Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Molecular Genetic Analysis of Two Loci (Ity2 and Ity3) Involved in The
Copyright Ó 2007 by the Genetics Society of America DOI: 10.1534/genetics.107.075523 Molecular Genetic Analysis of Two Loci (Ity2 and Ity3) Involved in the Host Response to Infection With Salmonella Typhimurium Using Congenic Mice and Expression Profiling Vanessa Sancho-Shimizu,*,† Rabia Khan,*,† Serge Mostowy,† Line Larivie`re,† Rosalie Wilkinson,† Noe´mie Riendeau,† Marcel Behr† and Danielle Malo*,†,‡,1 *Department of Human Genetics, McGill University, Montreal, Quebec H3G 1A4, Canada and †Center for the Study of Host Resistance, McGill University Health Center, Montreal, Quebec H3G 1A4, Canada and ‡Department of Medicine, McGill University, Montreal, Quebec H3G 1A4, Canada Manuscript received May 4, 2007 Accepted for publication July 27, 2007 ABSTRACT Numerous genes have been identified to date that contribute to the host response to systemic Sal- monella Typhimurium infection in mice. We have previously identified two loci, Ity2 and Ity3, that control survival to Salmonella infection in the wild-derived inbred MOLF/Ei mouse using a (C57BL/6J 3 MOLF/ Ei)F2cross. We validated the existence of these two loci by creating congenic mice carrying each quan- titative trait locus (QTL) in isolation. Subcongenic mice generated for each locus allowed us to define the critical intervals underlying Ity2 and Ity3. Furthermore, expression profiling was carried out with the aim of identifying differentially expressed genes within the critical intervals as potential candidate genes. Genomewide expression arrays were used to interrogate expression differences in the Ity2 congenics, leading to the identification of a new candidate gene (Havcr2, hepatitis A virus cellular receptor 2). Interval-specific oligonucleotide arrays were created for Ity3, identifying one potential candidate gene (Chi3l1, chitinase 3-like 1) to be pursued further. -
DEDD (NM 001039712) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC310813 DEDD (NM_001039712) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: DEDD (NM_001039712) Human Untagged Clone Tag: Tag Free Symbol: DEDD Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG -
UNIVERSITY of CALIFORNIA, SAN DIEGO Functional Analysis of Sall4
UNIVERSITY OF CALIFORNIA, SAN DIEGO Functional analysis of Sall4 in modulating embryonic stem cell fate A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Pathology by Pei Jen A. Lee Committee in charge: Professor Steven Briggs, Chair Professor Geoff Rosenfeld, Co-Chair Professor Alexander Hoffmann Professor Randall Johnson Professor Mark Mercola 2009 Copyright Pei Jen A. Lee, 2009 All rights reserved. The dissertation of Pei Jen A. Lee is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Co-Chair ______________________________________________________________ Chair University of California, San Diego 2009 iii Dedicated to my parents, my brother ,and my husband for their love and support iv Table of Contents Signature Page……………………………………………………………………….…iii Dedication…...…………………………………………………………………………..iv Table of Contents……………………………………………………………………….v List of Figures…………………………………………………………………………...vi List of Tables………………………………………………….………………………...ix Curriculum vitae…………………………………………………………………………x Acknowledgement………………………………………………….……….……..…...xi Abstract………………………………………………………………..…………….....xiii Chapter 1 Introduction ..…………………………………………………………………………….1 Chapter 2 Materials and Methods……………………………………………………………..…12 -
A Genome‐Wide Association Study Highlights a Regulatory Role for IFNG‐AS1
bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.903989; this version posted January 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A genome‐wide association study highlights a regulatory role for IFNG‐AS1 contributing to cutaneous leishmaniasis in Brazil Short title: A GWAS for cutaneous leishmaniasis in Brazil Léa C. Castellucci1,2,*, Lucas Almeida1,2,*, Svetlana Cherlin3,*, Michaela Fakiola4, Edgar Carvalho1, Amanda B. Figueiredo5, Clara M. Cavalcanti5, Natalia S. Alves5, Walderez O. Dutra1,6 , Kenneth J. Gollob1,5,7, Heather J. Cordell3 , and Jenefer M. Blackwell8,9 *Equal contributions 1National Institute of Science and Technology in Tropical Diseases, Brazil; 2Federal University of Bahia, Salvador, Brazil; 3Population Health Sciences Institute, Newcastle University, UK; 4INGM‐National Institute of Molecular Genetics "Romeo ed Enrica Invernizzi" Milan, Milan, Italy; 5International Center for Research, AC Camargo Cancer Center, São Paulo, Brazil; 6Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil; 7Núcleo de Ensino e Pesquisa, Instituto Mario Penna, Belo Horizonte, Brazil; 8Department of Pathology, University of Cambridge, UK; 9Telethon Kids Institute, The University of Western Australia, Western Australia Corresponding author: Jenefer M. Blackwell ([email protected] Correspondence to: Jenefer M. Blackwell, PO Box 855, West Perth, Western Australia 6872; Hospital Avenue, Nedlands, Western Australia 6009; Phone: +61 8 63191000. Funding British Medical Research Council (MRC) MR/N017390/1, FAPEMIG grant in cooperation with MRC/CONFAP (CBB-APQ-00883-16), National Institute of Science and Technology in Tropical Diseases, Brazil (N° 573839/2008–5), CNPq (K.J.G. -
EHD2 Is a Mechanotransducer Connecting Caveolae Dynamics with Gene Transcription
EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription Satish Kailasam Mani, Cesar Valades-Cruz, Stéphanie Torrino, Wei-Wei Shen, Cedric Blouin, Satish Kailasam Mani, Christine Viaris de Lesegno, Pierre Bost, Alexandre Grassart, Darius Köster, et al. To cite this version: Satish Kailasam Mani, Cesar Valades-Cruz, Stéphanie Torrino, Wei-Wei Shen, Cedric Blouin, et al.. EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription. Journal of Cell Biology, Rockefeller University Press, 2018, 217 (12), pp.4092-4105. 10.1083/jcb.201801122. inserm- 02426440 HAL Id: inserm-02426440 https://www.hal.inserm.fr/inserm-02426440 Submitted on 2 Jan 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - ShareAlike| 4.0 International License REPORT EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription Stéphanie Torrino1,2,3*, Wei‑Wei Shen1,2,3*, Cédric M. Blouin1,2,3, Satish Kailasam Mani1,2,3, Christine Viaris de Lesegno1,2,3, Pierre Bost4,5, Alexandre Grassart6, Darius Köster7, Cesar Augusto Valades‑Cruz2,3,8, Valérie Chambon2,3,8, Ludger Johannes2,3,8, Paolo Pierobon9, Vassili Soumelis4, Catherine Coirault10, Stéphane Vassilopoulos10, and Christophe Lamaze1,2,3 Caveolae are small invaginated pits that function as dynamic mechanosensors to buffer tension variations at the plasma membrane. -
High-Throughput Discovery of Novel Developmental Phenotypes
High-throughput discovery of novel developmental phenotypes The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Dickinson, M. E., A. M. Flenniken, X. Ji, L. Teboul, M. D. Wong, J. K. White, T. F. Meehan, et al. 2016. “High-throughput discovery of novel developmental phenotypes.” Nature 537 (7621): 508-514. doi:10.1038/nature19356. http://dx.doi.org/10.1038/nature19356. Published Version doi:10.1038/nature19356 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:32071918 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nature. Manuscript Author Author manuscript; Manuscript Author available in PMC 2017 March 14. Published in final edited form as: Nature. 2016 September 22; 537(7621): 508–514. doi:10.1038/nature19356. High-throughput discovery of novel developmental phenotypes A full list of authors and affiliations appears at the end of the article. Abstract Approximately one third of all mammalian genes are essential for life. Phenotypes resulting from mouse knockouts of these genes have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5000 knockout mouse lines, we have identified 410 Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms #Corresponding author: [email protected]. -
Rabbit Anti-TAF1C/FITC Conjugated Antibody
SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF1C/FITC Conjugated antibody SL24053R-FITC Product Name: Anti-TAF1C/FITC Chinese Name: FITC标记的TATA盒Binding protein相关因子TAF1C抗体 RNA polymerase I-specific TBP-associated factor 110 kDa; SL1; Taf1c; TAF1C_MOUSE; TAFI110; TAFI95; TATA box binding protein associated factor 1C; TATA box-binding protein-associated factor 1C; TATA box-binding protein-associated Alias: factor RNA polymerase I subunit C; TBP associated factor 1C; TBP associated factor RNA polymerase I 95 kDa; TBP associated factor, RNA polymerase I, 110-KD; TBP- associated factor 1C; Transcription initiation factor SL1/TIF-IB subunit C. Organism Species: Rabbit Clonality: Polyclonal React Species: ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 95kDa Form: Lyophilized or Liquid Concentration: 2mg/1ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from mouse TAF1C Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Initiation of transcription by RNA polymerase I requires the formation of a complex Product Detail: composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. -
Identification of Novel Alternative Splice Isoforms of Circulating Proteins in a Mouse Model of Human Pancreatic Cancer
Research Article Identification of Novel Alternative Splice Isoforms of Circulating Proteins in a Mouse Model of Human Pancreatic Cancer Rajasree Menon,1 Qing Zhang,3 Yan Zhang,1 Damian Fermin,1 Nabeel Bardeesy,4 Ronald A. DePinho,5 Chunxia Lu,2 Samir M. Hanash,3 Gilbert S. Omenn,1 and David J. States1 1Center for Computational Medicine and Biology and 2Pediatric Endocrinology, University of Michigan, Ann Arbor, Michigan; 3Fred Hutchinson Cancer Research Center, Seattle, Washington; and 4Center for Cancer Research, Massachusetts General Hospital; 5Center for Applied Cancer Science, Dana-Farber Cancer Institute and Harvard Medical School, Boston, Massachusetts Abstract database are scored as high, medium, or low confidence, reflecting the amount of cumulative evidence in support of the existence of a To assess the potential of tumor-associated, alternatively particular alternatively spliced sequence. Evidence is collected from spliced gene products as a source of biomarkers in biological clustering of ESTs, mRNA sequences, and gene model predictions. fluids, we have analyzed a large data set of mass spectra We modified the ECgene database to include three-frame trans- derived from the plasma proteome of a mouse model of lations of the cDNA sequences (5) to determine the occurrence of human pancreatic ductal adenocarcinoma. MS/MS spectra novel splice variant proteins. An important development in recent were interrogated for novel splice isoforms using a non- years is the substantial improvement in tandem mass spectrometry redundant database containing an exhaustive three-frame instrumentation for proteomics, allowing in-depth analysis and translation of Ensembl transcripts and gene models from confident identifications even for proteins coded by mRNA ECgene. -
Essential Genes and Their Role in Autism Spectrum Disorder
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality. -
DNA Sequences of Ca2+-Atpase Gene in Rice KDML 105
Kasetsart J. (Nat. Sci.) 40 : 472 - 485 (2006) DNA Sequences of Ca2+-ATPase Gene in Rice KDML 105 Sakonwan Prasitwilai1, Sripan Pradermwong2, Amara Thongpan3 and Mingkwan Mingmuang1* ABSTRACT Total RNA isolated from the leaves of KDML 105 rice was used as template to make complementary DNA (cDNA). Primer combinations of CA1-CA10 which were designed from Lycopersicon esculentum and Arabidopsis thaliana Ca2+-ATPase gene sequence were used. The nucleotide sequences amplified from 7 primer combinations gave 2,480 bp (fragment A). This fragment was found to be 99% homology to that of the putative calcium ATPase of Oryza sativa (Japonica cultivar-group) as shown in the GenBank. Amplification of 3v end fragment done by Rapid Amplification of cDNA Ends (3vRACE) technique using 3vGSP1, 3vGSP2, and 3vUAP as primers gave a DNA fragment of 933 bp having an overlapping region with DNA fragment A, which resulted in the combined length of 2,944 bp (fragment B). To find the sequence of 5v end, 5vRACE technique was used having 5vGSP1, 5vGSP2, 5v AP and 5vUAP as primers. It gave a DNA fragment of 473 bp showing an overlapping region with DNA fragment B, which ultimately resulted in the combined length of 3,331 bp (total CA). The deduced 1,008 amino acid sequence of total CA showed 99% homology to putative calcium ATPase of O. sativa (Japonica cultivar-group) cv. Nipponbare. The higher percent homology of this Ca2+-ATPase gene in KDML105 to that of O. sativa cv. Nipponbare (99%) than to O. sativa cv. IR36 (89%) was not as anticipated since both KDML105 and O. -
Functional Architecture of the Reb1-Ter Complex of PNAS PLUS Schizosaccharomyces Pombe
Functional architecture of the Reb1-Ter complex of PNAS PLUS Schizosaccharomyces pombe Rahul Jaiswala,1,2, Malay Choudhuryb,2, Shamsu Zamanb, Samarendra Singhb,3, Vishaka Santosha, Deepak Bastiab,4, and Carlos R. Escalantea,4 aDepartment of Physiology and Biophysics, Virginia Commonwealth University, Richmond, VA 23298; and bDepartment of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425 Edited by Lucia B. Rothman-Denes, The University of Chicago, Chicago, IL, and approved February 26, 2016 (received for review December 28, 2015) Reb1 of Schizosaccharomyces pombe represents a family of multi- consisting of purified pol I, Reb1 (ScReb1), the Ter site, and an functional proteins that bind to specific terminator sites (Ter) and upstream AT-rich release element were necessary and sufficient cause polar termination of transcription catalyzed by RNA polymer- for transcription termination (7). However, recent work has shown ase I (pol I) and arrest of replication forks approaching the Ter sites that Nsi1 (Ytt1) is also responsible for transcription termination in from the opposite direction. However, it remains to be investigated S. cerevisiae (28). whether the same mechanism causes arrest of both DNA transac- In addition to their aforementioned role, many of these proteins tions. Here, we present the structure of Reb1 as a complex with a are also involved in replication termination and transcription acti- Ter site at a resolution of 2.7 Å. Structure-guided molecular genetic vation. For instance, in S. pombe, the Reb1 (Sp.Reb1) protein binds analyses revealed that it has distinct and well-defined DNA binding to tandem pairs of terminator sites (Ter2 and Ter3) located on the and transcription termination (TTD) domains. -
Molecular Effects of Isoflavone Supplementation Human Intervention Studies and Quantitative Models for Risk Assessment
Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis committee Promotors Prof. Dr Pieter van ‘t Veer Professor of Nutritional Epidemiology Wageningen University Prof. Dr Evert G. Schouten Emeritus Professor of Epidemiology and Prevention Wageningen University Co-promotors Dr Anouk Geelen Assistant professor, Division of Human Nutrition Wageningen University Dr Lydia A. Afman Assistant professor, Division of Human Nutrition Wageningen University Other members Prof. Dr Jaap Keijer, Wageningen University Dr Hubert P.J.M. Noteborn, Netherlands Food en Consumer Product Safety Authority Prof. Dr Yvonne T. van der Schouw, UMC Utrecht Dr Wendy L. Hall, King’s College London This research was conducted under the auspices of the Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 20 June 2014 at 13.30 p.m. in the Aula. Vera van der Velpen Molecular effects of isoflavone supplementation: Human intervention studies and quantitative models for risk assessment 154 pages PhD thesis, Wageningen University, Wageningen, NL (2014) With references, with summaries in Dutch and English ISBN: 978-94-6173-952-0 ABSTRact Background: Risk assessment can potentially be improved by closely linked experiments in the disciplines of epidemiology and toxicology.