Non-Canonical Functions of the Gamma-Tubulin Meshwork in the Regulation of the Nuclear Architecture
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Title a New Centrosomal Protein Regulates Neurogenesis By
Title A new centrosomal protein regulates neurogenesis by microtubule organization Authors: Germán Camargo Ortega1-3†, Sven Falk1,2†, Pia A. Johansson1,2†, Elise Peyre4, Sanjeeb Kumar Sahu5, Loïc Broic4, Camino De Juan Romero6, Kalina Draganova1,2, Stanislav Vinopal7, Kaviya Chinnappa1‡, Anna Gavranovic1, Tugay Karakaya1, Juliane Merl-Pham8, Arie Geerlof9, Regina Feederle10,11, Wei Shao12,13, Song-Hai Shi12,13, Stefanie M. Hauck8, Frank Bradke7, Victor Borrell6, Vijay K. Tiwari§, Wieland B. Huttner14, Michaela Wilsch- Bräuninger14, Laurent Nguyen4 and Magdalena Götz1,2,11* Affiliations: 1. Institute of Stem Cell Research, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany. 2. Physiological Genomics, Biomedical Center, Ludwig-Maximilian University Munich, Germany. 3. Graduate School of Systemic Neurosciences, Biocenter, Ludwig-Maximilian University Munich, Germany. 4. GIGA-Neurosciences, Molecular regulation of neurogenesis, University of Liège, Belgium 5. Institute of Molecular Biology (IMB), Mainz, Germany. 6. Instituto de Neurociencias, Consejo Superior de Investigaciones Científicas and Universidad Miguel Hernández, Sant Joan d’Alacant, Spain. 7. Laboratory for Axon Growth and Regeneration, German Center for Neurodegenerative Diseases (DZNE), Bonn, Germany. 8. Research Unit Protein Science, Helmholtz Centre Munich, German Research Center for Environmental Health, Munich, Germany. 9. Protein Expression and Purification Facility, Institute of Structural Biology, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany. 10. Institute for Diabetes and Obesity, Monoclonal Antibody Core Facility, Helmholtz Center Munich, German Research Center for Environmental Health, Munich, Germany. 11. SYNERGY, Excellence Cluster of Systems Neurology, Biomedical Center, Ludwig- Maximilian University Munich, Germany. 12. Developmental Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, USA 13. -
Differential Expression of Two Neuronal Intermediate-Filament Proteins, Peripherin and the Low-Molecular-Mass Neurofilament Prot
The Journal of Neuroscience, March 1990, fO(3): 764-764 Differential Expression of Two Neuronal Intermediate-Filament Proteins, Peripherin and the Low-Molecular-Mass Neurofilament Protein (NF-L), During the Development of the Rat Michel Escurat,’ Karima Djabali,’ Madeleine Gumpel,2 Franqois Gras,’ and Marie-Madeleine Portier’ lCollBne de France, Biochimie Cellulaire, 75231 Paris Cedex 05, France, *HBpital de la Salpktricke, Unite INSERM 134, 75651Paris Cedex 13, France The expression of peripherin, an intermediate filament pro- and Freeman, 1978), now more generally referred to respectively tein, had been shown by biochemical methods to be local- as high-, middle-, and low-molecular-mass NFP (NF-H, NF-M, ized in the neurons of the PNS. Using immunohistochemical and NF-L). These proteins are expressed in most mature neu- methods, we analyzed this expression more extensively dur- ronal populations belonging either to the CNS or to the PNS; ing the development of the rat and compared it with that of developing neurons generally do not express any of them until the low-molecular-mass neurofilament protein (NF-L), which they become postmitotic (Tapscott et al., 198 la). is expressed in every neuron of the CNS and PNS. We, however, described another IFP with a molecular weight The immunoreactivity of NF-L is first apparent at the 25 of about 57 kDa, which we had first observed in mouse neu- somite stage (about 11 d) in the ventral horn of the spinal roblastoma cell lines and which was also expressed in rat pheo- medulla and in the posterior part of the rhombencephalon. chromocytoma PC1 2 cell line. -
The Basal Bodies of Chlamydomonas Reinhardtii Susan K
Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4]. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplemental Information Proximity Interactions Among Centrosome
Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl -
Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
[CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors. -
Tubulin: Are They Linced?
cells Review Microtubular and Nuclear Functions of γ-Tubulin: Are They LINCed? Jana Chumová, Hana Kourová, Lucie Trögelová, Petr Halada and Pavla Binarová * Institute of Microbiology of the Czech Academy of Sciences, Vídeˇnská 1083, 142 20 Prague, Czech Republic; [email protected] (J.C.); [email protected] (H.K.); [email protected] (L.T.); [email protected] (P.H.) * Correspondence: [email protected]; Tel.: +420-241-062-130 Received: 8 February 2019; Accepted: 14 March 2019; Published: 19 March 2019 Abstract: γ-Tubulin is a conserved member of the tubulin superfamily with a function in microtubule nucleation. Proteins of γ-tubulin complexes serve as nucleation templates as well as a majority of other proteins contributing to centrosomal and non-centrosomal nucleation, conserved across eukaryotes. There is a growing amount of evidence of γ-tubulin functions besides microtubule nucleation in transcription, DNA damage response, chromatin remodeling, and on its interactions with tumor suppressors. However, the molecular mechanisms are not well understood. Furthermore, interactions with lamin and SUN proteins of the LINC complex suggest the role of γ-tubulin in the coupling of nuclear organization with cytoskeletons. γ-Tubulin that belongs to the clade of eukaryotic tubulins shows characteristics of both prokaryotic and eukaryotic tubulins. Both human and plant γ-tubulins preserve the ability of prokaryotic tubulins to assemble filaments and higher-order fibrillar networks. γ-Tubulin filaments, with bundling and aggregating capacity, are suggested to perform complex scaffolding and sequestration functions. In this review, we discuss a plethora of γ-tubulin molecular interactions and cellular functions, as well as recent advances in understanding the molecular mechanisms behind them. -
Lamin A/C Cardiomyopathy: Implications for Treatment
Current Cardiology Reports (2019) 21:160 https://doi.org/10.1007/s11886-019-1224-7 MYOCARDIAL DISEASE (A ABBATE AND G SINAGRA, SECTION EDITORS) Lamin A/C Cardiomyopathy: Implications for Treatment Suet Nee Chen1 & Orfeo Sbaizero1,2 & Matthew R. G. Taylor1 & Luisa Mestroni1 # Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract Purpose of Review The purpose of this review is to provide an update on lamin A/C (LMNA)-related cardiomyopathy and discuss the current recommendations and progress in the management of this disease. LMNA-related cardiomyopathy, an inherited autosomal dominant disease, is one of the most common causes of dilated cardiomyopathy and is characterized by steady progression toward heart failure and high risks of arrhythmias and sudden cardiac death. Recent Findings We discuss recent advances in the understanding of the molecular mechanisms of the disease including altered cell biomechanics, which may represent novel therapeutic targets to advance the current management approach, which relies on standard heart failure recommendations. Future therapeutic approaches include repurposed molecularly directed drugs, siRNA- based gene silencing, and genome editing. Summary LMNA-related cardiomyopathy is the focus of active in vitro and in vivo research, which is expected to generate novel biomarkers and identify new therapeutic targets. LMNA-related cardiomyopathy trials are currently underway. Keywords Lamin A/C gene . Laminopathy . Heart failure . Arrhythmias . Mechanotransduction . P53 . CRISPR–Cas9 therapy Introduction functions, including maintaining nuclear structural integrity, regulating gene expression, mechanosensing, and Mutations in the lamin A/C gene (LMNA)causelaminopathies, mechanotransduction through the lamina-associated proteins a heterogeneous group of inherited disorders including muscu- [6–11]. -
Actin Nucleator Spire 1 Is a Regulator of Ectoplasmic Specialization in the Testis Qing Wen1,Nanli1,Xiangxiao 1,2,Wing-Yeelui3, Darren S
Wen et al. Cell Death and Disease (2018) 9:208 DOI 10.1038/s41419-017-0201-6 Cell Death & Disease ARTICLE Open Access Actin nucleator Spire 1 is a regulator of ectoplasmic specialization in the testis Qing Wen1,NanLi1,XiangXiao 1,2,Wing-yeeLui3, Darren S. Chu1, Chris K. C. Wong4, Qingquan Lian5,RenshanGe5, Will M. Lee3, Bruno Silvestrini6 and C. Yan Cheng 1 Abstract Germ cell differentiation during the epithelial cycle of spermatogenesis is accompanied by extensive remodeling at the Sertoli cell–cell and Sertoli cell–spermatid interface to accommodate the transport of preleptotene spermatocytes and developing spermatids across the blood–testis barrier (BTB) and the adluminal compartment of the seminiferous epithelium, respectively. The unique cell junction in the testis is the actin-rich ectoplasmic specialization (ES) designated basal ES at the Sertoli cell–cell interface, and the apical ES at the Sertoli–spermatid interface. Since ES dynamics (i.e., disassembly, reassembly and stabilization) are supported by actin microfilaments, which rapidly converts between their bundled and unbundled/branched configuration to confer plasticity to the ES, it is logical to speculate that actin nucleation proteins play a crucial role to ES dynamics. Herein, we reported findings that Spire 1, an actin nucleator known to polymerize actins into long stretches of linear microfilaments in cells, is an important regulator of ES dynamics. Its knockdown by RNAi in Sertoli cells cultured in vitro was found to impede the Sertoli cell tight junction (TJ)-permeability barrier through changes in the organization of F-actin across Sertoli cell cytosol. Unexpectedly, Spire 1 knockdown also perturbed microtubule (MT) organization in Sertoli cells cultured in vitro. -
Proteomic and Bioinformatic Investigation of Altered Pathways in Neuroglobin-Deficient Breast Cancer Cells
molecules Article Proteomic and Bioinformatic Investigation of Altered Pathways in Neuroglobin-Deficient Breast Cancer Cells Michele Costanzo 1,2 , Marco Fiocchetti 3 , Paolo Ascenzi 3, Maria Marino 3 , Marianna Caterino 1,2,* and Margherita Ruoppolo 1,2,* 1 Department of Molecular Medicine and Medical Biotechnology, School of Medicine, University of Naples Federico II, 80131 Naples, Italy; [email protected] 2 CEINGE—Biotecnologie Avanzate S.C.Ar.L., 80145 Naples, Italy 3 Department of Science, University Roma Tre, 00146 Rome, Italy; marco.fi[email protected] (M.F.); [email protected] (P.A.); [email protected] (M.M.) * Correspondence: [email protected] (M.C.); [email protected] (M.R.) Abstract: Neuroglobin (NGB) is a myoglobin-like monomeric globin that is involved in several processes, displaying a pivotal redox-dependent protective role in neuronal and extra-neuronal cells. NGB remarkably exerts its function upon upregulation by NGB inducers, such as 17β-estradiol (E2) and H2O2. However, the molecular bases of NGB’s functions remain undefined, mainly in non- neuronal cancer cells. Human MCF-7 breast cancer cells with a knocked-out (KO) NGB gene obtained using CRISPR/Cas9 technology were analyzed using shotgun label-free quantitative proteomics in comparison with control cells. The differential proteomics experiments were also performed after treatment with E2, H2O2, and E2 + H2O2. All the runs acquired using liquid chromatography–tandem mass spectrometry were elaborated within the same MaxQuant analysis, leading to the quantification Citation: Costanzo, M.; Fiocchetti, of 1872 proteins in the global proteomic dataset. Then, a differentially regulated protein dataset was M.; Ascenzi, P.; Marino, M.; Caterino, M.; Ruoppolo, M. -
Gamma Tubulin (TUBG1) (NM 001070) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119462 gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Tag: Tag Free Symbol: TUBG1 Synonyms: CDCBM4; GCP-1; TUBG; TUBGCP1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC119462 sequence for NM_001070 edited (data generated by NextGen Sequencing) ATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCGGCAATCAGATTGGGTTCGAG TTCTGGAAACAGCTGTGCGCCGAGCATGGTATCAGCCCCGAGGGCATCGTGGAGGAGTTC GCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAGGCAGACGATGAGCACTAC ATCCCCCGGGCCGTGCTGCTGGACTTGGAACCCCGGGTGATCCACTCCATCCTCAACTCC CCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGAGGAGCT GGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGGACATTTTTGAC ATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTTTGTGCTGTGTCACTCC ATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTCTTAGAACGGCTGAATGACAGG TATCCTAAGAAGCTGGTGCAGACATACTCAGTGTTTCCCAACCAGGACGAGATGAGCGAT GTGGTGGTCCAGCCTTACAATTCACTCCTCACACTCAAGAGGCTGACGCAGAATGCAGAC TGTGTGGTGGTGCTGGACAACACAGCCCTGAACCGGATTGCCACAGACCGCCTGCACATC CAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCTACCATCATGTCAGCCAGCACC ACCACCCTGCGCTACCCTGGCTACATGAACAATGACCTCATCGGCCTCATCGCCTCGCTC ATTCCCACCCCACGGCTCCACTTCCTCATGACCGGCTACACCCCTCTCACTACGGACCAG TCAGTGGCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGGCGGCTGCTGCAGCCC -
Supplementary Table S1. Correlation Between the Mutant P53-Interacting Partners and PTTG3P, PTTG1 and PTTG2, Based on Data from Starbase V3.0 Database
Supplementary Table S1. Correlation between the mutant p53-interacting partners and PTTG3P, PTTG1 and PTTG2, based on data from StarBase v3.0 database. PTTG3P PTTG1 PTTG2 Gene ID Coefficient-R p-value Coefficient-R p-value Coefficient-R p-value NF-YA ENSG00000001167 −0.077 8.59e-2 −0.210 2.09e-6 −0.122 6.23e-3 NF-YB ENSG00000120837 0.176 7.12e-5 0.227 2.82e-7 0.094 3.59e-2 NF-YC ENSG00000066136 0.124 5.45e-3 0.124 5.40e-3 0.051 2.51e-1 Sp1 ENSG00000185591 −0.014 7.50e-1 −0.201 5.82e-6 −0.072 1.07e-1 Ets-1 ENSG00000134954 −0.096 3.14e-2 −0.257 4.83e-9 0.034 4.46e-1 VDR ENSG00000111424 −0.091 4.10e-2 −0.216 1.03e-6 0.014 7.48e-1 SREBP-2 ENSG00000198911 −0.064 1.53e-1 −0.147 9.27e-4 −0.073 1.01e-1 TopBP1 ENSG00000163781 0.067 1.36e-1 0.051 2.57e-1 −0.020 6.57e-1 Pin1 ENSG00000127445 0.250 1.40e-8 0.571 9.56e-45 0.187 2.52e-5 MRE11 ENSG00000020922 0.063 1.56e-1 −0.007 8.81e-1 −0.024 5.93e-1 PML ENSG00000140464 0.072 1.05e-1 0.217 9.36e-7 0.166 1.85e-4 p63 ENSG00000073282 −0.120 7.04e-3 −0.283 1.08e-10 −0.198 7.71e-6 p73 ENSG00000078900 0.104 2.03e-2 0.258 4.67e-9 0.097 3.02e-2 Supplementary Table S2.