DOCSLIB.ORG

Snapshot: Microtubule Regulators I

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

SnapShot: Microtubule Regulators I Karen Lyle, Praveen Kumar, and Torsten Wittmann Department of Cell and Tissue Biology, University of California, San Francisco, CA 94143, USA Representative Proteins Protein Biochemical Family Function H. sapiens D. melanogaster C. elegans A. thaliana S. cerevisiae S. pombe γ-tubulin γ-TuSC provides TUBG1 γTub23C TBG-1 ATGCP2 Tub4 Gtb1 primary nucleation TUBG2 γTub37C TUBG1 site γ-tubulin contribute to GCP2 Dgrip84 Ce-Grip-1 AtSpc97p Spc97 Alp4 complex nucleation GCP3 Dgrip91 AtSpc98p Spc98 Alp6 -TuRC) γ proteins ( (GCPs) contribute to GCP4 Dgrip75 AtGCP4 Gfh1p nucleation, γ-TuRC GCP5 Dgrip128 AtGCP5 Mod21 integrity and assembly -Tubulin Ring Complex -Tubulin γ GCP6 Dgrip163 AtGCP6 Alp16 Augmin recruits γ-TuRC to hDgt6 Dgt2, Dgt3, Dgt4, spindle microtubules Dgt5, Dgt6 Centrosomin controls γ-TuRC Cnn (centrosomin) Mto1 distribution Microtubule Nucleators Microtubule Cep192 recruits NEDD1 to Cep192 D-Spd2 SPD-2 centrosome NEDD1 recruits γ-TuRC to NEDD1 Dgp71WD At-Nedd1 centrosome -TuRC Regulators -TuRC γ Rsp1 regulates γ-TuRC Rsp1 dispersion Bicaudal dynein-dependent BICD1 BicD (bicaudal D) BICD-1 ■Mitosis/spindle assembly minus end anchor ■Tissue-specifi c microtubule organization Microtubule cell cortex interactions Desmoplakin links microtubule *DSP ■ Plant-specifi c protein families minus ends to ■ desmosomes *Mutation or overexpression linked to disease Proteins Anchoring Minus End Ninein minus end anchor Ninein Nudel minus end anchor NDEL1 NudE NUD-2 Ndl1 EBs promote both rescue EB1 EBP-1, EBP-3 AtEB1C Bim1 Mal3 and catastrophe, directly recognize EB2 growing microtubule ends EB3 EB1 AtEB1A, AtEB1B XMAP215, processively *chTOG (CKAP5) Msps (mini spindles) ZYG-9 MOR1 Stu2 Dis1, Alp14 chTOG accelerate polymerization CLIPs promote rescue in cells *CLIP-170 CLIP-190 Bik1 Tip1 and in vitro CLIP-115 CRMP-2 binds tubulin dimers, *CRMP-2 UNC-33 promotes assembly SPIRAL suppresses growth SPR1, SP1L Microtubule Assembly Promoters Microtubule pauses SPR2, SP2L Stathmin/Op18 promotes catastrophe, *Stathmin/Op18 stathmin inhibits polymerization, highly expressed in SCG10, SCLIP, developing neurons RB3 MAP18 inhibits polymerization MAP18 Kinesin-8 and depolymerize Kif2A KLP10A KLP-7 Kip3 Klp5, Klp6 13 (internal microtubules from Kif2B KLP59C motor domain) both ends Promoters MCAK/Kif2C KLP59D Kif18A KLP67A Direct Regulators of Microtubule Polymerization Dynamics Regulators of Microtubule Direct Kinesin-14 depolymerizes Kar3 Microtubule Disassembly Microtubule (C-terminal microtubules from the motor domain) plus end Katanin severs microtubules Katanin p60/p80 D-Kat60 MEI-1 AtKTN1, AtKSS Spastin severs microtubules *SPG4 D-Spastin SPAS-1 Fidgetin severs microtubules FIGN D-Fidgetin FIGL-1 Proteins Severing Microtubule Microtubule 380 Cell 136, January 23, 2009 ©2009 Elsevier Inc. DOI 10.1016/j.cell.2009.01.010 See online version for legend and references. SnapShot: Microtubule Regulators I Karen Lyle, Praveen Kumar, and Torsten Wittmann Department of Cell and Tissue Biology, University of California, San Francisco, CA 94143, USA Dynamic remodeling of the microtubule cytoskeleton is essential for many cellular processes, including cell division, migration, and differentiation. Microtubules are dynamic polymers composed of α/β-tubulin dimers, and they switch stochastically between phases of growth (polymerization) and shortening (depolymerization). The transition from microtubule growth to shortening is referred to as catastrophe, and the transition from microtubule shortening to growth is called rescue. Intracellular microtubule organization is controlled by the activity and distribution of nucleation sites and by the activity of microtubule-regulatory proteins. These proteins may influ- ence polymerization dynamics directly, may cut or bundle existing microtubules, or may stabilize microtubules indirectly. In cells, microtubule nucleation is mediated by the multisubunit γ-tubulin ring complex (γ-TuRC), which is recruited to centrosomes or spindle poles by associated proteins such as Cep192. However, the regulation of microtubule nucleation is incompletely understood. In differentiated cells, microtubule minus ends are often redistributed away from the centrosome. For example, the protein ninein anchors minus ends to cell-cell junctions in polarized epithelial cells and to desmosomes in differentiated keratinocytes. Several different proteins influence microtubule polymerization dynamics by directly interacting with microtubule plus ends. EB-family proteins directly recognize biochemical or structural differ- ences at the growing microtubule plus ends, influence microtubule polymerization dynamics, and may act as adaptors that mediate the association of other proteins with growing microtubule plus ends. Proteins of the XMAP215 family are thought to enhance the microtubule polymerization rate by processively adding tubulin subunits to the growing microtubule plus ends. In contrast, the CRMP-2 protein in neurons enhances microtubule assembly by interacting with free tubulin dimers. Microtubule disassembly is promoted by two different mechanisms. Stathmin is a small protein that binds to tubulin dimers and lowers the pool of free tubulin avail- able for polymerization, thus decreasing the microtubule growth rate and increasing the frequency of spontaneous depolymerization (catastrophe). In contrast, internal motor domain kinesins bind directly to microtubule ends and use ATP hydrolysis to catalytically depolymerize microtubules. Microtubule-severing proteins cut existing microtubules, generating new minus and plus ends. The generation of short microtubule fragments by these proteins is important for the reorganization of the micro- tubule cytoskeleton without requiring complete microtubule disassembly. Because organization and dynamics of the microtubule cytoskeleton are crucial for many cellular functions, most direct regulators of microtubule nucleation, polymerization, and disassembly are involved in multiple cell processes. In addition, the existence of plant-specific families of microtubule regulatory proteins, such as SPIRAL, highlights important differences in microtubule function and organization between plants and animals. Abbreviations chTOG, colonic hepatic tumor overexpressed gene; CLIP, cytoplasmic linker protein; CRMP, collapsin response mediator protein; Dgt, dim γ-tubulin; EB, end-binding protein; KLP, kinesin-like protein; MAP, microtubule-associated protein; NEDD1, neural precursor cell expressed, developmentally downregulated gene 1; Spc, spindle pole body component; γ-TuRC, γ-tubulin ring complex; γ-TuSC, γ-tubulin small complex. ACKNOWLEDGMENTS T.W. is supported by NIH R01GM079139. K.L. is supported by NIH/NIDCR training grant 5T32DE007306. REFERENCES Baas, P.W., Karabay, A., and Qiang, L. (2005). Microtubules cut and run. Trends Cell Biol. 15, 518–524. Bartolini, F., and Gundersen, G.G. (2006). Generation of noncentrosomal microtubule arrays. J. Cell Sci. 119, 4155–4163. Cassimeris, L. (2002). The oncoprotein 18/stathmin family of microtubule destabilizers. Curr. Opin. Cell Biol. 14, 18–24. Ehrhardt, D.W. (2008). Straighten up and fly right: microtubule dynamics and organization of non-centrosomal arrays in higher plants. Curr. Opin. Cell Biol. 20, 107–116. Howard, J., and Hyman, A.A. (2007). Microtubule polymerases and depolymerases. Curr. Opin. Cell Biol. 19, 31–35. Manning, J., and Kumar, S. (2007). NEDD1: function in microtubule nucleation, spindle assembly and beyond. Int. J. Biochem. Cell Biol. 39, 7–11. Sharp, D.J., Mennella, V., and Buster, D.W. (2005). KLP10A and KLP59C: the dynamic duo of microtubule depolymerization. Cell Cycle 4, 1482–1485. Sonnenberg, A., and Liem, R.K. (2007). Plakins in development and disease. Exp. Cell Res. 313, 2189–2203. Wiese, C., and Zheng, Y. (2006). Microtubule nucleation: gamma-tubulin and beyond. J. Cell Sci. 119, 4143–4153. Wordeman, L. (2005). Microtubule-depolymerizing kinesins. Curr. Opin. Cell Biol. 17, 82–88. 380.e1 Cell 136, January 23, 2009 ©2009 Elsevier Inc. DOI 10.1016/j.cell.2009.01.010.
Recommended publications
  • Title a New Centrosomal Protein Regulates Neurogenesis By

    Title a New Centrosomal Protein Regulates Neurogenesis By

    Title A new centrosomal protein regulates neurogenesis by microtubule organization Authors: Germán Camargo Ortega1-3†, Sven Falk1,2†, Pia A. Johansson1,2†, Elise Peyre4, Sanjeeb Kumar Sahu5, Loïc Broic4, Camino De Juan Romero6, Kalina Draganova1,2, Stanislav Vinopal7, Kaviya Chinnappa1‡, Anna Gavranovic1, Tugay Karakaya1, Juliane Merl-Pham8, Arie Geerlof9, Regina Feederle10,11, Wei Shao12,13, Song-Hai Shi12,13, Stefanie M. Hauck8, Frank Bradke7, Victor Borrell6, Vijay K. Tiwari§, Wieland B. Huttner14, Michaela Wilsch- Bräuninger14, Laurent Nguyen4 and Magdalena Götz1,2,11* Affiliations: 1. Institute of Stem Cell Research, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany. 2. Physiological Genomics, Biomedical Center, Ludwig-Maximilian University Munich, Germany. 3. Graduate School of Systemic Neurosciences, Biocenter, Ludwig-Maximilian University Munich, Germany. 4. GIGA-Neurosciences, Molecular regulation of neurogenesis, University of Liège, Belgium 5. Institute of Molecular Biology (IMB), Mainz, Germany. 6. Instituto de Neurociencias, Consejo Superior de Investigaciones Científicas and Universidad Miguel Hernández, Sant Joan d’Alacant, Spain. 7. Laboratory for Axon Growth and Regeneration, German Center for Neurodegenerative Diseases (DZNE), Bonn, Germany. 8. Research Unit Protein Science, Helmholtz Centre Munich, German Research Center for Environmental Health, Munich, Germany. 9. Protein Expression and Purification Facility, Institute of Structural Biology, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany. 10. Institute for Diabetes and Obesity, Monoclonal Antibody Core Facility, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany. 11. SYNERGY, Excellence Cluster of Systems Neurology, Biomedical Center, Ludwig- Maximilian University Munich, Germany. 12. Developmental Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, USA 13.
  • Bioinformatics Identi Cation of Prognostic Factors Associated With

    Bioinformatics Identi Cation of Prognostic Factors Associated With

    Bioinformatics Identication of Prognostic Factors Associated with Breast Cancer Ying Wei Sichuan University https://orcid.org/0000-0001-8178-4705 Shipeng Zhang College of Pharmacy, North Sichuan Medical College Li Xiao West China School of Basic Medical Sciences and Forensic Medicine Jing Zou West China School of Basic Medical Sciences and Forensic Medicine Yingqing Fu West China School of Basic Medical Sciences and Forensic Medicine Yi Ye West China School of Basic Medical Sciences and Forensic Medicine Linchuan Liao ( [email protected] ) West China School of Basic Medical Sciences and Forensic Medicine https://orcid.org/0000-0003-3700-8471 Research Keywords: Breast cancer, Differentially expressed genes, miRNAs, Transcription factors, Bioinformatic analysis Posted Date: December 2nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-117477/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/23 Abstract Background: Breast cancer (BRCA) remains one of the most common forms of cancer and is the most prominent driver of cancer-related death among women. The mechanistic basis for BRCA, however, remains incompletely understood. In particular, the relationships between driver mutations and signaling pathways in BRCA are poorly characterized, making it dicult to identify reliable clinical biomarkers that can be employed in diagnostic, therapeutic, or prognostic contexts. Methods: First, we downloaded publically available BRCA datasets (GSE45827, GSE42568, and GSE61304) from the Gene Expression Omnibus (GEO) database. We then compared gene expression proles between tumor and control tissues in these datasets using Venn diagrams and the GEO2R analytical tool. We further explore the functional relevance of BRCA-associated differentially expressed genes (DEGs) via functional and pathway enrichment analyses using the DAVID tool, and we then constructed a protein-protein interaction network incorporating DEGs of interest using the Search Tool for the Retrieval of Interacting Genes (STRING) database.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • The Basal Bodies of Chlamydomonas Reinhardtii Susan K

    The Basal Bodies of Chlamydomonas Reinhardtii Susan K

    Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4].
  • Par6c Is at the Mother Centriole and Controls Centrosomal Protein

    Par6c Is at the Mother Centriole and Controls Centrosomal Protein

    860 Research Article Par6c is at the mother centriole and controls centrosomal protein composition through a Par6a-dependent pathway Vale´rian Dormoy, Kati Tormanen and Christine Su¨ tterlin* Department of Developmental and Cell Biology, University of California, Irvine, Irvine, CA 92697-2300, USA *Author for correspondence ([email protected]) Accepted 3 December 2012 Journal of Cell Science 126, 860–870 ß 2013. Published by The Company of Biologists Ltd doi: 10.1242/jcs.121186 Summary The centrosome contains two centrioles that differ in age, protein composition and function. This non-membrane bound organelle is known to regulate microtubule organization in dividing cells and ciliogenesis in quiescent cells. These specific roles depend on protein appendages at the older, or mother, centriole. In this study, we identified the polarity protein partitioning defective 6 homolog gamma (Par6c) as a novel component of the mother centriole. This specific localization required the Par6c C-terminus, but was independent of intact microtubules, the dynein/dynactin complex and the components of the PAR polarity complex. Par6c depletion resulted in altered centrosomal protein composition, with the loss of a large number of proteins, including Par6a and p150Glued, from the centrosome. As a consequence, there were defects in ciliogenesis, microtubule organization and centrosome reorientation during migration. Par6c interacted with Par3 and aPKC, but these proteins were not required for the regulation of centrosomal protein composition. Par6c also associated with Par6a, which controls protein recruitment to the centrosome through p150Glued. Our study is the first to identify Par6c as a component of the mother centriole and to report a role of a mother centriole protein in the regulation of centrosomal protein composition.
  • Supplemental Information Proximity Interactions Among Centrosome

    Supplemental Information Proximity Interactions Among Centrosome

    Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl
  • Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes

    Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes

    [CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors.
  • The P53/P73 - P21cip1 Tumor Suppressor Axis Guards Against Chromosomal Instability by Restraining CDK1 in Human Cancer Cells

    The P53/P73 - P21cip1 Tumor Suppressor Axis Guards Against Chromosomal Instability by Restraining CDK1 in Human Cancer Cells

    Oncogene (2021) 40:436–451 https://doi.org/10.1038/s41388-020-01524-4 ARTICLE The p53/p73 - p21CIP1 tumor suppressor axis guards against chromosomal instability by restraining CDK1 in human cancer cells 1 1 2 1 2 Ann-Kathrin Schmidt ● Karoline Pudelko ● Jan-Eric Boekenkamp ● Katharina Berger ● Maik Kschischo ● Holger Bastians 1 Received: 2 July 2020 / Revised: 2 October 2020 / Accepted: 13 October 2020 / Published online: 9 November 2020 © The Author(s) 2020. This article is published with open access Abstract Whole chromosome instability (W-CIN) is a hallmark of human cancer and contributes to the evolvement of aneuploidy. W-CIN can be induced by abnormally increased microtubule plus end assembly rates during mitosis leading to the generation of lagging chromosomes during anaphase as a major form of mitotic errors in human cancer cells. Here, we show that loss of the tumor suppressor genes TP53 and TP73 can trigger increased mitotic microtubule assembly rates, lagging chromosomes, and W-CIN. CDKN1A, encoding for the CDK inhibitor p21CIP1, represents a critical target gene of p53/p73. Loss of p21CIP1 unleashes CDK1 activity which causes W-CIN in otherwise chromosomally stable cancer cells. fi Vice versa 1234567890();,: 1234567890();,: Consequently, induction of CDK1 is suf cient to induce abnormal microtubule assembly rates and W-CIN. , partial inhibition of CDK1 activity in chromosomally unstable cancer cells corrects abnormal microtubule behavior and suppresses W-CIN. Thus, our study shows that the p53/p73 - p21CIP1 tumor suppressor axis, whose loss is associated with W-CIN in human cancer, safeguards against chromosome missegregation and aneuploidy by preventing abnormally increased CDK1 activity.
  • KIF2C (2488C3a): Sc-81305

    KIF2C (2488C3a): Sc-81305

    SANTA CRUZ BIOTECHNOLOGY, INC. KIF2C (2488C3a): sc-81305 BACKGROUND RECOMMENDED SUPPORT REAGENTS Kinesin family member 2c (KIF2C), alternately known as mitotic centromere- To ensure optimal results, the following support reagents are recommended: associated kinesin (MCAK), is a member of the kinesin-like family of proteins. 1) Western Blotting: use m-IgGk BP-HRP: sc-516102 or m-IgGk BP-HRP (Cruz KIF2C is a cytoplasmic and nuclear protein, present throughout the cell cycle. Marker): sc-516102-CM (dilution range: 1:1000-1:10000), Cruz Marker™ KIF2C associates with the centromere early in prophase, and disassociates Molecular Weight Standards: sc-2035, UltraCruz® Blocking Reagent: after telophase. KIF2C is abundant in thymus and testis, and present at lower sc-516214 and Western Blotting Luminol Reagent: sc-2048. 2) Immunopre- levels in small intestine, the mucosal lining of the colon, and placenta. Human cipitation: use Protein A/G PLUS-Agarose: sc-2003 (0.5 ml agarose/2.0 ml). KIF2C maps to chromosome 1p34.1. 3) Immunofluorescence: use m-IgGk BP-FITC: sc-516140 or m-IgGk BP-PE: sc-516141 (dilution range: 1:50-1:200) with UltraCruz® Mounting Medium: REFERENCES sc-24941 or UltraCruz® Hard-set Mounting Medium: sc-359850. 1. Kim, I.G., et al. 1997. Cloning and expression of human mitotic centromere- associated kinesin gene. Biochim. Biophys. Acta 1359: 181-186. DATA 2. Maney, T., et al. 1998. Mitotic centromere-associated kinesin is important AB CDE F AB for anaphase chromosome segregation. J. Cell Biol. 3: 787-801. 132 K – 3. Hunter, A.W., et al. 2003. The kinesin-related protein MCAK is a micro- 109 K – KIF2C 90 K – tubule depolymerase that forms an ATP-hydrolyzing complex at microtubule 87 K – KIF2C ends.
  • Gamma Tubulin (TUBG1) (NM 001070) Human Untagged Clone Product Data

    Gamma Tubulin (TUBG1) (NM 001070) Human Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119462 gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Tag: Tag Free Symbol: TUBG1 Synonyms: CDCBM4; GCP-1; TUBG; TUBGCP1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC119462 sequence for NM_001070 edited (data generated by NextGen Sequencing) ATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCGGCAATCAGATTGGGTTCGAG TTCTGGAAACAGCTGTGCGCCGAGCATGGTATCAGCCCCGAGGGCATCGTGGAGGAGTTC GCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAGGCAGACGATGAGCACTAC ATCCCCCGGGCCGTGCTGCTGGACTTGGAACCCCGGGTGATCCACTCCATCCTCAACTCC CCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGAGGAGCT GGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGGACATTTTTGAC ATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTTTGTGCTGTGTCACTCC ATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTCTTAGAACGGCTGAATGACAGG TATCCTAAGAAGCTGGTGCAGACATACTCAGTGTTTCCCAACCAGGACGAGATGAGCGAT GTGGTGGTCCAGCCTTACAATTCACTCCTCACACTCAAGAGGCTGACGCAGAATGCAGAC TGTGTGGTGGTGCTGGACAACACAGCCCTGAACCGGATTGCCACAGACCGCCTGCACATC CAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCTACCATCATGTCAGCCAGCACC ACCACCCTGCGCTACCCTGGCTACATGAACAATGACCTCATCGGCCTCATCGCCTCGCTC ATTCCCACCCCACGGCTCCACTTCCTCATGACCGGCTACACCCCTCTCACTACGGACCAG TCAGTGGCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGGCGGCTGCTGCAGCCC
  • Supplementary Table S1. Correlation Between the Mutant P53-Interacting Partners and PTTG3P, PTTG1 and PTTG2, Based on Data from Starbase V3.0 Database

    Supplementary Table S1. Correlation Between the Mutant P53-Interacting Partners and PTTG3P, PTTG1 and PTTG2, Based on Data from Starbase V3.0 Database

    Supplementary Table S1. Correlation between the mutant p53-interacting partners and PTTG3P, PTTG1 and PTTG2, based on data from StarBase v3.0 database. PTTG3P PTTG1 PTTG2 Gene ID Coefficient-R p-value Coefficient-R p-value Coefficient-R p-value NF-YA ENSG00000001167 −0.077 8.59e-2 −0.210 2.09e-6 −0.122 6.23e-3 NF-YB ENSG00000120837 0.176 7.12e-5 0.227 2.82e-7 0.094 3.59e-2 NF-YC ENSG00000066136 0.124 5.45e-3 0.124 5.40e-3 0.051 2.51e-1 Sp1 ENSG00000185591 −0.014 7.50e-1 −0.201 5.82e-6 −0.072 1.07e-1 Ets-1 ENSG00000134954 −0.096 3.14e-2 −0.257 4.83e-9 0.034 4.46e-1 VDR ENSG00000111424 −0.091 4.10e-2 −0.216 1.03e-6 0.014 7.48e-1 SREBP-2 ENSG00000198911 −0.064 1.53e-1 −0.147 9.27e-4 −0.073 1.01e-1 TopBP1 ENSG00000163781 0.067 1.36e-1 0.051 2.57e-1 −0.020 6.57e-1 Pin1 ENSG00000127445 0.250 1.40e-8 0.571 9.56e-45 0.187 2.52e-5 MRE11 ENSG00000020922 0.063 1.56e-1 −0.007 8.81e-1 −0.024 5.93e-1 PML ENSG00000140464 0.072 1.05e-1 0.217 9.36e-7 0.166 1.85e-4 p63 ENSG00000073282 −0.120 7.04e-3 −0.283 1.08e-10 −0.198 7.71e-6 p73 ENSG00000078900 0.104 2.03e-2 0.258 4.67e-9 0.097 3.02e-2 Supplementary Table S2.
  • Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations

    Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations

    Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations by Jelena Perovanovic M.S. in Molecular Biology and Physiology, September 2009, University of Belgrade M.Phil. in Molecular Medicine, August 2013, The George Washington University A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 31, 2015 Dissertation directed by Eric P. Hoffman Professor of Integrative Systems Biology The Columbian College of Arts and Sciences of The George Washington University certifies that Jelena Perovanovic has passed the Final Examination for the degree of Doctor of Philosophy as of May 5, 2015. This is the final and approved form of the dissertation. Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Jelena Perovanovic Dissertation Research Committee: Eric P. Hoffman, Professor of Integrative Systems Biology, Dissertation Director Anamaris Colberg-Poley, Professor of Integrative Systems Biology, Committee Member Robert J. Freishtat, Associate Professor of Pediatrics, Committee Member Vittorio Sartorelli, Senior Investigator, National Institutes of Health, Committee Member ii © Copyright 2015 by Jelena Perovanovic All rights reserved iii Acknowledgments I am deeply indebted to countless individuals for their support and encouragement during the past five years of graduate studies. First and foremost, I would like to express my gratitude to my mentor, Dr. Eric P. Hoffman, for his unwavering support and guidance, and keen attention to my professional development. This Dissertation would not have been possible without the critical input he provided and the engaging environment he created.