. Erich rsn drs:MxPac nttt fImnbooyadEieeis Stu Epigenetics, and Immunobiology of Institute Max-PIanck address: Present uhrfrcrepnec ( correspondence for Author iznrm nvriyo ae,Kiglegtas 07,45 ae,Switzerland Basel, 4056 Universita 50/70, Mikroskopie, Klingelbergstrasse ZMBP, Basel, of University Biozentrum, 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. etil ulcto uigSpaei ntae ythe by initiated is phase S during duplication Centriole e12 e12 l4 etil ulcto,Centrosome duplication, Centriole Plk4, Cep192, Cep152, 1,§ [email protected] a eeldaptwyfrcentriole for pathway a revealed has 1, ,An-ai Gabryjonczyk Anna-Maria *, tTu ¨t bne,AfdrMresel ,706Tu 72076 5, Morgenstelle der Auf ¨bingen, ) nz,21;Lu 2012; ¨nczy, dr and ¨ders bwg5,718Febr,Germany Freiburg, 79108 51, ¨beweg 1 dadAnselm Eduard , htrle nsrcua n/rfntoa oooso the of homologs functional and/or structural centriole on described that mechanism relies conserved evolutionarily demonstrate that an al., by studies et governed notably is Kleylein-Sohn these assembly 2008; species, Collectively, al., et other 2007). Dobbelaere was (e.g. in van assembly vertebrates 2011; centriole conducted al., on work et Extensive also Kitagawa 2011). symmetry 2012; al., 9-fold al., et typical Breugel et the (Guichard conferring in centrioles role that to key indicating Sas-6 a structure, plays that cartwheel-like Sas-6 a demonstrate into to self-assemble and combined manner can crystallography were Sas-4-dependent X-ray microscopy recently, a Most electron in was 2006). al., assembled et pathway that are (Pelletier centriole assembly showing new This the tomography Go 2006). and cryoelectron elegans Leidel al., by 2005; et al., corroborated et turn Pelletier Leidel in 2003; 2003; 2006; al., al., these triggers et et which (Delattre and Sas-4, Kirkham microtubules procentriolar protein, Sas-5, of third 2000; assembly a and the al., of recruitment Sas-6 et the of O’Connell proteins, mediate recruitment the 2001; induces structural then al., kinase two This et 2004). al., O’Connell et (Kemp Pelletier centriole 2004; mother the for al., to required Zyg-1, et is kinase, Spd-2 a of protein recruitment coiled-coil the the which in biogenesis tndadGo and Strnad etil ulcto nalseiseaie.Ti iaeis kinase This examined. species in Zyg-1 all as known in duplication centriole bne,Germany ¨bingen, eietroiekns ftePl aiyi eta to central is family Polo the of kinase serine/threonine A a- om eta ueaon hc h T of MTs the which around tube central a forms Sas-6 .elegans C. nz,2008). ¨nczy, 1, ` okDee Stierhof York-Dieter , .elegans C. eepout Crah-atse l,2010; al., et (Carvalho-Santos products gene n sPl-iekns Pk)or (Plk4) 4 kinase Polo-like as and 2 and Drosophila ¨nczy, 3223 and C. Journal of Cell Science otoesa Czeigue l,21;Dhnze ta. 2010; remains al., Plk4 et Dzhindzhev of 2010; recruitment al., et centrosome (Cizmecioglu but the controversial duplication, to centriole Asterless for contribution found required of was be its been mechanisms. and Asterless, homologs Plk4 of with vertebrate homolog have interact human to the distinct the data of Cep152, Spd-2. roles and conflicting through the for uncertainty, are reported centrosomes Plk4/Sak PCM this and both on Zyg-1 Compounding to studies 2008; that above in suggest the al., recruited value, thus et face function species at (Blachon Taken invertebrate to 2007). duplication for al., et 1998) shown screen centriole Varmark al., a and et subsequently (Bonaccorsi in recruitment infertility was identified male in been and result originally The that 2010). had mutants al., of product et recruitment (Dzhindzhev gene Asterless for 2004; to 2007). role attributed Raff, al., and (Dix a et assembly PCM Instead, in (Kemp only function the Zyg-1 to but reported 2004), of al., et recruitment Pelletier centrosomal the elegans C. pcfcly efcsdo h oeo e12adCep152. and homologs centrosomes. putative Cep192 the of human are proteins role of to centrosomal the large Plk4 two on These focused of we recruitment Specifically, the Plk4/Sak underlying the mammalian of of identity established. the be partner(s) to but remains 2012), so- interaction three al., comprises et centrosomal which (Slevin 2005), al., polo-boxes et (Fode called Habedanck domain localization 1994; (non-catalytic) Centrosome al., C-terminal al., et the centrosomes. et mammalian on how to Song depends understood clearly 2011; targeted well yet al., is not et is Plk4/Sak (Brownlee it in contrast, worms Plk4/Sak In of in 2011). stability Zyg-1 Rogers the phosphatase 2010; and regulating Furthermore, in al., flies 2010). implicated et al., been Holland et has 2012; 2A Sillibourne al., 2009; Guderian et al., 2009; Holland et al., 2010; al., et et (Cunha-Ferreira degradation that human dependent both to mechanisms leads In the that 2007). Plk4. trans-auto-phosphorylation understand of number (Nigg, and localization to the and control) cells crucial expression controlling number be the control will for (copy it critical centrioles Hence, is nascent centrosomes of of concentration at local the Plk4 that suggesting of for formation centrosomes, cells, near-simultaneous multiple human the mechanism In triggers elucidate Plk4 functional family. excess the to Zyg-1/Plk4/Sak example, fully the important the of understand be be regulation but will the it better to 2012), biogenesis centriole to remain al., underlying phosphorylations Likewise, al., et these et understood. (Bahtz (Chang of GCP6 CPAP/hSas-4 consequences 2011), and al., 2010) et (Puklowski (in Fbxw5 Sas-6 including is 2005; identified, Zyg-1 been of elegans Plk4/Sak recently substrates al., have few of Plk4/Sak A 2007). or et al., expression et (Rodrigues-Martins and Habedanck eggs trigger 2007), amplification to 2005; Conversely, al., sufficient centriole divisions. et al., and to cell Kleylein-Sohn cells leads et successive human Plk4/Sak (Bettencourt-Dias in both of centrioles In overexpression of 2005). loss al., et Drosophila Habedanck 2005; in Sak 3224 ntepeetsuy ehv xlrdtemechanism the explored have we study, present the In .elegans C. .melanogaster D. iaaae l,20) e12(ac ta. 2010), al., et (Hatch Cep152 2009), al., et Kitagawa ; ora fCl cec 2 (14) 126 Science Cell of Journal Drosophila p- a enipiae nbt C sebyand assembly PCM both in implicated been has Spd-2 elto fPk/a assteprogressive the causes Plk4/Sak of depletion , p- and Spd-2 enovo de h eeso l4Skaergltdby regulated are Plk4/Sak of levels the , n etbae BtecutDa tal., et (Bettencourt-Dias vertebrates and .melanogaster D. Drosophila etil omto in formation centriole Drosophila b rP n proteasome- and TrCP- sels,respectively. Asterless, ooo fSd2was Spd-2 of homolog l4Skwas Plk4/Sak Drosophila asterless C. 08.Apsil otiuino e12t h centrosome explored. the been Results to previously in not Cep192 al., has protein Plk4 of et this human Zhu contribution of of 2007; recruitment possible role al., A the et on 2008). (Gomez-Ferreria data recruitment, duplication PCM conflicting in centriole report Spd-2, of they requirement homolog but a human describe the studies Cep192, two for Likewise, 2010). al., et Hatch eonzn l oeta sfrs(cmd ta. 2009) antibody al., anti-Cep192 et an (Schmidt Cep192, isoforms human potential of all cell case recognizing human S3B). the Fig. all S1D; in Fig. and In material expressed (Cep152-1/2) (supplementary here long are analyzed both lines isoforms 2012), (Cep152-3/-4) al., et short C material (Sonnen extended (supplementary S1B,C) (Cep152- an (Cep152-C) N- Fig. -2 of C-terminus the against extended presence and antibodies or the of Cep152-1 N) use by Cep152 by mainly Cep192-4. shown -4 As both to terminus. and Cep192-1 -3 for from and Cep152- differ as isoforms Cep152-4 to referred to be four will 1 (supplementary isoforms Cep192 These least S2A). and Fig. material S1A) at Fig. material of suggests (supplementary databases existence NCBI and the UniProt Ensembl, of Examination Cep192 and Cep152 isoforms of localization and Expression hmdn ret(upeetr aeilFg S3B), (supplementary Fig. progression cycle material only cell showed during levels (supplementary Cep192 variations whereas minor 2010), arrest al., from et release (Cizmecioglu thymidine after increased Cep152 parental of a second material mother levels the (supplementary Overall S3A). to duplication (Cep164-positive) Fig. recruited centriole but during mature phase centrioles G1 the during centriole with predominantly their along 1B). mother centrioles (Fig. daughter lengths tubulin of and entire glutamylated mother ends both and labeled proximal Cep192 (GT335) the against anti- antibodies stained Whereas centrioles, only 3D- (3D-SIM). antibodies from microscopy Cep152 results lower by illumination corroborated than 1A, structured was distribution (Fig. broader conclusion centrioles a This daughter shows Cep152. Cep192 and that mother indicating panel), entire both the of along labeling walls long showed anti- Cep152, consistently of staining to antibodies contrast In localizations Cep192 similar. indistinguishable are centrosomal isoforms Cep152 the short produced and that suggesting antibodies mother patterns, Both of halves 2011). Lukinavic proximal 2010; previous al., with et line the (Cizmecioglu in panels), data middle to and upper 1A, confined (Fig. centrioles was of Cep152 C-termini or found that we N- (immuno-EM), microscopy the immunoelectron against for Cep152 proteins antibodies two Using the centrosomes. of localization at precise the compared we Cep192, al., generally et Gomez-Ferreria studies 2012; 2007). al., previous Cep192 et of that (Gomez-Ferreria isoform truncated (Cep192-2) note N-terminally shorter, but the on cell focused here, human that all analyzed in emphasize overexpressed expressed lines We isoform predominant with shown). the is not Cep192 here Cep192-1 (data analyzed endogenous Cep192-1 lines of FLAG-tagged cell by co-migration band confirmed human was notion the a This the S2B). represents Fig. in towards material Cep192-1 (supplementary species that reactivity prominent suggesting kDa, the specific 250 above and migrating prominent showed elcceaayi hwdta e12wsassociated was Cep152 that showed analysis cycle Cell and Cep152 of functions the dissecting towards step first a As ise l,21;Sre al., et Sir 2013; al., et ˇius Journal of Cell Science ellrpoenlvl Fg C.Frhroe elto of depletion in Furthermore, changes 2C). to (Fig. attributed levels be As not protein 2A,B). 2A,B). could (Fig. (Fig. cellular depletion localization Cep192 Cep192 of Cep152 or Cep152 effect on the Cep152 affected blotting, western centrosomal either not by was demonstrated of control, of depletion for analyzed upon loss Cep135, albeit strong, of a Localization complete to Whereas led affect Cep192 localization. detectably not of between not depletion centrosome did localization, interdependence Cep152 Cep192 for of possible depletion Cep192 siRNA-mediated a and investigated Cep152 we Cep192 on depends Next, Cep152 of localization Centrosome shown). no not (data revealed isoforms two 3D-SIM the of between by differences localizations significant Cep192-2 the and of (supplementary Cep192-1 analysis FLAG-tagged mitosis Furthermore, S3E). during Fig. PCM material spread expanding but the interphase during throughout centrioles to isoforms: both close Cep192-2, Cep192 spread localized and proteins of Cep192-1 FLAG-tagged localizations Cep192 of the transfection could comparing after differences in centrioles, significant when As no seen 1C). isoforms, Cep152 be (Fig. of the cells remained of mitotic proximity case of the Cep152 (supplementary PCM expanding the spindle whereas the throughout mitotic However, to the S3C,D). confined of Fig. poles material the Cep192 to and Cep152 localized both mitosis, Throughout S3B). Fig. material illustrated is 1 the orientation bars: by Centriole Scale distinguished pairs. schematically. were centriole (C) the cells between mitotic distance and (B) Interphase antibodies. antibodies antibodies. or secondary Cep152 nanogold-labeled ( of by domains followed C-terminal Cep192, or against N- the centrosome against cycle-specific antibodies cell distinct show Cep192 localizations. and Cep152 1. Fig. B , C 2Sclswr ie n tie o DSMwt h indicated the with 3D-SIM for stained and fixed were cells U2OS ) ( A 2Sclswr ie n tie o muoE using immuno-EM for stained and fixed were cells U2OS ) m m. e12adCp5 oprt orcutPk 3225 Plk4 recruit to cooperate Cep152 and Cep192 htteNtriu fCp9- sdsesbefrteinteraction the for dispensable is Cep192-1 indicating of 1–519), N-terminus (residues the Interestingly, Cep192-1 that of 3A). N-terminus but (Fig. Cep192-2, the and with CPAP Cep192-1 not both or with down Cep63 brought was with Cep152 not co-immunoprecipitation but out Cep152, with carried co-immunoprecipitated be next readily could Cep192 various we experiments. CPAP, the and and 2F). to Cep63 Fig. itself), resistant in summarized CPAP all shown; than not were (data (other CP110 regimes depletion here and any of hSas-6 analyzed levels Cep135, proteins centrosomal the the affect detectably of Cep192 not depletion on did Conversely, localization S4). CPAP Fig. of Cep152 material of Cep192, supplementary of dependency 2F; depletion (Fig. the upon of with reduced levels line also centrosomal in were Furthermore, CPAP CPAP). S4; and Fig. for Cep63 material shown supplementary not 2F; was data CPAP (Fig. and Cep152 Cep63 on both dependent of localization centrosome the or 2011), al., Lukinavic et 2010; al., (Cizmecioglu et 2D) reports the Dzhindzhev recent but (Fig. 2010; with Cep192 that Consistent on versa. indicate Cep192 detectably depends vice centrosomes not results with either not these Cep152 of Collectively, of association did 2E). (Fig. localization Pericentrin, Cep152 with component, interfere PCM another ufcetfrteitrcinwt e121(i.3C,D). (Fig. coiled-coil Cep192-1 with central interaction and necessary the both for the was sufficient 221–1308) Conversely, acids (amino Cep152 3B,D). of region (Fig. Cep152 with gemn ihordt nedgnu l4adalwu to us allow proteins and these Plk4 endogenous of on depletion data excellent our single in are with results by agreement These recruitment S5B). Cep152 not Fig. Plk4 of material but (supplementary co-depletion that by Cep192, show only clearly and abolished spite results completely In be our could impossible. caveat, experiment this this expression of of making Myc-Plk4 cells, quantification individual promoter. rigorous amongst Plk4 depleting variation inducible myc-tagged of considerable of an showed effects recruitment the from the examined on expressed also Cep192 we and/or Thus, Cep152 2010). (Cizmecioglu Plk4 al., synthesized et newly of association centrosome Plk4 overall shown). in not (data reductions levels reflect merely results protein not these Fig. and that localization material showed blotting impaired (supplementary Western 4B). effect Fig. significant for S5A; analyzed of no Pericentrin, had co-depletion of control, Depletion and with 4A,B). association Plk4, Plk4 (Fig. prevented centrosomes strongly of completely Cep192 Cep152 levels of and Cep192 depletion centrosomal earlier contrast, the striking with Hatch reduced In line 2010; 2010). Plk4 al., in et al., Dzhindzhev with et 4A,B), 2010; (Fig. al., increase interfere et slight staining (Cizmecioglu a reports significantly Plk4 observed centrosomal we not instead in Cep152 did centrioles; of to cells Depletion recruitment Plk4. U2OS extent human from what of recruitment to centrosome asked of homologs we vertebrate elegans respective Hence, the been Cep152, 2010). and/or has the Cep192 al., Plk4/Sak of et product of (Dzhindzhev the recruitment recruitment to the centrosomal attributed for a in role as Zyg-1 corresponding identified for was factor recruitment Spd-2 Plk4 in Whereas cooperate Cep152 and Cep192 oepoepsil neatosbtenCp9,Cep152, Cep192, between interactions possible explore To e12hspeiul endsrbdt erqie for required be to described been previously has Cep152 p- and Spd-2 Drosophila .elegans C. sels,mgtcnrbt othe to contribute might Asterless, asterless OCnele l,20) a 2001), al., et (O’Connell ise l,21;Sre al., et Sir 2013; al., et ˇius eein gene Drosophila C. Journal of Cell Science muorcpttoswr efre n nlzdb etr ltiguigteidctdatbde.( antibodies. indicated the using blotting western by analyzed and Cep192. performed and were Cep152 immunoprecipitations of Interaction 3. Fig. 3226 ora fCl cec 2 (14) 126 Science Cell of Journal ( A–C E23 el eetasetdwt h niae lsisfr1 or.Atrlss anti-FLAG lysis, After hours. 18 for plasmids indicated the with transfected were cells HEK293T ) D ceeo dniiditrcindomains. interaction identified of Scheme ) euto fcnrsmlprotein; centrosomal detectable of no reduction +, A,D,E). in (exemplified microscopy immunofluorescence and by siRNA determined as localizations, centrosome for interdependencies ( all cells. summarizing phase S identify used to was the Anti-PCNA with antibodies. stained indicated and fixed before were hours they 72 for indicated oligonucleotides the siRNA with transfected were ( cells antibodies. indicated blotting the western using by analyzed were lysates ih panels). right 1 bars: protein. Scale centrosomal of reduction arrow, partial centrosome; from loss complete ro asidct ....( s.e.m.). indicate bars each; error cells 10 experiments, (three independent levels Cep152 and Cep135, Cep192 centrosomal of Quantification (B) cells. images. phase Representative S (A) visualize to used Anti-PCNA was antibodies. stained indicated and the fixed were with they before hours 72 for oligonucleotides siRNA indicated ( Cep152. of for recruitment important centrosome is Cep192 2. Fig. A , B 2Sclswr rnfce ihthe with transfected were cells U2OS ) m m(5 m noeve images, overview in m F C Table ) hl cell Whole ) D , 2 E U2OS ) near- , Journal of Cell Science mgs ih panels). right images, yi,at-y muorcpttoswr efre n nlzdb etr ltiguigteidctdatbde.Saebr:1 bars: Scale antibodies. indicated the using blotting western by analyzed ( antibodies. and indicated performed the were using immunoprecipitations blotting anti-myc western lysis, by analyzed and performed on oitrc ihCp9- hog einformerly region comprise to a recognized now co- through but box’ to Cep192-1 polo ‘cryptic with sufficient as was to Plk4 interact referred was Conversely, N-terminus to Cep192-1) 5A). the found (Fig. of view, myc-Plk4 this this 1–519 for immunoprecipitate of required (residues support N- is In alone the isoform 5A). that Cep192-1 (Fig. indicating the interaction Cep192-2, to not specific but terminus Cep192-1 cells. human length in full Plk4 with interact indicate Cep152 results and Cep135, These Cep192 4D). whereas both (Fig. precipitates, that absent the was in control, for Cep152 analyzed as endogenous well induced as detect we Cep192 following readily and, could experiments, cells immunoprecipitation, U2OS converse anti-myc in In expression be myc-Plk4 endogenous shown). of not of expression FLAG-Cep63 not levels could (data low or Plk4 the Plk4 endogenous reflecting FLAG-CPAP co- presumably of visualized, with be Co-precipitation myc-Plk4 co-precipitate 4C). FLAG- could contrast, (Fig. In not either myc-Plk4 4C). (Fig. might did with Indeed, FLAG-Cep152-2 Cep192 or co-expression whether Plk4. Cep192-1 asked after with Having next immunoprecipitated 2010). we interact al., Cep152, also than et recruitment centrosome Plk4 Hatch for al., critical of 2010; more et is Cep192 (Cizmecioglu al., that Plk4 observed et of Dzhindzhev partner interaction 2010; prominent a as centrosomes. of recruitment human the to in cooperate Plk4 Cep152 and Cep192 that conclude Pericent on data Quant immunofluorescence (B) For images. s.e.m.). Representative (A) indicate DAPI. bars with error stained each; was ( DNA cells S5A. and 10–15 Fig. antibodies experiments, material indicated independent supplementary the (three with see stained levels Plk4. were Plk4 of cells centrosomal recruitment the of centrosome fixation, the After in hours. cooperate 72 Cep152 for and Cep192 4. Fig. neetnl,mcPk ol ec-muorcpttdwith co-immunoprecipitated be could myc-Plk4 Interestingly, Cep152 of characterization the on focused had studies Previous C E23 el eetasetdwt h niae lsis fe yi,at-LGimnpeiiain were immunoprecipitations anti-FLAG lysis, After plasmids. indicated the with transfected were cells HEK293T ) D e12adCp5 oprt orcutPk 3227 Plk4 recruit to cooperate Cep152 and Cep192 y-l4epeso a nue nUO:y-l4clsfr1 or.After hours. 16 for cells U2OS:myc-Plk4 in induced was expression Myc-Plk4 ) ( A emnso e121i ohncsayadsfiin o the shorter for the that sufficient imply also and They necessary Plk4. with both Cep192 of is interaction Cep192-1 of terminus interactions. centrosomal electrostatic to through Plk4 mediated of is 1–46; evolutionarily binding material proteins the docking (supplementary that comprise (residues suggesting residues S6B,C), acidic S6A) Cep152 Fig. regions of both Fig. stretches in the and conserved Plk4 Interestingly, material to 190–240) binding 2010). supplementary for (residues al., important et being Cep192 as Dzhindzhev Hatch here 2010; 2010; al., identified 5E), et al., (Fig. (Cizmecioglu binding et cells this of Plk4 U2OS importance for the in on region data (1–46) previous extending but Cep152-2 expressing and A confirming when of centrosomes 5E). seen N-terminus (Fig. also to the was centrosomes localize phenotype from sequestration not away similar Plk4 did sequestered Cep192-1 instead of When 5D). fragment of (Fig. 190–240 interaction two the residues for expressed the sufficient spanning being within region between as domain Cep192-1 the Plk4-binding interaction identified the direct of Cep192-1 narrowing a Further proteins. 570–820) supporting (residues (1– Plk4 5C), Cep192-1 GST-tagged (Fig. to of bound fragment consistently of recombinant 330) small, albeit expressed fraction, bacterially a Furthermore, a al., 2010). with et al., interaction Cizmecioglu et residues 2010; Hatch the 5B; al., 2010; for et (Fig. (Dzhindzhev sufficient 2012) 5B), also al., (Fig. Cep152-2 is et region (Slevin This boxes 570–820). polo three of two , B olciey hs eut eosrt htteetne N- extended the that demonstrate results these Collectively, 2Sclswr rnfce ihteidctdsRAoligonucleotides siRNA indicated the with transfected were cells U2OS ) nvivo in hsmnmlPk-idn N-terminal Plk4-binding minimal this , m m(5 m noverview in m i siRNA rin ification Journal of Cell Science r eurdfrmta neato n o etilrlclzto ti td) e12as neat ihCp3(i ta. 01 n PP(Cizme CPAP and of 2011) region al., coiled-coil et central (Sir the Cep63 and with Cep192 interacts of 1 also 603–2538 bars: Cep152 acids Scale study). Amino 2010). (this Plk4. localization of al., centriolar box et for polo Dzhindzhev cryptic and 2010; the interaction with mutual interact for study) required this are 2010; al., et (Hatch Cep152 eetasetdwt h niae F-e12cntut n y-l4 fe yi,at-F muorcpttoswr efre n nlzdb analyzed and performed were immunoprecipitations anti-GFP and lysis, ( Plk4 After against antibodies. myc-Plk4. indicated and the constructs using GFP-Cep192 blotting indicated the with transfected were n omsi lesann.Tearwpit tteNs-i-e121130famn htseiial neat ihGTPk 7–2.( 570–820. GST-Plk4 with interacts specifically lo that fragment to 1–330 Due NusA-His-Cep192-1 (4 the (B) volume at more antibodies. points times indicated arrow four The the staining. with using Blue loaded Coomassie blotting were and western samples by these (FL), analyzed length and ( full performed GFP-Plk4 were of immunoprecipitations levels anti-FLAG expression lysis, After hours. 18 fPk e st rdc htteetopoen hudalso should proteins two these that predict to us discovery led Our recruitment 2008). centrosome Plk4 the controversial al., in of been cooperate et Cep152 al., has Zhu and process Cep192 et 2007; that this al., Hatch in et for Cep192 2010; (Gomez-Ferreria for important al., role be et a to 2010), (Cizmecioglu shown been duplication previously centriole has duplication Cep152 centriole in While cooperate Cep152 and centrosome Cep192 for required are that domains CPAP localization. Cep63, including al., Cep192, Plk4, Cep152, summarizes et and 5F between Fig. interactions Gomez-Ferreria Plk4. previous known with 2012; interact all in to competent al., investigated not is et 2007), been (Gomez-Ferreria has studies which Cep192-2, isoform, Plk4. of recruitment centrosome for important is Cep192 of N-terminus The 5. Fig. 3228 C h niae S-o uAHstge osrcswr uiidfo atraadsbetdt S ulonasy rtiswr eetdb SDS-P by detected were Proteins assay. pulldown GST a to subjected and bacteria from purified were constructs NusA-His-tagged or GST- indicated The ) ora fCl cec 2 (14) 126 Science Cell of Journal c tbln N a tie ihDP.( DAPI. with stained was DNA -tubulin; E 2Sclswr rnfce ihteidctdGPpamd.Atrfxto,teclswr tie ihantibodies with stained were cells the fixation, After GFP-plasmids. indicated the with transfected were cells U2OS ) m m(5 m noeve mgs ih panels). right images, overview in m F neato a novn e12adCp9.TeNtria ein fCp9 ti td)and study) (this Cep192 of regions N-terminal The Cep192. and Cep152 involving map Interaction ) upesdt iia xetb elto fete Ss6or hSas-6 either of depletion was cells by U2OS extent in similar Plk4 a of to overexpression one suppressed by most induced that at overduplication be Cep192. centriole showing could the cells Likewise, genuine or 6A,C). a of Fig. hSas-6, centriole; (70% of Cep152 depletion factor same after duplication seen was the centriole that either Cep152 as showing and severe Cep192 as of cells co-depleting almost of of effect depletion 35% the Furthermore, only after Cep192 to dots phenotype and CP110 compared of Cep152 number cell), the of on the per (based co-depleted centriole of one been 60% most at in had to showed and Up that 6A,C) 6B,D). cells (Fig. (Fig. U2OS cells Plk4 overexpressing U2OS cells in U2OS both impairment strong duplication, a centriole in resulted of proteins two the of met, co-depletion indeed as was prediction This duplication. centriole in cooperate ( A , B h niae lsiswr xrse nHK9Tclsfor cells HEK293T in expressed were plasmids indicated The ) 6 nteiptglta h te F-l4samples. GFP-Plk4 other the than gel input the on ) D E23 cells HEK293T ) igue al., et cioglu western y w Cep152 AGE Journal of Cell Science y-l4oeepeso a nue o 6husb diino ercci.Atrfxto,clswr tie ihteidctdatbde n ce and antibodies indicated the with h stained 8 were and * cells aphidicolin s.e.m.); of fixation, indicate addition After bars by tetracyclin. induced error of was each; arrest addition cells ( phase ( by microscopy. S microscopy. immunofluorescence hours Then, immunofluorescence by hours. 16 by determined determined 48 for numbers numbers for induced centriole oligonucleotides was siRNA and overexpression indicated antibodies the indicated myc-Plk4 with the transfected with were stained cells were Plk4 cells fixation, After hours. 72 sfr fCp9,drcl id l4 hsioomhsnot has isoform This Plk4. longest binds the directly Cep192-1, versa. Cep192, that vice of not demonstrate but isoform we Cep192 on importantly, depends association Most interphase centrosome in maximal Cep192 Cep152 been that that of addition and specifically al., in Cep152 has show et with now Zhu function interacts We 2004; cells. this mitotic al., to Cep192 al., et attributed et human Pelletier been Kemp nucleation For 2000; 2007; al., previously 2008). microtubule al., et et have O’Connell and Gomez-Ferreria 2004; 2007; recruitment Spd2 Raff, and and PCM homolog (Dix Cep192 Cep192 in human invertebrate duplication. implicated of centriole its and roles recruitment and the Plk4 investigated in Cep152 have we Here Discussion Plk4. through of recruitment likely centrosome and most the Cep192 in duplication, synergism that centriole their conclude in we cooperate Thus, Cep152 6B,D). (Fig. the of proteins depletion single latter not but Cep152, and Cep192 of co-depletion duplication. centriole abolishes Cep192 and Cep152 of Co-depletion 6. Fig. P , .5 ** 0.05, P , .1 cl as 1 bars: Scale 0.01. C , D uniiaino h eut hw nAadB epciey(he needn xeiet,100 experiments, independent (three respectively B, and A in shown results the of Quantification ) m m(5 e12adCp5 oprt orcutPk 3229 Plk4 recruit to cooperate Cep152 and Cep192 ( m A ugs htcnroercuteto l4dpnso electrostatic on depends Plk4 for of indispensable recruitment centriole is that strongly Asterless data suggest our Collectively, why flies. in Sak for provides of recruitment centriolar this explanation and residues attractive acidic an conserved the Interestingly, lacks 2010). that members al., et (Dzhindzhev melanogaster from Sak Cep192 with from 24–55 deletion interaction domain similarly, residues and, acidic study) (this the of Plk4 human of to Deletion binding stretches prevents conserved residues. comprise acidic Cep152 Plk4 and of for Cep192 required both domains in of binding the Interestingly, in absence results duplication. the then centriole Cep152 concomitantly, impairs Plk4 and, in centrosomes and from Plk4 in of Cep192 only loss complete both Cep152 of apparent for Co-depletion readily role Cep192. a becomes whereas localization centrosomes, to an As recruitment interaction detection. escaped the hitherto has why vivo Plk4 explaining and Cep192 perhaps between studied, been previously noeve mgs ih panels). right images, overview in m 2Swr rnfce ihteidctdsRAoiouloie for oligonucleotides siRNA indicated the with transfected were U2OS ) elcino hsitrcin e12i rtclfrPlk4 for critical is Cep192 interaction, this of reflection p- steol n fteaaye e12family Cep192 analyzed the of one only the is Spd-2 .melanogaster D. sels prevents Asterless B U2OS:myc- ) ntriole uslater ours D. in Journal of Cell Science vrxrsino h l4bnigdmi fCp9 displaces Cep192 is of strongly domain conclusion Cep192 Plk4-binding conversely, the of whereas, of This centrosomes, depletion overexpression with that Plk4. association Plk4 showing impairs novel for data a by as partner supported kDa), 279 docking of isoform weight centrosomal longest molecular the specifically (predicted Cep192, Cep192-1 identify we study this In electrostatic through interactions Plk4 of docking Centrosomal similarly may between Cep192 in relationship development. mutations mammalian extent functional affect interesting what be the to will determine it on duplication, to centriole in Based Cep192 the and 2011). Cep152 in Kalay al., 2010; al., mutations et et by (Guernsey afflicted humans, syndrome patients Seckel in and In identified microcephaly been 2012; recently 2011). have al., gene al., et Cep152 (Azimzadeh et of Cep152 Plk4-expressing exception and/or the Carvalho-Santos Cep192 all possible on either that supported the express suggest studies One is fact (with Recent in conclusion organisms hSas-6. centrioles patterns. This their of expression recruitment. through evolution or phylogenetic duplication Plk4 Plk4 centriole in by Cep192 role in that as is joint cooperate centriole findings of Cep152 such these depletion a and of as factors in interpretation severe straightforward as results duplication nearly Cep152 is key that and that phenotype centriole Cep192 demonstrate in duplication we protein particular, of this In 2008), for 2008). co-depletion al., role al., et et a Zhu (Zhu confirm duplication 2007; also al., data (Dix present et assembly our Gomez-Ferreria spindle emphasized 2007; and Raff, mostly expansion and PCM have to Cep192 related on functions studies previous Cep152 and Whereas Cep192 between (see cooperation is Functional data complexes distinct immunolocalization multiple high-resolution of below). by co-existence complex we the supported but limited components, that particular of of note because abundance low complexes and/or stability quaternary isolate co- to the or fail for ternary experiments argue co-immunoprecipitation course results of that is these possible It complexes. value, multiprotein distinct face any, several of At existence if CPAP, Cep63. little, or or comprise Cep63 CPAP complexes Cep152–Plk4 either that ternary and suggesting robust Cep152–Plk4 reveal between not complexes did co- experiments Cep152– our distinct immunoprecipitation Similarly, of complexes. existence Cep152–Cep63/CPAP the and suggests Cep192 This or co- interaction, CPAP. ternary either or Using and Cep63 this detect Cep192 Cep192. both not comprising by for complexes Cep152 binding did quaternary required Plk4 we for experiments not required immunoprecipitation is is it Cep192-1 although Importantly, of Cep192. N-terminal the in that with extension indicating show -2, interacts and but Cep192-1 both also interactions binds Cep152 Cep152 these confirm that readily and addition we Cep63 al., et Here with Sir 2010; al., interact 2011). et Dzhindzhev to 2010; al., shown et complexes (Cizmecioglu CPAP been multiple previously form to has likely Cep152 are Cep192 and Cep152 see centrosomal to prediction. the this interesting confirms be within information will regions domain structural It direct Cep152. acidic whether polo-box and and Cep192 charged 2012) proteins docking al., positively et the (Slevin between interactions 3230 ora fCl cec 2 (14) 126 Science Cell of Journal .dendrobatidis B. ) e igedpeino e12ipiscnrsm soito of and association Cep152, centrosome co- or impairs Cep192 Cep192 more of that either single-depletion recruitment yet of Plk4 observation single-depletion affects than our Cep152 severely and from Cep192 of arises depletion contradiction partly apparent can proteins Cep192. Cep152 two of that absence the the and for that functions compensate indicates redundant partly This in the display reduction levels. Cep192, additional Plk4 of Plk4 significant a absence centrosomal caused or the Cep152 synthesized centrosomes in Cep152 of at However, depletion of maintenance recruitment. newly depletion Plk4 initial hands, either its impair our of not In did 2010). alone association al., et cells required (Cizmecioglu centrosome specifically essential but not mammalian centrosomes is at Cep152 for in Plk4 that al., of suggested et maintenance was Cep152 Hatch it for 2010; study al., for one et In Dzhindzhev 2010). role 2010; al., corresponding et (Cizmecioglu 2010; a whilst al., Plk4 However, on of to 2010). association et centrosome al., for in concur et (Cizmecioglu important clearly Hatch is 2010; Plk4 studies Asterless al., of with et Previous homolog Dzhindzhev human interacts centrosome. the Asterless, Cep152, the that demonstrate from Plk4 oePk tcnrsms nyc-elto fCp9 and Cep192 binding. of Plk4 abolish co-depletion completely Only then would centrosomes. it Cep152 along of at but persistence Cep192, Cep192, for Plk4 allow to on to some bound Cep152 sites was residual binding sufficient that leave Plk4 Cep152 would of most Plk4 population of the additional loss loss with would of the this Cep192 of in unmasking but depletion of result Conversely, the lost, Plk4 Cep192. depletion on be by sites that would Upon binding compensated sites Cep152. be predict Cep192, binding from would by Plk4 would contribution some dominated minor Cep152, model largely a is the with centrosomes also to cells, but recruitment centrosomes. to untreated Cep152, binding of centrosomal Plk4 For enhances depletion of Cep152 why loss of depletion only partial why not a explain causes on would Cep192 sites model interaction Plk4 This Cep192, the Cep152 with Cep192. of to some interacts first, masking than Cep152 Plk4 potentially which, Cep192 of thereby sub-population to to for a data readily according second, more our model important and, binds tentative Collectively, cells a become within Cep192. propose Plk4 of to to us absence likely lead the this in and is centrosomes, recruitment from Cep152 Cep152 of does loss residual Cep192 complete of a depletion cause that not emphasize we However, Cep152. euaecnrsm auain(aeadNg,19)adthat to and known 1996) Nigg, been and long (Lane not has maturation post-translational is centrosome Plk1 other thus regulate recruitment that and or level Considering This phosphorylation protein modifications. study). by Cep192 total this governed in likely 2008; increase an al., by al., paralleled et et (Gomez-Ferreria centrosomes cycle-regulation Zhu 2012; mitosis at of al., levels 2007; cell onset Cep192 et the First, Sonnen at 2008). their drastically 2011; al., increase al., et and et Zhu study; Sir this Plk4 of 2010; al., localizations et and centrosome (Cizmecioglu precise Cep152 the the explain Cep192, in to fails differences it However, striking Cep152. siRNA-mediated and after Cep192 Plk4- observed of the have depletion explain we largely that can phenotypes above related described model simple Plk4 The and Cep152 Cep192, of localization regulation local for Evidence osdrn htbt e12adCp5 idt l4 an Plk4, to bind Cep152 and Cep192 both that Considering Drosophila atal ofitn eut aebe reported been have results conflicting partially , Drosophila Journal of Cell Science ihcnrsmsadgnrlysosamr restricted Sonnen more restricted 2010; more even an al., a shows Plk4 et Third, study). shows this (Cizmecioglu 2012; al., generally et Cep192 than and localization association centrosomes a cycle-regulated 2011). G2/M is cell al., with Cep192 undergoes et the that also (Santamaria intriguing Cep152 Plk1 at is Second, of it substrate recruitment 2009), physiological likely al., Cep192 et (Haren prevents transition inhibition Plk1 ltmltdtbln(T3;muemncoa)wr idypoie yF. and Germany) by (Munich, provided Leonhardt H. kindly previously. 2011), and Edde al., were B. monoclonal) et described (Sir monoclonal) (mouse UK) been mouse (Cambridge, PCNA Gergely have (GT335; polyclonal), 2010) tubulin (rabbit glutamylated al., monoclonal anti-Cep135 Cep63 and et 2006) against al., culture and 2009), Antibodies (Guderian et al., (Yan antibodies et (undiluted anti-Cap350 anti-Plk4 (Schmidt 2007), anti-Plk4 al., anti-Cep192 E et and polyclonal (Graser anti-CP110 anti-Cep164 anti-Cyclin 2007), anti-Sas-6, al., et HE-12 (undiluted (Kleylein-Sohn anti-Plk1, anti-Myc des monoclonal 9E10 Scientifique Monoclonal supernatant), to 2012). supernatant), (Elevages according al., purified Laboratories et culture and (Sonnen aa1378– River France) protocols Romans, and Charles standard Laboratories, (aa1–87 River at Charles Cep152 raised Dombes, His-tagged were against 1654) antibodies rabbit Polyclonal Antibodies construct a (1– into Cep192-1 product the of ligating N-terminus and with library the restriction cDNA after cDNA amplifying from U2OS Cep192-2 2009). by a containing al., obtained from et cDNAs obtained was Schmidt bp) CPAP was 3986 2005; cDNA and al., Cep192-1 Plk4 et (Gomez- Cep152-2 of for (Habedanck USA) A previously York, cloning described (New Gergely and respectively. was Sharp F. IRCMp5012G0825D) J. 2007), by (clone D. al., provided Imagenes and 2011) kindly et al., were et Ferreria Cep192-2 (Sir UK) and (Cambridge, Cep63 encoding Plasmids major a Plasmids Methods represents pro-centriole and Materials clearly the of 2012) proximity restrict investigation. close al., future for that the et Plk4.challenge to (Sonnen and mechanisms Plk4 formation Cep152 detailed of Cep192, localization of cooperate the control to expected spatiotemporal Understanding are and/or the factors modifications accessory in posttranslational unidentified confer yet as to multiple Thus, able kinases. and cycle shown), enzymes cell Cep152 not by both (data regulation that at Plk1 hinting for and strongly sites 2010) docking al., predicted harbor et Cep192 (Joukov Cep192 A that Aurora intriguing and/or also binds Cep152 is regulate It phosphorylation. might through in Cep192 Plk4 Plk4 Conversely, with interact assays. directly locallybinding Cep192 that and possible Cep152 be both stability, is Plk4 as regulate must locally It to contribute progression. Cep192 proteins and/or cycle Cep152 these cell throughout between controlled that indicate data formation these Collectively, study). complex this in 1 al., et Fig. Sonnen and (compare 2012 Cep152 or Cep192 either than localization aee eodr nioiswr ucae rmBoim osimultaneously To CF405S- Biotium. and from USA) purchased AlexaRed-555-, CA, were (Carlsbad, AlexaRed-594-, antibodies Invitrogen anti-rabbit secondary Abcam. from labeled and purchased from anti-mouse were antibodies secondary purchased antibody an AlexaCy5-647-labeled and was Germany) AlexaGreen-488-, (Taufkirchen, GFP Sigma western from by against purchased Plk4 were endogenous Germany) FLAG of (Heidelberg, and NEDD1, detection Hoffmann against for used Antibodies I. was blotting. by 2010) al., provided et kindly (Cizmecioglu Plk4, against antibody pET-57- respectively. Nova (Invitrogen), pDEST15 pcDNA3.1(-)Puro/EGFP-C1, or for the and (Novagen) using constructs DEST (Invitrogen) vector expression technology Gateway entry bacterial the via the pENTR/D-TOPO prepared and were Plk4 plasmids myc, and N-terminal GFP-tagged Cep192 providing tags. vectors FLAG pcDNA3.1 into or subcloned were cDNAs ATC). CAGAGGGAAGAGGTACCCATCC- sequence-specific Cep192-1N-rv: with TTTTGGCCGGCCAAATGGAAGATTTTCGAGGTA- and amplified TAGCAGAAGAATC was manufacturer’s (Cep192-1-fw: cDNA II the Ultra Cep192 primers Pfu to Technologies) Polymerase Transcriptase the (Agilent according Using Reverse kit (Invitrogen). III (QIAGEN) primers Superscript oligo-dT kit with using (Invitrogen) performed Mini was RNeasy RT-PCR instructions. the using cells ´ Mnplir rne Wlfe l,19) epciey monoclonal A respectively. 1992), al., et (Wolff France) (Montpellier, a -tubulin, Kpn :RAwsioae rmU2OS from isolated was RNA I: c tbln eieti,cci B1 cyclin Pericentrin, -tubulin, nvitro in e12adCp5 oprt orcutPk 3231 Plk4 recruit to cooperate Cep152 and Cep192 ihdrcl ope nioiso h aespecies. same the of incubation antibodies to prior coupled antibodies directly anti-FLAG required, with using Whenever blocked (Invitrogen). were with Kits antibodies labeled Labeling secondary Antibody directly fluorophores, corresponding were the AlexaCy5-647 using and they AlexaGreen-488 antibodies, AlexaRed-555, rabbit AlexaRed-594, polyclonal different visualize i meso betv Oyps,adaCoSA Q aea(Photometrics). 0.2- camera obtained HQ2 sections CoolSNAP optical a Serial and (Olympus), objective immersion oil ufr(0m rsHLp .,50m al %Igepal). 1% NaCl, mM 500 7.4, pH Tris-HCL mM (50 buffer ACACGAACA(rsre l,20) ie12# GCATT- al., #2 et (Gomez-Ferreria (Zhu siCep152 CAGAGGAATCAATAATAAA #2 siCep192 AAGGAAGACATTTTCATCTCT 2007), 2008), al., #1 et al., siCep192 et GCG- GAGGTTGAGACTAA, #1 (Graser siCep152 2001), al., GATCCAACTGGAAATCTA et used: the were (Elbashir oligonucleotides to CGTACGCGGAATACTTCGA duplex siGL2 according siRNA following (Invitrogen) The Oligofectamin protocol. manufacturer’s using performed were Transfections depletion protein siRNA-mediated 37 at grown were cells All transfections and culture Cell o loecnemcocp el eegono oesisadfxdi methanol in fixed at and minutes coverslips 5 on grown for were cells microscopy fluorescence For Microscopy mM 1 NaF, buffer mM lysis 50 13,000 in for NaCl, at centrifugation by after minutes mM minutes cleared 30 150 were 15 Lysates hours for Diagnostics)]. IgePal, 24 (Roche ice Cocktail 0.5% Inhibitor on mM collected 7.4, 25 lysed pH PMSF, were and Tris-HCl PBS mM cells [50 in HEK293T washed transfection, immunoprecipitations, assays siRNA biochemical For All and preparation shown. extract are Cell Unless #1 Germany. results. Hilden, Cep192 CAACGCT- Qiagen, similar and from gave #1 ordered siCep63 were respectively, Cep152 oligonucleotides for Cep192, duplex used 2009), results or oligonucleotides otherwise, Cep152 siRNA stated of al., Both depletion 2007). GGAA- al., for et siCPAP et (Graser 2002), TGATTTATCAGCAA (Schmidt Merdes, GCAGC- and GATTGCACCAGTCAA siPericentrin (Dammermann 2007), al., TGAGCTGAAGGAGA et siSas-6 2005), (Graser al., CTAGATGATGCTACTAAGCAA et (Habedanck CTGGTAGTACTAGTTCACCTA siPlk4 2007), el eeclue nDlec’ oiidEgesmdu (DMEM), medium (100 Biotech, Eagle’s PAN penicillin-streptomycin (FCS, modified serum and calf Dulbecco’s Germany) fetal in heat-inactivated Aidenbach, 10% cultured with supplemented were cells vrin4 ple rcso,Isqa,W)eupe ih45 4,48 514, 488, 445, 405, with equipped WA) Issaquah, generated. Precision, were Applied intensity. 4; projections signal (version centrosomal maximum-intensity the from For and subtracted was Softworx. exposure intensity ImageJ, using signal same with Background picture levels the one protein into with centrosomal projected of and a quantitation algorithm using deconvolution a analyzed equipped were Precision), Cells (Applied base 1999). TE200 100 Nikon al., APOPLAN an a with et on microscope (Meraldi DeltaVision previously described MIT o 8husa 16 at hours 18 for IPTG mM 1 blotting. h auatrrsisrcin.GTpldw saswr efre by performed were 4 assays was at hours Strep-tag, GST-pulldown protein, 2 C-terminal for to fusion instructions. proteins a according incubating Germany) and Cep192 manufacturer’s GmbH, NusA-tag (IBA Healthcare); beads the and Superflow Strep-Tactin (GE His- using purified N-terminal beads an 4B harboring Sepharose Glutathione 5 MNC,1m T,1m MF opeeMn rtaeInhibitor Protease Mini Complete PMSF, mM 1 4 DTT, 2 Diagnostics), mM (Roche 1 Cocktail NaCl, mM 150 lhgoyi Mrk n y-l4epeso a nue yteadto of addition the by 1.6 induced was 2007). 50 expression and myc-Plk4 al., 1 (Invitrogen) and G418 et (Merck) mg/ml hygromycin (Kleylein-Sohn 0.5 line ml with cell previously cultured were WT described cells U2OS:myc-Plk4 myc-Plk4 been U2OS has tetracycline-inducible (U2OS:myc-Plk4) The Germany). Karlsruhe, rsHlp .,1 gPl 0 MNC) on rtiswr ltdby eluted were proteins mM Bound (50 NaCl). buffer wash mM 300 with times IgePal, 2 three in 1% boiling washed 7.4, were pH beads Immune- Tris-HCl (ChromoTek). to beads bound agarose GFP-Trap complexes 1 or with (Sigma-Aldrich) coated Gel Affinity Healthcare) (GE beads proteinG efre sn rnI-T rnfcinraet(iu i,Mdsn WI) Madison, Bio, (Mirus protocol. were manufacturer’s reagent controls the vector transfection to U2OS corresponding according TransIT-LT1 or or HEK293T using vectors of expression performed transfections mammalian Transient with medium. cells culture in incubated and ˚ ihGuahoeSpaoe4 ed G elhae n ahn ihwash with washing and Healthcare) (GE beads 4B Sepharose Glutathione with C m DSMwspromdo etVso M-lz irsoesystem microscope OMX-Blaze DeltaVision a on performed was 3D-SIM eobnn rtiswr xrse yidcino L1DE3 BL21 of induction by expressed were proteins Recombinant /lo ercci.T nueSpaearss el eeicbtdwt either with incubated were cells arrests, phase S induce To tetracyclin. of g/ml m /lahdclno Mtyiie o ees el eewse ihPBS with washed were cells release For thymidine. mM 2 or aphidicolin g/ml 6 D apebfe,rsle ySSPG n nlzdb western by analyzed and SDS-PAGE by resolved buffer, sample SDS b 2 gyeohsht,1m aaae opeeMn Protease Mini Complete vanadate, mM 1 -glycerophosphate, 20 ˚ .Atbd nuain n ahnswr efre as performed were washings and incubations Antibody C. 6 g ,4 . ..olimrinadaPa pcrmt60 Apochromat Plan a and oil-immersion N.A. 1.4 ˚ na5 O topee ea 2So HEK293T or U2OS HeLa, atmosphere. CO2 5% a in C ˚ n xrcsicbtdfr2husa 4 at hours 2 for incubated extracts and C ˚ m .Pk S-uinpoenwsprfe using purified was protein GST-fusion Plk4 C. /lBA olwdb nuainfr1hu at hour 1 for incubation by followed BSA, g/ml m ˚ pr ln the along apart m n5 MTi-C H74 .%IgePal, 0.5% 7.4, pH Tris-HCl mM 50 in C m fatbde,at-LGM2 anti-FLAG antibodies, of g z ai eepoesdusing processed were -axis z sak eeacquired were -stacks m /l Gibco-BRL, g/ml, .coli E. ˚ with C 6 with 1.42 m g/ Journal of Cell Science atr ntesml ln.Teptenwssitdltrlytruhfv phases 60 five through of laterally rotations shifted interference was angular fine-striped pattern three a The generate plane. and sample to the grating on optical pattern movable a through directed ol h hneswr hncrflyainduigainetprmtrfrom using parameter axis alignment 1 optical using with aligned the alignment carefully around measurements SoftWoRx then the and were and control lens plane channels target The image a using tool. the measured as in shifts predetermined aligned were channels zmae,J,Wn,M . onor .M,Sa M., D. Downhour, L., M. Wong, J., Azimzadeh, References number [grant at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.129502/-/DC1 online grant available Foundation Sciences material Supplementary a Science Life by National supported Cellular E.A.N.] Swiss was to and 31003A_132428/1 Planck work the Max Molecular This International from Germany). the for Boehringer the of (Martinsried, from School member fellowship a PhD Research and a Fonds of recipient Ingelheim the was K.F.S. Funding manuscript. the wrote E.A.N. analyzed and and experiments K.F.S. K.F.S., the data. experiments. performed the Y.-D.S. the and designed E.A. and A.-M.G., conceived E.A.N. and K.F.S. contributions Author laboratory Nigg the support of Oliver members for discussions. and all facility helpful and for Ferrand Core microscope, OMX Imaging Isabelle F. the Biozentrum’s thank with Alexia the also help, of We Biehlmaier technical stage. excellent early its for Edde Martinsried B. during Sharp, in D. work Biochemistry Gergely, this of supporting Institute Max-Planck for the thank We Acknowledgements mean Workbench as Main Student’s ** represented CLC using software are the performed using Data performed 6.7.1. were alignments Protein techniques Miscellaneous 2560 sCMOs liquid-cooled frame 60 four N full and Apo (Olympus) Edge, Plan a lens (pco using objective acquired cameras immersion were oil Images lasers. NA solid-state 1.42 nm 642 and 568 3232 eefrhrpoesda ecie rvosy(r ta. 1998). al., Cells et (Nanoprobes). (Fry previously Silver described for HQ by as with minutes, Nanoprobes) followed processed 30 silver-enhanced further and (1:50; for was were minutes performed Nanogold IgG-Nanogold 60 was minutes. for goat-anti-mouse/rabbit BSA 50 performed 2% with + were X- PBS incubation Triton incubations in 0.5% antibody Blocking + primary minutes. PBS 2 with permeabilized for and 100 minutes, 10 for paraformaldehyde Probes). Molecular (Invitrogen, 256 of was al., images et reconstructed Schermelleh the 2008; of al., size SoftWoRx resulting et OMX The Gustafsson 2008). DeltaVision Precision; the (Applied 3D-SIM using package Raw reconstructed software cameras. and separate processed laser achieved by were lowest was wavelengths the images of imaging at acquisition range Multichannel dynamic sequential photobleaching. between 15-bit through minimize of of intensities image to raw optimal possible a achieve power in to counts adjusted milliseconds, 10,000 was 250 and laser 7000 and each 10 of between power typically the and were times Exposure acquisition. SIM 0.125 by separated etnor-is . orge-atn,A,Cretr . iabli M., Riparbelli, L., Carpenter, A., Rodrigues-Martins, M., Raff, Bettencourt-Dias, and A. Khodjakov, A., Franz, N., Peel, T., Lehmann, Vinadogrova, K., C., Brunk, R., Antony, Basto, U., Haselmann-Weiss, M., Arnold, J., Seidler, R., Bahtz, P o lcrnmcocp,clswr rw ncvrlp,fxdwt 4% with fixed coverslips, on grown were cells microscopy, electron For emn,L,Gt,M . am,N,Blox . alii .adGlover, and G. Callaini, F., Balloux, N., Carmo, development. K., M. M. D. Gatt, L., Lehmann, 1032-1042. W. J. I. duplication. Hoffmann, centriole and D. W. 461-463. F. W. Marshall, , 0.01. 20) etooeapiiaincniiit uoieei nflies. in tumorigenesis initiate can amplification Centrosome (2008). 20) A/L4i eurdfrcnroedpiainadflagella and duplication centriole for required is SAK/PLK4 (2005). ora fCl cec 2 (14) 126 Science Cell of Journal ur Biol. Curr. 21) etooels nteeouino planarians. of evolution the in loss Centrosome (2012). m .Telsrlns48 6 n 4 mwr sdfr3D- for used were nm 642 and 568 488, lines laser The m. .Cl Sci. Cell J. 15 21) C6i usrt fPk n eurdfor required and Plk4 of substrate a is GCP6 (2012). 2199-2207. , t ts.Sgiiac sidctda * as indicated is Significance -test. ´ m n .Hfmn o egns ln Nigg Elena reagents, for Hoffmann I. and . imtrmliseta loecn beads fluorescent multi-spectral diameter m 125 ˚ o ahzscin pia -etoswere z-sections Optical section. z each for 6 486-496. , 10 htmtis.Ectn ih was light Exciting Photometrics). 2160; 6 ...Piws oprsn were comparisons Pairwise s.e.m. nhzAvrd,A and A. Alvarado, ´nchez 6 5 ies The pixels. 256 P Science , .5and 0.05 Cell 133 335 6 , , ucad . efse,A,Mhswr,A,Hce,V,Derc,C,Bue A., Brune, C., Dietrich, V., Hachet, A., Maheshwari, A., Desfosses, P., Guichard, ursy .L,Jag . usn . rod . oyka,K,Pry S., Perry, K., Bouyakdan, M., Arnold, J., Hussin, H., Jiang, L., D. A. Guernsey, E. Nigg, and A. Uldschmid, J., Westendorf, G., Guderian, rsr . tehf .D,Lvi,S . ase,O . al,S,L lc,M and M. Clech, Le S., Lamla, S., O. Gassner, B., S. Lavoie, D., Y. Stierhof, S., Graser, ai,E .adKtai,N. Katsanis, and E. E. Davis, A. Merdes, and A. Dammermann, Go oe-erra .A,Bskrv . uln . iga,A .adPelletier, and C. A. Gingras, M., S., Mullin, M., J. Bashkurov, Caldwell, A., K., M. S. Gomez-Ferreria, Chanda, W., D. Buster, U., Rath, D. A., Pellman, M. and Gomez-Ferreria, A. S. Godinho, J., N. Ganem, uh-eria . orge-atn,A,Bno . iabli . hn,W., Zhang, M., Riparbelli, I., Bento, A., Rodrigues-Martins, I., Cunha-Ferreira, r,A . ead,P n ig .A. E. Nigg, and P. W. Meraldi, M., J. A. Dennis, Fry, and M. Heffernan, S., Yousefi, B., Motro, C., Fode, imcol,O,Anl,M,Bhz . etl,F,Ert . aemn-es,U., Haselmann-Weiss, L., Ehret, F., Settele, R., Bahtz, M., Arnold, O., Cizmecioglu, K. Rhee, and I. Hoffmann, O., Cizmecioglu, J., Chang, lahr .M,Hrot,J,Lnekl . acn . ee,K n Tuschl, and K. Weber, A., Yalcin, W., Lendeckel, J., Harborth, M., S. Elbashir, avloSno,Z,Aizdh . eer-el .B n Bettencourt-Dias, and B. J. Pereira-Leal, J., Azimzadeh, Z., Carvalho-Santos, C. G. Rogers, and W. D. Buster, E., J. Klebba, W., C. Brownlee, aeac,R,Siro,Y . ikno,C .adNg,E A. E. Nigg, and J. C. Wilkinson, D., Y. Stierhof, R., Habedanck, zidhv .S,Y,Q . esof . zlvk,G,CnaFrer,I., Cunha-Ferreira, G., Tzolovsky, K., Weiskopf, D., Q. Yu, S., N. Dzhindzhev, Josue J., Dobbelaere, avloSno,Z,Mcao . rno . aae-aee . Rodrigues- F., Tavares-Cadete, P., Branco, P., Machado, Z., Carvalho-Santos, M. Bornens, M. Gatti, and G. M. Giansanti, S., Bonaccorsi, utfsn .G,Sa,L,Crtn .M,Wn,C . ouosaa .N., I. Golubovskaya, J., C. Wang, M., P. Carlton, L., Shao, G., M. Gustafsson, i,C .adRf,J W. J. Raff, and I. C. Dix, Go and C. Canard, M., Delattre, lco,S,Gplkiha,J,Ooi . oynvk,A,Cuc,A,Nicastro, A., Church, A., Polyanovsky, Y., Omori, J., Gopalakrishnan, S., Blachon, etnor-is . idbad,F,Plmn . od,G n oih,S A. S. Godinho, and G. Woods, D., Pellman, F., Hildebrandt, M., Bettencourt-Dias, nz,P. ¨nczy, siaa . ahe .adGo and C. Sachse, T., Ishikawa, rcoypabslbody. basal Trichonympha MCPH4. to linked families al. microcephaly Genet. et Hum. primary C. J. S. in Am. Evans, CEP152 N., protein Dumas, centrosomal J., Beis, T., Babineau-Sturk, uohshrlto euae etil ubrb otoln betaTrCP-mediated controlling by number degradation. centriole regulates autophosphorylation formation. cilium A. E. Nigg, ilg fhmngntcdisease. genetic human of biology o.Cl Biol. Cell Mol. irtbl raiaindpnso PCM-1. on depends organization microtubule YDt rmt ioi pnl assembly. spindle mitotic promote to CYLD L. J. D. assembly. Sharp, spindle and and centrosome R. D. Rines, instability. chromosomal to centrosomes lm bqii iaelmt etooeapiiaintruhdgaaino SAK/ of degradation through M. amplification Bettencourt-Dias, centrosome PLK4. and limits M. ligase D. ubiquitin Glover, Slimb G., Callaini, E., Laue, e2poenkns,amme fteNM aiyo elcceregulators. cycle cell of family NIMA the of 17 member a kinase, protein Nek2 l4adCA otecentrosome. the to CPAP and I. Plk4 Hoffmann, and C. cycle. Antony, centrosome the during formation procentriole in J. function EMBO CPAP for critical is uiepoensrn/henn iaeta srltdt h rspiapl kinase polo Drosophila the proliferation. to cell related in is involved and that kinase protein-serine/threonine murine cells. mammalian T. 194 M. iaePk ucin ncnroeduplication. centriole in functions Plk4 kinase iabli . orge-atn,A,BtecutDa,M,Clan,G and G. Callaini, Nature M., centrosome M. Bettencourt-Dias, and D. A., Glover, duplication Rodrigues-Martins, M., centriole Riparbelli, dissect to screen Drosophila. in RNAi maturation genome-wide A atn,A,PriaLa,J .adBtecutDa,M. Bettencourt-Dias, and centriole pathway. B. centriole-assembly induce the J. of to Pereira-Leal, evolution Plk4 A., Martins, stabilizes Twins subunit regulatory amplification. 2A Phosphatase obigi iefedfursec irsoyb tutrdillumination. structured by W. microscopy J. J. fluorescence Sedat, wide-field and in A. doubling D. Agard, Z., W. Cande, etil,bti ipnal o etil duplication. centriole for dispensable is but centriole, yoiei uigml eoi natresmtnso rspiamelanogaster. Drosophila of mutants asterless in Biol. Cell meiosis J. male during cytokinesis duplication. centriole for T. essential orthologs Avidor-Reiss, Are and Cep152 J. Malicki, D., lgn etil formation. centriole elegans 21) etooe n ii nhmndisease. human in cilia and Centrosomes (2011). 470-481. , 94 21) E12itrcspyial n ucinlywt h K63-deubiquitinase the with functionally and physically interacts CEP192 (2012). 20) ulxso 1ncetd NsmdaeRAitreec ncultured in interference RNA mediate RNAs 21-nucleotide of Duplexes (2001). 21) vlto:Taigteoiiso etils ii,adflagella. and cilia, centrioles, of origins the Tracing Evolution: (2011). 165-175. , 4957-4970. , ur Biol. Curr. 467 21) oad oeua rhtcueo etil assembly. centriole of architecture molecular a Towards (2012). 29 21) h etooei el n organisms. and cells in centrosome The (2012). 714-718. , 20) e14 oe etil pedg rti eurdfrprimary for required protein appendage centriole novel a Cep164, (2007). 2395-2406. , 142 .Cl Sci. Cell J. .Cl Biol. Cell J. 13 21) sels sasafl o h ne fcnroeassembly. centriole of onset the for scaffold a is Asterless (2010). 751-761. , .Cl Biol. Cell J. 425-435. , Nature ,F,Sikruj,S,Bu,B,Tpn .adRf,J. Raff, and N. Tapon, B., Baum, S., Suijkerbuijk, F., ´, 19 87 43-49. , 40-51. , 123 411 LSBiol. PLoS Science 195 21) h iiptis rniinlmdlit systems into model transitional a ciliopathies: The (2012). 20) rspiaSd2rcut C otesperm the to PCM recruits Spd-2 Drosophila (2007). 2163-2169. , ur Biol. Curr. 494-498. , nz,P. ¨nczy, 179 231-243. , 21) e12at sasafl o erimn of recruitment for scaffold a as acts Cep152 (2010). rc al cd c.USA Sci. Acad. Natl. Proc. 321-330. , ur Biol. Curr. ur pn ee.Dev. Genet. Opin. Curr. 20) ua e12i eurdfrmitotic for required is Cep192 Human (2007). 337 .Cl Biol. Cell J. 20) sebyo etooa rtisand proteins centrosomal of Assembly (2002). nz,P. ¨nczy, 6 19) etooa ucinfrtehuman the for function centrosomal A (1998). e224. , 553. , 20) rspiaatresadvertebrate and asterless Drosophila (2008). 16 20) eunilpoenrcuteti C. in recruitment protein Sequential (2006). Nature 1844-1849. , elCycle Cell .Cl Sci. Cell J. .Cl Biol. Cell J. 17 a.Cl Biol. Cell Nat. 19) pnl efognzto and self-organization Spindle (1998). 20) he-iesoa resolution Three-dimensional (2008). 20) ehns ikn extra linking mechanism A (2009). 21) athe rhtcueof architecture Cartwheel (2012). 191 460 1960-1966. , rnsGenet. Trends 731-739. , 278-282. , ur Biol. Curr. 21) L2phosphorylation PLK2 (2010). 11 123 Genetics 3555-3558. , 159 Science 22 1414-1426. , 7 91 290-303. , 255-266. , 1140-1146. , 21) uain in Mutations (2010). 27 6388-6392. , 21) h Protein The (2011). 21) l4trans- Plk4 (2010). 17 20) h SCF/ The (2009). 21) Stepwise (2010). 307-315. , 180 20) h Polo The (2005). 335 1759-1764. , 19) a,a Sak, (1994). 2081-2094. , 422-426. , .Cl Biol. Cell J. a.Rev. Nat. MOJ. EMBO Biophys. (2008). Journal of Cell Science edl . eate . eut,L,Bue,K n Go and K. Baumer, L., Cerutti, M., Delattre, S., Leidel, edl .adGo and S. Leidel, A. E. Nigg, and A. H. Lane, V., and Y.-D. Olieric, Stierhof, R., D., Habedanck, M., Keller, Clech, Le J., M., Westendorf, J., Hilbert, Kleylein-Sohn, N., Olieric, I., Vakonakis, D., Kitagawa, iaaa . us,C,Flu C., Busso, D., Kitagawa, Mu M., Kirkham, F. K. O’Connell, and J. Ahringer, P., Zipperlen, R., K. H., Kopish, Kayserili, A., S., C. L. Kemp, Bicknell, E., Pohl, E., K. Brown, Y., Aslan, G., Yigit, E., Kalay, M. D. Livingston, and C. J. Walter, A., Rodriguez, A., Nicolo, De V., Joukov, ead,P,Lks . r,A . atk .adNg,E A. E. Nigg, and J. Bartek, M., A. Fry, J., Lukas, P., Meraldi, oln,A . ahnti . h,Q,Bur . em,I . ig .A and A. E. Nigg, M., I. Verma, M., Bauer, Q., Zhu, D., Fachinetti, J., A. W. Holland, D. Cleveland, and H. Hoover, S., Niessen, W., Lan, J., A. Holland, T. Stearns, and W. D. Cleveland, J., A. Holland, A., Kulukian, M., E. Hatch, ’onl,K . ao,C,Kps,K . ud .D,Kmhe,K . Li, J., K. Kemphues, D., D. Hurd, R., K. Kopish, C., Caron, F., K. O’Connell, G. J. White, and N. K. Maxwell, F., K. O’Connell, A. E. Nigg, A. E. Nigg, S. R. Nowakowski, and T. J. Sharkey, L., T. Megraw, Lu ae,L,Sers .adLdr,J. Luders, and T. Stearns, L., Haren, ig .A n af .W. J. Raff, and A. E. Nigg, Lukinavic dr,J n tan,T. Stearns, and J. ¨ders, 439. lgn n srcutdt agtrcnroe neprcl cycle. cell per once centrioles daughter to recruited is and elegans 190-202. A. E. Nigg, centrioles. of symmetry 9-fold Flu the C., M. Erat, M., Bortfeld, o ua oolk iae1(l1 ntefntoa auaino mitotic of maturation functional the in (Plk1) 1 kinase polo-like centrosomes. human for embryos. elegans C. in formation centriole for critical 17 is ZYG-1 by SAS-6 size. centrosome controls that protein centriolar 587. elegans C. a is SAS-4 syndrome. Seckel in disrupted protein Tu Y., Li, etooemtrto n ulcto nC lgn eur h oldci protein coiled-coil the require elegans C. in SPD-2. duplication and maturation Centrosome spindle centrosome-driven activation. A promotes Aurora (Cep192) organelle-specific USA kDa in Sci. engaging 192 by of assembly protein Centrosomal etooedpiaint neprcl cycle. cell per once to duplication centrosome W. D. Cleveland, 721-729. etooedpiainwt itntmtra n aenlrlsi h embryo. the in roles paternal and maternal 105 distinct G. with duplication J. the centrosome White, in asters and sperm Y. the of formation and zygote. axis elegans anteroposterior Caenorhabditis the of polarization for A. Cdk2-cyclin and E2F requires cells Biol. somatic mammalian in duplication syndromes. microcephaly of root centrosomal iekns iaeatvt iiscnrsm vrulcto yatrgltn its autoregulating by overduplication centrosome limits stability. activity own kinase 4 kinase like duplication. centriole for required is and Plk4 with interacts Cep152 components. PCM multiple involves centrosomes One mitotic to complexes tubulin disease. 215-221. progression? complex. centrosomal Cep57-Cep63-Cep152 Go N., in Biol. and Cell elegans Mol. C. Rev. in Nat. duplication centrosome for required cells. family human protein a defines 900-907. , 547-558. , 4 1 nz,P n onsn K. Johnsson, and P. ¨nczy, e5976. , 88-93. , ˇ u,G,Lvgn,D,Opnl,M,Ueaa . emn,L,Garin, L., Reymond, K., Umezawa, M., Orpinell, D., Lavogina, G., ius, e.Cell Dev. Cell 20) etooedpiain frlsadlicenses. and rules of duplication: Centrosome (2007). ¨ysu 107 20) etooeaertos as rcneuneo cancer of consequence or cause aberrations: Centrosome (2002). 20) l4idcdcnroeboeei nhmncells. human in biogenesis centriole Plk4-induced (2007). z . Nu B., ¨z, a.Rv Cancer Rev. Nat. 21022-21027. , 139 Biol. Cell Nat. .Cl Biol. Cell J. .Cl Biol. Cell J. nz,P. ¨nczy, le-ecet . eea . rl,S n ya,A A. A. Hyman, and S. Grill, K., Oegema, T., ¨ller-Reichert, 663-678. , 6 21) h uoeuae ntblt fPl-iekns limits 4 kinase Polo-like of instability autoregulated The (2012). 511-523. , rbr,G tal. et G. ¨rnberg, 20) h .eeaszg1gn noe euao of regulator a encodes gene zyg-1 elegans C. The (2001). 20) A- sesnilfrcnrsm ulcto nC in duplication centrosome for essential is SAS-4 (2003). 8 135 161-167. , 20) irtbl-raiigcnrs re-evaluation. a centres: Microtubule-organizing (2007). cie,I n Go and I. ¨ckiger, 188 19) nioymconeto eel nesnilrole essential an reveals microinjection Antibody (1996). 20) etils etooe,adclai elhand health in cilia and centrosomes, Centrioles, (2009). 7 cie,I,Go I., ¨ckiger, 115-125. , 1701-1713. , 191-198. , 2 e.Biol. Dev. 815-825. , Cell 21) eetv hmclcosikn eel a reveals crosslinking chemical Selective (2013). 20) l1dpnetrcuteto gamma- of recruitment Plk1-dependent (2009). a.Genet. Nat. 144 21) E12i eoemaintenance genome a is CEP152 (2011). 222 nz,P tal. et P. ¨nczy, 364-375. , ur Biol. Curr. nz,P. ¨nczy, 55-70. , rnsCl Biol. Cell Trends ee Dev. Genes 20) h p- eei required is gene spd-2 The (2000). 43 23-26. , 21) d5a2epssthe exposes Cdk5rap2 (2011). 20) hshrlto of Phosphorylation (2009). 23 nz,P. ¨nczy, 21) tutrlbssof basis Structural (2011). 26 265-270. , 2684-2689. , rnsCl Biol. Cell Trends 19) Centrosome (1999). 21 rc al Acad. Natl. Proc. e.Cell Dev. 470-480. , .Cl Biol. Cell J. 20) SAS-6 (2005). Cell e.Cell Dev. 21) Polo- (2010). 112 e.Cell Dev. a.Cell Nat. (2003). (2004). (2010). (2010). 4 431- , 575- , PLoS 191 Cell 13 17 , , , e12adCp5 oprt orcutPk 3233 Plk4 recruit to cooperate Cep152 and Cep192 a,X,Hbdnk .adNg,E A. E. Nigg, and R. Habedanck, X., Yan, Ne de A., Wolff, amr,H,Laaae,S,Rblo . ag,B,Ria . cwr,H and H. Schwarz, J., Reina, B., Lange, E., Rebollo, S., Llamazares, H., Varmark, a rue,M,Hrn,M,Adev,A,Yngsw,H . aauh,S., Yamaguchi, A., H. Yanagisawa, A., Andreeva, M., Hirono, M., Breugel, van G. C. Woods, and K. G. Thornton, Go and P. Strnad, A. E. Nigg, and H. F. Leonhardt, K. L., Schermelleh, O’Connell, F., and K. J. Sonnen, W. Jahng, E., D. Anderson, Y., Liu, H., M. Song, oes .C,Rsn .M,Rbrs .M,Pie,M n oes .L. S. Rogers, and M. Peifer, M., D. Roberts, M., N. Rusan, C., G. Rogers, i,J . ar .R,Ncoa,A . avlo .P,Kusi,M,Ssik A., Sossick, M., Khurshid, P., O. Carvalho, K., A. Nicholas, R., A. Barr, H., J. P., Sir, Bonnet, S., Thambirajah, A., Boeckx, N., Vloemans, F., Tack, E., J. Sillibourne, lvn .K,Ne . ikro,D . utr .W,Rgr,G .adSe,K C. K. Slep, and C. G. Rogers, W., D. Buster, C., D. Pinkerton, J., Nye, K., L. Slevin, orge-atn,A,Rprel,M,Clan,G,Goe,D .adBettencourt- and M. D. Glover, G., Callaini, M., Riparbelli, A., Rodrigues-Martins, Gru U., Kossatz, S., Chauhan, M., May, D., Keller, Y., Homsi, A., Puklowski, cmd,T . lyenSh,J,Wsedr,J,L lc,M,Lvi,S B., S. Lavoie, M., Clech, Le J., Westendorf, J., Kleylein-Sohn, I., T. Schmidt, elte,L,OToe . cwgr . ya,A .adMu and A. A. Hyman, A., Schwager, E., O’Toole, L., Pelletier, Ozlu L., Pelletier, cemle,L,Crtn .M,Hae . ho . ioo . nr . uk,B., Burke, P., Kner, L., Winoto, L., Shao, S., Haase, M., P. Carlton, L., Schermelleh, A., Schmidt, M., Bauer, F., Zhang, R., Malik, S., Elowe, B., Wang, A., Santamaria, h,F,Lw,S,Br,A,Pnhv . ap,A,Rctr . Mu C., Richter, A., Ralph, D., Pinchev, A., Bird, S., Lawo, F., Zhu, rtis A30adFP oprtswt B nmcouueanchoring. microtubule in EB1 with cooperates FOP, and CAP350 proteins, GT335. antibody, monoclonal specific a Biol. using Cell tissues mouse in beta-tubulin Edde ucinadeby eeomn nDrosophila. in development embryo and function C. Gonzalez, 1199. aaaa . oge,N,Ptoih . bn,I . oisn .V tal. et V. C. centrioles. Robinson, in organization O., its I. suggest Ebong, SAS-6 M., of Structures Petrovich, (2011). N., Morgner, Y., Nakazawa, Biol. fpl-iekns n t oei etil duplication. centriole in role its and 4 T. kinase Grand-Perret, polo-like and of M. Bornens, C., F. Ramaekers, Rome? human of architecture into insight novel provides centrosomes. microscopy illumination factors. by assembly elegans centriole C. of in levels duplication boxes the centriole polo controlling regulates tandem 2A-SUR-6/B55 two phosphatase reveals Protein box polo cryptic duplication. plk4 centriole the for of required structure The F. (2012). Gergely, and G. centrioles. parental C. around ring 1147-1153. a Woods, forms complex C., protein microcephaly D’Santos, S., Reichelt, Science centrosome control M. to Dias, HsSAS-6 al. targets et and P. PLK4 M. by Manns, regulated duplication. is A., ligase Pich, ubiquitin S., Kubicka, V., tehf .D n ig .A. E. Nigg, CP110. and D. Y. Stierhof, rti P- srqie o ohprcnroa aeilrcutetadcentriole T. and recruitment material pericentriolar both for duplication. required A. is A. SPD-2 Hyman, protein and T. Reichert, utclriaigo h ula eihr ih3 tutrdillumination structured 3D with periphery al. et nuclear G. the M. Gustafsson, of microscopy. A., imaging D. Agard, multicolor C., A. M. E. spindle. Cardoso, Nigg, mitotic and early R. the M110.004457. Korner, of H., phosphoproteome H. Sillje, e12rgltscnrsm biogenesis. L. centrosome Pelletier, regulates and Cep192 A. A. Hyman, R., Kittler, Cell Biol. h C lm bqii iaergltsPk/a eest lc centriole block to levels Plk4/Sak regulates ligase ubiquitin Slimb reduplication. SCF The 20) etil sebyi anradtselegans. Caenorhabditis in assembly Centriole (2006). ,B,Go,F n eolt P. Denoulet, and F. Gros, B., ´, 18 rnsGenet. Trends 389-396. , ur Biol. Curr. 316 20) eiiigterl ftemte etil ncnroebiogenesis. centriole in centriole mother the of role the Revisiting (2007). 59 17 1046-1050. , a.Cl Biol. Cell Nat. ur Biol. Curr. Science 425-432. , 634-644. , cad . hle,D,Mzrul . Desbruye H., Mazarguil, D., Chillet, B., ´chaud, il Open Biol. .Cl Biol. Cell J. ,N,Hna,E,Cwn . aemn,B,Re,M,Mu M., Ruer, B., Habermann, C., Cowan, E., Hannak, N., ¨, nz,P. ¨nczy, 20) sels sacnroa rti eurdfrcentrosome for required protein centriolar a is Asterless (2007). 19 320 1005-1011. , 25 14 1332-1336. , 501-510. , 1 20) ehnsso rcnroeformation. procentriole of Mechanisms (2008). 965-976. , 863-873. , 184 13 1004-1009. , 225-239. , 20) oto fCnroeLnt yCA and CPAP by Length Centriole of Control (2009). 20) rmr ircpay oalrasla to lead roads all do microcephaly: Primary (2009). Structure 20) h anradtseeascentrosomal elegans Caenorhabditis The (2004). 19) itiuino ltmltdapaand alpha glutamylated of Distribution (1992). ur Biol. Curr. 20) ope ftocentrosomal two of complex A (2006). 20) h amla P- ortholog SPD-2 mammalian The (2008). 20 1905-1917. , ur Biol. Curr. e.Cell Dev. 21) h C-BW E3- SCF-FBXW5 The (2011). 21) h Plk1-dependent The (2011). 18 o.Cl.Proteomics Cell. Mol. 21) Autophosphorylation (2010). 136-141. , o.Bo.Cell Biol. Mol. Nature rs . ueet S., Audebert, E., `res, 17 20) Subdiffraction (2008). 20 21) 3D-structured (2012). 1735-1745. , 563-571. , 21) primary A (2011). Science 444 le-ecet T., ¨ller-Reichert, ¨ller-Reichert, 619-623. , a.Genet. Nat. 21 rnsCell Trends 331 547-561. , ¨nwald, (2011). (2009). 1196- , u.J. Eur. ¨ller- Mol. 10 43 , ,