Anti-Hyperalgesic Properties of a Flavanone Derivative Poncirin In

Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 https://doi.org/10.1186/s40360-019-0335-5

RESEARCH ARTICLE Open Access Anti-hyperalgesic properties of a flavanone derivative Poncirin in acute and chronic inflammatory pain models in mice Ruqayya Afridi1, Ashraf Ullah Khan1, Sidra Khalid1, Bushra Shal1, Hina Rasheed1, Muhammad Zia Ullah1, Omer Shehzad2, Yeong Shik Kim3 and Salman Khan1,3*

Abstract Background: Poncirin is flavanone derivative (isolated from Poncirus trifoliata) with known pharmacological activities such as anti-tumor, anti-osteoporotic, anti-inflammatory and anti-colitic. The present study aimed to explore the anti-allodynic and anti-hyperalgesic potentials of poncirin in murine models of inflammatory pain. Methods: The analgesic potential of poncirin was evaluated in formalin-, acetic acid-, carrageenan- and Complete Freund’s Adjuvant (CFA)-induced inflammatory pain models in mice. Anti-allodynic and anti-hyperalgesic activities were measured using Von Frey filaments, Randall Selitto, hotplate and cold acetone tests. The serum nitrite levels were determined using Griess reagent. The Quantitative Real-time PCR (qRT-PCR) was performed to assess the effect of poncirin on mRNA expression levels of inflammatory cytokines and anti-oxidant enzymes. Results: Intraperitoneal administration of poncirin (30 mg/kg) markedly reduced the pain behavior in both acetic acid-induced visceral pain and formalin-induced tonic pain models used as preliminary screening tools. The poncirin (30 mg/kg) treatment considerably inhibited the mechanical hyperalgesia and allodynia as well as thermal hyperalgesia and cold allodynia. The qRT-PCR analysis showed noticeable inhibition of pro-inflammatory cytokines (mRNA expression levels of TNF-α, IL-1β and IL-6) (p < 0.05) in poncirin treated group. Similarly, poncirin treatment also enhanced the mRNA expressions levels of anti-oxidant enzymes such as transcription factor such as nuclear factor (erythroid-derived 2)-like 2 (Nrf2) (p < 0.05), heme oxygenase (HO-1) (p < 0.05) and superoxide dismutase (SOD2) (p < 0.05). Chronic treatment of poncirin for 6 days did not confer any significant hepatic and renal toxicity. Furthermore, poncirin treatment did not altered the motor coordination and muscle strength in CFA-induced chronic inflammatory pain model. Conclusion: The present study demonstrated that poncirin treatment significantly reduced pain behaviors in all experimental models of inflammatory pain, suggesting the promising analgesic potential of poncirin in inflammatory pain conditions. Keywords: Poncirin, Inflammatory pain, Cytokines, Hyperalgesia, Allodynia

* Correspondence: [email protected]; [email protected] 1Department of Pharmacy, Faculty of Biological Sciences, Quaid-i-Azam University, Islamabad, Pakistan 3College of Pharmacy, Seoul National University, Seoul 151-742, South Korea Full list of author information is available at the end of the article

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 2 of 16

Background in Chinese medicine for the treatment of asthma and in- Pain is the major protective response that is initiated by flammation [12]. Several studies reported that poncirin peripheral sensory neurons to protect the organism from exhibit anti-inflammatory [13], anti-tumor [14], anti- any harm by infection or tissue injury [1]. Pain helps the osteoporotic activity [15] and anti-colitic properties body to take corrective actions in the presence of any (Kang and Kim 2016). Therefore, in the present study noxious stimuli. However, the presence of pain is not various animal models of pain were carried out to assess always beneficial, in certain clinical scenarios; pain the anti-allodynic, anti-hyperalgesic and anti-nociceptive increases the suffering when there is a dysfunction in properties of poncirin as a potential new analgesic to nociceptive pathways for example in neuropathic pain treat different types of inflammatory pain. and abnormal central amplifications syndromes [1]. Inflammatory pain results whenever injury to the tissues Methods ensues, causing the release of inflammatory mediators, Chemicals and reagents which decreases pain threshold by increasing the Carrageenan, Complete Freund’s adjuvant (CFA), forma- transduction of painful stimuli [2]. These inflammatory lin, acetic acid, dexamethasone, Griess reagent, acetone, mediators including tumor necrosis factor-α (TNF-α), piroxicam, and poncirin were obtained from Sigma interleukin-1β (IL-1β) and IL-6, reduces pain threshold chemical company (St. Louis, MO, USA). Trizol reagent by directly sensitizing nociceptors and causing its in- was obtained from Invitrogen (USA). creased responsiveness leading to a state of hyperalgesia and allodynia [3, 4]. In addition to directly activating Ethics approval and consent to participate nociceptive fibers, these cytokines also potentiate the All procedures were complied with “Animal care guide- inflammatory responses and increase the release of lines of QAU” Islamabad. The study was also approved proalgesic agents including nerve growth factor (NGF), by Bioethical Committee (Approval No: BEC-FBS-QAU extracellular protons, bradykinin, and prostaglandins, 2017–2) of QAU University, Islamabad. All the experi- resulting in pain hypersensitivity [5]. These inflamma- ments were designed to cause minimum harm to tory mediators are also linked with an increased tran- animals. scription of various inflammatory genes through transcription factors including mitogen activated protein Animals kinases (MAPKs), cAMP response element-binding All experiments were performed on male albino (BALB/ protein (CREB) and Nuclear factor kappa B (NF-κB), c mice, 4–5 weeks of age, weighing 25–30 g), purchased which further aggravates the immune and pain re- from National Institute of Health (NIH), Islamabad, sponses by altering the neuronal threshold [5–7]. Pakistan. All behavioral assays were carried out in patho- Although, painful conditions either acute or chronic gen-free environment of laboratory of Pharmacology, De- inflammatory pain, constitute a major health prob- partment of Pharmacy, QAU, Islamabad, Pakistan. Seven lem. There is still need for safe and effective therapeutic animals were housed per cage in controlled temperature options. For example, non-steroidal anti-inflammatory and humidity, with free access to food and water. All ex- drugs (NSAIDs) are widely used for the management of periments were performed between 8:00 a.m. to 6:00 p.m. inflammatory pain conditions, are unable to completely During the current study, fresh/separate set of animals abolish pain and are associated with several serious ad- were procured for each model (acetic acid, formalin, carra- verse effects including gastrointestinal bleeding and geenan and CFA) and used once as per institutional ethical renal toxicity [8]. On the other hand, opioid analgesic guidelines. represents a potent class of analgesics are also associated with major adverse effects including physical and psy- Experimental groups and treatment protocols chological dependence, lethargy, euphoria, respiratory The animals were randomly arranged into various depression [8]. Current therapies available for treating groups and each group consists of 6–7 animals. The ve- acute and chronic inflammatory are inadequate and hicle control received only normal saline with 2% DMSO there is a need of newer and safer analgesics and anti-in- and no other treatment or inducer was given. The nega- flammatory drugs, that have better efficacy and tolerabil- tive control group received either acetic acid, formalin, ity [9, 10]. Carrageenan or CFA and no other treatment was admin- Medicinal plants have been used for centuries for pain istered. The positive control either received Piroxicam management, which can be used as a potential source (in case of formalin and acetic acid-induced models), for the development of novel analgesics for treating pain while dexamethasone was administered in case of the [11]. Poncirin is a flavanone derivative obtained from Carrageenan and CFA-induced inflammatory models. dried immature fruits of Poncirus trifoliata. Poncirus The treatment control received the poncirin at three dif- trifoliata belongs to genus Citrus, which have been used ferent doses such as 5 mg/kg, 15 mg/kg and 30 mg/kg in Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 3 of 16

case of formalin, acetic acid and Carrageenan-induced min prior to formalin induction. Control group was models, while only 30 mg/kg dose was administered to treated with vehicle (2% DMSO in 300 μl saline, i.p) and only CFA-induced models. The inclusion and exclusion positive control was treated with piroxicam (5 mg/kg), criteria was followed as reported previously [16]. The while treatment group received poncirin (5 mg/kg, 15 animals were anesthetized with the Xylazine + ketamine mg/kg or 30 mg/kg, i.p). injection (16 mg + 60 mg, i.p) to avoid distress to the mice (to make them unconscious and reduce the painful feeling associated with the euthanasia) and then CO2 Carrageenan-induced acute inflammatory pain model chamber was used to euthanize the mice. The The anti-inflammatory potential of the poncirin institutional ethical committee regulated the overall against the Carrageenan-induced inflammatory model process of euthanasia. Prior to the disposal, the animal was explored [24]. The animals were randomly death was confirmed by observing the movement, heart- divided into various groups as described above. The beat, respiration and eye reflex. Carrageenan-induced inflammation was established by injecting 1% carrageenan solution into the right hind Randomization, blinding and sample size selection paw as reported [24]. The animals were assigned to various groups randomly as reported previously [16]. Similarly, to avoid experi- Assessment of mechanical hyperalgesia in carrageenan- mental biasness double blindness was maintained during induced inflammatory pain the whole experiment as mentioned [16]. The sample The mechanical hyperalgesia test was performed by size (n =6–7) was selected according to the previously using Randall Selitto (Digital Paw Pressure Randall established protocols [16–19]. At the end of the experi- Selitto Meter, IITC Life Science Inc. Wood land Hills, ments the mice were euthanized using CO chamber. 2 CA) according to the method described previously [24–26]. Animals were pretreated with poncirin (30 Acetic acid-induced visceral pain model mg/kg) or vehicle (2% DMSO in 300 μl saline, i.p) or Acetic acid-induced writhing test was performed in mice dexamethasone (5 mg/kg) 1 h before the injection of as described previously [20]. The acetic acid-induced carrageenan (100 μg/paw). The anti-hyperalgesic pain model simulate the visceral pain model and initi- response of poncirin was recorded 4 h after the carra- ated by the release of inflammatory mediators, which geenan injection. trigger the sensitization of the sensitization of nociceptors [20, 21]. Briefly, acetic acid (0.8% v/v, 10 ml/kg) was injected into peritoneal cavity of the mice. Mice were Assessment of mechanical allodynia in carrageenan- then placed in large glass cylinder (10 cm diameter) and treated mice writhing response was measured i.e. number of writhes In order to evaluate the anti-allodynic effects of poncirin occurring between 0 and 30 min after acetic acid injec- in acute inflammatory pain model was noted 4 h after tion. Drugs were administered by i.p route 40 min prior carrageenan injection (100 μg /paw). One day before the to acetic acid induction, control group was treated with experiment, baseline withdrawal threshold was deter- μ vehicle (2% DMSO in 300 l saline, i.p), positive control mined for all animals. On the day of the experiment, was treated with piroxicam (5 mg/kg, i.p) and the animals were treated with poncirin (30 mg/kg) or treatment group received poncirin (5 mg/kg, 15 mg/kg vehicle (2% DMSO in 300 μl saline, i.p) or or 30 mg/kg, i.p). dexamethasone (5 mg/kg) 1 h before the injection of carrageenan. Mechanical allodynia was measured in Formalin-induced tonic pain model all the treated groups using previously described Paw licking was induced by intraplantar injection of for- protocol [27, 28]. malin as described previously with some modification [22]. Before the initiation of formalin-induction, the mice were transferred to the formalin testing boxes and Assessment of thermal hyperalgesia in carrageenan- observed for 30 min. Following the induction of the for- treated mice malin-induced nociception, animals were further Spontaneous nociception to heat stimuli was measured observed for 30 min and the total time taken was 60 min according to previously described methods [29]. Mice as reported previously with necessary modification [23]. were placed in quiet room 30 min before starting the test Mice were observed for first 10 min (early phase) and and were observed for the signs of the nociception from 10 to 30 min (late phase) and total time spent in including licking of the hind paws. The response latency licking the injected paw was calculated for both phases. was considered as nociceptive behavior with a cut off The mice were administered drugs through i.p. route 40 time of 35 s, in order to avoid any tissue damage. Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 4 of 16

Paw edema test in carrageenan-treated mice Assessment of cold allodynia in CFA-treated mice-cold Paw edema was measured in carrageenan-induced acetone test inflammatory pain model according to the methods Cold acetone test was carried out in mice model of previously described [26, 28]. Briefly, paw thickness was CFA-induced inflammatory pain as described previously measured by using a dial thickness gauge (No. 2046F, [31, 32]. One day before the experiment, baseline Mitutoyo, Kawasaki, Japan) one day before and after withdrawal threshold was determined for all animals. carrageenan (100 μg/paw) administration for all the Mice were placed in glass cylinders, and the noxious treated groups. cold stimulus was applied in form of brief spray of acetone to the ventral surface of the right hind paw. The nociceptive response, which included licking or biting, CFA-induced chronic inflammatory pain model was measured for 25 s as mentioned earlier [28]. For the evaluation of anti-hyperalgesic activity of poncirin in chronic inflammatory pain model, CFA-induced Muscle strength and motor activity pain model was employed [28, 30]. For the evaluation of The muscle strength of mice was determined by using the effect of poncirin on acute inflammation and pain, weights test and Kondziela’s inverted screen tests, in readings were taken at 2, 4 and 6 h post CFA injection. order to assess the effect of poncirin on motor activity While to investigate the effect of chronic treatment of of mice [33]. In Kondziela’s screen test, each mouse was poncirin on mechanical and thermal sensitivity, mice placed in the center of wire mesh screen and the screen were treated with poncirin once a day for the period of was inverted, which was held 40–50 cm above the pad- 6 days. However, the dose of poncirin was skipped at day ded surface. Time taken by mice to hold the inverted 5 in order to check any tolerance effects (to see whether screen was recorded using a digital stopwatch and score the effect of the drug remains persistent or it should be was assigned according to the protocol described else- administered daily to achieve the response) as described where [33]. Weight test was performed for measuring previously [28]. muscle strength according to the protocol described previously [33].

Assessment of mechanical hyperalgesia and allodynia Biochemical assays induced by CFA Serum nitrite determination To evaluate mechanical hyperalgesia induced by CFA, Griess reagents was used to determine the serum nitric mice were treated with poncirin (30 mg/kg), vehicle (2% oxide (NO) as reported previously [34, 35]. The blood DMSO in 300 μl saline, i.p) or dexamethasone (5 mg/kg) was centrifuged at 2500 rpm for 10 min following collec- by intra peritoneal route 40 min before the injection of tion of the blood directly from the cardiac puncture and CFA (20 μl/paw). One day before the experiment, NO was determined as described [34, 35]. baseline withdrawal threshold was determined for all animals. For the evaluation of acute effects of poncirin on Extraction of mRNA and q-RT-PCR pain profile, readings were taken at 2, 4 and 6 h post At day 6 of the CFA administration the animals were CFA injection. Mechanical hyperalgesia was measured anesthetized with Xylazine + ketamine (16 mg + 60 mg, by Randall Selitto (Digital Paw Pressure Randall Selitto i.p) to remove the paw tissue. Following removal of paw Meter, IITC Life Science Inc. Wood land Hills, CA), tissue, the animals were euthanized in the CO2 chamber while mechanical allodynia was measured using von Frey [36]. Mice paw were used for the extraction of total hair filament. RNA using Trizol Reagent according to manufacturer instructions (Invitrogen Life Technologies, Carlsbad, CA, USA) as described previously [28]. Briefly, q-RT- Assessment of thermal hyperalgesia induced by CFA PCRanalysisforvarioustargetgenes(TNF-α,IL-1β, Hotplate test was carried out in mice model of CFA IL-6, Nrf2, HO-1, SOD2, VEGF, β-actin) mRNA was induced inflammatory pain as described previously performed using Applied Biosystems (AB) detection [29]. One day before the experiment, baseline with- instruments and software as described previously [28]. drawal threshold was determined for all animals. The forward and revere primers used are listed in the Readings were taken at 2, 4 and 6 h post CFA injec- Table 1. tion in order to evaluate the effect of poncirin in the acute phase, while readings were taken for 6 consecu- Renal and liver toxicity tive days for the chronic study. The dose of the pon- Biochemical tests were performed using serum samples cirin was skipped at day 5 to assess the tolerance for assessment of RFTs and LFTs (Renal function tests effect as reported previously [28]. and liver function tests) at day 6 of the CFA Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 5 of 16

Table 1 the sequences of PCR primers Genes Forward primer Reverse prime β-actin TGAAGGTCGGTGTGAACGGATTTGGC CATGTAGGCCATGAGGTCCACCAC TNF-α GTTCTATGGCCCAGACCCTCA GGCACCACTAGTTGGTTGTCTTTG IL-1β TCC AGG ATG AGG ACA TGA GCAC GAA CGT CAC CCA GCA GGT TA IL-6 CCA CTT CAC AAG TCG GAG GCT TA CCA GTT TGG TAG CAT CCA TCA TTT C VEGF TTACTGCTGTACCTCCACC ACAGGACGGCTTGAAGATG Nrf2 TGG GGA ACC TGT GCT GAG TCA CTG GAG ACC CCT TGG ACA CGA CTC AGT GAC CTC HO-1 CACGCATATACCCGCTACCT CCAGAGTGTTCATTCGAGA SOD2 GCGGTCGTGTAAACCTCAT GGTGAGGGTGTCAGAGTGT administration. Serum Aspartate Aminotransferase administration considerably (p < 0.05) reduced the (AST), Alanine Aminotransferase (ALT) and creatinine number of abdominal writhing movements as compared concentration were determined as indicators of liver and to vehicle-treated group (Fig. 1). kidney functions respectively [37, 38]. Poncirin reduces formalin-induced paw licking in both Histopathological and X-ray examination of inflamed paws phases To observe the effect of daily treatment of poncirin on The anti-nociceptive effect of poncirin was also con- mice paw tissue, histopathological and radiological ana- firmed by using formalin test, which produces a biphasic lysis of the paw tissues were performed [21]. At day 6 of response, each phase represents distinct types of pain the CFA administration the animals were anesthetized [40]. The first phase, named as nociceptive phase, is a with Xylazine + ketamine (16 mg/kg + 60 mg/kg, i.p) and result of direct stimulation of nociceptors and is medi- were euthanized in the CO2 chamber as mentioned [21]. ated centrally, while the second phase is an inflamma- After removal, each paw was washed using saline and tory phase, caused by the local release of hyperalgesic then fixed in 10% formalin solution, dehydrated and and inflammatory mediators [40]. Formalin injection embedded in paraffin according to the methods de- produced biphasic paw licking response with the first scribed previously [21]. Paw tissue blocks sections were phase ranged from 0 to 10 min, while the second phase made of 4 μm thickness, stained with hematoxylin-eosin ranged from 10 to 30 min. Administration of poncirin and observed by microscopy (40×) as per reported 40 min prior to formalin-induction significantly reduced protocols [21]. Similarly, the X-ray analysis (Philips 612 the paw licking response dose dependently in both early machine 40 kW for 0.01 s) was performed as to assess phase (Fig. 2a) and late phase (Fig. 2b) respectively, how- the soft tissue swelling and bone erosion as described ever, the dose of 30 mg/kg showed maximum response previously [21]. (p < 0.05). The positive control treated with piroxicam (5 mg/kg) also showed the significant anti-nociceptive Statistical analysis effect in both phases. All results are expressed as mean ± SEM. The differences between the control and normal groups were tested by Poncirin inhibits carrageenan-induced mechanical and one-way analysis of variance (ANOVA) followed by thermal hyperalgesia Student’s t-test using SPSS (version 10.0, Chicago, IL). A The compound poncirin was tested in three different value of p < 0.05 was chosen as the criterion for statis- doses (5 mg/kg, 15 mg/kg or 30 mg/kg, i.p) in first two tical significance. The graphs were plotted using Sigma set of experiments and 30 mg/kg dose of poncirin pro- plot version 12.0, Chicago, USA. duced significant analgesic responses when compared with negative control groups, therefore, poncirin (30 Results mg/kg) was used in subsequent experiments. Next, the Poncirin inhibits abdominal constriction induced by anti-nociceptive effect of poncirin (30 mg/kg, i.p) was acetic acid assessed in carrageenan-induced acute inflammatory In the first set of experiments, the anti-nociceptive effect pain model. Poncirin noticeably inhibited (p < 0.05) car- of poncirin was assessed in acetic acid-induced visceral rageenan-induced mechanical (Fig. 3a) and thermal pain (Fig. 1), which has been employed widely for the (Fig. 3b) hyperalgesia at given dose after 4 h of carra- assessment of anti-inflammatory or analgesic properties geenan injection. In vehicle-treated group marked in- of new compounds [39]. Intraperitoneal administration crease in pain sensitivity was observed in mechanical of poncirin 40 min prior to the acetic acid (Fig. 3a) and thermal hyperalgesia (Fig. 3b). Whereas, Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 6 of 16

Fig. 1 Inhibition of abdominal writhing induced by acetic-acid as described in “Materials and methods”. The total numbers of writhing were evaluated over the period of 30 min. Each column represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group the dexamethasone used as positive control also inhib- significant reduction in allodynic responses compared, ited mechanical and thermal hyperalgesia (Fig. 3). however, the negative control group showed decreased in pain threshold and hypersensitivity to Poncirin inhibits carrageenan-induced mechanical the allodynic stimulus. Similarly, the poncirin admin- allodynia and paw edema istration markedly reversed the carrageenan-induced The poncirin treatment significantly inhibited carrageenan- paw swelling compared to the negative control group induced mechanical allodynia, while the maximum (treated with carrageenan only) (Fig. 3d). Further- increase in pain threshold (p < 0.05) was noticed with more, the positive control group also significantly escalated dose i.e. 30 mg/kg (Fig. 3c). The positive inhibited the carrageenan-induced paw edema in mice control (dexamethasone 5 mg/kg, i.p) also exhibited (Fig. 3d).

Fig. 2 Inhibition of formalin-induced paw licking and total time spent in paw licking was reduced by poncirin. The total time spent in paw licking was observed for 0–10 min (a) and 10–30 min (b) after formalin injection. Treatment with piroxicam (5 mg/kg, i.p) was used as a control. Each column represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 7 of 16

Fig. 3 Anti-hyperalgesic activities of poncirin in acute inflammatory pain model induced by carrageenan (a) inhibition of mechanical hyperalgesia, (b) inhibition of thermal hyperalgesia, (c) inhibition of mechanical allodynia and (d) reduction in paw thickness. Each column represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group

Poncirin inhibits CFA-induced mechanical hyperalgesia its effect) as described previously [28]. However, the pon- and allodynia cirin treatment did not exhibited any tolerance effect and Next, the modulatory effect of poncirin was evaluated in the mechanical hyperalgesia and allodynia was reestab- mechanical hyperalgesia and allodynia. In order to inves- lished when the dose was skipped at day 5 (Fig. 4c & d). tigate the effects of poncirin in CFA-induced mechanical hyperalgesia, animals were treated with poncirin (30 mg/ Inhibition of thermal hyperalgesia and cold allodynia by kg, i.p) 40 min prior to CFA injection. Poncirin signifi- poncirin in CFA-induced pain model cantly increased pain thresholds in both mechanical In order to investigate the effects of poncirin in CFA-in- hyperalgesia test and allodynia at 2, 4 and 6 h after CFA duced thermal hyperalgesia and cold allodynia, animals injection, showing the promising activity of poncirin in were treated with poncirin (30 mg/kg, i.p) 40 min prior to acute case. Dexamethasone also significantly increased CFA injection. Poncirin significantly inhibited acute the pain threshold as compared to negative control thermal hyperalgesia (Fig. 5a) at 2, 4 and 6 h after CFA in- (Fig. 4). jection, showing the promising activity of poncirin. Dexa- In order to investigate the chronic anti-inflammatory methasone treated group also significantly increased the and analgesic effects of poncirin on mechanical hyper- pain threshold as compared to negative control. For long- algesia and allodynia, animals were treated daily for 6 term effects of poncirin on thermal hyperalgesia, animals days skipping day 5 after CFA injection. Poncirin (30 were treated daily for 6 days after CFA injection, skipping mg/kg, i.p) daily treatment significantly increased pain day 5 for evaluation of tolerance effect (whether the anti- thresholds throughout treatment period compared with inflammatory effect of the poncirin remains persistent negative control (Fig. 4c and d) indicating the effective- while skipping the dose or it should be administered daily ness of poncirin in chronic inflammatory pain model. to produce its effect) of the drug on thermal hyperalgesia The dose of the poncirin was skipped at day 5 to observe as reported previously [28]. Poncirin (30 mg/kg, i.p) daily the tolerance effect (whether the anti-inflammatory ef- treatment significantly increased pain thresholds (Fig. 5b) fect of the poncirin remains persistent while skipping indicating the effectiveness of poncirin in chronic inflam- the dose or it should be administered daily to produce matory pain model. Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 8 of 16

Fig. 4 Anti-hyperalgesic activities of poncirin in chronic inflammatory pain model induced by CFA (a) inhibition of acute mechanical hyperalgesia, (b) inhibition of acute mechanical allodynia, (c) inhibition of chronic mechanical hyperalgesia and (d) inhibition of chronic mechanical allodynia. Each data point represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group

Similarly, poncirin significantly inhibited acute cold Poncirin doesn’t have any effect on the motor activity allodynia (Fig. 5c) at 4 and 6 h after CFA injection. For of mice long-term effects of poncirin on cold allodynia, animals Poncirin chronic administration does not effected the were treated daily for 6 days after CFA injection. Pon- motor function of the mice, which was evaluated by cirin (30 mg/kg, i.p) daily treatment significantly in- Weights test and Kondziela’s screen tests utilized as a creased pain thresholds on day 4 and 6 compared with screening tool in preliminary drug research for evalu- negative control, indicating the effectiveness of poncirin ation of motor function (Fig. 7a and b) [33, 41]. Motor in chronic inflammatory pain model (Fig. 5c). function was altered in the CFA-treated group while both poncirin and dexamethasone did not alter the Poncirin inhibited CFA-induced paw edema muscle strength both after acute and long-term adminis- Poncirin inhibited paw edema induced by CFA in both tration of drugs. acute and chronic inflammation models. Administration of poncirin significantly reduced the paw thickness at 2, Body weight assessment 4 and 6 h after CFA-induced acute edema (Fig. 6a). For Each group of mice were weighted before the disease the evaluation of long-term effects of poncirin in CFA- induction with CFA. Similarly, the weight of mice were induced paw edema, poncirin (30 mg/kg) treatment for also recorded at day 6 of the CFA administration at the 6 days showed significant inhibition of paw edema end of the experiment as shown (Additional file 1). compared to CFA treated group (Fig. 6b). Similarly, the positive control (dexamethasone 5 mg/kg) also signifi- Poncirin reduced the production of NO in plasma after cantly attenuated the acute paw edema 2, 4 and 6 h after CFA induction CFA administration, while the daily administration of The inhibitory effect of poncirin on NO production dexamethasone (5 mg/kg) for 6 days also markedly in plasma was analyzed on day 6 of the CFA adminis- attenuated the CFA-induced paw edema compared to tration using Griess reagent method as described the negative control (Fig. 6b). previously [28]. The CFA administration markedly Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 9 of 16

Fig. 5 Anti-nociceptive activities of poncirin in thermal hyperalgesia and cold allodynia induced by CFA (a) inhibition of acute thermal hyperalgesia, (b) inhibition of chronic thermal hyperalgesia and (c) inhibition of cold allodynia. Each data point represents the mean ± SEM of 6–7 mice per group. *p <0.05,**p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group increased the production of NO in mice plasma at Poncirin inhibits CFA-induced pro-inflammatory cytokines day6oftheadministration.Theponcirin(30mg/kg) production treatment significantly attenuated the NO (almost To examine the effect of poncirin (30 mg/kg) on the 80%) production compared to the negative control production of pro-inflammatory cytokines in CFA- (only CFA treated group) (Fig. 8). Similarly, the dexa- treated paw, qRT- PCR was performed. qRT-PCR results methasone-treated group also showed obvious showed increased expressions of TNF-α, IL-1β, IL-6 and decrease in NO production (approximately 83% VEGF mRNA in CFA-induced mice paw tissue (Fig. 9a, decrease was noted in NO production) (Fig. 8). b, c and d). Whereas, poncirin treatment strikingly

Fig. 6 Anti-inflammatory activities of poncirin in paw induced by CFA (a) inhibition of acute paw edema and (b) inhibition of chronic paw edema. Each data point represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 10 of 16

Fig. 7 (a) Effect of poncirin treatment on muscle strength and motor coordination of animals was measured by using inverted tray method at 0 h, 6 h and day 6 as described in materials and method section. (b) Effect of poncirin treatment on muscle coordination of animals was measured by using weight test at 0 h, 6 h, and day 6. Each column represents the means ± SEM of 6–7 mice per group. *p <0.05,**p <0.01and***p < 0.001 denote the significant differences from the negative control group inhibited the mRNA expression levels of pro-algesic and Poncirin treatment up-regulated Nrf2 (100% increase) inflammatory cytokines such as TNF-α,IL-1β, IL-6 and expression level considerably (Fig. 10a). VEGF (Fig. 9). Poncirin doesn’t cause hepatic or renal damage Poncirin increased the expression levels of Nrf2, HO-1, Mice were treated daily with poncirin (30 mg/kg, i.p) or and SOD2 in CFA-induced inflammatory pain model dexamethasone (5 mg/kg, i.p) or vehicle for 6 days after in- qRT-PCR was also used to investigate the effect of duction of inflammatory pain. The treatment with poncirin poncirin treatment on expression levels of the phase II and dexamethasone did not alter the hepatic and renal antioxidant enzymes (HO-1 and SOD2). Nrf2 activates functions (Table 2), thus signifies that poncirin administra- antioxidant response element (ARE) that in turns is tion did not produce any toxicity against these vital organs. responsible for the expression of phase II antioxidant enzymes [42]. The mRNA expression levels of SOD2 Poncirin inhibited infiltration of inflammatory cells and (approximately 79% increase was noticed) and HO-1 soft tissue swelling after CFA induction (more than 5 times) was increased in poncirin treated Histopathological analysis of tibiotarsal joints of right group as compared to CFA treated group (Fig. 10b and c). hind paw showed a significant infiltration of immune Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 11 of 16

Fig. 8 Effect of treatment with poncirin on nitrite (NO) production determination in blood plasma. Each column represents the means ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group cells and synovial hyperplasia in CFA treated group, with less side effects profile. Since decades, medicinal while poncirin treated group showed a reduction of im- plants have been used for therapeutic purposes, as they mune cells infiltration and synovial hyperplasia (Fig. 11b). are effective and safe and offer a good source of new The radiographic examination of the soft tissue showed chemical entity [44–47]. Poncirin is flavanone derivative marked reduction in soft tissue swelling of the right hind obtained from dried immature fruits of Poncirus trifoliata, paw in those animals who were treated with the pon- which was used to treat inflammation and asthma in an- cirin, however, the animals challenged with CFA only cient times [44–47]. Recent studies on poncirin have also showed noticeable soft tissue swelling and bony erosion confirmed its anticancer and anti-inflammatory activity (Fig. 11a). [14]. In the current study, it was demonstrated that systemic administration of poncirin in various inflammatory Discussion pain models successfully alleviated pain associated with in- Inflammatory pain is a common chief complaint associ- flammation. The anti-hyperalgesic effects of poncirin in ated with many disease conditions including irritable inflammatory pain can be attributed to suppression of bowel syndrome, rheumatoid arthritis and osteoarthritis pro-inflammatory cytokines including TNF-α,IL-1β and [2]. The inflammation mediated pain trigger the induc- IL-6, enhancing the expression of antioxidant genes and tion of pro-inflammatory cytokines and activates several enzymes (Nrf2, HO-1 and SOD2) respectively. Therefore, signaling pathways such as NF-κB, MAPKs etc. Cur- the present study highlights the analgesic potential of rently, several therapeutic approaches are employed to poncirin together with its safety since the systemic admin- treat the inflammatory pain such as NSAIDs and opioids istration of poncirin did not present any renal, hepatic or [43]. The chronic use of NSAIDs such as aspirin can motor side effects. cause the GIT ulceration, while the prolonged use of Acetic acid-induced abdominal writhing is a simple opioids is related with the development of tolerance, de- method for novel drugs screening in visceral pain [20]. pendence and respiratory depression [44–47]. All these Acetic acid administration causes the activation of challenges necessitate the development and discovery peritoneal macrophages and mast cells which leads to new molecules, which are safe, effective and associated local release cytokines such as TNF-α and IL-1β and Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 12 of 16

Fig. 9 (a) Effect of treatment with poncirin on mRNA expression levels of TNF-α,(b) IL-6, (c) IL-1β and (d) VEGF in mice paw tissue. The mice were treated with poncirin (30 mg/kg, i.p), dexamethasone (5 mg/kg, i.p) or vehicle control as described in “Materials and methods”. Each column represents the mean ± SEM of 6–7 mice per group. *p < 0.05, ** p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group

Fig. 10 (a) Effect of treatment with poncirin on protein expression of Nrf2, (b) HO-1 and (c) SOD2 in mice paw tissue. Each column represents the means ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 13 of 16

Table 2 Effect of poncirin on liver and kidney function fibers [50]. The late inflammatory phase of formalin test Sample Creatinine (mg/dL) GPT/ALT (UI/L) GOT/AST (UI/L) lasts from 10 to 30 min and occurs because of release of Normal 0.4 ± 0.28 94 ± 1.41 141 ± 2.82 inflammatory cytokines including TNF-α, IL-1β, IL-6 Dex 5 mg/kg 0.4 ± 0.22 94 ± 1.56 142 ± 1.25 and prostaglandins after administration of inflammatory stimuli like formalin [51]. Poncirin inhibited both paw Poncirin 30 mg/kg 0.4 ± 0.14 95 ± 2.12 144 ± 2.12 licking and total time spent in paw licking in both phases of formalin injection. Interestingly, poncirin ad- other mediators like eicosanoids and sympathomimetic ministration reduced the total spent in paw licking in amines [38]. Since poncirin administration inhibited the first phase as compared the positive control, showing acetic acid-induced writhing markedly, it is likely that its effect on the central pain pathways. The analgesic the anti-nociceptive activity of poncirin might be con- potential of poncirin was also demonstrated in carra- tributed due to its inhibitory activity cytokines produc- geenan- and CFA-induced acute and chronic inflammation. Similarly, the anti-nociceptive activity of poncirin tory pain models. Carrageenan and CFA are algogenic was also observed in formalin-induced tonic pain model. substances and cause the local release of mediators, such The injection of formalin causes an intense and immedi- as prostanoids and cytokines, involved in the inflamma- ate increase in impulses transmission from C afferent tory signs such as vasodilation, edema, and hyperalgesia fibers and produce a diverse quantifiable behavior as [52, 53]. Importantly, the systemic administration of paw licking by the animal that indicates the intensity of poncirin reduced both hyperalgesia and allodynia in both pain [48]. This test can also be used to determine the ef- carrageenan and CFA model with comparable results to fect of new compounds on central and peripheral noci- dexamethasone, which is a standard anti-inflammatory ceptive pathways as formalin injection causes biphasic drug, showing the anti-nociceptive potential of poncirin. reaction consisting of early neurogenic phase and late in- Carrageenan- and CFA-induced inflammatory pain are flammatory phase [49]. The early neurogenic phase of well-accepted models of acute and chronic pain respect- formalin injection last from 0 to 10 min and is caused by ively. The peripheral injection of algogenic substances the release of neurotransmitters such bradykinin and like carrageenan and CFA causes the release of numer- serotonin as well as molecules released from residents ous nociceptive and inflammatory mediators, resulting cells causing the activation of transient receptor poten- in the alteration of synaptic activity by increasing the tial ankyrin 1 (TRPA1) on the surface of nociceptive primary sensory fibers discharge and causing central

Fig. 11 Clinical appearance of right hind paws. (a) Radiographic evidence of right hind paw from (1) Vehicle control, (2) negative control group, (3) positive control group and (4) poncirin treated group. Tissue swelling can be observed in the tibiotarsal region of CFA treated mice as compared to poncirin treated mice. (b) Histopathological analysis of tibiotarsal joint from (1) vehicle control, (2) negative control group, (3) positive control treated group and (4) poncirin treated group. Paw tissues were sectioned at 4 μm thickness, stained by hematoxylin-eosin and observed with the microscope (40×). Note marked immune cell infiltration, synovial hyperplasia, in the vehicle-treated group as compared to poncirin treated group Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 14 of 16

pain sensitization by modifying neuroimmune cells [54]. COX-2 in early events of inflammation. HO-1 is one of In present study, systemic administration of flavanone the major anti-inflammatory and cytoprotective en- glycoside poncirin remarkably inhibited the mechanical, zymes, expression of which is controlled by Nrf2 [59]. thermal hyperalgesia and mechanical and cold allodynia The HO-1 expression is induced by many inflammatory induced by carrageenan and CFA in both acute and stimuli and increased inflammatory state was observed chronic inflammation models in mice. Poncirin in- in mice deficient with HO-1 emphasizing on the import- creased the pain threshold after 2 h of treatment and ant role of HO-1 in inflammation resolution and hence its effects persisted until 6 h in the acute model and decreasing hyperalgesic state [60]. In the current study, until day 5 in the chronic model. The paw edema in- systemic administration of poncirin has shown to signifi- duced by carrageenan and CFA was also significantly cantly increased the expression of Nrf2 and induction of reduced by poncirin. Because TNF-α,IL-1β and IL-6, HO-1, highlighting its importance in reducing the play a key role in inflammatory hyperalgesia, it may inflammatory pain through Nrf2 mediated pathway. be suggested that the anti-nociceptive effects of Poncirin treatment also up-regulated the expression of poncirin are due to its ability to inhibit the release of SOD2 (superoxide dismutase 2) following CFA-induced inflammatory cytokines [44]. inflammatory pain in mice. SOD2 is antioxidant enzyme NO is a well-established mediator of inflammation and belonging to SOD family and plays important role in its production is related to the degree of inflammation body defense as antioxidant enzyme by modulating the [55]. The expression of NO is under the influence of production of inflammatory cytokines [61]. SOD2 high iNOS gene, however, its production is also regulated by levels in the body inhibit the phospholipase-2 (PLA2) the TNF-α, thus maintain the hyperalgesic state after the overexpression and consequently inhibits the downstream inflammation and pain. The poncirin treatment signifi- PGE2 production via NF-κB-dependent pathways [62], cantly reduced the levels of NO compared to the CFA- thus, reduces the pain by reducing the inflammation. induced group. To assess the toxic effect of poncirin on liver and Inflammation is closely related to sensation of pain [5]. kidney, liver and kidney functions test were performed Following the local injection of CFA there is a release of using blood plasma. The poncirin treatment exhibits no various inflammatory mediators including TNF-α, IL-1β toxic effect on the liver and kidney. Similarly, to observe and IL-6. NO also contributes to the hyperalgesic state any possible toxic effect on the animals, muscle strength by indirectly sensitizing the nociceptors through the pro- and coordination was assessed. The poncirin treatment duction of prostanoids such as PGE2. In addition, these was not associated with any toxic effect on the muscle cytokines increase the synaptic transmission by directly strength and coordination. activating nociceptors [4]. In the present study, poncirin also significantly reduced the expression of TNF-α, IL- 1β and IL-6 in CFA induced inflammatory pain, suggest- Conclusion ing that suppression of these pro-inflammatory cytokines Poncirin significantly reduced abdominal writhing in contributes to the anti-nociceptive activity of poncirin. acetic acid-induced visceral pain and also showed Vascular endothelial growth factor (VEGF) induces vas- remarkable results in both phases of formalin test. In cular leakage by enhancing vascular permeability, thus addition, poncirin administration also significantly playing an important role in inflammation [56]. The produced anti-allodynic and anti-hyperalgesic effects in expression of inflammatory cytokines is, also induced by carrageenan- and CFA-induced models. Importantly, VEGF indicating the role of VEGF in the production of chronic treatment with poncirin in CFA model did not these hyperalgesic cytokines [56]. The poncirin treat- produce any side effects. Poncirin also reduced the NO ment significantly reduced the mRNA expression level content and pro-inflammatory cytokines expression in- of the VEGF compared to the negative control group, cluding TNF-α, IL-1β and IL-6 in paw tissue. The thus, indicating the potent anti-inflammatory role of the mRNA expression of VEGF was also inhibited by poncirin. poncirin, which correlates to reduction in paw edema Nrf2 is transcription factor responsible for the induc- and increased pain thresholds in CFA induced inflam- tion antioxidant enzymes including glutathione peroxid- matory pain models. Poncirin also significantly increased ase (GPx), Glutathione S transferase (GST) and HO-1 the antioxidant enzymes (HO-1 and SOD2) and tran- [42]. Nrf2 have multiple protective actions including scription factor (Nrf2), suggesting that protective role of antioxidant activity by induction of antioxidant enzymes, poncirin as well as multiple targets by which poncirin anti-inflammatory role in many diseases as well as pro- modulates pain. Collectively, our data demonstrate the tective action in wound healing [57, 58]. The protective analgesic potential of poncirin in acute and chronic anti-inflammatory role of Nrf2 is attributed to inhibition inflammatory pain conditions that still need an effective of expression of pro-inflammatory cytokines, iNOS and and safe therapeutic option. Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 15 of 16

Additional file 7. Matsumori A, Nunokawa Y, Sasayama S. Pimobendan inhibits the activation of transcription factor NF-κB: a mechanism which explains its inhibition of cytokine production and inducible nitric oxide synthase. Life Sci. Additional file 1: Figure S1. Body weight assessment. The weight of 2000;67:2513–9. animals at day 1 and day 7. (DOCX 59 kb) 8. Ahmad N, Subhan F, Islam NU, Shahid M, Rahman FU, Fawad K. A novel Pregabalin functionalized Salicylaldehyde derivative afforded prospective Abbreviations pain, inflammation, and pyrexia alleviating propensities. Arch Pharm. CFA: Complete Freund’s adjuvant; COX-2: Cyclooxygenase-2; CREB: cAMP 2017;350. response element-binding protein; Dex: Dexamethasone; HO-1: Heme 9. Brower V. New paths to pain relief. Nat Biotechnol. 2000;18:387. oxygenase; i.p.: intraperitoneal; i.pl: intraplantar; IκB: Inhibitory kappa B; 10. Pivatto M, Crotti AE, Lopes NP, Castro-Gamboa I, Rezende AD, Viegas C Jr, MAPKs: Mitogen activated protein kinase; NF-κB: Nuclear factor kappa B; MCM Y, Furlan M, Bolzani VS. Electrospray ionization mass spectrometry NO: Nitric oxide; Nrf2: Nuclear factor (erythroid-derived 2)-like 2; screening of piperidine alkaloids from Senna spectabilis (Fabaceae) extracts: SOD2: Superoxide dismutase fast identification of new constituents and co-metabolites. J Braz Chem Soc. 2005;16:1431–8. Acknowledgements 11. Calixto JB, Cabrini DA, Ferreira J, Campos MM. Kinins in pain and Not applicable. inflammation. Pain. 2000;87:1–5. 12. Manthey JA, Guthrie N, Grohmann K. Biological properties of citrus Authors’ contributions flavonoids pertaining to cancer and inflammation. Curr Med Chem. 2001;8: RA, AUK, HR, SK1, ZU dispensed and performed all the experiments including 135–53. behavioral assays and biochemical analysis. RA, SK1, OS and BS analyzed the 13. Lee JH, Lee SH, Kim YS, Jeong CS. Protective effects of neohesperidin and results. RA and SK1 drafted the manuscript. OS also provided various poncirin isolated from the fruits of Poncirus trifoliata on potential gastric chemicals and reagents. SK2 and YSK supervised and funded the project. disease. Phytother Res. 2009;23:1748–53. All authors read and approved the final manuscript. 14. Zhu X, Luo F, Zheng Y, Zhang J, Huang J, Sun C, Li X, Chen K. Characterization, purification of poncirin from edible citrus ougan Funding (Citrus reticulate cv. suavissima) and its growth inhibitory effect on human The Higher Education Commission (HEC) of Pakistan (under the SRGP gastric cancer cells SGC-7901. Int J Mol Sci. 2013;14:8684–97. funding No. 357SRGP/HEC/2014) supported the study only financially and 15. Yoon H-Y, Won Y-Y, Chung Y-S. Poncirin prevents bone loss in was not involved in the designing of the project. The authors are grateful to glucocorticoid-induced osteoporosis in vivo and in vitro. J Bone Miner the National Research Foundation of Korea (NRF), Seoul National University, Metab. 2012;30:509–16. grant funded by the Korean Government (MSIP) (No. 2009–0083533). The 16. Runtsch MC, Nelson MC, Lee S-H, Voth W, Alexander M, Hu R, Wallace J, Proff: Yeong Shik Kim (National Research Foundation of Korea (NRF), Seoul Petersen C, Panic V, Villanueva CJ. Anti-inflammatory microRNA-146a National University) was actively involved in the designing of the experiment protects mice from diet-induced metabolic disease. PLoS Genet. and analysis of the results. 2019;15:e1007970. 17. Charan J, Biswas T. How to calculate sample size for different study designs Availability of data and materials in medical research? Indian J Psychol Med. 2013;35:121. The data used in the current study can be accessed by requesting the 18. Charan J, Kantharia N. How to calculate sample size in animal studies? corresponding author. J Pharmacol Pharmacother. 2013;4:303. 19. Arifin WN, Zahiruddin WM. Sample size calculation in animal studies using Ethics approval and consent to participate resource equation approach. Malaysian J Med Sci: MJMS. 2017;24:101. All procedures were complied with “Animal care guidelines of QAU” 20. Verri WA, Cunha TM, Magro DA, Domingues AC, Vieira SM, Souza GR, Liew Islamabad. The study was also approved by Bioethical Committee (Approval FY, Ferreira SH, Cunha FQ. Role of IL-18 in overt pain-like behaviour in mice. No: BEC-FBS-QAU 2017–2) of QAU University, Islamabad. All the experiments Eur J Pharmacol. 2008;588:207–12. were designed to cause minimum harm to animals. 21. Khan A, Ullah MZ, Afridi R, Rasheed H, Khalid S, Ullah H, Ali H, AlSharari SD, Kim YS, Khan S. Antinociceptive properties of 25-methoxy hispidol a, a Consent for publication triterpinoid isolated from Poncirus trifoliata (Rutaceae) through inhibition of Not applicable. NF-κB signalling in mice. Phytother Res. 2019;33:327–41. 22. Gong N, Huang Q, Chen Y, Xu M, Ma S, Wang Y-X. Pain assessment using Competing interests the rat and mouse formalin tests. Bio-protocol. 2014;4:e1288. The authors declare that they have no competing interests. 23. Erami E, Azhdari-Zarmehri H, Imoto K, Furue H. Characterization of nociceptive behaviors induced by formalin in the glabrous and hairy skin of Author details rats. Basic Clin Neurosci. 2017;8:37. 1Department of Pharmacy, Faculty of Biological Sciences, Quaid-i-Azam 24. Radhakrishnan R, Moore SA, Sluka KA. Unilateral carrageenan injection into University, Islamabad, Pakistan. 2Department of Pharmacy, Abdul Wali Khan muscle or joint induces chronic bilateral hyperalgesia in rats. Pain. University, Mardan, Pakistan. 3College of Pharmacy, Seoul National University, 2003;104:567–77. Seoul 151-742, South Korea. 25. Khan S, Shehzad O, Jin H-G, Woo E-R, Kang SS, Baek SW, Kim J, Kim YS. Anti- inflammatory mechanism of 15, 16-epoxy-3α-hydroxylabda-8, 13 (16), 14- Received: 29 May 2018 Accepted: 30 August 2019 trien-7-one via inhibition of LPS-induced multicellular signaling pathways. J Nat Prod. 2012;75:67–71. 26. Oliveira MG, Marques RB, Santana MF, Santos AB, Brito FA, Barreto EO, Sousa References DP, Almeida FR, Badauê-Passos D, Antoniolli ÂR. α-Terpineol reduces 1. Milligan ED, Watkins LR. Pathological and protective roles of glia in chronic mechanical hypernociception and inflammatory response. Basic Clin pain. Nat Rev Neurosci. 2009;10:23. Pharmacol Toxicol. 2012;111:120–5. 2. Scholz J, Woolf CJ. Can we conquer pain? Nat Neurosci. 2002;5:1062–7. 27. ChoH,YangYD,LeeJ,LeeB,KimT,JangY,BackSK,NaHS,Harfe 3. Julius D, Basbaum AI. Molecular mechanisms of nociception. Nature. BD, Wang F. The calcium-activated chloride channel anoctamin 2001;413:203–10. 1 acts as a heat sensor in nociceptive neurons. Nat Neurosci. 4. Sandkühler J. Models and mechanisms of hyperalgesia and allodynia. 2012;15:1015–21. Physiol Rev. 2009;89:707–58. 28. Khan S, Shehzad O, Chun J, Kim YS. Mechanism underlying anti- 5. Basbaum AI, Bautista DM, Scherrer G, Julius D. Cellular and molecular hyperalgesic and anti-allodynic properties of anomalin in both acute mechanisms of pain. Cell. 2009;139:267–84. and chronic inflammatory pain models in mice through inhibition of 6. Ji R-R, Gereau RW, Malcangio M, Strichartz GR. MAP kinase and pain. Brain NF-κB, MAPKs and CREB signaling cascades. Eur J Pharmacol. Res Rev. 2009;60:135–48. 2013;718:448–58. Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 Page 16 of 16

29. Zeeshan S, Naveed M, Khan A, Atiq A, Arif M, Ahmed MN, Kim YS, Khan S. deficiency reduces overt pain-like behaviors in mice. Braz J Med Biol Res. N-Pyrazoloyl and N-thiopheneacetyl hydrazone of isatin exhibited potent 2013;46:601–6. anti-inflammatory and anti-nociceptive properties through suppression of 52. Fehrenbacher JC, Vasko MR, Duarte DB. Models of Inflammation: NF-κB, MAPK and oxidative stress signaling in animal models of Carrageenan-or Complete Freund's Adjuvant (CFA)–Induced Edema and inflammation. Inflamm Res. 2019;68:613–32. Hypersensitivity in the Rat. Current Protocols Pharmacol. 2012:5.4. 1–5.4. 4. 30. Khan S, Shehzad O, Chun J, Choi RJ, Park S, Islam MN, Choi JS, Kim YS. Anti- 53. Woolf C, Allchorne A, Safieh-Garabedian B, Poole S. Cytokines, nerve growth hyperalgesic and anti-allodynic activities of capillarisin via suppression of factor and inflammatory hyperalgesia: the contribution of tumour necrosis inflammatory signaling in animal model. J Ethnopharmacol. 2014;152:478–86. factor α. Br J Pharmacol. 1997;121:417–24. 31. DSM d C, Meotti FC, Andrade EL, Leal PC, Motta EM, Calixto JB. The 54. Li M, Shi J, CHEN D, Ai B, Chen J. Effects of complete Freund's adjuvant on involvement of the transient receptor potential A1 (TRPA1) in the immunohistochemical distribution of IL-1β and IL-1R I in neurons and glia maintenance of mechanical and cold hyperalgesia in persistent cells of dorsal root ganglion. Acta Pharmacol Sin. 2005;26:192–8. inflammation. PAIN®. 2010;148:431–7. 55. Voscopoulos C, Lema M. When does acute pain become chronic? 32. Dhaka A, Murray AN, Mathur J, Earley TJ, Petrus MJ, Patapoutian A. TRPM8 is Br J Anaesth. 2010;105:i69–85. required for cold sensation in mice. Neuron. 2007;54:371–8. 56. Autiero M, Luttun A, Tjwa M, Carmeliet P. Placental growth factor and its 33. Deacon RM. Measuring the strength of mice. JoVE: Journal of visualized receptor, vascular endothelial growth factor receptor-1: novel targets for experiments; 2013. stimulation of ischemic tissue revascularization and inhibition of angiogenic 34. Khan S, Shin EM, Choi RJ, Jung YH, Kim J, Tosun A, Kim YS. Suppression of and inflammatory disorders. J Thromb Haemost. 2003;1:1356–70. LPS-induced inflammatory and NF-κB responses by anomalin in RAW 264.7 57. Kim J, Cha Y-N, Surh Y-J. A protective role of nuclear factor-erythroid macrophages. J Cell Biochem. 2011;112:2179–88. 2-related factor-2 (Nrf2) in inflammatory disorders. Mutation Res/Fundam 35. Khan A, Khan S, Ali H, Shah KU, Ali H, Shehzad O, Onder A, Kim YS. Mole Mechanisms Mutagenesis. 2010;690:12–23. Anomalin attenuates LPS-induced acute lungs injury through inhibition of 58. Nguyen T, Nioi P, Pickett CB. The Nrf2-antioxidant response element AP-1 signaling. Int Immunopharmacol. 2019;73:451–60. signaling pathway and its activation by oxidative stress. J Biol Chem. 36. Parasuraman S, Raveendran R, Kesavan R. Blood sample collection in small 2009;284:13291–5. laboratory animals. J Pharmacol Pharmacother. 2010;1:87. 59. Alam J, Stewart D, Touchard C, Boinapally S, Choi AM, Cook JL. Nrf2, a 37. Fracasso M, Leone R, Cuzzolin L, Del Soldato P, Velo G, Benoni G. Cap’n’Collar transcription factor, regulates induction of the heme – Indomethacin induced hepatic alterations in mono-oxygenase system and oxygenase-1 gene. J Biol Chem. 1999;274:26071 8. faecal Clostridium perfringens enterotoxin in the rat. Inflamm Res. 60. Kapturczak MH, Wasserfall C, Brusko T, Campbell-Thompson M, Ellis TM, 1990;31:313–6. Atkinson MA, Agarwal A. Heme oxygenase-1 modulates early inflammatory 38. Ribeiro RA, Vale ML, Thomazzi SM, Paschoalato AB, Poole S, Ferreira SH, responses: evidence from the heme oxygenase-1-deficient mouse. – Cunha FQ. Involvement of resident macrophages and mast cells in the Am J Pathol. 2004;165:1045 53. writhing nociceptive response induced by zymosan and acetic acid in mice. 61. White CW, Avraham KB, Shanley PF, Groner Y. Transgenic mice with Eur J Pharmacol. 2000;387:111–8. expression of elevated levels of copper-zinc superoxide dismutase in the 39. Collier H, Dinneen L, JOHNSON CA, Schneider C. The abdominal lungs are resistant to pulmonary oxygen toxicity. J Clin Investig. constriction response and its suppression by analgesic drugs in the mouse. 1991;87:2162. – Br J Pharmacol. 1968;32:295–310. 62. Fakhrzadeh L, Laskin JD, Gardner CR, Laskin DL. Superoxide dismutase 40. Hunskaar S, Hole K. The formalin test in mice: dissociation between overexpressing mice are resistant to ozone-induced tissue injury and α inflammatory and non-inflammatory pain. Pain. 1987;30:103–14. increases in nitric oxide and tumor necrosis factor- . Am J Respir Cell Mol – 41. Golli NE, Dallagi Y, Rahali D, Rejeb I, Fazaa SE. Neurobehavioral assessment Biol. 2004;30:280 7. following e-cigarette refill liquid exposure in adult rats. Toxicol Mech Methods. 2016;26:425–32. Publisher’sNote 42. Alam J, Killeen E, Gong P, Naquin R, Hu B, Stewart D, Ingelfinger JR, Nath Springer Nature remains neutral with regard to jurisdictional claims in KA. Heme activates the heme oxygenase-1 gene in renal epithelial cells by published maps and institutional affiliations. stabilizing Nrf2. Am J Physiol-Renal Physiol. 2003;284:F743–52. 43. Ribeiro-Rama AC, Figueiredo IV, Veiga FJ, Castel-Branco MM, Cabrita AMS, Caramona MM. Hepatic and renal toxicities of indomethacin acid, salt form and complexed forms with hydroxypropyl-β-cyclodextrin on Wistar rats after oral administration. Fundam Clin Pharmacol. 2011;25:599–607. 44. Kim J-B, Han A-R, Park E-Y, Kim J-Y, Cho W, Lee J, Seo E-K, Lee K-T. Inhibition of LPS-induced iNOS, COX-2 and cytokines expression by poncirin through the NF- κB inactivation in RAW 264.7 macrophage cells. Biol Pharm Bull. 2007;30:2345–51. 45. Kang S-M, Kim K-N, Lee S-H, Ahn G, Cha S-H, Kim A-D, Yang X-D, Kang M-C, Jeon Y-J. Anti-inflammatory activity of polysaccharide purified from AMG- assistant extract of Ecklonia cava in LPS-stimulated RAW 264.7 macrophages. Carbohydr Polym. 2011;85:80–5. 46. Roh GS, Seo S-W, Yeo S, Lee JM, Choi J-W, Kim E, Shin Y, Cho C, Bae H, Jung S-K. Efficacy of a traditional Korean medicine, Chung-sang-Bo-ha-tang, in a murine model of chronic asthma. Int Immunopharmacol. 2005;5:427–36. 47. Seyedrezazadeh E, Sabri A, Barzegari A, Kolahian S, Shahbazfar A-A, Ansarin K, Vafa M, Sakhinia E. Dietary flavanones and citrus fruits influence cytokines and thyroid transcription factor-1 in an HDM-induced chronic asthma murine model. J Funct Foods. 2016;26:709–18. 48. Heapy C. Afferent C-fibre and A-delta activity in models of inflammation. Br J Pharmacol. 1987;90:164. 49. Malmberg AB, Yaksh TL. Antinociceptive actions of spinal nonsteroidal anti- inflammatory agents on the formalin test in the rat. J Pharmacol Exp Ther. 1992;263:136–46. 50. McNamara CR, Mandel-Brehm J, Bautista DM, Siemens J, Deranian KL, Zhao M, Hayward NJ, Chong JA, Julius D, Moran MM. TRPA1 mediates formalin- induced pain. Proc Natl Acad Sci. 2007;104:13525–30. 51. Magro D, Hohmann M, Mizokami S, Cunha T, Alves-Filho J, Casagrande R, Ferreira S, Liew F, Cunha F, Verri W Jr. An interleukin-33/ST2 signaling