Co-Translational Protein Targeting Facilitates
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The Basal Bodies of Chlamydomonas Reinhardtii Susan K
Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4]. -
Supplemental Information Proximity Interactions Among Centrosome
Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl -
Ninein, a Microtubule Minus-End Anchoring Protein 3015 Analysis As Described Previously (Henderson Et Al., 1994)
Journal of Cell Science 113, 3013-3023 (2000) 3013 Printed in Great Britain © The Company of Biologists Limited 2000 JCS1634 Microtubule minus-end anchorage at centrosomal and non-centrosomal sites: the role of ninein Mette M. Mogensen1,*, Azer Malik1, Matthieu Piel2, Veronique Bouckson-Castaing2 and Michel Bornens2 1Department of Anatomy and Physiology, MSI/WTB complex, Dow Street, University of Dundee, Dundee, DD1 5EH, UK 2Institute Curie, UMR 144-CNRS, 26 Rue d’Ulm, 75248 Paris Cedex 05, France *Author for correspondence (e-mail: [email protected]) Accepted 14 June; published on WWW 9 August 2000 SUMMARY The novel concept of a centrosomal anchoring complex, epithelial cells, where the vast majority of the microtubule which is distinct from the γ-tubulin nucleating complex, has minus-ends are associated with apical non-centrosomal previously been proposed following studies on cochlear sites, suggests that it is not directly involved in microtubule epithelial cells. In this investigation we present evidence nucleation. Ninein seems to play an important role in the from two different cell systems which suggests that the positioning and anchorage of the microtubule minus-ends centrosomal protein ninein is a strong candidate for the in these epithelial cells. Evidence is presented which proposed anchoring complex. suggests that ninein is released from the centrosome, Ninein has recently been observed in cultured fibroblast translocated with the microtubules, and is responsible for cells to localise primarily to the post-mitotic mother the anchorage of microtubule minus-ends to the apical centriole, which is the focus for a classic radial microtubule sites. We propose that ninein is a non-nucleating array. -
Downloaded from Bioscientifica.Com at 10/04/2021 03:09:50PM Via Free Access
242 S-M Ho et al. Regulation of centrosome 24:2 83–96 Research duplication by BPA analogues Bisphenol A and its analogues disrupt centrosome cycle and microtubule dynamics in prostate cancer Shuk-Mei Ho1,2,3,4, Rahul Rao1, Sarah To1,5,6, Emma Schoch1 and Pheruza Tarapore1,2,3 1Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA 2Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA Correspondence 3Cincinnati Cancer Center, Cincinnati, Ohio, USA should be addressed 4Cincinnati Veteran Affairs Hospital Medical Center, Cincinnati, Ohio, USA to S-M Ho or P Tarapore 5Center for Cancer Research, Hudson Institute of Medical Research, Clayton, Victoria, Australia Email 6Monash University, Clayton, Victoria, Australia [email protected] or [email protected] Abstract Humans are increasingly exposed to structural analogues of bisphenol A (BPA), as Key Words BPA is being replaced by these compounds in BPA-free consumer products. We have f endocrine-disrupting previously shown that chronic and developmental exposure to BPA is associated with chemicals increased prostate cancer (PCa) risk in human and animal models. Here, we examine f bisphenol A analogues whether exposure of PCa cells (LNCaP, C4-2) to low-dose BPA and its structural analogues f BPA (BPS, BPF, BPAF, TBBPA, DMBPA and TMBPA) affects centrosome amplification (CA), f BPS a hallmark of cancer initiation and progression. We found that exposure to BPA, BPS, f BPF DMBPA and TBBPA, in descending order, increased the number of cells with CA, in a non- f TBBPA Endocrine-Related Cancer Endocrine-Related monotonic dose–response manner. -
The Emerging Role of Ncrnas and RNA-Binding Proteins in Mitotic Apparatus Formation
non-coding RNA Review The Emerging Role of ncRNAs and RNA-Binding Proteins in Mitotic Apparatus Formation Kei K. Ito, Koki Watanabe and Daiju Kitagawa * Department of Physiological Chemistry, Graduate School of Pharmaceutical Science, The University of Tokyo, Bunkyo, Tokyo 113-0033, Japan; [email protected] (K.K.I.); [email protected] (K.W.) * Correspondence: [email protected] Received: 11 November 2019; Accepted: 13 March 2020; Published: 20 March 2020 Abstract: Mounting experimental evidence shows that non-coding RNAs (ncRNAs) serve a wide variety of biological functions. Recent studies suggest that a part of ncRNAs are critically important for supporting the structure of subcellular architectures. Here, we summarize the current literature demonstrating the role of ncRNAs and RNA-binding proteins in regulating the assembly of mitotic apparatus, especially focusing on centrosomes, kinetochores, and mitotic spindles. Keywords: ncRNA; centrosome; kinetochore; mitotic spindle 1. Introduction Non-coding RNAs (ncRNAs) are defined as a class of RNA molecules that are transcribed from genomic DNA, but not translated into proteins. They are mainly classified into the following two categories according to their length—small RNA (<200 nt) and long non-coding RNA (lncRNA) (>200 nt). Small RNAs include traditional RNA molecules, such as transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PIWI-interacting RNA (piRNA), and micro RNA (miRNA), and they have been studied extensively [1]. Research on lncRNA is behind that on small RNA despite that recent transcriptome analysis has revealed that more than 120,000 lncRNAs are generated from the human genome [2–4]. -
Identification and Localization of a Novel, Cytoskeletal, Centrosome-Associated Protein in Ptk2 Cells
Identification and Localization of a Novel, Cytoskeletal, Centrosome-associated Protein in PtK2 Cells Andre T. Baron and Jeffrey L. Salisbury Laboratory for Cell Biology, Center for NeuroSciences, Case Western Reserve University, School of Medicine, Cleveland, Ohio 44106 Abstract. Antisera raised against centrin (Salisbury, apparatus of algal cells, spindle pole body of yeast J. L., A. T. Baron, B. Surek, and M. Melkonian. cells, and centrosome of mammalian cells are homolo- 1984. J. Cell Biol. 99:962-970) have been used, here, gous structures essential for cytoplasmic organization Downloaded from http://rupress.org/jcb/article-pdf/107/6/2669/1057450/2669.pdf by guest on 28 September 2021 to identify a centrosome-associated protein with an Mr and cellular proliferation. Molecular cloning studies of 165,000. Immunocytochemistry indicates that this have recently shown that the cell cycle gene product protein is a component of pericentriolar satellites, CDC31, required for spindle pole body duplication, basal feet, and pericentriolar matrix of interphase shares 50% sequence homology with centrin (Huang, cells. These components of pericentriolar material are, B., A. Mengersen, and V. D. Lee. 1988. J. Cell Biol. in part, composed of 3-8-nm-diam filaments, which 107:133-140). The evolutionary conservation of interconnect to form a three-dimensional pericentriolar centrin-related sequences and immunologic epitopes to lattice. We conclude that the 165,000-Mr protein is im- microtubule organizing centers of divergent phylogeny munologically related to centrin, and that it is a com- suggests that a functional attribute(s) may have been ponent of a novel centrosome-associated cytoskeletal conserved as well. -
Centriole Overduplication Is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma
Published OnlineFirst January 12, 2018; DOI: 10.1158/1541-7786.MCR-17-0197 Oncogenes and Tumor Suppressors Molecular Cancer Research Centriole Overduplication is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma Ryan A. Denu1,2, Maria Shabbir3, Minakshi Nihal3, Chandra K. Singh3, B. Jack Longley3,4,5, Mark E. Burkard2,4, and Nihal Ahmad3,4,5 Abstract Centrosome amplification (CA) is common in cancer and can evaluated. PLK4 is significantly overexpressed in melanoma com- arise by centriole overduplication or by cell doubling events, pared with benign nevi and in a panel of human melanoma cell including the failure of cell division and cell–cell fusion. To assess lines (A375, Hs294T, G361, WM35, WM115, 451Lu, and SK-MEL- the relative contributions of these two mechanisms, the number of 28) compared with normal human melanocytes. Interestingly, centrosomes with mature/mother centrioles was examined by although PLK4 expression did not correlate with CA in most cases, immunofluorescence in a tissue microarray of human melanomas treatment of melanoma cells with a selective small-molecule PLK4 and benign nevi (n ¼ 79 and 17, respectively). The centrosomal inhibitor (centrinone B) significantly decreased cell proliferation. protein 170 (CEP170) was used to identify centrosomes with The antiproliferative effects of centrinone B were also accompa- mature centrioles; this is expected to be present in most centro- nied by induction of apoptosis. somes with cell doubling, but on fewer centrosomes with over- duplication. Using this method, it was determined that the major- Implications: This study demonstrates that centriole overdupli- ity of CA in melanoma can be attributed to centriole overduplica- cation is the predominant mechanism leading to centrosome tion rather than cell doubling events. -
Assembly of Centrosomal Proteins and Microtubule Organization Depends on PCM-1
JCBArticle Assembly of centrosomal proteins and microtubule organization depends on PCM-1 Alexander Dammermann and Andreas Merdes Wellcome Trust Centre for Cell Biology, Institute of Cell and Molecular Biology, University of Edinburgh, Edinburgh EH9 3JR, UK he protein PCM-1 localizes to cytoplasmic granules treatment of cells with the microtubule inhibitor nocodazole. known as “centriolar satellites” that are partly enriched Inhibition or depletion of PCM-1 function further disrupted T around the centrosome. We inhibited PCM-1 function the radial organization of microtubules without affecting using a variety of approaches: microinjection of antibodies microtubule nucleation. Loss of microtubule organization into cultured cells, overexpression of a PCM-1 deletion was also observed after centrin or ninein depletion. Our mutant, and specific depletion of PCM-1 by siRNA. All data suggest that PCM-1–containing centriolar satellites are Downloaded from approaches led to reduced targeting of centrin, pericentrin, involved in the microtubule- and dynactin-dependent recruit- and ninein to the centrosome. Similar effects were seen ment of proteins to the centrosome, of which centrin and upon inhibition of dynactin by dynamitin, and after prolonged ninein are required for interphase microtubule organization. jcb.rupress.org Introduction Microtubule organization is essential for directional intra- the centrosomal surface or subsequently released and anchored cellular transport, for the modulation of cell morphology in other places of the cell (Mogensen, 1999). The initial step and locomotion, and for the formation of the spindle apparatus of microtubule nucleation is dependent on the function of during cell division. With the exception of plants, most cells 25S ring complexes of the protein ␥-tubulin and associated on December 31, 2017 organize their microtubule network using specialized structures, proteins (Zheng et al., 1995). -
CEP63 Deficiency Promotes P53-Dependent Microcephaly and Reveals a Role for the Centrosome in Meiotic Recombination
ARTICLE Received 25 Mar 2015 | Accepted 30 May 2015 | Published 9 Jul 2015 DOI: 10.1038/ncomms8676 CEP63 deficiency promotes p53-dependent microcephaly and reveals a role for the centrosome in meiotic recombination Marko Marjanovic´1,2, Carlos Sa´nchez-Huertas1,*, Berta Terre´1,*, Rocı´oGo´mez3, Jan Frederik Scheel4,w, Sarai Pacheco5,6, Philip A. Knobel1, Ana Martı´nez-Marchal5,6, Suvi Aivio1, Lluı´s Palenzuela1, Uwe Wolfrum4, Peter J. McKinnon7, Jose´ A. Suja3, Ignasi Roig5,6, Vincenzo Costanzo8, Jens Lu¨ders1 & Travis H. Stracker1 CEP63 is a centrosomal protein that facilitates centriole duplication and is regulated by the DNA damage response. Mutations in CEP63 cause Seckel syndrome, a human disease characterized by microcephaly and dwarfism. Here we demonstrate that Cep63-deficient mice recapitulate Seckel syndrome pathology. The attrition of neural progenitor cells involves p53-dependent cell death, and brain size is rescued by the deletion of p53. Cell death is not the result of an aberrant DNA damage response but is triggered by centrosome-based mitotic errors. In addition, Cep63 loss severely impairs meiotic recombination, leading to profound male infertility. Cep63-deficient spermatocytes display numerical and structural centrosome aberrations, chromosome entanglements and defective telomere clustering, suggesting that a reduction in centrosome-mediated chromosome movements underlies recombination failure. Our results provide novel insight into the molecular pathology of microcephaly and establish a role for the centrosome in meiotic recombination. 1 Institute for Research in Biomedicine (IRB Barcelona), Barcelona 08028, Spain. 2 Division of Molecular Medicine, Rud–er Bosˇkovic´ Institute, Zagreb 10000, Croatia. 3 Departamento de Biologı´a, Edificio de Biolo´gicas, Universidad Auto´noma de Madrid, Madrid 28049, Spain. -
PCM1 Is Necessary for Focal Ciliary Integrity and Is a Candidate for Severe Schizophrenia
ARTICLE https://doi.org/10.1038/s41467-020-19637-5 OPEN PCM1 is necessary for focal ciliary integrity and is a candidate for severe schizophrenia Tanner O. Monroe 1,2, Melanie E. Garrett3, Maria Kousi4, Ramona M. Rodriguiz5,6, Sungjin Moon7, Yushi Bai8, Steven C. Brodar8, Karen L. Soldano3, Jeremiah Savage9, Thomas F. Hansen10,11, Donna M. Muzny12,13, Richard A. Gibbs12,13, Lawrence Barak8, Patrick F. Sullivan14,15,16, Allison E. Ashley-Koch 3, ✉ Akira Sawa 17,18,19,20, William C. Wetsel 5,6,8,21, Thomas Werge 10,11,22,23 & Nicholas Katsanis 1,2 1234567890():,; The neuronal primary cilium and centriolar satellites have functions in neurogenesis, but little is known about their roles in the postnatal brain. We show that ablation of pericentriolar material 1 in the mouse leads to progressive ciliary, anatomical, psychomotor, and cognitive abnormalities. RNAseq reveals changes in amine- and G-protein coupled receptor pathways. The physiological relevance of this phenotype is supported by decreased available dopamine D2 receptor (D2R) levels and the failure of antipsychotic drugs to rescue adult behavioral defects. Immunoprecipitations show an association with Pcm1 and D2Rs. Finally, we sequence PCM1 in two human cohorts with severe schizophrenia. Systematic modeling of all discovered rare alleles by zebrafish in vivo complementation reveals an enrichment for pathogenic alleles. Our data emphasize a role for the pericentriolar material in the postnatal brain, with progressive degenerative ciliary and behavioral phenotypes; and they support a contributory role for PCM1 in some individuals diagnosed with schizophrenia. 1 Department of Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA. -
Centrin-2 Is Required for Centriole Duplication in Mammalian Cells
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Current Biology, Vol. 12, 1287–1292, August 6, 2002, 2002 Elsevier Science Ltd. All rights reserved. PII S0960-9822(02)01019-9 Centrin-2 Is Required for Centriole Duplication in Mammalian Cells Jeffrey L. Salisbury,1 Kelly M. Suino, Microsurgical removal or laser ablation of centro- Robert Busby, and Margaret Springett somes results in errors in cytokinesis and in G1 arrest, Tumor Biology Program implicating a role for this organelle in the regulation of Mayo Clinic cell cycle progression [7, 8]. Centrosome defects (i.e., Rochester, Minnesota 55905 centrosome amplification and the accumulation of su- pernumerary centrioles) are characteristic of many solid tumors and may be responsible for the origin of mitotic Summary spindle abnormalities, chromosomal instability, and an- euploidy seen in cancer [9–11]. Furthermore, recent Background: Centrosomes are the favored microtu- studies showing transient centrosome association of bule-organizing framework of eukaryotic cells. Centro- key cell cycle regulators, including the tumor suppressor somes contain a pair of centrioles that normally dupli- proteins p53, BRCA-1, and -2, and the cyclin/cdks, have cate once during the cell cycle to give rise to two mitotic led to speculation that centrosomes provide an impor- spindle poles, each containing one old and one new tant structural context for coordinating cell cycle regula- centriole. However, aside from their role as an anchor tion [12–18]. Taken together, these observations sug- point for pericentriolar material and as basal bodies of gest the existence of a centrosome-based checkpoint flagella and cilia, the functional attributes of centrioles that functions to monitor coordination between centro- remain enigmatic. -
Suppl. Table 1
Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA