Rabbit Anti-TAF1C/FITC Conjugated Antibody
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
DEDD (NM 001039712) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC310813 DEDD (NM_001039712) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: DEDD (NM_001039712) Human Untagged Clone Tag: Tag Free Symbol: DEDD Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG -
Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
[CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors. -
Bidirectional Cooperation Between Ubtf1 and SL1 Determines RNA Polymerase I Promoter
bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447350; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Bidirectional cooperation between Ubtf1 and SL1 determines RNA Polymerase I promoter 2 recognition in cell and is negatively affected in the UBTF-E210K neuroregression syndrome. 3 4 Michel G. Tremblay1, Dany S. Sibai1,2, Melissa Valère1,2, Jean-Clément Mars1,2,+, Frédéric Lessard1, 5 Roderick T. Hori3, Mohammad M. Khan4, Victor Y. Stefanovsky1, Mark S. Ledoux5 and Tom Moss1,2*. 6 7 1Laboratory of Growth and Development, St-Patrick Research Group in Basic Oncology, Cancer 8 Division of the Quebec University Hospital Research Centre, Québec, Canada. 2Department of 9 Molecular Biology, Medical Biochemistry and Pathology, Faculty of Medicine, Laval University, 10 Québec, Canada. 3Departments of Microbiology, Immunology and Biochemistry and 4Departments of 11 Neurology and Anatomy & Neurobiology, University of Tennessee Health Science Center, Memphis, 12 TN, USA. 5Department of Psychology, University of Memphis, Memphis TN and Veracity 13 Neuroscience LLC, Memphis, TN 14 15 +Present address, IRIC, Université de Montréal, Montréal, Québec, Canada 16 17 Correspondence should be addressed to; 18 Tom Moss, PhD, 19 Edifice St Patrick, 9 rue McMahon, Québec, QC, G1R 3S3, Canada. 20 E-mail. [email protected] 21 Tel. 1 418 691 5281 22 FAX 1 418 691 5439 23 24 Short title: Ubtf1-SL1 cooperation and the Ubtf-E210K syndrome. -
Cross-Cohort Analysis Identifies a TEAD4– MYCN Positive Feedback Loop As the Core Regulatory Element of High-Risk Neuroblastoma
Cross-Cohort Analysis Identifies a TEAD4– MYCN Positive Feedback Loop as the Core Regulatory Element of High-Risk Neuroblastoma The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Rajbhandari, Presha et al. “Cross-Cohort Analysis Identifies a TEAD4–MYCN Positive Feedback Loop as the Core Regulatory Element of High-Risk Neuroblastoma.” Cancer Discovery 8, 5 (March 2018): 582–599 © 2018 AACR As Published http://dx.doi.org/10.1158/2159-8290.CD-16-0861 Publisher American Association for Cancer Research Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/117503 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cancer Manuscript Author Discov. Author manuscript; Manuscript Author available in PMC 2018 August 01. Published in final edited form as: Cancer Discov. 2018 May ; 8(5): 582–599. doi:10.1158/2159-8290.CD-16-0861. Cross-cohort analysis identifies a TEAD4 ↔ MYCN positive- feedback loop as the core regulatory element of high-risk neuroblastoma Presha Rajbhandari1,2,$, Gonzalo Lopez1,3,$, Claudia Capdevila1, Beatrice Salvatori1, Jiyang Yu1,#, Ruth Rodriguez-Barrueco4,5, Daniel Martinez3, Mark Yarmarkovich3, Nina Weichert-Leahey6, Brian J. Abraham7, Mariano J Alvarez1, Archana Iyer1, Jo Lynne Harenza3, Derek Oldridge3, Katleen De Preter8, Jan Koster9, Shahab Asgharzadeh10,11, Robert -
The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs. -
Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A. -
Ribosome and Translational Control in Stem Cells
cells Review Ribosome and Translational Control in Stem Cells Mathieu Gabut 1,2 , Fleur Bourdelais 1,2 and Sébastien Durand 1,2,* 1 Equipe ‘Transcriptome Diversity in Stem Cells’, Cancer Cell Plasticity Department, INSERM 1052, CNRS 5286, Cancer Research Center of Lyon, Centre Léon Bérard, 69008 Lyon, France; [email protected] (M.G.); fl[email protected] (F.B.) 2 Université Claude Bernard Lyon 1, 69100 Villeurbanne, France * Correspondence: [email protected]; Tel.: +33-469-856-092 Received: 15 January 2020; Accepted: 17 February 2020; Published: 21 February 2020 Abstract: Embryonic stem cells (ESCs) and adult stem cells (ASCs) possess the remarkable capacity to self-renew while remaining poised to differentiate into multiple progenies in the context of a rapidly developing embryo or in steady-state tissues, respectively. This ability is controlled by complex genetic programs, which are dynamically orchestrated at different steps of gene expression, including chromatin remodeling, mRNA transcription, processing, and stability. In addition to maintaining stem cell homeostasis, these molecular processes need to be rapidly rewired to coordinate complex physiological modifications required to redirect cell fate in response to environmental clues, such as differentiation signals or tissue injuries. Although chromatin remodeling and mRNA expression have been extensively studied in stem cells, accumulating evidence suggests that stem cell transcriptomes and proteomes are poorly correlated and that stem cell properties require finely tuned protein synthesis. In addition, many studies have shown that the biogenesis of the translation machinery, the ribosome, is decisive for sustaining ESC and ASC properties. Therefore, these observations emphasize the importance of translational control in stem cell homeostasis and fate decisions. -
Discovery of a Molecular Glue That Enhances Uprmt to Restore
bioRxiv preprint doi: https://doi.org/10.1101/2021.02.17.431525; this version posted February 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Discovery of a molecular glue that enhances UPRmt to restore proteostasis via TRKA-GRB2-EVI1-CRLS1 axis Authors: Li-Feng-Rong Qi1, 2 †, Cheng Qian1, †, Shuai Liu1, 2†, Chao Peng3, 4, Mu Zhang1, Peng Yang1, Ping Wu3, 4, Ping Li1 and Xiaojun Xu1, 2 * † These authors share joint first authorship Running title: Ginsenoside Rg3 reverses Parkinson’s disease model by enhancing mitochondrial UPR Affiliations: 1 State Key Laboratory of Natural Medicines, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. 2 Jiangsu Key Laboratory of Drug Discovery for Metabolic Diseases, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. 3. National Facility for Protein Science in Shanghai, Zhangjiang Lab, Shanghai Advanced Research Institute, Chinese Academy of Science, Shanghai 201210, China 4. Shanghai Science Research Center, Chinese Academy of Sciences, Shanghai, 201204, China. Corresponding author: Ping Li, State Key Laboratory of Natural Medicines, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. Email: [email protected], Xiaojun Xu, State Key Laboratory of Natural Medicines, Jiangsu Key Laboratory of Drug Discovery for Metabolic Diseases, China Pharmaceutical University, 210009, Nanjing, Jiangsu, China. Telephone number: +86-2583271203, E-mail: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.17.431525; this version posted February 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. -
CASC3 Promotes Transcriptome-Wide Activation of Nonsense
bioRxiv preprint doi: https://doi.org/10.1101/811018; this version posted October 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 2 CASC3 promotes transcriptome-wide activation of nonsense- 3 mediated decay by the exon junction complex 4 5 Jennifer V. Gerbracht1, Volker Boehm1, Thiago Britto-Borges2,3, Sebastian Kallabis4, Janica L. 6 Wiederstein4, Simona Ciriello1,5, Dominik U. Aschemeier1, Marcus Krüger4, Christian K. 7 Frese4,6, Janine Altmüller7,8, Christoph Dieterich2,3, Niels H. Gehring1 8 1 Institute for Genetics, University of Cologne, 50674 Cologne, Germany 9 2 Section of Bioinformatics and Systems Cardiology, Department of Internal Medicine III and Klaus 10 Tschira Institute for Integrative Computational Cardiology, University of Heidelberg, 69120 Heidelberg, 11 Germany 12 3 DZHK (German Centre for Cardiovascular Research), Partner site Heidelberg/Mannheim, 69120 13 Heidelberg, Germany 14 4 CECAD Research Center, University of Cologne, Joseph-Stelzmann-Str. 26, 50931 Cologne, Germany 15 5 present address: AO Research Institute Davos, Clavadelerstrasse 8, CH-7270 Davos Platz, Switzerland 16 6 present address: Max Planck Unit for the Science of Pathogens, 10117 Berlin, Germany 17 7 Cologne Center for Genomics (CCG), University of Cologne, 50931 Cologne, Germany 18 8 Center for Molecular Medicine Cologne, University of Cologne, 50937 Cologne, Germany 19 20 21 Contact 22 Niels H. Gehring, University of Cologne, Institute for Genetics, Zuelpicher Str. 47a, 50674 Cologne, 23 Germany; email: [email protected] 24 25 26 27 Running Title (40 Characters) 28 CASC3 promotes EJC-dependent NMD 29 Keywords (5, alphabetical order, separated by slash) 30 CRISPR-Cas9/gene expression/mRNA quality control/NMD/RNA degradation 31 1 bioRxiv preprint doi: https://doi.org/10.1101/811018; this version posted October 21, 2019. -
Full-Text.Pdf
Systematic Evaluation of Genes and Genetic Variants Associated with Type 1 Diabetes Susceptibility This information is current as Ramesh Ram, Munish Mehta, Quang T. Nguyen, Irma of September 23, 2021. Larma, Bernhard O. Boehm, Flemming Pociot, Patrick Concannon and Grant Morahan J Immunol 2016; 196:3043-3053; Prepublished online 24 February 2016; doi: 10.4049/jimmunol.1502056 Downloaded from http://www.jimmunol.org/content/196/7/3043 Supplementary http://www.jimmunol.org/content/suppl/2016/02/19/jimmunol.150205 Material 6.DCSupplemental http://www.jimmunol.org/ References This article cites 44 articles, 5 of which you can access for free at: http://www.jimmunol.org/content/196/7/3043.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 23, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Systematic Evaluation of Genes and Genetic Variants Associated with Type 1 Diabetes Susceptibility Ramesh Ram,*,† Munish Mehta,*,† Quang T. -
Granulocyte Colony-Stimulating Factor-Induced TAF9 Modulates P53-TRIAP1-CASP3 Axis to Prevent Retinal Ganglion Cell Death After Optic Nerve Ischemia
Granulocyte Colony-Stimulating Factor-Induced TAF9 Modulates P53-TRIAP1-CASP3 Axis to Prevent Retinal Ganglion Cell Death after Optic Nerve Ischemia Yao-Tseng Wen Buddhist Tzu Chi General Hospital Hualien: Hualien Tzu Chi Hospital Keh-Liang Lin Chung Shan Medical University Hospital Chin-Te Huang Tzu Chi University Rong Kung Tsai ( [email protected] ) Hualien Tzu Chi Hospital https://orcid.org/0000-0001-8760-5739 Research article Keywords: Granulocyte colony-stimulating factor, Rat anterior ischemic optic neuropathy model, Retinal ganglion cell, TBP associated factor 9, TP53, TRIAP1 Posted Date: January 6th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-138908/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/25 Abstract Background Optic nerve head (ONH) infarct can result in progressive retinal ganglion cell (RGC) death. Some evidences indicated that the granulocyte colony-stimulating factor (GCSF) provides positive effects against ischemic damage on RGCs. However, protective mechanisms of the GCSF after ONH infarct are complex and remain unclear. Methods To investigate the complex mechanisms, the transcriptome proles of the GCSF-treated retinas were examined using microarray technology. The retinal mRNA samples on days 3 and 7 post rat anterior ischemic optic neuropathy model (rAION) were analyzed by microarray and bioinformatics analyses. To evaluate the TAF9 function in RGC apoptosis, GCSF plus TAF9 siRNA-treated rats were evaluated using retrograde labeling with FluoroGold assay, TUNEL assay, and Western blotting in a rAION. Results GCSF treatment inuenced 3101 genes and 3332 genes on days 3 and 7 post rAION, respectively. -
A Chromosome-Centric Human Proteome Project (C-HPP) To
computational proteomics Laboratory for Computational Proteomics www.FenyoLab.org E-mail: [email protected] Facebook: NYUMC Computational Proteomics Laboratory Twitter: @CompProteomics Perspective pubs.acs.org/jpr A Chromosome-centric Human Proteome Project (C-HPP) to Characterize the Sets of Proteins Encoded in Chromosome 17 † ‡ § ∥ ‡ ⊥ Suli Liu, Hogune Im, Amos Bairoch, Massimo Cristofanilli, Rui Chen, Eric W. Deutsch, # ¶ △ ● § † Stephen Dalton, David Fenyo, Susan Fanayan,$ Chris Gates, , Pascale Gaudet, Marina Hincapie, ○ ■ △ ⬡ ‡ ⊥ ⬢ Samir Hanash, Hoguen Kim, Seul-Ki Jeong, Emma Lundberg, George Mias, Rajasree Menon, , ∥ □ △ # ⬡ ▲ † Zhaomei Mu, Edouard Nice, Young-Ki Paik, , Mathias Uhlen, Lance Wells, Shiaw-Lin Wu, † † † ‡ ⊥ ⬢ ⬡ Fangfei Yan, Fan Zhang, Yue Zhang, Michael Snyder, Gilbert S. Omenn, , Ronald C. Beavis, † # and William S. Hancock*, ,$, † Barnett Institute and Department of Chemistry and Chemical Biology, Northeastern University, Boston, Massachusetts 02115, United States ‡ Stanford University, Palo Alto, California, United States § Swiss Institute of Bioinformatics (SIB) and University of Geneva, Geneva, Switzerland ∥ Fox Chase Cancer Center, Philadelphia, Pennsylvania, United States ⊥ Institute for System Biology, Seattle, Washington, United States ¶ School of Medicine, New York University, New York, United States $Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, NSW, Australia ○ MD Anderson Cancer Center, Houston, Texas, United States ■ Yonsei University College of Medicine, Yonsei University,