Fate of the M-Phase-Assembled Centrioles During the Cell

Home , Centrin, Centrin 2, PCNT, Pericentriolar material

1 Fate of the M-phase-assembled centrioles during the cell cycle in the 2 TP53;PCNT;CEP215-deleted cells 3 4 5 Gee In Jung and Kunsoo Rhee* 6 7 Department of Biological Sciences, Seoul National University, Seoul 08826, Korea 8 9 10 11 Running Head: Fate of the M-phase-assembled centrioles 12 13 Keywords: centrosome, supernumerary centrioles, cell cycle, CEP215, PCNT 14 15 16 17 *Correspondence: Kunsoo Rhee (E-mail: [email protected])

18 ABSTRACT 19 20 Cancer cells frequently include supernumerary centrioles. Here, we generated 21 TP53;PCNT;CEP215 triple knockout cell lines and observed precocious separation and 22 amplification of the centrioles at M phase. Many of the triple KO cells maintained 23 supernumerary centrioles throughout the cell cycle. The M-phase-assembled centrioles lack an 24 ability to function as templates for centriole assembly during S phase. They also lack an ability 25 to organize microtubules in interphase. However, we found that a fraction of them acquired an 26 ability to organize microtubules during M phase. Our works provide an example how 27 supernumerary centrioles behave in dividing cells.

28 INTRODUCTION 29 30 Centrosome is a subcellular organelle which functions as a major microtubule 31 organizing center. Centrosome is comprised of a pair of centrioles surrounded by pericentriolar 32 material (PCM). Centriole duplication and separation are controlled in close link to the cell 33 cycle. When a cell enters S phase, daughter centrioles start to assemble in a perpendicular angle 34 to mother centrioles and elongate. Entering mitosis, the daughter centriole disengages from the 35 mother centriole but remains associated until the end of mitosis (Cabral et al., 2013; Shukla et 36 al., 2015; Seo et al., 2015). Centriole separation initiates at anaphase when separase cleaves 37 pericentrin (PCNT), a major PCM protein (Lee and Rhee, 2012; Matsuo et al., 2012). Cleavage 38 of PCNT induces disintegration of mitotic PCM, resulting in release of a daughter centriole 39 from the mother centriole during mitotic exit (Kim et al., 2015). 40 When a cell exits M phase, a daughter centriole becomes a young mother centriole. 41 Centriole-to-centrosome conversion is a process for a centriole to acquire PCM for microtubule 42 organization activity (Wang et al., 2011). In addition, a young mother centriole can function as 43 a template for procentriole assembly at subsequent S phase (Wang et al., 2011). One of the 44 highlight events in the conversion may be accumulation of CEP152, an adaptor for PLK4 into 45 the young mother centriole (Wang et al., 2011; Novak et al., 2014). CEP152 is recruited after 46 a sequential process which begins immediately after daughter centriole assembly at S phase 47 (Fu et al., 2016; Tsuchiya et al., 2016). Cep63 and Cep152 form a stable complex at the 48 proximal end of the centrioles, and Cep57 is a proximity interactor of Cep63 (Firat-Karalar and 49 Stearns, 2014; Kim et al., 2019; Zhao et al., 2020). 50 PLK4 is a central regulator of centriole duplication and, therefore, the levels and 51 activity of PLK4 are tightly regulated during the cell cycle (O’Connell et al., 2001; Bettencourt- 52 Diaz et al., 2005; Habedanck et al., 2005). Centriole assembly cannot start at G1 phase since 53 the PLK4 activity is maintained low. Once the PLK4 activity is induced near S phase, daughter 54 centrioles assemble using the mother centrioles as templates. Upon binding to STIL, PLK4 is 55 activated through trans-autophosphorylation and phosphorylates STIL, triggering the centriolar 56 recruitment of SAS6 and cartwheel formation (Ohta et al., 2014; Dzhindshev et al., 2014; 57 Moyer et al., 2015; Lopes et al., 2015; Arquint et al, 2015). Mother centrioles are not allowed 58 to form new daughter centrioles at G2 and M phase, as far as they are associated with daughter 59 centrioles in vicinity (Wong and Stearns, 2003; Kim et al., 2016). 60 Supernumerary centrioles are frequently observed in diverse cancer cells (Chan, 2011; 61 Marteil et al., 2018). Several ways to generate centriole amplification have been suggested, 62 including centriole over duplication, de novo centrosome formation, fragmentation of overly 63 elongated centrioles and cytokinesis failure (Sabat-Pospiech et al., 2019). Most of all, 64 overexpression of PLK4 generates multiple daughter centriole during S phase (Habedanck et 65 al., 2005; Kleylein-Sohn et al., 2007). In fact, genetic variants near the PLK4 gene are closely 66 associated with aneuploidy (McCoy et al., 2015) and overexpression of PLK4 has been 67 reported in a variety of tumor cells (Liao et al., 2019). Involvement of PLK1 on centriole 68 amplification was also reported. PLK1 is a novel regulator of centriole elongation in human 69 cells (Kong et al., 2014) and augmented PLK1 activity generates mitotic centriole over- 70 elongation (Kong et al., 2020). Over-elongated centrioles can also contribute to centrosome

71 amplification through fragmentation or the formation of multiple procentrioles along their 72 elongated walls (Kohlmaier et al., 2009; Marteil et al., 2018). 73 PCM is organized as a toroid around mature centrioles in interphase, and expands into 74 a more amorphous structure in preparation for mitosis (Fu and Glover, 2012; Lawo et al., 2012; 75 Mennella et al., 2012). PCNT and CEP215, two major PCM proteins in the human centrosome 76 (Doxsey et al., 1994; Dictenberg et al., 2002; Andersen et al., 2003; Fong et al., 2007), 77 specifically interact to each other in both interphase and mitotic centrosomes and act as 78 scaffolds for the γ-tubulin ring complex (Kim and Rhee, 2014). CEP215 mutations cause 79 autosomal recessive primary microcephaly (Bond et al., 2005). Likewise, PCNT mutations 80 cause microcephalic osteodysplastic primordial dwarfism as well as other disease, such as 81 cancers and mental disorders (Rauch et al., 2008; Delaval and Doxsey, 2010). 82 We previously reported that centrioles prematurely separate and eventually amplify 83 when PCNT is deleted (Kim et al., 2019). We interpret that absence of PCNT generate defects 84 in mitotic PCM which holds the mother and daughter centrioles together (Kim et al., 2019). 85 When PCM is dissolved with a prolonged treatment of mitotic drugs such as STLC and 86 nocodazole, mother centrioles are distanced from daughter centrioles and generate nascent 87 centrioles even at M phase (Seo et al., 2015). In this work, we generated the TP53, PCNT and 88 CEP215 triple knockout (KO) cells and determined centriole amplification. The results showed 89 that the centrioles precociously separate and amplify during M phase. We analyzed the fate of 90 the M-phase-assembled centrioles during the cell cycle.

91 RESULTS 92 93 Generation of the TP53;PCNT;CEP215-deleted cells 94 We previously observed precocious separation and amplification of centrioles at M 95 phase in HeLa cells with TP53 and PCNT double deletions (Kim et al., 2019). To expand our 96 understanding on PCM regulation of centriole separation and assembly, we generated the TP53, 97 PCNT and CEP215 triple KO cells, using the CRISPR/Cas9 method (Figure1 Supplement 98 Figure 1). During the selection step, we realized that the triple KO cells failed to form a stable 99 cell line, due to a low proliferation activity and cell apoptosis. Therefore, the triple KO cells 100 were generated in the presence of the ectopic PCNT gene with a destabilization domain (DD- 101 PCNT), whose expression is induced by doxycycline and shield1 (Kim et al., 2019). The 102 ectopic DD-PCNT gene was hardly expressed as far as doxycycline and shield1 were absent. 103 In fact, immunoblot analysis revealed that PCNT and CEP215 were below detection levels in 104 the triple KO cells (Figure 1A). Immunostaining analysis also revealed that the PCNT and 105 CEP215 signals were absent at the centrosomes of the triple KO cells (Figure 1B-D). These 106 results indicate that the TP53, PCNT and CEP215 triple KO cell lines were properly generated. 107 Therefore, we used the triple KO line to analyze combined roles of PCNT and CEP215 for 108 regulation of centriole behavior during mitosis. 109 110 Precocious centriole separation and amplification in the triple KO cells during M phase 111 We initially examined precocious separation and amplification of centrioles at M phase 112 in the TP53, PCNT and CEP215 triple KO cells. The cells were arrested at prometaphase using 113 S-trityl-L-cysteine (STLC), an EG5 inhibitor, and determined centriole behaviors (Figure 2A). 114 We confirmed that PCNT and CEP215 were not detected in the deletion cells arrested at 115 prometaphase (Figure 2B). Precocious centriole separation was observed in most of the TP53 116 and PCNT double KO cells and supernumerary centrioles were detected in about 40% of them 117 (Figure 2C-E). In the TP53 and CEP215 double KO cells, precocious centriole separation was 118 observed in less than a half of the cells and no centriole amplification occurred (Figure. 2C-E). 119 Precocious centriole separation was obvious in the TP53, PCNT and CEP215 triple KO cells 120 and centriole amplification was fortified (Figure 2C-E). Indeed, some of the triple KO cells 121 included exceeding number of extra centrioles up to 30 (Figure 2C, E). These results revealed 122 a cooperative function of PCNT and CEP215 in prevention of precocious centriole separation 123 and amplification during mitosis. 124 We recorded generation of M-phase centrioles in the triple KO cells. We used centrin- 125 2 coupled to the photo-convertible fluorescent protein Dendra2 (CETN2-Dendra2), which 126 allows to distinguish newly formed centrioles from pre-existing ones (Loffler et al., 2013). The 127 CETN2-Dendra2-expressing cells synchronously entered mitosis and were arrested at 128 prometaphase with the STLC treatment. Nascent centrioles started to appear in prometaphase- 129 arrested triple KO cells (Figure 2F; Figure 2 Supplement Movie 1a). However, no centriole 130 was generated in the TP53-deleted control cells (Figure 2G). As far as we know, this is the first 131 live observation of centriole generation at M phase. 132 133 Limited centriole assembly at S phase in the triple KO cells

134 We traced the fate of the extra centrioles in the triple KO cells throughout the cell cycle. 135 It is well-known that the PLK4-overexpressing cells generate extra centrioles (Habedanck et 136 al., 2005; Coelho et al., 2015). The extra centrioles were observed when expression of the 137 ectopic PLK4 gene was induced by doxycycline for 24 h (Figure 3A, B). We designated the 138 extra centrioles in the PLK4-overexpressing cells as S-phase-assembled centrioles. In 139 comparison, the extra centrioles in the triple KO cells was designated as the M-phase- 140 assembled centrioles. 141 Using the mitotic shake-off method, we collected the M-phase population of the PLK4- 142 overexpressing cells and the triple KO cells, forced them to synchronously enter into G1 phase 143 and cultured them for up to indicated time points (Figure 3A). In control cells, the number of 144 centrioles were two in the beginning of the culture and increased to four in 17th hour when the 145 cells entered S phase (Figure 3B). The centriole number eventually down to two in 24th hour 146 after the next mitosis (Figure 3B, C). The PLK4-overexpressing cells includes extra centrioles 147 in the beginning of the culture and 60% of them had five or more centrioles at 17th hour, 148 indicating that most of the centrioles assembled new procentrioles during the S phase (Figure 149 3B, C). The triple KO cells also included multiple centrioles at G1 phase. However, the number 150 of centrioles in the triple deletion cells slightly increased at S phase (Figure 3B, C). These 151 results suggest that the M-phase-assembled centrioles survive but do not duplicate during 152 interphase. 153 CEP152 is a mother centriole protein which functions as an adaptor for PLK4 (Hatch 154 et al., 2010). In control cells, the number of the CEP152-positive centrioles are two throughout 155 the cell cycle (Figure 3B, D). About 40% of the PLK4-overexpressing cells included three or 156 more CEP152-positive centrioles in the beginning of the culture and this proportion was 157 maintained throughout the cell cycle (Figure 3B, D). This observation is consistent with the 158 previous reports in which multiple centrioles in the PLK4-overexpressing cells can duplicate 159 during S phase (Coelho et al., 2015). It is interesting that the triple KO cells included only two 160 CEP152-positive centrioles out of multiple centrioles and this number was maintained 161 throughout the cell cycle (Figure 3B, D). These results suggest that only a single out of multiple 162 daughter centrioles can convert into a mother centriole in the triple KO cells during mitotic 163 exit. 164 We used centrinone, a PLK4 inhibitor, to determine centriole assembly in S phase in 165 the PLK4-overexpressing cells and the triple KO cells (Wong et al., 2015). As expected, the 166 number of centrioles in control cells remained two at S phase (Figure 3E). The average number 167 of centrioles in PLK4-overexpressing cells started with seven and increased to ten during S 168 phase (Figure 3E). However, the S phase assembly of the centrioles was inhibited with the 169 centrinone treatment (Figure 3E). The average number of centrioles in the triple KO cells were 170 3.5 and this number hardly increased even at S phase, (Figure 3E). Centrinone had a little effect 171 on the triple deletion cells, confirming that the triple KO cells hardly assemble procentrioles in 172 S phase (Figure 3E). 173 174 Centriole-to-centrosome conversion in the precociously separated centrioles 175 We investigated centriole-to-centrosome conversion after precocious centriole 176 separation at M phase. When PCNT-deleted cells were arrested at prometaphase with STLC,

177 their centrioles readily separated (Figure 2D; Kim et al., 2019). We determined localization of 178 CEP295 and CEP152 in the precociously separated centrioles at M phase. The results showed 179 that about halves of the TP53;PCNT-deleted and TP53;PCNT;CEP215-deleted cells included 180 three and more CEP295 and CEP152 signals in their centrioles (Figure 4). On the other hand, 181 CEP295 and CEP152 signals were detected at a centriole pair in most of the TP53- and 182 TP53;CEP215-deleted cells (Figure 4). These results suggest that daughter centrioles readily 183 convert to centrosomes even at M phase as soon as they are separated from the mother 184 centrioles. 185 186 Defective centriole-to-centrosome conversion in the triple KO cells 187 Presence of only two CEP152-positive centrioles out of multiple ones in the triple KO 188 cells suggests that only a pair of centrioles are able to recruit PLK4 for generation of new 189 procentrioles during S phase. In order to examine intactness of the centrioles in the triple KO 190 cells, we performed coimmunostaining analysis with CEP152 and selected centrosome proteins 191 (Figure 5A). As expected, most of centrioles in the control cells were CEP152-positive and 192 also coimmunostained with antibodies specific to CEP295, CEP192, CEP135 and γ-tubulin 193 (Figure 5B). Most of the multiple centrioles in the PLK4-overexpressing cells were 194 immunostained with all the antibodies we used (Figure 5B). However, only two centrioles in 195 the triple KO cells were positive to CEP152 (Figure 5B). Furthermore, CEP295, CEP192, 196 CEP135 and γ-tubulin were detected almost exclusively at the CEP152-positive centrioles 197 (Figure 5B). These results strongly suggest that only a pair of the CEP152-positive centrioles 198 are intact mother centrioles whereas the rest of them are defective centrioles in the triple KO 199 cells. 200 We performed a similar coimmunostaining analysis with the KO cells at mitosis 201 (Figure 5C, D). Consistent with the previous results, the control as well as the KO cells at 202 interphase had two centrosomes positive to CEP192 and γ-tubulin (Figure 5C, D). In the mitotic 203 control cells, both CEP192 and γ-tubulin signals were detected at two pairs of centrioles (Figure 204 5C, D). The double and triple KO cells had centrioles separated and frequently amplified at 205 mitosis. Both the CEP192 and γ-tubulin signals were detected in many of the separated and 206 amplified centrioles of the deletion cells at mitosis (Figure 5D). These results suggest that 207 separated centrioles in the triple KO cells may have an ability to organize microtubules during 208 mitosis. 209 210 Defective microtubule organization in the triple KO cells 211 We performed microtubule regrowth assays to determine biological activities of the 212 centrosomes in the PLK4-overexpressing cells and the triple KO cells. In control cells, 213 microtubules started to be organized from both centrosomes present at G1 phase (Figure 6A, 214 B). About 6 centrosomes are present in the PLK4-overexpressing cells and 91% of them were 215 able to organize microtubules (Figure 6A, B). However, in the tripled KO cells, only 73% of 216 the centrosomes organized microtubules, leaving 27% of them without an activity (Figure 6A, 217 B). These results suggest that a significant fraction of the centrosomes in the triple KO cells 218 have functional defects in microtubule organization during interphase. 219 We determined spindle configurations in mitotic cells of the PLK4-overexpressing and

220 triple KO cells. Spindle pole phenotypes are categorized into five groups following Watanabe 221 et al. (2019); lagging chromosome, chromosome misalignment, monopole, bipole and 222 multipole (Figure 6C). As expected, most of the mitotic control cells formed bipolar spindles 223 (Figure 6D). In PLK4-overexpressing cells, about 60% of mitotic cells formed multipoles 224 (Figure 6D). On the other hand, the proportion of monopoles were significantly increased up 225 to 40% in the triple KO cells but the mitotic cells with multipoles were insignificant (Figure 226 6D). These results suggest that many of the separated centrioles in the triple KO cells have 227 limited ability to function as spindle poles during mitosis.

228 DISCUSSION 229 230 In this work, we generated TP53, PCNT and CEP215 triple KO cell lines and 231 determined their phenotypes at the centrosome. We observed that centrioles in the triple KO 232 cells precociously separated and amplified at M phase. Many of the triple KO cells maintained 233 supernumerary centrioles throughout the cell cycle. However, the number of centrioles did not 234 double during S phase. It is likely that, in the triple KO cells, supernumerary centrioles, many 235 of which are assembled during M phase, lack an ability to function as templates for centriole 236 assembly during S phase (Figure 7). 237 Since PCNT and CEP215 are major PCM components in the human centrosome, 238 deletion of them might result in disorganized structure of mitotic PCM. As previously shown, 239 most of the PCNT-deleted cells revealed precocious centriole separation during mitosis and a 240 small fraction of them have multiple centrioles (Kim et al., 2019). Centriole-to-centrosome 241 conversion readily follows after precocious centriole separation at M phase (Tsuchiya et al., 242 2016). However, less than a half of CEP215-deleted cells had precocious centriole separation 243 without amplification, suggesting that integrity of the mitotic PCM is more or less maintained 244 in the absence of CEP215. In fact, we and others reported that mitotic centrosomes are 245 relatively intact in the CEP215-depleted cells, except that their centrioles are frequently 246 displaced from spindle poles during mitosis (Lee and Rhee, 2010; Barr et al., 2010; Chavali et 247 al., 2016; Gambarotto et al., 2019). Nonetheless, deletion of CEP215 enforced the PCNT KO 248 phenotypes, suggesting that PCNT and CEP215 cooperatively constitute mitotic PCM to 249 maintain centriole association during M phase (Buchman et al., 2010; Kim and Rhee, 2014). 250 Monopolar spindles in the triple KO cells should be attributed to a low microtubule organizing 251 activity, due to a limited accumulation of mitotic PCM (Lee and Rhee, 2010; Figure 6d). 252 The M-phase-assembled centrioles in the triple KO cells failed to duplicate during S 253 phase. In contrast, the S-phase-assembled centrioles in PLK4-overexpressing cells doubled in 254 the next S phase. These results strongly suggest that majority of the M-phase-assembled 255 centrioles lack an ability to function as template for nascent centriole assembly during S phase. 256 In fact, only two out of multiple centrioles in the triple KO cells are positive to CEP152 which 257 is a scaffold for PLK4 in mother centrioles. Known preceding components for the centriole-to- 258 centrosome conversion, such as CEP135, CEP295 and CEP192, were also detected almost 259 exclusively at the CEP152-positive centrioles, indicating that only a single out of many 260 centrioles in a triple KO cell is able to convert from centriole to centrosome during mitotic exit. 261 We suspect that two CEP152-positive centrioles may be generated at the previous S phase, 262 while the other centrioles are assembled at M phase. It remains to be investigated why the M- 263 phase-assembled centrioles cannot be converted to centrosome during mitotic exit. A 264 possibility may be that centriole assembly processes cannot be compressively proceeded within 265 a short M phase. As a result, the M-phase assembled centrioles may not be able to recruit a 266 series of centrosomal proteins necessary for the conversion until the end of mitosis. It remains 267 to be identified what factors are critically absent for the M-phase-assembled centrioles to 268 undergo conversion. 269 Once a daughter centriole converts to a mother centriole during mitotic exit, it acquires 270 an ability to recruit PCM (Wang et al., 2011; Fu et al., 2016). We observed that almost all

271 amplified centrioles in the PLK4-overexpressing cells can organize microtubules. As a result, 272 majority of the PLK4-overexpressing cells formed multipoles in M phase. On the other hand, 273 a significant proportion of centrioles in the triple KO cells failed to organize microtubules in 274 interphase. These results also support the notion that the M-phase-assembled centrioles cannot 275 convert to centrosomes during mitotic exit. Consequently, they hardly function as microtubule 276 organizing centers during the cell cycle. Nonetheless, we do not rule out the possibility that a 277 fraction of the M-phase-assembled centrioles may acquire an ability to organize microtubules 278 especially during mitosis. In fact, we found the γ-tubulin signals in some of the extra centrioles 279 of the triple KO cells at M phase. 280 Supernumerary centrioles are common in cancer cells (Chan, 2011; Marteil et al., 281 2018). It is not clear whether supernumerary centrosomes are sufficient to drive tumor 282 development or not (Vitre et al., 2015). It remains to be investigated how centrioles are 283 amplified and how supernumerary centrioles are maintained in tumor cells (Kwon et al., 2013). 284 Supernumerary centrioles may be generated by a number of non-physiological pathways, in 285 addition to PLK4 overexpression. In this work, we revealed that M-phase-assembled centrioles 286 are generated in cells which lack critical PCM proteins. The supernumerary centrioles which 287 are generated during M phase may be dormant with little biological activity, and, therefore, are 288 maintained throughout the cell cycle. However, since these centrioles can also recruit γ-tubulin 289 at M phase, they have a chance to cause mitotic defects and aneuploidy.

290 MATERIALS AND METHODS

291 Cell culture, generation of deleted cell lines and synchronization 292 The deleted cell lines were made in the Flp-In T-Rex Hela cells (Kim et al., 2019). CEP215 293 was deleted using CRISPR/Cas9 technique in the PCNT, TP53-double deleted cells expressing 294 DD-PCNT (Kim et al., 2019). The gRNA sequences for CEP215 deletion are (5’- 295 ccagggacggtgacgtcctcttc-3’) and (5’-ctgcagccgctgagcgtcccagg-3’). HeLa cells were cultured in 296 DMEM (LM001-05; Welgene, Gyeongsangbuk-do, South Korea) with 10% FBS (S101-01; 297 Welgene). For mitotic synchronization, cells were sequentially treated with 2mM thymidine 298 (T9250; Sigma-Aldrich, St. Louis, MO) and 5μM STLC (2191; Tocris, Bristol, United 299 Kingdom). For the time course experiment, cells were treated with doxycycline for 24 hours 300 after seeding to induce ectopic PLK4 expression, washed out and cultured for another 24 hours. 301 Mitotic cells were obtained with a gentle shake-off from asynchronous cell plates and collected 302 with a warm medium at indicated time points. 303 304 Microtubule regrowth assay 305 Mitotic cells were obtained with mitotic shake-off and cultured for 2 h to reach at early G1 306 phase. The cells were treated with 5μM of nocodazole (M1404; Sigma-Aldrich) for 2 hours at 307 37℃, placed on ice for 1 hour, and then transferred to a warm medium for microtubule growth. 308 The cells were fixed with PEM buffer (80mM PIPES pH6.9, 1mM MgCl2, 5mM EGTA, 0.5% 309 Triton X-100) for 10 minutes at room temperature, incubated in phosphate-balanced buffer 310 with 0.5% Triton-X (PBST) for 5 minutes to increase permeability, and subjected to 311 immunostaining with antibodies specific to α-tubulin and centrin-2. 312 313 Antibodies 314 The antibodies specific to centrin-2 [immunocytochemistry (ICC) 1:1000; 04-1624; Merck 315 Millipore, Billerica, MA], CEP295 (ICC 1:500; 122490; Abcam, Cambridge, MA), CEP192 316 [ICC 1:1000, immunoblot (IB) 1:500; A302-324A; Bethyl Laboratories, Montgomery, TX], 317 CEP152 (ICC 1:500, IB 1:100; 183911; Abcam), GAPDH (IB 1: 20,000; AM4300; Life 318 Technologies, Carlsbad, CA), SAS-6 (ICC 1:200, IB 1:100; sc-376836; Santa Cruz 319 Biotechnology, Dallas, TX), α-tubulin (ICC 1:2000, IB 1: 20,000; ab18251; Abcam), γ-tubulin 320 (ICC 1:1000, IB 1:2000; 11316; Abcam) were purchased. The antibodies specific to CEP215 321 (Lee and Rhee, 2010; ICC 1:2000, IB 1:500), PCNT (Kim and Rhee, 2011; ICC 1:2000, IB 322 1:2000), CEP135 (Kim et al., 2008; ICC 1:2000) and CPAP (Chang et al., 2010; ICC 1:100; IB 323 1:500) were previously described. Secondary antibodies conjugated with fluorescent dyes (ICC 324 1:1000; Alexa Fluor 488, 594 and 647; Life Technologies) and with horseradish peroxidase (IB 325 1:10,000; Sigma-Aldrich or Millipore) were purchased. 326 327 Immunostaining analysis 328 Cells on a cover glass (0117520; Paul Marienfeld, Lauda-Königshofen, Germany) were fixed 329 with cold methanol for 10 min at 4℃, washed with cold PBS, and blocked with blocking 330 solution (3% bovine serum albumin, and 0.3% Triton X-100 in PBS) for 30 min. The samples 331 were incubated with primary antibodies for 1 h, washed with 0.1% PBST, incubated with 332 secondary antibodies for 30 minutes, washed, and treated with 4,6-diamidino-2-phenylindole

333 (DAPI) solution for up to 2 minutes. The cover glasses were mounted on a slide glass with 334 ProLong Gold antifade reagent (P36930; Life Technologies). Images were observed with 335 fluorescence microscopes with a digital camera (Olympus IX51) equipped with QImaging 336 QICAM Fast 1394 and processed in ImagePro 5.0 (Media Cybernetics). ImagePro 5.0 (Media 337 Cybernetics), Photoshop CC (Adobe) and ImageJ 1.51k (National Institutes of Health) were 338 used for image processing. For measuring fluorescence intensities at centrosome, all images 339 were obtained in an identical setting with the same exposure time. ImageJ was used for 340 measuring and the background signals were subtracted from the centrosomal signals. 341 342 Live cell imaging 343 CQ1 benchtop high-content analysis system was used for imaging live cells. The CETN2- 344 Dendra2 plasmid which had been kindly provided by Alwin Krämer (Löffler et al., 2012) were 345 stably transfected into the cells. The cells were synchronized at M phase with sequential 346 treatments of thymidine and STLC, activated with 405nm wavelength for 10 sec and recorded 347 with 488nm and 561nm wavelengths for up to 2 h. 348 349 Immunoblot analysis 350 Cells were washed with PBS, lysed on ice for 10 min with RIPA buffer (1% Triton X-100, 150 351 mM NaCl, 0.5% sodium deoxycolate, 0.1% SDS, 50 mM Tris-HCl at pH 8.0, 1 mM Na3VO4, 352 10 mM NaF, 1 mM EDTA and 1 mM EGTA) containing a protease inhibitor cocktail (Sigma- 353 Aldrich, P8340) and centrifuged for 10 minutes at 4°C. A fraction of the supernatants was used 354 for the Bradford assays, and the rest were mixed with 4×SDS sample buffer (250 mM Tris-HCl 355 at pH 6.8, 8% SDS, 40% glycerol and 0.04% bromophenol blue) and 10 mM DTT (0281-25G; 356 Amresco). The mixtures were boiled for 5 min. For PCNT, CEP215, and CEP152, 3% stacking 357 gel and 4% separating gel were used with 20mg of protein samples. For SAS-6 and CPAP, 5% 358 stacking gel and 8% separating gel were used with 20mg of protein samples. The rest are loaded 359 in 5% stacking gel and 10% separating gel with 10mg of protein samples. Proteins at gels were 360 transferred to Protran BA85 nitrocellulose membranes (10401196; GE Healthcare Life 361 Sciences). The membranes were blocked with a blocking solution (5% nonfat milk in 0.1% 362 Tween 20 in TBS or 5% bovine serum albumin in 0.1% Tween 20 in TBS) for 2 h, incubated 363 with primary antibodies diluted in blocking solution for overnight at 4°C, washed with TBST 364 (0.1% Tween 20 in TBS), incubated with secondary antibodies in blocking solution for 30 min 365 and washed again. ECL reagent (LF-QC0101; ABfrontier, Seoul, South Korea) and X-ray films 366 (CP-BU NEW; Agfa, Mortsel, Belgium) were used to detect the signals.

367 FIGURE LEGENDS 368 369 Figure 1. Generation of TP53;PCNT;CEP215-deleted cells (A) The TP53, PCNT and 370 CEP215 genes were deleted in HeLa cells using the CRISPR/CAS9 method. Endogenous 371 PCNT was deleted in the presence of ectopic DD-PCNT gene whose expression was induced 372 by doxycycline (Dox) and shield1 (SHLD1). The deletions were confirmed with the 373 immunoblot analysis with antibodies specific to PCNT, CEP215 and GAPDH. (B) The triple 374 KO cells were coimmunostained with antibodies specific to centrin-2 (CETN2, green), PCNT 375 (red) and CEP215 (red). Nuclei were stained with DAPI (blue). Scale bar, 10 μm. (C, D) 376 Relative intensities of the centrosomal PCNT (C) and CEP215 (D) signals were determined. 377 Greater than 30 cells per group were analyzed in three independent experiments. Values are 378 means and SEM. The statistical significance was analyzed using two-way ANOVA and 379 indicated by lower cases (P<0.05). 380 381 Figure 2. Precocious centriole separation and amplification at M phase in the triple KO 382 cells (A) Timeline for preparation of prometaphase cells. The triple KO cells were treated with 383 thymidine 24 h followed by STLC for 10 h. (B) Immunoblot analyses were performed with 384 antibodies specific to PCNT, CEP215, cyclin B1, γ-tubulin and GAPDH. (C) The 385 prometaphase-arrested cells were subjected to coimmunostaining analysis with antibodies 386 specific to centrin-2 (CETN2, green) and CEP135 (red). Nuclei were stained with DAPI (blue). 387 Scale bar, 10 μm. (D) The number of cells with separated centrioles were counted, based on 388 1:1 ratio of the centriolar CEP135 and CETN2 signals. (E) The number of centrioles per cell 389 were counted. Greater than 30 cells per group were analyzed in three independent experiments. 390 Values are means and SEM. The statistical significance was analyzed using two-way ANOVA 391 and indicated by lower cases (P<0.05). (F) The CETN2-Dendra2-expressing triple KO cells 392 were treated with thymidine 24 h followed by STLC for 8 h. After a light activation, the 393 CETN2-Dendra2 signals were recorded for up to 2 h. Light activation makes CETN2-Dendra2 394 detected with 594 nm fluorescence (red). Nascent centrioles were detected only with 488 nm 395 fluorescence (green, white arrow). Scale bar, 10 μm. (G) The number of cells with nascent 396 centrioles were counted. Greater than 20 cells per group were analyzed in three independent 397 experiments. Values are means and SEM. The statistical significance was analyzed using one- 398 way ANOVA. *, P<0.05. 399 400 Figure 3. Limited S-phase centriole assembly in the triple KO cells (A) Timeline for 401 preparation of synchronous interphase cells. Doxycycline was treated for 24 h to induce ectopic 402 PLK4 expression, washed out and cultured for another 24 h. Mitotic cells were collected and 403 cultured for up to 24 h. At indicated time points, the cells were subjected to coimmunostaining 404 analyses. (B) The PLK4-overexpressing and triple KO cells were subjected to 405 coimmunostaining analysis with antibodies specific to CETN2 (green) and CEP152 (red). 406 Scale bar, 2 μm. (C, D) Number of CETN2 (C) and CEP152 (D) dots were counted in the 407 PLK4-overexpressing and triple KO cells at indicated time points. (E) After mitotic shake-off, 408 the PLK4-overexpressing and triple KO cells were cultured in the presence of centrinone for 2 409 and 17 h, and immunostained with the centrin-2 antibody. The number of centrioles per cell

410 was counted. Greater than 30 cells per group were analyzed in three independent experiments. 411 Values are means and SEM. The statistical significance was analyzed using one-way ANOVA. 412 *, P<0.05. 413 414 Figure 4. Centriole-to-centrosome conversion in precociously separated centrioles 415 during M phase (A) The triple KO cells were treated with STLC for 10 h and 416 coimmunostained with CETN-2 (green) and CEP295 or CEP152 (red). Nuclei were stained 417 with DAPI (blue). Scale bar, 10 μm. (B) The numbers of CEP295 and CEP152 signals were 418 counted in the cells. Greater than 30 cells per group were analyzed in three independent 419 experiments. Values are means and SEM. 420 421 Figure 5. Determination of intact centrioles in the triple KO cells (A) The PLK4- 422 overexpressing and triple KO cells at G1 phase were coimmunostained with antibodies specific 423 to CEP295, CEP192, CEP135 and γ-tubulin (cyan), along with CETN2 (green) and CEP152 424 (red). Scale bar, 2 μm. Arrows and arrowheads mark the CEP152-positive and -negative 425 centrioles, respectively. (B) The number of centrioles with CEP152 and the indicated antibodies 426 were counted. (C) The KO cells at interphase and mitosis were coimmunostained with 427 antibodies specific to CEP192 (green), γ-tubulin (red) and CETN2 (cyan). Nuclei were stained 428 with DAPI (blue). Scale bar, 10 μm. (D) The number of CEP192 and γ-tubulin signals were 429 counted in cells at interphase (I) and mitosis (M). Greater than 30 cells per group were analyzed 430 in three independent experiments. Values are means and SEM. 431 432 Figure 6. MTOC activities in the supernumerary centrioles (A) The PLK4-overexpressing 433 and triple KO cells at G1 phase were subjected to microtubule regrowth assays. The cells were 434 coimmunostained with antibodies specific to CETN2 (green) and α-tubulin (red). Scale bar, 2 435 μm. (B) The number of CETN2 dots with microtubule asters are counted. (C) The PLK4- 436 overexpressing and triple KO cells at mitosis were subjected to coimmunostaining analysis 437 with antibodies specific to CETN2 (green), α-tubulin (red) and DAPI (blue). Representative 438 abnormalities of the spindle poles were shown. Scale bar, 10 μm. (D) Mitotic cells with 439 abnormal spindle poles were counted. (B, D) Greater than 30 cells per group were analyzed in 440 three independent experiments. Values are means and SEM. 441 442 Figure 7. Model. At early M phase, daughter centrioles readily disengage from mother 443 centrioles, but remain associated surrounded by mitotic PCM. Daughter centrioles eventually 444 separate from the mother centrioles after PCM is disintegrated at the end of mitosis. Deletion 445 of PCNT and CEP215 makes mitotic PCM disorganized. As results, daughter centrioles 446 precociously separate from mother centrioles at M phase and centriole amplification occurs. 447 The M-phase-assembled centrioles, however, cannot convert to mother centrioles during 448 mitotic exit. They do not organize microtubules, nor function as templates for nascent centriole 449 assembly in subsequent S phase, and are detected throughout the cell cycle. 450 451 Figure 1 Supplement Figure 1. Deletion of CEP215 in HeLa cells The CEP215 gene was 452 deleted using the CRISPR/CAS9 technique. Guide RNAs and indel types were indicated.

453 Insertions and deletions were marked with blue and red colors, respectively. 454 455 Figure 2 Supplement Movie 1. Live cell imaging of CETN2-Dendra2 in the triple KO cells 456 The CETN2-Dendra2-expressing triple KO cells were treated with thymidine for 24 h followed 457 by STLC for 8 h. After a light activation, the CETN2-Dendra2 signals were recorded in 15 458 min-intervals for up to 2 h. Preexisting centrioles were detected with both 488 nm and 561 nm 459 wavelengths, while de novo centrioles (arrow) were detected only with 488 nm wavelength.

460 REFERENCES 461 462 Andersen, J.S., Wilkinson, C.J., Mayor, T., Mortensen, P., Nigg, E.A., and Mann, M. (2003). 463 Proteomic characterization of the human centrosome by protein correlation profiling. Nature 464 426, 570-574. 465 Barrera, J.A., Kao, L.R., Hammer, R.E., Seemann, J., Fuchs, J.L., and Megraw, T.L. (2010). 466 CDK5RAP2 regulates centriole engagement and cohesion in mice. Developmental cell 18, 467 913-926. 468 Bettencourt-Dias, M., Rodrigues-Martins, A., Carpenter, L., Riparbelli, M., Lehmann, L., 469 Gatt, M.K., Carmo, N., Balloux, F., Callaini, G., and Glover, D.M. (2005). SAK/PLK4 is 470 required for centriole duplication and flagella development. Current biology 15, 2199-2207. 471 Bond, J., Roberts, E., Springell, K., Lizarraga, S.B., Scott, S., Higgins, J., Hampshire, D.J., 472 Morrison, E.E., Leal, G.F., Silva, E.O., Costa, S.M.R., Baralle, D., Raponi, M., Karbani, G., 473 Rashid, Y., Jafri, H., Bennett, C., Corry, P., Walsh, C.A., and Woods, C.G. (2005). A 474 centrosomal mechanism involving CDK5RAP2 and CENPJ controls brain size. Nature 475 genetics 37, 353-355. 476 Buchman, J.J., Tseng, H.C., Zhou, Y., Frank, C.L., Xie, Z., and Tsai, L.H. (2010). Cdk5rap2 477 interacts with pericentrin to maintain the neural progenitor pool in the developing neocortex. 478 Neuron 66, 386-402. 479 Cabral, G., Sans, S.S., Cowan, C.R., and Dammermann, A. (2013). Multiple mechanisms 480 contribute to centriole separation in C. elegans. Current biology 23, 1380-1387. 481 Chan, J.Y. (2011). A clinical overview of centrosome amplification in human cancers. Int J 482 Biol Sci 7, 1122-1144. 483 Chang, C.W., Hsu, W.B., Tsai, J.J., Tang, C.J., and Tang, T.K. (2016). CEP295 interacts with 484 microtubules and is required for centriole elongation. Journal of cell science 129, 2501-2513. 485 Chavali, P.L., Chandrasekaran, G., Barr, A.R., Tatrai, P., Taylor, C., Papachristou, E.K., 486 Woods, C.G., Chavali, S., and Gergely, F. (2016). A CEP215-HSET complex links 487 centrosomes with spindle poles and drives centrosome clustering in cancer. Nature 488 communications 7, 11005. 489 Cizmecioglu, O., Arnold, M., Bahtz, R., Settele, F., Ehret, L., Haselmann-Weiss, U., Antony, 490 C., and Hoffmann, I. (2010). Cep152 acts as a scaffold for recruitment of Plk4 and CPAP to 491 the centrosome. The Journal of cell biology 191, 731-739. 492 Coelho, P.A., Bury, L., Shahbazi, M.N., Liakath-Ali, K., Tate, P.H., Wormald, S., Hindley, 493 C.J., Huch, M., Archer, J., Skarnes, W.C., Zernicka-Goetz, M., and Glover, D.M. (2015). 494 Over-expression of Plk4 induces centrosome amplification, loss of primary cilia and 495 associated tissue hyperplasia in the mouse. Open biology 5, 150209. 496 Delaval, B., and Doxsey, S.J. (2010). Pericentrin in cellular function and disease. The Journal 497 of cell biology 188, 181-190. 498 Dictenberg, J.B., Zimmerman, W., Sparks, C.A., Young, A., Vidair, C., Zheng, Y., 499 Carrington, W., Fay, F.S., and Doxsey, S.J. (1998). Pericentrin and gamma-tubulin form a 500 protein complex and are organized into a novel lattice at the centrosome. The Journal of cell 501 biology 141, 163-174. 502 Dzhindzhev, N.S., Tzolovsky, G., Lipinszki, Z., Schneider, S., Lattao, R., Fu, J., Debski, J., 503 Dadlez, M., and Glover, D.M. (2014). Plk4 phosphorylates Ana2 to trigger Sas6 recruitment 504 and procentriole formation. Current biology 24, 2526-2532. 505 Dzhindzhev, N.S., Yu, Q.D., Weiskopf, K., Tzolovsky, G., Cunha-Ferreira, I., Riparbelli, M., 506 Rodrigues-Martins, A., Bettencourt-Dias, M., Callaini, G., and Glover, D.M. (2010). 16

507 Asterless is a scaffold for the onset of centriole assembly. Nature 467, 714-718. 508 Firat-Karalar, E.N., Rauniyar, N., Yates, J.R., and Stearns, T. (2014). Proximity interactions 509 among centrosome components identify regulators of centriole duplication. Current biology 510 24, 664-670. 511 Fong, C.S., Kim, M., Yang, T.T., Liao, J.C., and Tsou, M.F. (2014). SAS-6 assembly 512 templated by the lumen of cartwheel-less centrioles precedes centriole duplication. 513 Developmental cell 30, 238-245. 514 Fong, K.W., Choi, Y.K., Rattner, J.B., and Qi, R.Z. (2008). CDK5RAP2 is a pericentriolar 515 protein that functions in centrosomal attachment of the gamma-tubulin ring complex. 516 Molecular biology of the cell 19, 115-125. 517 Fu, J., and Glover, D. (2016). How the newborn centriole becomes a mother. Cell Cycle 15, 518 1521-1522. 519 Fu, J., and Glover, D.M. (2012). Structured illumination of the interface between centriole 520 and peri-centriolar material. Open biology 2, 120104. 521 Gambarotto, D., Pennetier, C., Ryniawec, J.M., Buster, D.W., Gogendeau, D., Goupil, A., 522 Nano, M., Simon, A., Blanc, D., Racine, V., Kimata, Y., Rogers, G.C., and Basto, R. (2019). 523 Plk4 Regulates Centriole Asymmetry and Spindle Orientation in Neural Stem Cells. 524 Developmental cell 50, 11-24 e10. 525 Gisselsson, D., Bjork, J., Hoglund, M., Mertens, F., Dal Cin, P., Akerman, M., and Mandahl, 526 N. (2001). Abnormal nuclear shape in solid tumors reflects mitotic instability. The American 527 journal of pathology 158, 199-206. 528 Godinho, S.A., and Pellman, D. (2014). Causes and consequences of centrosome 529 abnormalities in cancer. Philosophical transactions of the Royal Society of London Series B, 530 Biological sciences 369, 20130467 531 Habedanck, R., Stierhof, Y.D., Wilkinson, C.J., and Nigg, E.A. (2005). The Polo kinase Plk4 532 functions in centriole duplication. Nature cell biology 7, 1140-1146. 533 Hatch, E.M., Kulukian, A., Holland, A.J., Cleveland, D.W., and Stearns, T. (2010). Cep152 534 interacts with Plk4 and is required for centriole duplication. The Journal of cell biology 191, 535 721-729. 536 Izquierdo, D., Wang, W.J., Uryu, K., and Tsou, M.F. (2014). Stabilization of cartwheel-less 537 centrioles for duplication requires CEP295-mediated centriole-to-centrosome conversion. 538 Cell reports 8, 957-965. 539 Kim, J., Lee, K., and Rhee, K. (2015). PLK1 regulation of PCNT cleavage ensures fidelity of 540 centriole separation during mitotic exit. Nature communications 6, 10076. 541 Kim, J., Kim, J., and Rhee, K. (2019). PCNT is critical for the association and conversion of 542 centrioles to centrosomes during mitosis. Journal of cell science 132, Jcs225789 543 Kim, M., O'Rourke, B.P., Soni, R.K., Jallepalli, P.V., Hendrickson, R.C., and Tsou, M.B. 544 (2016). Promotion and Suppression of Centriole Duplication Are Catalytically Coupled 545 through PLK4 to Ensure Centriole Homeostasis. Cell reports 16, 1195-1203. 546 Kim, S., and Rhee, K. (2014). Importance of the CEP215-pericentrin interaction for 547 centrosome maturation during mitosis. PloS one 9, e87016. 548 Kleylein-Sohn, J., Westendorf, J., Le Clech, M., Habedanck, R., Stierhof, Y.D., and Nigg, 549 E.A. (2007). Plk4-induced centriole biogenesis in human cells. Developmental cell 13, 190- 550 202. 551 Kohlmaier, G., Loncarek, J., Meng, X., McEwen, B.F., Mogensen, M.M., Spektor, A., 552 Dynlacht, B.D., Khodjakov, A., and Gonczy, P. (2009). Overly long centrioles and defective 553 cell division upon excess of the SAS-4-related protein CPAP. Current biology 19, 1012-1018. 17

554 Kong, D., Farmer, V., Shukla, A., James, J., Gruskin, R., Kiriyama, S., and Loncarek, J. 555 (2014). Centriole maturation requires regulated Plk1 activity during two consecutive cell 556 cycles. The Journal of cell biology 206, 855-865. 557 Kong, D., Sahabandu, N., Sullenberger, C., Vasquez-Limeta, A., Luvsanjav, D., Lukasik, K., 558 and Loncarek, J. (2020). Prolonged mitosis results in structurally aberrant and over-elongated 559 centrioles. The Journal of cell biology 219, e201910019 560 Kwon, M., Godinho, S.A., Chandhok, N.S., Ganem, N.J., Azioune, A., Thery, M., and 561 Pellman, D. (2008). Mechanisms to suppress multipolar divisions in cancer cells with extra 562 centrosomes. Genes & development 22, 2189-2203. 563 Lawo, S., Hasegan, M., Gupta, G.D., and Pelletier, L. (2012). Subdiffraction imaging of 564 centrosomes reveals higher-order organizational features of pericentriolar material. Nature 565 cell biology 14, 1148-1158. 566 Lee, K., and Rhee, K. (2012). Separase-dependent cleavage of pericentrin B is necessary and 567 sufficient for centriole disengagement during mitosis. Cell Cycle 11, 2476-2485. 568 Lee, S., and Rhee, K. (2010). CEP215 is involved in the dynein-dependent accumulation of 569 pericentriolar matrix proteins for spindle pole formation. Cell Cycle 9, 774-783. 570 Liao, Z., Zhang, H., Fan, P., Huang, Q., Dong, K., Qi, Y., Song, J., Chen, L., Liang, H., 571 Chen, X., Zhang, Z., and Zhang, B. (2019). High PLK4 expression promotes tumor 572 progression and induces epithelialmesenchymal transition by regulating the Wnt/betacatenin 573 signaling pathway in colorectal cancer. International journal of oncology 54, 479-490. 574 Loffler, H., Fechter, A., Liu, F.Y., Poppelreuther, S., and Kramer, A. (2013). DNA damage- 575 induced centrosome amplification occurs via excessive formation of centriolar satellites. 576 Oncogene 32, 2963-2972. 577 Lukinavicius, G., Umezawa, K., Olivier, N., Honigmann, A., Yang, G., Plass, T., Mueller, V., 578 Reymond, L., Correa, I.R., Jr., Luo, Z.G., Schultz, C., Lemke, E.A., Heppenstall, P., 579 Eggeling, C., Manley, S., and Johnsson, K. (2013). A near-infrared fluorophore for live-cell 580 super-resolution microscopy of cellular proteins. Nature chemistry 5, 132-139. 581 Marteil, G., Guerrero, A., Vieira, A.F., de Almeida, B.P., Machado, P., Mendonca, S., 582 Mesquita, M., Villarreal, B., Fonseca, I., Francia, M.E., Dores, K., Martins, N.P., Jana, S.C., 583 Tranfield, E.M., Barbosa-Morais, N.L., Paredes, J., Pellman, D., Godinho, S.A., and 584 Bettencourt-Dias, M. (2018). Over-elongation of centrioles in cancer promotes centriole 585 amplification and chromosome missegregation. Nature communications 9, 1258. 586 Matsuo, K., Ohsumi, K., Iwabuchi, M., Kawamata, T., Ono, Y., and Takahashi, M. (2012). 587 Kendrin is a novel substrate for separase involved in the licensing of centriole duplication. 588 Current biology 22, 915-921. 589 McCoy, R.C., Demko, Z., Ryan, A., Banjevic, M., Hill, M., Sigurjonsson, S., Rabinowitz, 590 M., Fraser, H.B., and Petrov, D.A. (2015). Common variants spanning PLK4 are associated 591 with mitotic-origin aneuploidy in human embryos. Science 348, 235-238. 592 Mennella, V., Keszthelyi, B., McDonald, K.L., Chhun, B., Kan, F., Rogers, G.C., Huang, B., 593 and Agard, D.A. (2012). Subdiffraction-resolution fluorescence microscopy reveals a domain 594 of the centrosome critical for pericentriolar material organization. Nature cell biology 14, 595 1159-1168. 596 Moyer, T.C., Clutario, K.M., Lambrus, B.G., Daggubati, V., and Holland, A.J. (2015). 597 Binding of STIL to Plk4 activates kinase activity to promote centriole assembly. The Journal 598 of cell biology 209, 863-878. 599 O'Connell, K.F., Caron, C., Kopish, K.R., Hurd, D.D., Kemphues, K.J., Li, Y., and White, 600 J.G. (2001). The C. elegans zyg-1 gene encodes a regulator of centrosome duplication with 18

601 distinct maternal and paternal roles in the embryo. Cell 105, 547-558. 602 Rauch, A., Thiel, C.T., Schindler, D., Wick, U., Crow, Y.J., Ekici, A.B., van Essen, A.J., 603 Goecke, T.O., Al-Gazali, L., Chrzanowska, K.H., Zweier, C., Brunner, H.G., Becker, K., 604 Curry, C.J., Dallapiccola, B., Devriendt, K., Dörfler, A., Kinning, E., Megarbane, A., 605 Meinecke, P., Semple, R.K., Spranger, S., Toutain, A., Trembath, R.C., Voss, E., Wilson, L., 606 Hennekam, R., Zegher, F.D., Dörr, H.G., and Reis, A. (2008). Mutations in the pericentrin 607 (PCNT) gene cause primordial dwarfism. Science 319, 816-819. 608 Sabat-Pospiech, D., Fabian-Kolpanowicz, K., Prior, I.A., Coulson, J.M., and Fielding, A.B. 609 (2019). Targeting centrosome amplification, an Achilles' heel of cancer. Biochemical Society 610 transactions 47, 1209-1222. 611 Seo, M.Y., Jang, W., and Rhee, K. (2015). Integrity of the Pericentriolar Material Is Essential 612 for Maintaining Centriole Association during M Phase. PloS one 10, e0138905. 613 Shukla, A., Kong, D., Sharma, M., Magidson, V., and Loncarek, J. (2015). Plk1 relieves 614 centriole block to reduplication by promoting daughter centriole maturation. Nature 615 communications 6, 8077. 616 Sieben, C., Banterle, N., Douglass, K.M., Gonczy, P., and Manley, S. (2018). Multicolor 617 single-particle reconstruction of protein complexes. Nature methods 15, 777-780. 618 Tsuchiya, Y., Yoshiba, S., Gupta, A., Watanabe, K., and Kitagawa, D. (2016). Cep295 is a 619 conserved scaffold protein required for generation of a bona fide mother centriole. Nature 620 communications 7, 12567. 621 Vitre, B., Holland, A.J., Kulukian, A., Shoshani, O., Hirai, M., Wang, Y., Maldonado, M., 622 Cho, T., Boubaker, J., Swing, D.A., Tessarollo, L., Evans, S.M., Fuchs, E., and Cleveland, 623 D.W. (2015). Chronic centrosome amplification without tumorigenesis. Proceedings of the 624 National Academy of Sciences of the United States of America 112, E6321-6330. 625 Wang, W.J., Soni, R.K., Uryu, K., and Tsou, M.F. (2011). The conversion of centrioles to 626 centrosomes: essential coupling of duplication with segregation. The Journal of cell biology 627 193, 727-739. 628 Watanabe, K., Takao, D., Ito, K.K., Takahashi, M., and Kitagawa, D. (2019). The Cep57- 629 pericentrin module organizes PCM expansion and centriole engagement. Nature 630 communications 10, 931. 631 Wong, C., and Stearns, T. (2003). Centrosome number is controlled by a centrosome-intrinsic 632 block to reduplication. Nature cell biology 5, 539-544. 633 Wong, Y.L., Anzola, J.V., Davis, R.L., Yoon, M., Motamedi, A., Kroll, A., Seo, C.P., Hsia, 634 J.E., Kim, S.K., Mitchell, J.W., Mitchell, B.J., Desai, A., Gahman, T.C., Shiau, A.K., and 635 Oegema, K. (2015). Cell biology. Reversible centriole depletion with an inhibitor of Polo-like 636 kinase 4. Science 348, 1155-1160. 637 Zhao, H., Yang, S., Chen, Q., Duan, X., Li, G., Huang, Q., Zhu, X., and Yan, X. (2020). Cep57 638 and Cep57l1 function redundantly to recruit the Cep63-Cep152 complex for centriole 639 biogenesis. Journal of cell science 133, jcs241836

bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A TP53 ------KO genes PCNT + + - - - - CEP215 + + + + - - Ectopic DD-PCNT - - + + + + Drugs Dox & SHLD1 + - + - + -

PCNT

CEP215 GAPDH

B TP53del - PCNTdel PCNTdel;CEP215del

E - DD-PCNT DD-PCNT

D&S + - + - + - PCNT / CETN2 CEP215 / CETN2

C D a a a b a b a a a a b b 3 2 PCNT

2 CEP215

1 centrosomal centrosomal Relative intensities intensities Relative Relative intensities intensities Relative of of 0 0 TP53 ------TP53 ------KO genes PCNT + + - - - - PCNT + + - - - - CEP215 + + + + - - CEP215 + + + + - - Ectopic DD-PCNT - - + + + + DD-PCNT - - + + + + Drugs Dox & SHLD1 + - + - + - Dox & SHLD1 + - + - + -

Figure 1. Generation of TP53;PCNT;CEP215-deleted cells (A) The TP53, PCNT and CEP215 genes were deleted in HeLa cells using the CRISPR/CAS9 method. Endogenous PCNT was deleted in the presence of ectopic DD-PCNT gene whose expression was induced by doxycycline (Dox) and shield1 (SHLD1). The deletions were confirmed with the immunoblot analysis with antibodies specific to PCNT, CEP215 and GAPDH. (B) The triple KO cells were coimmunostained with antibodies specific to centrin-2 (CETN2, green), PCNT (red) and CEP215 (red). Nuclei were stained with DAPI (blue). Scale bar, 10 μm. (C, D) Relative intensities of the centrosomal PCNT (C) and CEP215 (D) signals were determined. Greater than 30 cells per group were analyzed in three independent experiments. Values are means and SEM. The statistical significance was analyzed using two-way ANOVA and indicated by lower cases (P<0.05). bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.B All rights reserved. NoAsync reuse allowedMitosis without permission. A TP53 ------Fix KO genes PCNT + - + - + - + - CEP215 + + - - + + - - Async ▼ Ectopic DD-PCNT - - - + - - - + 0 12 24 34 Drug STLC - - - - + + + +

Fix PCNT ▼ Thymidine STLC Mitosis CEP215 0 12 24 34 CycB1 γ-Tub GAPDH

C TP53del

- PCNTdel CEP215del PCNTdel;CEP215del CEP135 / CETN2

a b c b D 100 E 100 80

60 50 40

% cells with % cells with >5 5

separatedcentrioles 20 4 The proportion of cells with # with of centrioles(%) <4 0 0 TP53 - - - - TP53 - - - - PCNT + - + - PCNT + - + - CEP215 + + - - CEP215 + + - -

F G * 60 del novo 40 ;CEP215 del

Dendra2 signals - Dendra2 20 ;PCNT del % cells with % cellswith de CETN2

TP53 0 TP53 - - 0:15 0:30 0:45 1:00 (h:m) PCNT + - CEP215 + - Figure 2. Precocious centriole separation and amplification at M phase in the triple KO cells (A) Timeline for preparation of prometaphase cells. The triple KO cells were treated with thymidine 24 h followed by STLC for 10 h. (B) Immunoblot analyses were performed with antibodies specific to PCNT, CEP215, cyclin B1, γ-tubulin and GAPDH. (C) The prometaphase-arrested cells were subjected to coimmunostaining analysis with antibodies specific to centrin-2 (CETN2, green) and CEP135 (red). Nuclei were stained with DAPI (blue). Scale bar, 10 μm. (D) The number of cells with separated centrioles were counted, based on 1:1 ratio of the centriolar CEP135 and CETN2 signals. (E) The number of centrioles per cell were counted. Greater than 30 cells per group were analyzed in three independent experiments. Values are means and SEM. The statistical significance was analyzed using two-way ANOVA and indicated by lower cases (P<0.05). (F) The CETN2-Dendra2-expressing triple KO cells were treated with thymidine 24 h followed by STLC for 8 h. After a light activation, the CETN2-Dendra2 signals were recorded for up to 2 h. Light activation makes CETN2-Dendra2 detected with 594 nm fluorescence (red). Nascent centrioles were detected only with 488 nm fluorescence (green, white arrow). Scale bar, 10 μm. (G) The number of cells with nascent centrioles were counted. Greater than 20 cells per group were analyzed in three independent experiments. Values are means and SEM. The statistical significance was analyzed using one-way ANOVA. *, P<0.05. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.Shake off All rights reserved. No reuse allowed without permission. A Dox ▼

-48 -24 2 17 24 (h)

TP53del B Ectopic PLK4 TP53del TP53del PCNTdel PCNTdel Dox - Dox + CEP215del 2h CEP152 / 17h CETN2 24h

C # of centrin2 (%) D # of CEP152 (%)

- 100

- 100 Dox

50 Dox 50

0 0 100 100 Ectopic PLK4 Ectopic PLK4

Dox+ 50 50 Dox+

0 0 100 100 TM TM 50 50 TP53 TP53 0 0 TM 100 TM 100

50 50 PCNT PCNT 0 0 TM 100 TM 100 > 4 > 2 50 3, 4 50 2 CEP215 1, 2 CEP215 1 0 0 Hours after 2 5 8 11 14 17 24 Hours after 2 5 8 11 14 17 24 shake off shake off * E 12

6 * * * n.s 4 CETN2 dots

2 Average number of

0 Hours after shake off 2 17 2 17 2 17 2 17 2 17 2 17 2 17 2 17 2 17 2 17 Centrinone - + - + - + - + - + TP53 + + - - - PCNT + + + - - CEP215 + + + + - Ectopic PLK4 + + Dox - + Figure 3. Limited S-phase centriole assembly in the triple KO cells (A) Timeline for preparation of synchronous interphase cells. Doxycycline was treated for 24 h to induce ectopic PLK4 expression, washed out and cultured for another 24 h. Mitotic cells were collected and cultured for up to 24 h. At indicated time points, the cells were subjected to coimmunostaining analyses. (B) The PLK4-overexpressing and triple KO cells were subjected to coimmunostaining analysis with antibodies specific to CETN2 (green) and CEP152 (red). Scale bar, 2 μm. (C, D) Number of CETN2 (C) and CEP152 (D) dots were counted in the PLK4-overexpressing and triple KO cells at indicated time points. (E) After mitotic shake-off, the PLK4-overexpressing and triple KO cells were cultured in the presence of centrinone for 2 and 17 h, and immunostained with the centrin-2 antibody. The number of centrioles per cell was counted. Greater than 30 cells per group were analyzed in three independent experiments. Values are means and SEM. The statistical iifi l d i ANOVA * P 0 05 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A TP53del

- PCNTdel CEP215del PCNTdel;CEP215del CEP295 / CETN2 CEP152 / CETN2

B 100

50 >4 4 3

with (%) # with CEP295 of 2 The proportion of cellsof proportion The 1 0 C 100

50 >4 4 3

with (%) # with CEP152 of 2 The proportion of cellsof proportion The 1 0 TP53 - - - - PCNT + - + - CEP215 + + - -

Figure 4. Centriole-to-centrosome conversion in precociously separated centrioles during M phase (A) The triple KO cells were treated with STLC for 10 h and coimmunostained with CETN-2 (green) and CEP295 or CEP152 (red). Nuclei were stained with DAPI (blue). Scale bar, 10 μm. (B) The numbers of CEP295 and CEP152 signals were counted in the cells. Greater than 30 cells per group were analyzed in three independent experiments. Values are means and SEM. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuseB allowedEarly without G1 (2h permission. after shake off) TP53del A Ectopic PLK4 TP53del TP53del PCNTdel CETN2 PCNTdel 6 CEP152 Dox - Dox + CEP215del CEP295

CEP295 2 Average numberof dots 0

6 CETN2 CEP152 CEP192 CEP192 4 CEP152 /

2 CETN2 Average numberof dots

CEP135 0 CETN2 6 CEP152 CEP135

4 - Tubulin γ 2 Average numberof dots

CETN2 6 CEP152 γ-tub

2 Average numberof dots 0 TP53 + + - - - PCNT + + + - - CEP215 + + + + - Ectopic PLK4 + + Dox - +

del C TP53 D 100 del del del

- PCNT PCNT ;CEP215 Tub (%) - 50 > 2 2

Proportion of cells # with of γ 1 0 CETN2

/ 100 Interphase - Tub γ

/ 50 > 2 2 1

Proportion of cells # with of CEP192 (%) 0 CEP192 Mitosis I M I M I M TP53 - - - PCNT + - - CEP215 + + -

Figure 5. Determination of intact centrioles in the triple KO cells (A) The PLK4-overexpressing and triple KO cells at G1 phase were coimmunostained with antibodies specific to CEP295, CEP192, CEP135 and γ-tubulin (cyan), along with CETN2 (green) and CEP152 (red). Scale bar, 2 μm. Arrows and arrowheads mark the CEP152-positive and - negative centrioles, respectively. (B) The number of centrioles with CEP152 and the indicated antibodies were counted. (C) The KO cells at interphase and mitosis were coimmunostained with antibodies specific to CEP192 (green), γ- tubulin (red) and CETN2 (cyan). Nuclei were stained with DAPI (blue). Scale bar, 10 μm. (D) The number of CEP192 and γ-tubulin signals were counted in cells at interphase (I) and mitosis (M). Greater than 30 cells per group were analyzed in three independent experiments. Values are means and SEM. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

B CETN2 w/o MT aster A Ectopic PLK4 TP53del TP53del 8 CETN2 w MT aster TP53del PCNTdel PCNTdel CEP215del Ectopic Dox - Dox + 6

4 CETN2 dots 2 Average numberof - tubulin α / 0 TP53 + + - - - PCNT + + + - - CETN2 CEP215 + + + + - Ectopic PLK4 + + Dox - +

C Lagging CM CM misalignment Monopole Bipole Multipole Tub - α / CETN2 / DAPI

D Asynchronous mitotic cell

100 Lagging CM CM misalignment 80 Monopole Bipole 60 Multipole

40 Spindle Spindle (%)pole 20

0 TP53 + + - - - PCNT + + + - - CEP215 + + + + - Ectopic PLK4 + + Dox - +

Figure 6. MTOC activities in the supernumerary centrioles (A) The PLK4-overexpressing and triple KO cells at G1 phase were subjected to microtubule regrowth assays. The cells were coimmunostained with antibodies specific to CETN2 (green) and α-tubulin (red). Scale bar, 2 μm. (B) The number of CETN2 dots with microtubule asters are counted. (C) The PLK4-overexpressing and triple KO cells at mitosis were subjected to coimmunostaining analysis with antibodies specific to CETN2 (green), α-tubulin (red) and DAPI (blue). Representative abnormalities of the spindle poles were shown. Scale bar, 10 μm. (D) Mitotic cells with abnormal spindle poles were counted. (B, D) Greater than 30 cells per group were analyzed in three independent experiments. Values are means and SEM. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Wild type Engagement Association Separation Conversion S-phase Assembly

G2 M G1 S Triple KO Engagement Precocious Separation M-phase Assembly Selective Conversion S-phase Assembly

Figure 7. Model. At early M phase, daughter centrioles readily disengage from mother centrioles, but remain associated surrounded by mitotic PCM. Daughter centrioles eventually separate from the mother centrioles after PCM is disintegrated at the end of mitosis. Deletion of PCNT and CEP215 makes mitotic PCM disorganized. As results, daughter centrioles precociously separate from mother centrioles at M phase and centriole amplification occurs. The M-phase-assembled centrioles, however, cannot convert to mother centrioles during mitotic exit. They do not organize microtubules, nor function as templates for nascent centriole assembly in subsequent S phase, and are detected throughout the cell cycle. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

CDK5RAP2 exon1

tactacctgaaccacaaccttctcctgcagtggcagggaccctgcgagtcgccgacgtc (13/25) tactacctgaaccacaaccttctcctgcagtggcagggaccctgcgagtcgccgacgtc (5/25) tactacctgaaccacaaccttctcctgcagtggcagggaccctgcgagtcgccgacgtc (5/25) tactacctgaaccacaaccttctcctgcagtggcagggaccctcgcgagtcgccgacgtc (1/25) tactacctgaaccacaacctctccagcagtggcagggaccctgcgagtcgccgacgtc (1/25)

Figure 1 Supplement Figure 1. Deletion of CEP215 in HeLa cells The CEP215 gene was deleted using the CRISPR/CAS9 technique. Guide RNAs and indel types were indicated. Insertions and deletions were marked with blue and red colors, respectively. bioRxiv preprint doi: https://doi.org/10.1101/2020.09.14.297440; this version posted September 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a TP53del TP53del;PCNTdel;CEP215del 488 nm 561 nm

Figure 2 Supplement Movie 1. Live cell imaging of CETN2-Dendra2 in the triple KO cells The CETN2-Dendra2- expressing triple KO cells were treated with thymidine for 24 h followed by STLC for 8 h. After a light activation, the CETN2-Dendra2 signals were recorded in 15 min-intervals for up to 2 h. Preexisting centrioles were detected with both 488 nm and 561 nm wavelengths, while de novo centrioles (arrow) were detected only with 488 nm wavelength.