Plots of Observed and Expected Χ2 Values of Association Between SNP Genotype and Risk of Chronic Lymphocytic Leukemia

Total Page:16

File Type:pdf, Size:1020Kb

Load more

λ = 0.9955 λ = 1.001 a) 60 b) 60 50 50 40 40 values values 2 2 30 30 χ χ 20 20 observed observed 10 10 0 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 expected χ2 values expected χ2 values λ = 0.9992 λ = 1.1054 c) 60 d) 60 50 50 40 40 values values 2 2 30 30 χ χ 20 20 observed observed 10 10 0 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 expected χ2 values expected χ2 values λ = 1.0268 λ = 1.0175 e) 60 f) 60 50 50 40 40 values values 2 2 30 30 χ χ 20 20 observed observed 10 10 0 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 expected χ2 values expected χ2 values Supplementary Figure 1: Quantile-Quantile (Q-Q) plots of observed and expected χ2 values of association between SNP genotype and risk of chronic lymphocytic leukemia. a) UK-CLL1, b) UK-CLL2, c) GEC, d) NHL GWAS, e) UCSF and f) Utah. The red line represents the null hypothesis of no true association. a) rs34676223 Chromosome 1 position (kb, hg19) 23,945 23,950 23,955 23,960 23,965 23,970 23,975 23,980 23,985 Super- CD19+ B-cell enhancers GM12878 MDS2 Genes MDS2 SNPs 4245 _ mCLL 0 _ 3352 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 200 _ mCLL H3K27ac 0 _ 200 _ uCLL H3K27ac 0 _ 200 _ Histone mCLL H3K4me1 0 _ marks: 200 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 50 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ b) rs41271473 Chromosome 1 position (kb, hg19) 228,750 228,800 228,850 228,900 Super- CD19+ B-cell enhancers GM12878 Genes RHOU SNPs 374 _ mCLL 0 _ 316 _ uCLL ATAC-seq 0 _ 200 _ CD19+ CD20+ B-cell 0 _ mCLL 50 _ H3K27ac 0 _ uCLL 50 _ H3K27ac 0 _ 50 _ Histone mCLL H3K4me1 0 _ marks: 50 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 50 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ Supplementary Figure 2 c) rs71597109 Chromosome 4 position (kb, hg19) 102,750 102,800 102,850 102,900 102,950 103,000 103,050 Super- CD19+ B-cell enhancers GM12878 BANK1 BANK1 Genes BANK1 BANK1 BANK1 SNPs 505 _ mCLL 0 _ 258_ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ mCLL 50 _ H3K27ac 0 _ uCLL 50 _ H3K27ac 0 _ 50 _ Histone mCLL H3K4me1 0 _ marks: uCLL 50 _ CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ uCLL 50 _ H3K27me3 0 _ 50 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ d) rs57214277 Chromosome 4 position (kb, hg19) 185,200 185,210 185,220 185,230 185,240 185,250 185,260 Super- CD19+ B-cell enhancers GM12878 Genes SNPs 2658 _ mCLL 0 _ 2183 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 250 _ mCLL H3K27ac 0 _ 250 _ uCLL H3K27ac 0 _ 200 _ Histone mCLL H3K4me1 0 _ marks: 200 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 200 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ Supplementary Figure 2 e) rs3800461 Chromosome 6 position (kb, hg19) 34,500 34,550 34,600 34,650 34,700 34,750 + Super- CD19 B-cell 34,800 enhancers GM12878 PACSIN1 C6orf106 SNRPC PACSIN1 C6orf106 SNRPC Genes PACSIN1 C6orf106 SNRPC PACSIN1 UHRF1BP1 SPDEF UHRF1BP1 SPDEF SNPs 923 _ mCLL 0 _ 771 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 200 _ mCLL H3K27ac 0 _ 200 _ uCLL H3K27ac 0 _ 200 _ Histone mCLL H3K4me1 0 _ marks: 200 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 200 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ Chromosome 11 position (kb, hg19) f) rs61904987 113,500 113,550 113,600 113,650 113,700 113,750 Super- CD19+ B-cell enhancers GM12878 TMPRSS5 ZW10 USP28 TMPRSS5 CLDN25 USP28 TMPRSS5 USP28 Genes TMPRSS5 USP28 TMPRSS5 TMPRSS5 TMPRSS5 SNPs 2589 _ mCLL 0 _ 1930 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 150 _ mCLL H3K27ac 0 _ 150 _ uCLL H3K27ac 0 _ 150 _ Histone mCLL H3K4me1 0 _ marks: 150 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 100 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ Supplementary Figure 2 g) rs1036935 Chromosome 18 position (kb, hg19) 47,850 47,900 47,950 Super- CD19+ B-cell enhancers GM12878 SKA1 Genes SKA1 SKA1 SKA1 SNPs 2838 _ mCLL 0 _ 2396 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 150 _ mCLL H3K27ac 0 _ 150 _ uCLL H3K27ac 0 _ 150 _ Histone mCLL H3K4me1 0 _ marks: 150 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 100 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ h) rs7254272 Chromosome 19 position (kb, hg19) 4,000 4,020 4,040 4,060 4,080 4,100 4,120 Super- CD19+ B-cell enhancers GM12878 PIAS4 MAP2K2 AC016586.1 MAP2K2 Genes ZBTB7A ZBTB7A SNPs 4277 _ mCLL 0 _ 3492 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 150 _ mCLL H3K27ac 0 _ 150 _ uCLL H3K27ac 0 _ 150 _ Histone mCLL H3K4me1 0 _ marks: 150 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 100 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ Supplementary Figure 2 i) rs140522 Chromosome 22 position (kb, hg19) 50,940 50,950 50,960 50,970 50,980 50,990 51,000 Super- CD19+ B-cell enhancers GM12878 LMF2 SCO2 KLHDC7B LMF2 SCO2 ODF3B SYCE3 NCAPH2 ODF3B SYCE3 NCAPH2 SCO2 ODF3B NCAPH2 ODF3B Genes NCAPH2 ODF3B SCO2 TYMP TYMP TYMP TYMP SNPs 3628 _ mCLL 0 _ 3122 _ uCLL ATAC-seq 0 _ 500 _ CD19+ CD20+ B-cell 0 _ 150 _ mCLL H3K27ac 0 _ 600 _ uCLL H3K27ac 0 _ 150 _ Histone mCLL H3K4me1 0 _ marks: 150 _ uCLL CLL H3K4me1 0 _ 50 _ mCLL H3K27me3 0 _ 50 _ uCLL H3K27me3 0 _ 200 _ GM12878 H3K27ac 0 _ Histone 50 _ marks: GM12878 H3K4me1 0 _ GM12878 50 _ GM12878 H3K27me3 0 _ Supplementary Figure 2: Annotation of the regulatory landscape of the nine novel CLL GWAS loci (a-i). Plots illustrate available histone mark ChIP-seq and ATAC-seq data from CLL and B-cell lineage cells. The three boxes in each image are arranged from the top as follows: Box 1) super-enhancers in CD19+ B-cells and lymphoblastoid cell line GM12878 are indicated by black boxes, coding genes from GENCODE v.24 are labelled in blue, all SNPs (marked by short vertical lines) in linkage disequilibrium r2>0.2 with the sentinel SNP (marked by a vertical line); Box 2) ATAC-seq peaks derived from IGHV mutated (mCLL, blue), unmutated (uCLL, orange) CLL samples plus normal CD19+/CD20+ B-cells; Box 3) Histone mark data from mCLL and uCLL samples for active chromatin marks H3K27ac (red) and H3K4me1 (yellow) plus repressive chromatin mark H3K27me3 (dark blue). Also shown is the same histone mark data for GM12878. rs75569736, 1p36.11 rs4698971, 4q24 rs1217972, 4q35.1 H. sapiens-ENCODE-motifs-EGR1_disc3 score H. sapiens-ENCODE-motifs-NFKB_known6 score G: 6.61, C: 7.64 H. sapiens-ENCODE-motifs-NFKB_disc3 score T: 8.87, G:9.79 2 A: 8.95, C: 10.39 2 2 1 1 1 bits bits bits 0 0 0 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 snp@20 5' G G G A G C A A G C G A T A 3' 5' T G C T G G A G T T A G C C C T T C T C 3' 5' G A G C G G G T T T T T T C 3' T C C G rs13149699, 4q35.1 rs13215181, 6p21.31 H. sapiens-ENCODE-motifs-EP300_disc5 score A: 7.80, G: 7.31 H. sapiens-ENCODE-motifs-E2F_known27 score A: 9.94, G: 9.45 2 2 1 1 bits bits 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 2 3 4 5 6 7 8 9 10 11 12 H.
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
  • The P63 Target HBP-1 Is Required for Keratinocyte Differentiation and Stratification

    The P63 Target HBP-1 Is Required for Keratinocyte Differentiation and Stratification

    The p63 target HBP-1 is required for keratinocyte differentiation and stratification. Roberto Mantovani, Serena Borrelli, Eleonora Candi, Diletta Dolfini, Olì Maria Victoria Grober, Alessandro Weisz, Gennaro Melino, Alessandra Viganò, Bing Hu, Gian Paolo Dotto To cite this version: Roberto Mantovani, Serena Borrelli, Eleonora Candi, Diletta Dolfini, Olì Maria Victoria Grober, et al.. The p63 target HBP-1 is required for keratinocyte differentiation and stratification.. Cell Death and Differentiation, Nature Publishing Group, 2010, 10.1038/cdd.2010.59. hal-00542927 HAL Id: hal-00542927 https://hal.archives-ouvertes.fr/hal-00542927 Submitted on 4 Dec 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Running title: HBP1 in skin differentiation. The p63 target HBP-1 is required for skin differentiation and stratification. Serena Borrelli1, Eleonora Candi2, Bing Hu3, Diletta Dolfini1, Maria Ravo4, Olì Maria Victoria Grober4, Alessandro Weisz4,5, GianPaolo Dotto3, Gerry Melino2,6, Maria Alessandra Viganò1 and Roberto Mantovani1*. 1) Dipartimento di Scienze Biomolecolari e Biotecnologie. Università degli Studi di Milano. Via Celoria 26, 20133 Milano, Italy. 2) Biochemistry IDI-IRCCS laboratory, c/o University of Rome "Tor Vergata", Via Montpellier 1, 00133 Roma, Italy.
  • The REST/NRSF Pathway As a Central Mechanism in CNS Dysfunction

    The REST/NRSF Pathway As a Central Mechanism in CNS Dysfunction

    The REST/NRSF Pathway as a Central Mechanism in CNS Dysfunction Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Alix Warburton April 2015 Disclaimer The data in this thesis is a result of my own work. The material collected for this thesis has not been presented, nor is currently being presented, either wholly or in part for any other degree or other qualification. All of the research, unless otherwise stated, was performed in the Department of Physiology and Department of Pharmacology, Institute of Translational Medicine, University of Liverpool. All other parties involved in the research presented here, and the nature of their contribution, are listed in the Acknowledgements section of this thesis. i Acknowledgements First and foremost, I would like to express my upmost gratitude to my primary and secondary supervisors Professor John Quinn (a.k.a Prof. Quinny) and Dr Jill Bubb for all of their support, guidance, wisdom (thank you Jill) and encouragement throughout my PhD; I could not have wished for a better pair. I am also extremely grateful to the BBSRC for funding my PhD project. I would also like to extend my thanks to Dr Graeme Sills for providing samples and assistance with my work on the SANAD epilepsy project, Dr Fabio Miyajima for offering his knowledge and knowhow on many occasions, Dr Gerome Breen for being a bioinformatics wizard and providing support on several projects, Dr Minyan Wang’s lab for their help and hospitality during my 3 month visit to Xi'an Jiaotong-Liverpool University, Dr Roshan Koron for assisting with the breast cancer study, Dr Chris Murgatroyd for his invaluable advice on ChIP and Professor Dan Rujescu’s lab for providing clinical samples and support with statistical analyses on the schizophrenia project.
  • Identification of SNP-Containing Regulatory Motifs in the Myelodysplastic Syndromes Model Using SNP Arrays Ad Gene Expression Arrays" (2013)

    Identification of SNP-Containing Regulatory Motifs in the Myelodysplastic Syndromes Model Using SNP Arrays Ad Gene Expression Arrays" (2013)

    University of Central Florida STARS Faculty Bibliography 2010s Faculty Bibliography 1-1-2013 Identification of SNP-containing egulatr ory motifs in the myelodysplastic syndromes model using SNP arrays ad gene expression arrays Jing Fan Jennifer G. Dy Chung-Che Chang University of Central Florida Xiaoboo Zhou Find similar works at: https://stars.library.ucf.edu/facultybib2010 University of Central Florida Libraries http://library.ucf.edu This Article is brought to you for free and open access by the Faculty Bibliography at STARS. It has been accepted for inclusion in Faculty Bibliography 2010s by an authorized administrator of STARS. For more information, please contact [email protected]. Recommended Citation Fan, Jing; Dy, Jennifer G.; Chang, Chung-Che; and Zhou, Xiaoboo, "Identification of SNP-containing regulatory motifs in the myelodysplastic syndromes model using SNP arrays ad gene expression arrays" (2013). Faculty Bibliography 2010s. 3960. https://stars.library.ucf.edu/facultybib2010/3960 Chinese Journal of Cancer Original Article Jing Fan 1, Jennifer G. Dy 1, Chung鄄Che Chang 2 and Xiaobo Zhou 3 Abstract Myelodysplastic syndromes have increased in frequency and incidence in the American population, but patient prognosis has not significantly improved over the last decade. Such improvements could be realized if biomarkers for accurate diagnosis and prognostic stratification were successfully identified. In this study, we propose a method that associates two state鄄of 鄄th e鄄ar t array technologies single nucleotide polymor鄄 要 phism (SNP) array and gene expression array with gene motifs considered transcription factor -binding 要 sites (TFBS). We are particularly interested in SNP鄄co ntaining motifs introduced by genetic variation and mutation as TFBS.
  • DEDD (NM 001039712) Human Untagged Clone Product Data

    DEDD (NM 001039712) Human Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC310813 DEDD (NM_001039712) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: DEDD (NM_001039712) Human Untagged Clone Tag: Tag Free Symbol: DEDD Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG
  • MOZ and MORF, Two Large Mystic Hats in Normal and Cancer Stem Cells

    MOZ and MORF, Two Large Mystic Hats in Normal and Cancer Stem Cells

    Oncogene (2007) 26, 5408–5419 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW MOZ and MORF, two large MYSTic HATs in normal and cancer stem cells X-J Yang and M Ullah Molecular Oncology Group, Department of Medicine, McGill University Health Center, Montre´al, Que´bec, Canada Genes of the human monocytic leukemia zinc-finger protein pattern. For cancer biology, it is thus important to MOZ (HUGO symbol, MYST3) and its paralog MORF understand the fundamental mechanisms whereby chro- (MYST4) are rearranged in chromosome translocations matin structure and function are regulated. In the associated withacute myeloid leukemia and/or benign past two decades, our knowledge about regulation in uterine leiomyomata. Both proteins have intrinsic histone this field has exploded. Known regulatory mechanisms acetyltransferase activity and are components of quartet include chromatin assembly, ATP-dependent remodeling, complexes withnoncatalytic subunits containing thebromo- covalent modification, condensin-mediated condensation, domain, plant homeodomain-linked (PHD) finger and replacement with histone variants, and association of proline-tryptophan-tryptophan-proline (PWWP)-containing noncoding RNA (reviewed by Horn and Peterson, 2002; domain, three types of structural modules characteristic of Khorasanizadeh, 2004; Li et al., 2007). Covalent chromatin regulators. Although leukemia-derived fusion pro- modification can occur at both the DNA and histone teins suchas MOZ-TIF2 promote self-renewal of leukemic levels. With histones, modifications include acetylation, stem cells, recent studies indicate that murine MOZ and phosphorylation, methylation, ubiquitination, and many MORF are important for proper development of hema- others (for reviews, see Spencer and Davie, 1999; Strahl topoietic and neurogenic progenitors, respectively, thereby and Allis, 2000; Berger, 2002; Jason et al., 2002; highlighting the importance of epigenetic integrity in Kouzarides, 2007).
  • Transcription Factors SOHLH1 and SOHLH2 Coordinate Oocyte Differentiation Without Affecting Meiosis I

    Transcription Factors SOHLH1 and SOHLH2 Coordinate Oocyte Differentiation Without Affecting Meiosis I

    Transcription factors SOHLH1 and SOHLH2 coordinate oocyte differentiation without affecting meiosis I Yong-Hyun Shin, … , Vasil Mico, Aleksandar Rajkovic J Clin Invest. 2017;127(6):2106-2117. https://doi.org/10.1172/JCI90281. Research Article Development Reproductive biology Following migration of primordial germ cells to the genital ridge, oogonia undergo several rounds of mitotic division and enter meiosis at approximately E13.5. Most oocytes arrest in the dictyate (diplotene) stage of meiosis circa E18.5. The genes necessary to drive oocyte differentiation in parallel with meiosis are unknown. Here, we have investigated whether expression of spermatogenesis and oogenesis bHLH transcription factor 1 (Sohlh1) and Sohlh2 coordinates oocyte differentiation within the embryonic ovary. We found that SOHLH2 protein was expressed in the mouse germline as early as E12.5 and preceded SOHLH1 protein expression, which occurred circa E15.5. SOHLH1 protein appearance at E15.5 correlated with SOHLH2 translocation from the cytoplasm into the nucleus and was dependent on SOHLH1 expression. NOBOX oogenesis homeobox (NOBOX) and LIM homeobox protein 8 (LHX8), two important regulators of postnatal oogenesis, were coexpressed with SOHLH1. Single deficiency of Sohlh1 or Sohlh2 disrupted the expression of LHX8 and NOBOX in the embryonic gonad without affecting meiosis. Sohlh1-KO infertility was rescued by conditional expression of the Sohlh1 transgene after the onset of meiosis. However, Sohlh1 or Sohlh2 transgene expression could not rescue Sohlh2-KO infertility due to a lack of Sohlh1 or Sohlh2 expression in rescued mice. Our results indicate that Sohlh1 and Sohlh2 are essential regulators of oocyte differentiation but do not affect meiosis I.
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K

    Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Genome-Wide Profiling of Active Enhancers in Colorectal Cancer

    Genome-Wide Profiling of Active Enhancers in Colorectal Cancer

    Genome-wide proling of active enhancers in colorectal cancer Min Wu ( [email protected] ) Wuhan University https://orcid.org/0000-0003-1372-4764 Qinglan Li Wuhan University Xiang Lin Wuhan University Ya-Li Yu Zhongnan Hospital, Wuhan University Lin Chen Wuhan University Qi-Xin Hu Wuhan University Meng Chen Zhongnan Hospital, Wuhan University Nan Cao Zhongnan Hospital, Wuhan University Chen Zhao Wuhan University Chen-Yu Wang Wuhan University Cheng-Wei Huang Wuhan University Lian-Yun Li Wuhan University Mei Ye Zhongnan Hospital, Wuhan University https://orcid.org/0000-0002-9393-3680 Article Keywords: Colorectal cancer, H3K27ac, Epigenetics, Enhancer, Transcription factors Posted Date: December 10th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-119156/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Genome-wide profiling of active enhancers in colorectal cancer Qing-Lan Li1, #, Xiang Lin1, #, Ya-Li Yu2, #, Lin Chen1, #, Qi-Xin Hu1, Meng Chen2, Nan Cao2, Chen Zhao1, Chen-Yu Wang1, Cheng-Wei Huang1, Lian-Yun Li1, Mei Ye2,*, Min Wu1,* 1 Frontier Science Center for Immunology and Metabolism, Hubei Key Laboratory of Cell Homeostasis, Hubei Key Laboratory of Developmentally Originated Disease, Hubei Key Laboratory of Intestinal and Colorectal Diseases, College of Life Sciences, Wuhan University, Wuhan, Hubei 430072, China 2Division of Gastroenterology, Department of Geriatrics, Hubei Clinical Centre & Key Laboratory of Intestinal and Colorectal Diseases, Zhongnan Hospital, Wuhan University, Wuhan, Hubei 430072, China #Equal contribution to the study. Contact information *Correspondence should be addressed to Dr. Min Wu, Email: [email protected], Tel: 86-27-68756620, or Dr.
  • Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes

    Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes

    [CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors.
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation

    Transcriptional Control of Tissue-Resident Memory T Cell Generation

    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.