Accepted Manuscript

Fibrogenic Activity of MECP2 is Regulated by Phosphorylation in Hepatic Stellate Cells

Eva Moran-Salvador, Marina Garcia-Macia, Ashwin Sivaharan, Laura Sabater, Marco Y.W. Zaki, Fiona Oakley, Amber Knox, Agata Page, Saimir Luli, Jelena Mann, Derek A. Mann

PII: S0016-5085(19)41126-8 DOI: https://doi.org/10.1053/j.gastro.2019.07.029 Reference: YGAST 62784

To appear in: Gastroenterology Accepted Date: 17 July 2019

Please cite this article as: Moran-Salvador E, Garcia-Macia M, Sivaharan A, Sabater L, Zaki MYW, Oakley F, Knox A, Page A, Luli S, Mann J, Mann DA, Fibrogenic Activity of MECP2 is Regulated by Phosphorylation in Hepatic Stellate Cells, Gastroenterology (2019), doi: https://doi.org/10.1053/ j.gastro.2019.07.029.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Fibrogenic Activity of MECP2 is Regulated by Phosphorylation in Hepatic Stellate Cells ACCEPTED MANUSCRIPT

Short title : Mecp2 controls myofibroblast transcriptome

Eva Moran-Salvador ###, Marina Garcia-Macia ###, Ashwin Sivaharan ###, Laura Sabater, Marco Y.W. Zaki, Fiona Oakley, Amber Knox, Agata Page, Saimir Luli, Jelena Mann* and Derek A Mann*.

Newcastle Fibrosis Research Group, Institute of Cellular Medicine, Faculty of Medical Sciences, Newcastle University,

Newcastle upon Tyne, UK.

# these authors contributed equally to the manuscript

*joint senior authors

Financial support: DM, FO and JM are funded by the UK Medical Research Council (Grants MR/K10019494/1,

MK/K001949/1 and MR/R023026/1). National Institute on Alcohol Abuse and Alcoholism (NIAAA) (grant

UO1AA018663). The work was also supported in part by GSK contribution of funding to the study to DAM and JM

(CRAFT consortium). The research was further supported by the National Institute for Health Research Newcastle Biomedical Research Centre based at Newcastle Hospitals NHSMANUSCRIPT Foundation Trust and Newcastle University.

Abbreviations : ACAN, aggrecan; ACTA2, smooth muscle aortic alpha-actin; aHSC, activated hepatic stellate cells;

ALT, alanine aminotransferase; ASH1, histone-lysine n-methyltransferase; AST, aspartate aminotransferase; BrdU, bromodeoxyuridine; BRIP1, BRCA1-interacting protein 1; CNC, coding-non-coding gene coexpression; CCl 4, carbon tetrachloride; CCNA2, cyclin A2; Cdc7, cell division cycle 7-related protein kinase; Cdk15, cyclin dependent kinase 15;

COL1A1, type IA1 Collagen; CREB, cAMP response element binding; CXCL2, chemokine ligand-2; Des, desmin;

DNA2, DNA replication ATP-dependent helicase/nuclease; DUSP5, dual specificity phosphatase 5; ECM, extracellular matrix; Eme1, Essential Meiotic Structure-Specific Endonuclease 1; EZH2, enhancer of zeste homolog 2; PDGF-BB, Platelet-Derived Growth FactorACCEPTED BB; HA, hyaluronic acid; Has1, 2, 3, hyaluronan synthase 1, 2, 3; HDAC6, histone Deacetylase 6; HDAC/Sin3A, histone deacetylase/ paired amphipathic helix protein; HIPK2, homeodomain-interacting protein kinase 2; HSC, hepatic stellate cells; H&E, Haematoxylin and Eosin; IGV, Integrative Genomics Viewer; IL1, 6,

Interleukin 1, 6; KEGG, Kyoto Encyclopedia of Genes and Genomes; KC, kupffer cells; linRNAs, long intergenic noncoding RNAs; lncRNA, long non-coding RNA; MCM2-6, maintenance protein complex 2-6; Mecp2, methyl-CpG binding protein 2; mHSC, mouse hepatic stellate cells; MMP2, 9, 13, matrix metalloproteinases 2, 9, 13; MTT, 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Myl7, myosin light chain 7; ORC, origin recognition complex;

1 OSTN, osteocrin; PCNA, proliferating cell nuclear antigen; PTCH1, hedgehog receptor Patched 1; POLD1, ACCEPTED MANUSCRIPT polymerase delta 1; PPAR γ, peroxisome proliferator-activated receptor gamma; RASAL1, RAS GTPase activating-like protein 1; RPA2, replication protein A2; rHSC, rat hepatic stellate cells; RNAseq, RNA sequencing; Sepp1,

Selenoprotein P; SFRP4, secreted frizzled-related protein 4; siRNA, small interfering RNA; αSMA, alpha smooth muscle actin; TGF-β1, transforming growth factor beta1; TIMP-1, tissue inhibitor of metalloproteinase-1; TNF-α, tumor necrosis factor alpha; TNXB, tenascin XB; TSC1/2, tuberous sclerosis proteins 1/2.

Contact information: *Joint senior authors. Corresponding author: Jelena Mann, Institute of Cellular Medicine,

Faculty of Medical Sciences, 4th Floor, William Leech Building, Newcastle University, Framlington Place, Newcastle upon Tyne, NE2 4HH, UK. Tel +44 191 208 3851. E-mail [email protected]

Disclosure: Authors report no conflict of interest

Author Contributions . EMS, AP, FO, AK and MGM performed experiments, analyzed the data and performed statistical analysis; AS, LS and MZ performed bioinformatic analysis; SL performed histological measurements and digital quantification; JM and DAM designed the study design and contributed to data analysis, supervised the project and wrote the paper.

Acknowledgments : We are very grateful to Professor Qian Chang,MANUSCRIPT UW, Madison, USA, for the kind gift of Mecp2 S80A mice. We gratefully acknowledge Graham Smith of the Bioinformatics Support Unit for assistance with bioinformatics analysis.

ACCEPTED

2 Abstract ACCEPTED MANUSCRIPT

Background & Aims: Methyl-CpG binding protein 2 (MECP2), which binds to methylated regions of DNA to regulate transcription, is expressed by hepatic stellate cells (HSCs) and is required for development of liver fibrosis in mice. We investigated the effects of MECP2 deletion from HSCs on their transcriptome and of phosphorylation of MECP2 on HSC phenotype and liver fibrosis.

Methods: We isolated HSCs from Mecp2 -/y mice and wild-type (control) mice. HSCs were activated in culture and used in array analyses of mRNAs and long non-coding RNAs. KEGG pathway analyses identified pathways regulated by MECP2. We studied mice that expressed a mutated form of Mecp2 that encodes the S80A substitution (MECP2S80), causing loss of MECP2

phosphorylation at serine 80. Liver fibrosis was induced in these mice by administration of CCl 4, and liver tissues and HSCs were collected and analyzed.

Results: MECP2 deletion altered expression of 284 mRNAs and 244 long non-coding RNAs, including those that regulate DNA replication, are members of the minichromosome maintenance protein complex family, or encode CDC7, HAS2, DNA2 (a DNA helicase), or RPA2 (a protein that binds single-strand DNA). We found MECP2 to regulate the DNA repair Fanconi anemia pathway in HSCs. Phosphorylation of MECP2S80 and its putative kinase, HAS2, were induced during transdifferentiation of HSCs. HSCs from MECP2S80 MANUSCRIPT mice had reduced proliferation and livers from these mice had reduced fibrosis following CCl 4 administration.

Conclusions: In studies of mice with disruption of Mecp2 or that expressed a form of MECP2 that is not phosphorylated at S80, we found phosphorylation of MECP2 to be required for HSC proliferation and induction of fibrosis. In HSCs, MECP2 regulates expression of genes required for DNA replication and repair. Strategies to inhibit MECP2 phosphorylation at S80 might be developed for treatment of liver fibrosis. Keywords: MCM, lncRNA, myofibroblast, epigenetic factor

ACCEPTED

3

ACCEPTED MANUSCRIPT Introduction

In the context of a self-limiting injury and acute inflammation, fibrogenesis is an important contributor to the wound repair and regeneration. The purpose of fibrogenesis is to form a temporary extracellular matrix (ECM)-rich barrier known as granulation tissue, which serves to maintain tissue integrity and prevent infection. Once inflammation subsides and effective regenerative processes are underway, fibrogenesis subsides and gives way to fibrolysis leading to the natural breakdown of temporary granulation tissue and its replacement with repaired epithelial and endothelial structures. Where an injury and/or inflammation persists or if regeneration is impaired, such as in the ageing organ, then fibrogenesis fails to subside and instead promotes then net deposition and maturation of fibril-forming collagen-rich ECM. In time, if unabated, non- resolving fibrogenesis leads to the formation of highly cross-linked mature scar tissue that distorts and perturbs normal organ architecture and function. Liver fibrosis is a common pathological process associated with the majority of chronic liver diseases and in the absence of an effective treatment for the underlying cause of liver damage willMANUSCRIPT often progress to end stage cirrhosis and/or hepatocellular carcinoma 1, 2. The relatively recent discovery that fibrogenesis is highly dynamic,

with the potential to both regress as well as progress, was an important conceptual milestone, as

was the clinical observation made across multiple types of liver disease that fibrosis can

spontaneously regress upon effective therapeutic removal of the causative agent. These

discoveries have stimulated new investigations into the molecular mechanisms of fibrogenesis and

have encouraged the pharmaceutical industry that fibrosis is an attractive and tractable

therapeutic target in chronic liver diseases.

A further conceptual ACCEPTEDmilestone was the experimental demonstration that, irrespective of cause of

liver injury, myofibroblasts are the central cellular drivers of collagen deposition 1, 3. Liver

myofibroblasts are rare in uninjured liver, but in response to damage and inflammation are

generated chiefly from resident cells of mesenchymal-lineage; the major sources being the hepatic

stellate cell (HSC) and periportal fibroblasts 4. Upon hepatocellular damage, peri sinusoidal HSCs

4 are triggered to undergo a complex phenotypic conversion (or transdifferentiation) into α-SMA+, ACCEPTED MANUSCRIPT collagen-secreting myofibroblasts 1-4. Where injury resolves HSC-derived myofibroblasts are either

removed from the tissue by apoptosis or may undergo a partial reversion of phenotype to return to

a non-collagen expressing state 5 . Experimental in vivo studies strongly support the concept that myofibroblasts are required for fibrogenesis to take place and that their subsequent removal is necessary for cessation of fibrogenesis and a mechanistic switch to fibrolysis. Further, while HSC are normally quiescent, upon transdifferentiation they enter the cell cycle and in response to paracrine and autocrine mitogens (e.g. PDGF-BB) adopt a highly proliferative and migratory state that serves to amplify and spread the fibrogenic reaction 4. Hence, the complex events that enable

HSC transdifferentiation and the mechanisms by which the cell adopts its proliferative and profibrogenic behaviours are of major interest towards the goal of therapeutic targeting of liver fibrosis.

We have previously proposed that HSC transdifferentiation is under tight epigenetic control and identified the prototypic methyl-DNA binding protei MANUSCRIPTn Mecp2 as being essential for experimental liver fibrosis 6. Subsequently, a similar role for Mecp2 has been described in the bleomycin model of lung fibrosis and in the development of interstitial fibrosis in a mouse model of myocardial infarction, while other reports have confirmed profibrogenic functions for Mecp2 in myofibroblasts from multiple tissue origins 7-9. In our earlier studies, we focused on Mecp2 as a key transcriptional

repressor of the nuclear hormone receptor PPAR-γ, downregulation of PPAR-γ being a necessary event for the HSC to adopt a fully transdifferenced myofibroblast state 6. Other proposed targets of

Mecp2 relevant to its role in fibrosis include the tuberous sclerosis proteins TSC1 and TSC2 that

regulate fibroblast differentiationACCEPTED and proliferation, the hedgehog receptor Patched 1 (PTCH1),

HDAC6, DUSP5, the Wnt pathway regulator SFRP4, TGF-β1-induced α-SMA and the RAS

GTPase activating-like protein 1 (RASAL1). In the present study we have used bulk transcriptome

profiling to determine that Mecp2 exerts broad influence over the coding and non-coding

transcriptional landscapes of the HSC-derived myofibroblast and is required for the expression of

5 transcripts that control DNA integrity and replication. Given the importance of these observations, ACCEPTED MANUSCRIPT we also identified a site-specific phosphorylation event on the Mecp2 protein that is required for its stimulation of HSC proliferation and which upon mutation reduces the level of toxin-induced liver fibrosis when compared with wild type mice. This work therefore expands our understanding of the mechanisms by which Mecp2 regulates myofibroblast behaviour and reveals a regulated translational modification of the protein that may be targeted for anti-fibrotic purposes.

Materials and methods

Ethics - Authors hold appropriate licenses for animal experiments, which were issued/approved by local ethical committee and UK Home Office.

Animals strains and experimental in vivo liver fibrosis models- Wild-type (Wt, strain C57Bl/6) and Mecp2 -/y mice (strain B6.129P2(C)-Mecp2tm1.1Bird/J) were obtained from Jax labs.

Mecp2 S80A mice were a kind gift from Prof Qiang Chang, UW, Madison, USA 10 . Acetaminophen

S80A (paracetamol) acute injury - 8 week-old male Mecp2 MANUSCRIPT and Wt littermate mice were injected intraperitoneally with N-acetyl-ρ-aminophen (APAP) at 500mg/kg body weight. APAP (Sigma) was

dissolved in 0.6 ml of warm (37°C) sterile phosphat e buffered saline prior to injection. Animals

were sacrificed at 4 hours after APAP administration, after which serum and liver tissue were

S80A collected. Acute CCl 4 model - 8–10 week-old male Mecp2 and Wt littermate mice were

intraperitoneally injected with a single dose of CCl 4/olive oil mixture in a 1:1 [vol/vol] ratio at 2l per gram of body weight. Tissues were harvested at 24, 48 and 72h post-CCl 4 injection. At least 4

animals were used per treatment group. Chronic CCl 4 model - mice were IP injected twice-weekly ACCEPTED for 4 weeks with a mixture of CCl 4/olive oil in a 3:1 [vol/vol] at 2l per gram of body weight. Tissues were harvested at 24h after the final CCl 4 injection.

Cell Isolation and Culture - Mouse hepatic stellate cells (mHSC) from C57Bl6 Wt, Mecp2 -/y or

Mecp2 S80A livers were isolated using sequential pronase/collagenase digestion followed by

6 density-gradient centrifugation with Nycodenz (11% over 16,5%) as described in 6. Two to five ACCEPTED MANUSCRIPT livers were pooled for each HSC isolation and considered as n=1. Purity of mHSC preparations

was assessed by autofluorescence 1 day after isolation and was found to be >97%. Isolation of

hepatocytes and Kupffer cells was performed as previously described in 11 . Hepatocytes were

cultured in William’s medium E (Sigma) supplemented with 10% fetal bovine serum. Mouse HSCs

and KC were cultured on plastic in Dulbecco’s modified Eagle’s medium, supplemented with 100

units/mL penicillin, 100 lg/mL streptomycin, 2 mM L-glutamine, and 16% fetal calf serum. Cell

cultures were maintained at 37 °C at an atmosphere of 5% CO 2. Freshly isolated HSCs (day 0)

were considered quiescent and were cultured in plastic dishes to transdifferentiate into activated

HSC (day 7 onwards).

Small interfering RNA (siRNA) transfection; HA quantification - Mouse Wt HSCs prepared

from 3 separate isolations; primary mHSC (1x10 6/well) were seeded in 6-well plates and

transfected at day 5 with siRNA using INTERFERin siRNA Transfection Reagent (Polyplus transfection SA). The siRNAs used were Stealth smallMANUSCRIPT interfering RNA (siRNA) targeting Has2 mRNA or Stealth Negative Control Duplex siRNA (Invitrogen). The final concentration of siRNA

was 50nM. The cells were allowed to grow for 72 hours post-transfection, then harvested and RNA

isolated. Conditioned media was collected for HA quantification using the Hyaluronan Quantikine

ELISA kit (DHYAL0, R&D systems) as per manufacturer’s instructions.

For Quantitative PCR (RT-qPCR) analysis, MTT assay, BrdU assay, Coding-non-coding gene

(CNC) co-expression network analysis, Histology/Immunohistochemistry, SDS-PAGE,

immunoblotting, preparationACCEPTED and sequencing of Wt and S80Ki whole liver RNA samples, transcript

quantification and differential expression analysis and microarray and Computational Analysis

please see Supplementary materials and methods

Statistical Analysis

7 Data are expressed as mean ± standard error of the mean (SEM). P values were calculated by ACCEPTED MANUSCRIPT either ANOVA with Bonferroni post hoc test or by Student’s t test as appropriate.

Results

Mecp2 regulates transcripts controlling myofibroblast DNA replication and integrity, metabolism and fibrogenesis. To determine biochemical pathways under the control of Mecp2 we carried out a

Mouse LncRNA Array v2.0 (8 x 60K, Arraystar) RNA microarray screen on primary Wt and Mecp2 -

/y murine HSC that had undergone culture-induced myofibroblast transdifferentiation. The rationale

for selection of array rather than RNAseq for our transcriptome analysis was a desire to map

Mecp2-regulated long non-coding transcripts (lncRNAs) as well as mRNAs. Typically, lncRNAs

are expressed at considerably lower abundance than mRNAs and can be overwhelmed and

under-reported by RNAseq 12 . Using the sequence-specific probe hybridization approach of the microarray platform avoids this bias and enables a broader coverage of transcripts to be quantified. Fig 1A confirms the absence of expression of Mecp2 protein in three individual Mecp2 -

/y HSC-derived myofibroblast lines used for transcrip MANUSCRIPTtome analysis. Fig 1B shows a volcano plot and associated heatmap (right panel) displaying 124 upregulated and 160 downregulated mRNA species identified from the microarray as reporting a 2-fold or greater change in expression between mecp2 -/y and Wt myofibroblasts (Supplementary Tables 1 and 2). KEGG pathway

analysis ( Fig 1C ) revealed with loss of Mecp2 there is reduced expression of mRNAs encoding proteins involved in DNA replication, cell cycle control, DNA damage response (e.g. Fanconi anemia pathway) and cytokine-chemokine receptor interactions. In contrast, upregulated mRNAs in Mecp2 -/y myofibroblasts encode proteins involved in complement and coagulation cascades,

metabolism of linoleicACCEPTED acid, arachidonic acid, glutathione, xenobiotics (cytochrome p450s) and

control of the renin-angiotensin system. Ingenuity pathway analysis (IPA) of the differentially

expressed genes further confirmed a role for Mecp2 in the control of DNA replication by showing a

number of genes involved in the pathways that were downregulated in Mecp2 -/y myofibroblasts

(Fig 1D ). Furthermore, IPA analysis also shows a major role for Mecp2 in the overall

8 epigenetic/transcriptional state of chromatin in myofibroblasts, with histones H3 and H4 as well as ACCEPTED MANUSCRIPT RNA polymerase II identified as the central targets affected by the changes in gene expression in

Mecp2 -/y myofibroblasts ( Suppl Fig 1 and 2) . To validate these data, we randomly selected transcripts from the top 25 most over- and underexpressed genes in Mecp2 -/y myofibroblasts for qRT-PCR analysis ( Fig 2A ). Has2, Myl7, Desmin (Des) transcripts were validated as underexpressed relative to wild type, by contrast a fourth transcript (Acan) failed validation ( Suppl

Fig 3A). All 4 mRNAs (Cdk15, Tnxb, Sepp1 and Ostn) selected from the heatmap of over- expressed transcripts were validated by qRT-PCR ( Suppl Fig 3B). We conclude that the observed de novo expression of Mecp2 protein that occurs early in HSC transdifferentiation impacts on the expression of around 280 protein-coding transcripts influencing key regulatory pathways relevant to fibrosis.

Mecp2 regulates DNA replication and repair systems . We have previously observed that myofibroblasts derived from Mecp2 -/y HSC are difficult to establish in culture and there are many reports documenting the pro-proliferative propertie MANUSCRIPTs of Mecp2 in HSC and other fibroblast lineages 13-16 . It was therefore of particular interest that KEGG pathway analysis highlighted a role for Mecp2 in the control of DNA replication ( Fig 1C ). IPA analysis of these data shows a number of downregulated genes in Mecp2 -/y HSC to be in the DNA damage and DNA replication pathways

(Fig 1D ). Closer interrogation of the array data revealed reduced expression of several subunits

for the minichromosome maintenance protein complex (MCM) which is a DNA helicase essential

for DNA replication (Fig 2B , left panel). In addition, Cdc7, a kinase regulator of MCM, was also expressed at reduced levels, as was a second DNA helicase Dna2 and the single strand DNA- binding protein Rpa2ACCEPTED ( Fig 2B ). Given the critical role of the Mcm complex in DNA replication, we validated these data by RT-PCR which confirmed reduced expression of transcripts for Mcm2-6 subunits in Mecp2 -/y HSC ( Suppl Fig 4A). Similarly, RT-PCR confirmed reduced expression of mRNAs encoding PolD1, Dna2 and Rpa2 in Mecp2 deficient cells ( Suppl Fig 4B ). To demonstrate the relevance of these findings to HSC transdifferentiation, Mcm2, Mcm5 and PolD1 proteins were

9 all induced at an early stage of HSC transdifferentiation (culture day 2) and in concert with ACCEPTED MANUSCRIPT induction of the Cyclin A2 (CCNA2) which promotes transition through G1/S and G2/M, and the

DNA polymerase processivity factor PCNA2 which is a marker for DNA replication ( Fig 2C). A further striking observation was an apparent role for Mecp2 in the control of genes involved in the

Fanconi anaemia pathway, which plays a fundamental role in DNA repair responses. IPA analysis identified multiple genes in this pathway display reduced transcript expression in Mecp2 -/y HSC

(Fig 2D, downregulated genes shown in blue) and random selection of 3 of these genes (Eme1,

Brip1 and Rad51) provided qRT-PCR validation of diminished expression (Suppl Fig 4C ).

As an exemplar for the potential for using the Mecp2-transcriptome map to identify novel regulators of liver fibrosis, we selected Mecp2-regulated Has2 for further investigation. We confirmed Has2 mRNA is highly expressed in HSC-derived myofibroblasts relative to Kupffer cells and hepatocytes ( Fig 2E ). Furthermore, Has2 transcript expression is elevated during culture- induced HSC transdifferentiation, while by contrast, its functionally related family members Has1 and Has3 were transcriptionally down-regulated ( Fig MANUSCRIPT 2F ). Induction of Has2 protein was observed to occur with similar kinetics as type IA1 Collagen (Col1A1) and αSMA, in addition immunoblotting for the HA receptor CD44 revealed a similar de novo induction occurring within 2 days of culturing

(Fig 2G ). It has previously been reported that the hyaluronan synthase isoform Has2 plays a pro-

fibrogenic function in the lung, however its role as a profibrogenic factor in HSC was not

determined 17 . Therefore, we employed siRNA-mediated knockdown of Has2 in transdifferentiating

HSC and observed an associated 50% reduction in expression of TGF β1 and blunted expression

of transcripts for the extracellular matrix modulators MMP9 and MMP13 ( Fig 2H ). We further

observed a reductionACCEPTED in Col1A1 and αSMA expression ( Fig 2I ) as well as a reduction in HA

production in HSCs transfected with Has2 siRNA ( Fig 2J ). These data indicate that Mecp2 can extend its control over fibrogenesis beyond that of its immediate target genes.

Mecp2 is a regulator of the non-coding transcriptome.

10 We next focused our attention on the potential for Mecp2 to influence the HSC lncRNA landscape ACCEPTED MANUSCRIPT using the array data from our analysis of Wt and Mecp2 -/y cells. A volcano plot of lncRNAs

detected in the array and subsequent heat mapping of differentially regulated transcripts revealed

that absence of Mecp2 alters the expression of 244 lncRNAs of which 161 species were

upregulated and 83 were downregulation relative to Wt (Fig 3A and Supplementary Tables 3

and 4). lncRNAs can be classified according to their genomic location. Mecp2 had the greatest

influence on lncRNAs derived from intragenic (so-called lincRNAs) sense and anti-sense

overlapping localities and had a lesser effect on lncRNAs classified as intergenic or bidirectional

(Fig 3B). Further genomic analysis revealed that Mecp2 influences the expression of lncRNAs that

are classified according to their association with known as well as unknown protein coding genes

(Fig 3C). From a focused heatmap of the 50 most up- and down-regulated lncRNAs in Mecp2 -/y cells ( Fig 3D) we identified the down-regulated transcript uc008hgf as in close physical association with the Acta2 ( αSMA) locus ( Suppl Fig 5). RT-PCR confirmed reduced expression of

uc008hgf and Acta2 in Mecp2 -/y HSC ( Suppl Fig 5). Coding to non-coding co-expression analyses and IPA analysis from the array data identified MANUSCRIPT Mecp2-regulated mRNA-lncRNA networks including systems controlling DNA metabolic processes, innate immunity, protein activation cascades and cell cycle ( Fig 3E and Suppl Fig 6), thus reaffirming a regulatory role for Mecp2 in

DNA replication and repair systems.

Mecp2 phosphorylation is required for HSC proliferation and collagen expression.

With the longer-term aim of designing molecular strategies for therapeutically manipulating the fibrogenic activities of Mecp2 we examined its post-translational modification by site-specific phosphorylation. MassACCEPTED spectrometry analysis has identified at least 8 sites of phosphorylation including S80, T148/S149, S164, S229, S399, S421 and S424 18 . Mutations at S80 and S421/S424 have been studied in neurons and shown to modify Mecp2 function 18 . Of particular importance

was the discovery that phosphorylation at the S80 residue is important for DNA binding, such that

mutating S80 to alanine reduced the affinity of Mecp2 for multiple target gene promoter

11 sequences 19 . Immunoblotting for Mecp2 and its phospho-modified forms was carried out across a ACCEPTED MANUSCRIPT time course of culture-induced HSC transdifferentiation. As anticipated from our previous work

Mecp2 controls an epigenetic pathway that promotes myofibroblast transdifferentiation and

fibrosis 6. Mecp2 was absent in freshly isolated (day 0) HSC but was induced during the early

(initiation) phase of transdifferentiation, appearing at Day 2 of culture and this expression

persisting throughout further culturing ( Fig 4A). Of note, the molecular weight of Mecp2 detected

in HSC was around 70kDa which has previously been reported as the slower migrating

phosphorylated form of the protein 20 . Antibodies recognizing phosphorylation at S80 (pMecp2 S80 )

and S421 (pMecp2 S421 ) also detected a protein of approximately 70kDa which was absent in freshly isolated HSC and appeared at Day 2 of culture. Furthermore, we also detected at the same time point induction of homeodomain-interacting protein kinase 2 (HIPK2) which is reported to bind to Mecp2 and phosphorylate it at its S80 residue 21 . These data encouraged us to examine the role of pMecp2 S80 in HSC using primary cells isolated from digested livers of mutant Mecp2 S80A knock- in (S80A) mice. While we were able to establish Mecp2 S80A HSC lines, they were morphologically observed to be more rounded (i.e. less activated) aMANUSCRIPTnd were slower growing than Wt lines (Suppl Fig 7), reduced proliferative rate being confirmed by BrdU incorporation ( Fig 4B) and MTT assays

carried out across a time course of transdifferentiation (Fig 4C). Moreover, S80A HSC were

impaired for expression of Mcm5 transcript and protein ( Fig 4D) and displayed diminished

expression of CCNA2 and Brip1 (Fig 4E). In addition, day 8 S80A HSCs express considerably

less Cyclin D1 and E1 ( Fig 4F). Given our previous observation that Mecp2 is required for HSC

expression of fibrogenic genes we next determined if phosphorylation at S80 was required for this

function. As shown in Fig 4G, S80A HSC consistently expressed reduced levels of transcripts for

Collagen 1A1 and displayedACCEPTED a delay in maximal expression of α-SMA, however induction of TIMP1

mRNA was no different between S80A and Wt HSC. These data suggested that S80

phosphorylation selectively modulates a subset of the fibrogenic characteristics of HSC.

12 Mecp2-S80 phosphorylation is required for toxin-induced liver fibrosis . We were next interested to ACCEPTED MANUSCRIPT determine if modulation of HSC behavior by S80 phosphorylation impacts on liver fibrosis. Prior to

determining a role in fibrosis, we asked if the S80A mutation has any impact on the normal

physiology and response of the liver to acute toxic injury. Histological examination of S80A livers

did not reveal any gross anatomical abnormalities, however we did note a mild steatosis which

was confirmed upon Oil Red-O staining ( Fig 5A). This observation was followed up with transcriptomic sequencing of uninjured Wt and S80A Ki livers, which revealed segregated clustering of two groups as determined using the principal component analysis (PCA, Fig 5B),

suggesting that S80A livers have phenotypic differences at baseline. A heatmap generated from

the transcriptome analysis shows 31 upregulated and 233 downregulated RNA species reporting a

2-fold or greater change in expression between S80A as compared to Wt control livers (Fig 5C

and Supplementary Table 5 ). We observed no gross differences in the response of S80A mice to

sub-lethal paracetamol intoxication ( Fig 5D), although examination of inflammatory gene

expression did reveal unanticipated defects in the induction of TNF α, IL-1β, IL-6 and CXCL2 in paracetamol injured S80A livers (Fig 5E). Given MANUSCRIPT these effects of the S80A mutation on liver physiology and response to acute injury we reassessed the cellular expression of MeCP2 in mouse liver. MeCP2 protein was barely detectable by Western blotting in whole liver, but was abundantly expressed in hepatic stellate cells ( Suppl Fig 8A ), this result supporting previous reports from our group and other investigators that hepatocytes express very low levels of MeCP2 whereas activated HSC abundantly express the protein 22-24 . Similar to injury with paracetamol, acute damage with carbon tetrachloride (CCl 4) was similar between S80A and Wt based on measurement of ALT ( Fig 6A). Moreover, analysis of αSMA expression as a surrogate for HSC

transdifferentiation revealedACCEPTED a similar acute fibrogenic response between S80A and Wt (Fig 6B).

By contrast chronic injury with CCl 4 suggested partial protection of S80A mice from development of fibrosis as determined by Picrosirius red staining and morphological quantification of cross- linked collagens ( Fig 6C), although no difference was observed in the amount of αSMA staining

(Fig 6D). This protective effect was mirrored by reduced hepatic expression of COL1A1, αSMA,

13 IL-6, MMP2 and TIMP1 (Fig 6E). In addition, we measured improved liver function (AST and ALT) ACCEPTED MANUSCRIPT and liver/body weight measurements as outputs of liver health in the S80A mutant mice ( Suppl

S421A/S424A Fig 8B and C). Of note, similar chronic CCl 4 challenge in Mecp2 mice showed no effect on fibrosis or liver function (data not shown). We conclude that site-specific phosphorylation of

Mecp2 at its S80 residue is required for a robust fibrogenic reaction to iterative liver damage but is not required for normal liver physiology or for the wound-healing response to acute liver damage.

Given the protective effect of S80A point mutation on fibrosis, we performed transcriptomic sequencing of CCl 4 injured livers. Sequencing data from two groups was normalized and used to generate a PCA plot which revealed clear phenotypic differences between Wt and S80A (Fig 7A).

Interrogation of the sequencing data revealed reduced expression of 116 genes and upregulation

of 306 genes in S80A livers as compared to Wt (Fig 7B and Supplementary Table 6 ). IPA

analysis of differentially expressed genes in S80A injured livers revealed similar networks to those

identified in Mecp2 -/y myofibroblasts, in particular pathways involving Histones H3 and H4, ERK

1/2 and RNA polymerase II (Fig 7C and 7D; Supplementary Figure 1 and 2). These data suggest a role for S80 phosphorylation in controlling Mecp2 mediatedMANUSCRIPT regulation of chromatin structure and gene transcription as well as MAPK signalling cascades in hepatic myofibroblasts and liver fibrosis.

Discussion .

Experimental in vivo studies in mice across multiple organ systems (liver, lung and heart) have identified Mecp2 as an important epigenetic profibrogenic factor 6, 14 .These data are supported by in vitro studies that suggest Mecp2 promotes the fibrogenic characteristics of fibroblasts and

myofibroblasts from numerousACCEPTED tissues 7-9. An exception to these observations was a recent report of Mecp2 suppressing the fibrogenic characteristics of human dermal fibroblasts which remains to be validated and show an impact on fibrosis 7. Hence, a consensus is emerging that in the majority

of organs, Mecp2 promotes fibrosis through its activities in the fibroblast/myofibroblast. Of

relevance to the functions of MeCP2 in liver fibrosis, expression of MeCP2 is found at very low

14 levels in healthy liver 22, 23 and this was confirmed in the present study. By contrast, MeCP2 ACCEPTED MANUSCRIPT expression is elevated in fibrotic liver where its expression is predominantly localized to liver myofibroblasts 24 . Here, we shed further light on the degree to which Mecp2 exerts its influence on the phenotype of HSC-derived myofibroblasts by discovering that it modulates the expression of at least 529 transcripts comprising 284 mRNAs and 244 lncRNAs. Differential transcript expression in Mecp2 -/y HSC included up- and down-regulation in both mRNA and lncRNA families. While

Mecp2 was originally described as a gene silencer 25, 26 , more recent studies have described cell

type specific functions for Mecp2 and an unexpected role as a gene activator 27-29 . These dual

opposing functions of Mecp2 are at least in-part explained by the activities of its numerous co-

regulators; for example, CREB enhances transcription, whereas HDAC/Sin3A complexes that

assemble with Mecp2 at the promoters of repressed genes are known to have potent suppressive

activities on transcription 30 . Additionally, Mecp2 can influence gene expression via its role in

chromatin organization and architecture which is further indicated in the data presented in this

report 31-33 . We have also described how Mecp2 can indirectly influence transcription by modulating the expression of other epigenetic factors such as ASH1MANUSCRIPT and EZH2 that associate with regulatory regions of profibrogenic genes 6, 34 . Further, as we have discovered in the present study, Mecp2

has a regulatory influence on lncRNAs which in large part exert their regulatory effects via

chromatin remodeling activities. These alternative mechanisms to the DNA-binding functions of

Mecp2 highlight an important limitation of the work presented here to be addressed in future, this

being that our available data cannot distinguish the degree to which Mecp2 controls the HSC

transcriptional landscape through its direct actions at gene promoters versus its various indirect

modes of action. A further limitation is the use of cultured HSC which may not accurately

recapitulate changesACCEPTED in gene expression associated with HSC transdifferentiation in vivo 35 .

However, a danger with isolating transdifferentiated HSC from the damaged liver is the degree to which subsets of phenotypically distinct cells are preferentially recovered by the isolation protocol.

Furthermore, this may be exacerbated in Mecp2 -/y livers where fibrosis is minimal and as Mecp2 -/y

HSC have an altered phenotype they are more challenging to identify and isolate from the

15 damaged liver. Despite these limitations, by comparing the transcriptional landscapes of Wt and ACCEPTED MANUSCRIPT Mecp2 -/y HSC we have discovered genes that were previously unrecognized as Mecp2 regulated and which to date have not been studied in the context of liver fibrosis yet functionally can be linked to the fibrotic process.

HSC are typically quiescent, but upon transdifferentiation will proliferate under the stimulation of a variety of mitogenic factors such as PDGF, IL-6, glucose and leptin 4. Initiation of DNA replication is

a key regulatory process in HSC transdifferentiation and as in all proliferating cells requires

‘melting’ of dsDNA at the origin recognition complex (ORC). A key role for the ORC is to load the

MCM2-7 replicative helicase onto the DNA which upon completion results in assembly of the pre-

replicative complex that licences progression to S-phase 36 . MCM proteins are required at abundant levels in proliferative cells to ensure accuracy of DNA replication and to protect against replicative stress during S-phase 37 . Indeed, in the absence of a full complement of Mcm proteins

genome integrity is lost 38 . We show here that Mcm proteins are induced with HSC transdifferentiation from either low or in the case ofMANUSCRIPT Mcm5 undetectable levels of expression in quiescent HSC. To our knowledge we have for the first time described Mecp2 as being required

for expression of multiple Mcm gene transcripts. These findings suggest a vital role for Mecp2 as a

regulator of DNA replication and integrity, and explains numerous reports of associations of Mecp2

with cell proliferation 39,40 . We also report that Mecp2 regulates Has2 which is the major isoform of the hyaluronan synthases expressed in mesenchymal cells where it is responsible for production of hyaluronic acid (HA), a key component of ECM and a modulator of collagen deposition 41. HAS2

has also been implicated as a regulator of cell senescence and proliferation, suppression of HAS2

in tumour cells arrestingACCEPTED the cell cycle in the G1-phase 42 . More recently, Has2 has been described as promoting the invasive phenotype of fibrogenic lung fibroblasts and when experimentally down- regulated in these cells promotes senescence and resolution of pulmonary fibrosis 17 . We found

that HAS2 and HA receptor CD44 are induced during HSC transdifferentiation. Of note, CD44

protein expression was undetectable in quiescent HSC and was abundantly expressed at day 2 of

16 culture which coincided with abundant induction of Mcm2 and Mcm5 proteins and Cyclin A2 ACCEPTED MANUSCRIPT (CCNA2 ), the latter being required for G2/M-phase transition. We therefore propose that Mecp2 regulates initiation and progression of HSC DNA replication via two distinct pathways. Molecular targeting of Mecp2 may therefore offer an attractive approach for suppressing the proliferative and invasive behaviour of fibrogenic cells. To this end, we were encouraged by the finding that HSC lacking the ability to phosphorylate the S80 residue of Mecp2 were defective for expression of

Mcm5 and displayed impaired proliferation. Since S80A mutant mice were able to mount a normal acute wound repair response to toxic liver injury, yet were at least partially protected from fibrosis in the context of chronic liver damage, targeting translational modification events on Mecp2 may offer a therapeutic strategy in fibrosis. As previously mentioned, in the absence of fibrosis MeCP2 is expressed in the liver at low to negligible levels. Moreover, MeCP2 is reported to be expressed in hepatocytes and specific deletion of epithelial MeCP2 promotes steatosis 43 . We also observed mild steatosis in the livers of S80A ki animals and elevated expression of inflammatory mediators in S80A ki liver in response to acute injury with paracetamol. Hence, while S80 phosphorylation in myofibroblasts offers an intriguing therapeutic target, MANUSCRIPT the same modification may be important for baseline metabolic functions of MeCP2 in hepatocytes and this would need to be considered if

S80 or its kinase HIPK2 were to be developed for therapeutic applications.

In summary, Mecp2 helps orchestrate widespread changes in the RNA landscape that convert the quiescent HSC into a fibrogenic cell and is required for the expression of genes that regulate entry and progression of HSC DNA replication. As site-specific phosphorylation of Mecp2 contributes to these events and is a modulator of liver fibrosis, manipulation of enzymes regulating Mecp2 phosphorylation has potentialACCEPTED for therapeutic targeting.

FIGURE LEGENDS

17 Figure 1. Mecp2 regulates transcripts controlling myofibroblast DNA replication, cell cycle ACCEPTED MANUSCRIPT and integrity, metabolism and fibrogenesis.

A) Western blot for Mecp2 in HSC from Wt or Mecp2 -/y mice. Schematic showing the samples

used for long non-coding RNA microarray and RNA microarray. B) Volcano plot and heatmap

displaying results of mRNA microarray performed on activated HSCs isolated from three control

and three Mecp2 -/y mice. C) Representation of the groups with 2-fold or greater change in gene expression following the KEGG pathway enrichment analysis. D) Top significantly enriched

canonical pathway identified by Ingenuity Pathway Analysis, showing cell cycle control of

chromosomal replication. Blue nodes signify a downregulated gene Mecp2 -/y fibroblasts, red is

upregulated. Symbol shapes signify the nature of the encoded protein, while unshaded symbol

signify genes relevant to the pathway but not differentially expressed in our dataset.

Figure 2. Mecp2 regulates DNA replication and repair systems; Has2 is involved in HSC

transdifferentiation. A) Heatmap displaying results of mRNA microarray MANUSCRIPT performed on activated HSC isolated from three control and three Mecp2 -/y mice. The top 50 most upregulated and downregulated genes are

shown. Blue denotes downregulated; red denotes upregulated; white, unchanged. B) Heatmap displaying the most downregulated genes with a fundamental role in DNA repair responses C)

Western blot for MCM2, MCM5, POLD1, PCNA, CCNA2 and GAPDH in Wt HSCs after 0, 2, 5 and

8 days in culture. D) IPA was used to form a network of focus genes that are downstream targets

of differentially expressed mRNAs. Blue nodes signify that a gene was downregulated in Mecp2 -/y myofibroblasts, red is upregulated. Symbol shapes signify the nature of the encoded protein, while unshaded symbol signifiesACCEPTED genes relevant to the pathway but not differentially expressed in our dataset. E) mRNA level of Has2 from hepatic stellate cells (HSC), Kupffer Cells (KC) and

Hepatocytes (Hep). F) mRNA levels of Has2, Has1 and Has3 in HSCs after 0, 2, 5 and 8 days in culture. G) Western blot for Collagen 1A1 (COL1A1), HAS2, the receptor CD44, αSMA and

GAPDH in HSCs after 0, 2, 5 and 8 days in culture. H) Schematic showing the silencing

18 experiment: HSC were cultured for 5 days, then transfected with a cocktail of Has2 targeting ACCEPTED MANUSCRIPT siRNA (1+3), single Has2 targeting siRNA (3) or a negative control (Con) and harvested 48 hours later on day 7. mRNA level of Has2, MMP9, MMP13 and TGF β in Control and Has2 siRNA

transfected HSCs. Error bars represent mean ± SEM. Statistical significance was determined by

ANOVA, *p <0.05; **p <0.01; ***p <0.001. I) Western blot for Collagen1A1 (Col1A1), CD44, αSMA and GAPDH and J) HA ELISA in HSCs transfected with Has2 siRNA as in H).

Figure 3. Mecp2 is a regulator of the non-coding transcriptome.

A) Volcano plot and heatmap displaying results of lncRNA microarray performed on activated

HSCs isolated from three control and three Mecp2 -/y mice. B) Schematic showing the lncRNAs

classified according with their genomic location. C) Schematic showing the lncRNAs according to

their association with known and unknown protein coding genes. D) Heatmap displaying results of

lncRNA microarray performed on activated HSCs isolated from three control and three Mecp2 -/y mice. The top 50 most upregulated and downregulated lncRNAs are shown. Blue are downregulated; red upregulated; white, unchanged. MANUSCRIPT E) IPA was used to form a network of focus genes that are downstream targets of differentially expressed lncRNAs. Blue nodes show downregulated genes in Mecp2 -/y myofibroblasts, red is upregulated. Symbol shape signifies the

nature of the encoded protein, while unshaded symbol signifies genes relevant to the pathway but

not differentially expressed in our dataset.

Figure 4. Mecp2 phosphorylation at S80 is required for HSC proliferation and collagen expression.

S80 S421 A) Western blot for Mecp2,ACCEPTED pMecp2 , pMecp2 , HIPK2, αSMA and GAPDH in HSCs after 0,

2, 5 and 8 days in culture. B) Proliferation assay: BrdU incorporation was measured in Wt and

Mecp2 S80A HSC after 0, 2, 5 and 8 days in culture. C) Viability assay: reduced MTT was measured

in Mecp2 S80A HSC (compared to Wt HSCs) after 0, 2, 5 and 8 days in culture. D) mRNA level of

Mcm5 quantified by qPCR in Wt and Mecp2 S80A HSC after 0, 2, 5 and 8 days in culture. Western

19 S80A blot for MCM5 and β-actin in Wt and Mecp2 HSCs after 8 days in culture. E) mRNA level of ACCEPTED MANUSCRIPT CCNA2 and BRIP1 in Wt and Mecp2 S80A HSC after 0, 2, 5 and 8 days in culture. F) Western blot

Cyclin D1 and E1 in Wt and Mecp2 S80A activated HSCs (8 days in culture). G) Col1A1, αSMA and

TIMP1 quantified by qPCR in Wt and Mecp2 S80A HSC after 0, 2, 5 and 8 days in culture. Error bars represent mean ± SEM. Statistical significance was determined by ANOVA or Student’s t test, *p

<0.05; **p <0.01; ***p <0.001. ᚻ denotes a trend with p<0.1.

Figure 5. Mecp2 S80 phosphorylation causes baseline difference in gene expression in

uninjured liver and is required for paracetamol-induced liver fibrosis.

A) Liver sections showing neutral triglycerides and lipids staining with Oil Red O from Wt and

Mecp2 S80A mice. B) Gene expression variances between Wt and Mecp2 S80A uninjured livers

displayed as principal component analysis (PCA plot) of scaled log2-transformed transcript counts.

C) Heatmap displaying results of transcriptome sequencing carried out using 3 uninjured livers

from Wt and Mecp2 S80A mice. The genes with greater than 2-fold change and significant to p<0.01 are shown. Green are downregulated in Mecp2 S80A MANUSCRIPT; red upregulated; black, unchanged. D) Liver morphology showed with H&E staining from Wt and Mecp2 S80A mice, control or treated with paracetamol. Photomicrographs are at ×100 magnification. E) mRNA level of TNF α, IL-1β, IL-6 and MIP2 α/CXCL2 quantified by qPCR in Wt and Mecp2 S80A mice, control or treated with paracetamol (n=8 per group). Error bars in relevant panels represent mean ± SEM. Statistical significance was determined by ANOVA or Student’s t test, *p <0.05; **p <0.01; ***p <0.001.

S80 Figure 6. Mecp2 phosphorylationACCEPTED is required for CCl 4-induced liver fibrosis. A) Alanine transaminase (ALT) assessment after 24, 48 and 72 hours CCl 4/olive oil injection in Wt

S80A and Mecp2 mice treated with acute CCl 4 or vehicle. B) Histological sections showing αSMA

S80A staining from Wt and Mecp2 mice treated with acute CCl 4. Graph showing percentage area positive for αSMA staining (n=6 per group). C) and D) Liver sections showing collagen staining

S80A (Picrosirius Red) and αSMA from Wt and Mecp2 mice treated with chronic CCl 4 or olive oil

20 vehicle. Associated graphs show percentage area positive for Picrosirius Red or αSMA staining. ACCEPTED MANUSCRIPT Photomicrographs are at x40 magnification. D) mRNA level of COL1A1, αSMA, IL-6, MMP2 and

TIMP1 quantify by qPCR in Wt and S80A mice treated with olive oil vehicle or chronic CCl 4.

S80 Figure 7. Mecp2 phosphorylation regulates gene expression in CCl 4-induced liver fibrosis

A) Gene expression variances between Wt and Mecp2 S80A fibrotic livers displayed as principal component analysis (PCA plot) of scaled log2-transformed transcript counts. B) Heatmap

displaying results of transcriptome sequencing carried out using 3 CCl 4-injured livers from each

the Wt and Mecp2 S80A mice; genes with greater than 2-fold change and significant to p<0.01 are shown. Green, negative values (downregulated in Mecp2 S80A ); red, positive (upregulated in

Mecp2 S80A ); black, unchanged. C) and D) IPA was used to form a network of focused genes that

are downstream targets of differentially expressed RNAs. Blue nodes show downregulated genes

S80A in Mecp2 CCl 4-injured liver, red is upregulated. Symbol shapes signify the nature of the encoded protein (See Supplementary Figure 1 and MANUSCRIPT 2 for shape information), while unshaded symbol signifies gene relevant to the pathway but not differentially expressed in our dataset.

References

1. Hernandez-Gea V, Friedman SL. Pathogenesis of liver fibrosis. Annu Rev Pathol 2011;6:425-56. 2. Lee YA, Wallace MC, Friedman SL. Pathobiology of liver fibrosis: a translational success story. Gut 2015;64:830-41. 3. Puche JE, Saiman Y, Friedman SL. Hepatic stellate cells and liver fibrosis. Compr Physiol 2013;3:1473-92. 4. Tsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation. Nat Rev Gastroenterol Hepatol 2017;14:397-411.ACCEPTED 5. Troeger JS, Mederacke I, Gwak GY, et al. Deactivation of hepatic stellate cells during liver fibrosis resolution in mice. Gastroenterology 2012;143:1073-83 e22. 6. Mann J, Chu DC, Maxwell A, et al. MeCP2 controls an epigenetic pathway that promotes myofibroblast transdifferentiation and fibrosis. Gastroenterology 2010;138:705-14, 714 e1-4. 7. He Y, Tsou PS, Khanna D, et al. Methyl-CpG-binding protein 2 mediates antifibrotic effects in scleroderma fibroblasts. Ann Rheum Dis 2018;77:1208-1218. 8. Nectoux J, Florian C, Delepine C, et al. Altered microtubule dynamics in Mecp2-deficient astrocytes. J Neurosci Res 2012;90:990-8.

21 9. Zhou P, Lu Y, Sun XH. Zebularine suppresses TGF-beta-induced lens epithelial cell- myofibroblast transdifferentiationACCEPTED by inhibiting MANUSCRIPT MeCP2. Mol Vis 2011;17:2717-23. 10. Tao J, Hu K, Chang Q, et al. Phosphorylation of MeCP2 at Serine 80 regulates its chromatin association and neurological function. Proceedings of the National Academy of Sciences of the United States of America 2009;106:4882-4887. 11. Perugorria MJ, Murphy LB, Fullard N, et al. Tumor progression locus 2/Cot is required for activation of extracellular regulated kinase in liver injury and toll-like receptor-induced TIMP- 1 gene transcription in hepatic stellate cells in mice. Hepatology 2013;57:1238-49. 12. Shi Y, Shang J. Long Noncoding RNA Expression Profiling Using Arraystar LncRNA Microarrays. Methods Mol Biol 2016;1402:43-61. 13. Babbio F, Castiglioni I, Cassina C, et al. Knock-down of methyl CpG-binding protein 2 (MeCP2) causes alterations in cell proliferation and nuclear lamins expression in mammalian cells. Bmc Cell Biology 2012;13. 14. Tao H, Yang JJ, Shi KH, et al. Epigenetic factors MeCP2 and HDAC6 control alpha-tubulin acetylation in cardiac fibroblast proliferation and fibrosis. Inflamm Res 2016;65:415-26. 15. Tao H, Yang JJ, Hu W, et al. MeCP2 regulation of cardiac fibroblast proliferation and fibrosis by down-regulation of DUSP5. Int J Biol Macromol 2016;82:68-75. 16. Yang JJ, Liu LP, Tao H, et al. MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R. Toxicology 2016;359-360:39-46. 17. Li Y, Jiang D, Liang J, et al. Severe lung fibrosis requires an invasive fibroblast phenotype regulated by hyaluronan and CD44. J Exp Med 2011;208:1459-71. 18. Li H, Chang Q. Regulation and function of stimulus-induced phosphorylation of MeCP2. Front Biol (Beijing) 2014;9:367-375. 19. Tao J, Hu K, Chang Q, et al. Phosphorylation of MeCP2 at Serine 80 regulates its chromatin association and neurological function. Proc Natl Acad Sci U S A 2009;106:4882-7. 20. Bueno C, Tabares-Seisdedos R, Moraleda JM, et al. Rett Syndrome Mutant Neural Cells Lacks MeCP2 Immunoreactive Bands. PLoS One 2016;11:e0153262. 21. Bracaglia G, Conca B, Bergo A, et al. Methyl-CpG-binding protein 2 is phosphorylated by homeodomain-interacting protein kinase 2MANUSCRIPT and contributes to apoptosis. EMBO Rep 2009;10:1327-33. 22. Shahbazian MD, Antalffy B, Armstrong DL, et al. Insight into Rett syndrome: MeCP2 levels display tissue- and cell-specific differences and correlate with neuronal maturation. Hum Mol Genet 2002;11:115-24. 23. Luikenhuis S, Giacometti E, Beard CF, et al. Expression of MeCP2 in postmitotic neurons rescues Rett syndrome in mice. Proc Natl Acad Sci U S A 2004;101:6033-8. 24. Mann J, Oakley F, Akiboye F, et al. Regulation of myofibroblast transdifferentiation by DNA methylation and MeCP2: implications for wound healing and fibrogenesis. Cell Death Differ 2007;14:275-85. 25. Klose R, Bird A. Molecular biology. MeCP2 repression goes nonglobal. Science 2003;302:793-5. 26. Wakefield RID, Smith BO, Nan XS, et al. The solution structure of the domain from MeCP2 that binds to methylated DNA. Journal of Molecular Biology 1999;291:1055-1065. 27. Ben-Shachar S, Chahrour M, Thaller C, et al. Mouse models of MeCP2 disorders share gene expression changes in the cerebellum and hypothalamus. Hum Mol Genet 2009;18:2431-42. 28. Chahrour M, JungACCEPTED SY, Shaw C, et al. MeCP2, a key contributor to neurological disease, activates and represses transcription. Science 2008;320:1224-9. 29. Sugino K, Hempel CM, Okaty BW, et al. Cell-type-specific repression by methyl-CpG-binding protein 2 is biased toward long genes. J Neurosci 2014;34:12877-83. 30. Della Ragione F, Filosa S, Scalabri F, et al. MeCP2 as a genome-wide modulator: the renewal of an old story. Front Genet 2012;3:181. 31. Georgel PT, Horowitz-Scherer RA, Adkins N, et al. Chromatin compaction by human MeCP2. Assembly of novel secondary chromatin structures in the absence of DNA methylation. J Biol Chem 2003;278:32181-8.

22 32. Horike S, Cai ST, Miyano M, et al. Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome. NatureACCEPTED Genetics 2005;37:31-4 MANUSCRIPT0. 33. Nikitina T, Ghosh RP, Horowitz-Scherer RA, et al. MeCP2-chromatin interactions include the formation of chromatosome-like structures and are altered in mutations causing Rett syndrome. J Biol Chem 2007;282:28237-45. 34. Perugorria MJ, Wilson CL, Zeybel M, et al. Histone methyltransferase ASH1 orchestrates fibrogenic gene transcription during myofibroblast transdifferentiation. Hepatology 2012;56:1129-39. 35. De Minicis S, Seki E, Uchinami H, et al. Gene expression profiles during hepatic stellate cell activation in culture and in vivo. Gastroenterology 2007;132:1937-46. 36. Evrin C, Clarke P, Zech J, et al. A double-hexameric MCM2-7 complex is loaded onto origin DNA during licensing of eukaryotic DNA replication. Proc Natl Acad Sci U S A 2009;106:20240-5. 37. Forsburg SL. Eukaryotic MCM proteins: beyond replication initiation. Microbiol Mol Biol Rev 2004;68:109-31. 38. Bailis JM, Forsburg SL. MCM proteins: DNA damage, mutagenesis and repair. Curr Opin Genet Dev 2004;14:17-21. 39. Zhao LY, Zhang J, Guo B, et al. MECP2 promotes cell proliferation by activating ERK1/2 and inhibiting p38 activity in human hepatocellular carcinoma HEPG2 cells. Cell Mol Biol (Noisy-le- grand) 2013;Suppl 59:OL1876-81. 40. Sharma K, Singh J, Frost EE, et al. MeCP2 overexpression inhibits proliferation, migration and invasion of C6 glioma by modulating ERK signaling and gene expression. Neurosci Lett 2018;674:42-48. 41. Albeiroti S, Soroosh A, de la Motte CA. Hyaluronan's Role in Fibrosis: A Pathogenic Factor or a Passive Player? Biomed Res Int 2015;2015:790203. 42. Udabage L, Brownlee GR, Nilsson SK, et al. The over-expression of HAS2, Hyal-2 and CD44 is implicated in the invasiveness of breast cancer. Exp Cell Res 2005;310:205-17. 43. Kyle SM, Saha PK, Brown HM, et al. MeCP2 co-ordinates liver lipid metabolism with the NCoR1/HDAC3 corepressor complex. Hum Mol Genet 2016;25:3029-3041. MANUSCRIPT Author names in bold designate shared co-first authorship

ACCEPTED

23 ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

WHAT YOU NEED TO KNOW Background and context: During development of liver fibrosis, hepatic stellate cells differentiate into myofibroblasts. This process is regulated by epigenetic events, including those controlled by the methyl-CpG binding protein 2 (MECP2).

New findings: MECP2 regulates expression of mRNAs and long noncoding RNAs in hepatic myofibroblasts, including those that control DNA replication. MECP2 is phosphorylated at S80; mutation of this amino acid protects mice from toxin-induced liver fibrosis.

Limitations: This study was performed in mice and did not determine whether MECP2 directly affects transcription of the genes identified.

Impact: Phosphorylation of MECP2 affects its ability to regulate gene expression and fibrosis. Strategies to inhibit MECP2 might be developed for treatment or prevention of liver fibrosis.

LAY SUMMARY: Hepatic stellate cells contribute to development of fibrosis in liver. We identified a protein, called MECP2, that regulates this process and we found mechanisms by which this protein is regulated. Strategies to alter the function of this protein might be developed for treatment of liver fibrosis

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT Supplementary Table 1. Differentially Expressed upregulated genes that passed the filtering (Fold Change ≥≥≥ 2.0, p-value ≤≤≤ 0.05)

Accession Number Gene Symbol FC p-val length Ch S Start End NM_001110146 Prg4 5.82 0.008 1884 chr1 - 152296541 152313295 NM_198112 Ostn 5.59 0.039 1268 chr16 + 27307726 27351295 NM_052992 Fxyd1 5.48 0.002 639 chr7 - 31836696 31840675 NM_029993 Mlana 5.00 0.037 461 chr19 + 29772430 29782796 NM_010738 Ly6a 4.95 0.013 842 chr15 - 74825306 74828318 NM_031176 Tnxb 4.56 0.014 9569 chr17 + 34807479 34856760 NM_008510 Xcl1 4.43 0.039 502 chr1 - 166861778 166865641 NM_001099217 Ly6c2 4.41 0.025 875 chr15 - 74938590 74942379 NM_001014422 Abi3bp 4.33 0.018 4454 chr16 + 56477958 56690248 NM_001039647 Gbp11 4.02 0.045 2723 chr5 - 105752044 105775491 NM_020498 Ly6i 3.97 0.032 878 chr15 - 74810241 74813860 NM_178790 Abi3bp 3.91 0.033 4394 chr16 + 56477958 56690248 NM_013606 Mx2 3.90 0.038 2424 chr16 + 97757689 97782506 NM_028979 Cyp2j9 3.74 0.021 1944 chr4 - 96235119 96258176 NM_009115 S100b 3.72 0.005 1676 chr10 + 75716580 75724064 NM_009155 Sepp1 3.33 0.010 2030 chr15 + 3220976 3230508 NM_001033373 Cdk15 3.20 0.024 1477 chr1 + 59313750 59409213 NM_001014399 Abi3bp 3.17 0.039 3884 chr16 + 56477958 56690248 NM_001161374 F8 3.13 0.028 7306 chrX - 72418055 72625380 NM_019823 Cyp2d22 3.10 0.019 2782 chr15 - 82200956 82210690 NM_146260 Tmie 3.03 0.041 2437 chr9 - 110768549 110782587 NM_009129 Scg2 2.97 0.023 2485 chr1 - 79431243 79436665 NM_008489 Lbp 2.97 0.039 2528 chr2 + 158132228 158158588 NM_207267 Tmsb15l 2.92 0.038 MANUSCRIPT 808 chrX - 133489528 133511390 NM_001163557 Ppfibp2 2.83 0.028 3850 chr7 + 114750357 114892097 NM_172951 Sntg2 2.79 0.010 2337 chr12 - 30859421 31058240 NM_008288 Hsd11b1 2.79 0.000 1381 chr1 - 195047834 195090239 NM_001001446 Cyp2c44 2.76 0.043 1964 chr19 - 44079511 44103737 NM_001102409 Kng2 2.76 0.042 1612 chr16 - 22985924 23029174 NM_001122635 Cdhr4 2.73 0.028 1135 chr9 + 107897371 107902011 NM_001126491 Gm14459 2.72 0.043 540 chrX - 8091177 8102080 NM_013755 Gyg 2.70 0.048 1739 chr3 - 20021969 20054995 NM_025727 Klhl10 2.69 0.005 2012 chr11 + 100303237 100318338 NM_181728 Art3 2.67 0.047 1578 chr5 + 92760866 92843653 NM_001160386 Dnahc7b 2.66 0.018 12318 chr1 + 46123582 46430395 NM_172524 Nipal4 2.59 0.004 3295 chr11 - 45961656 45979861 NM_008631 Mt4 2.57 0.042 392 chr8 + 96661103 96662931 NM_030150 Dhx58 2.54 0.026 2427 chr11 - 100556197 100565585 NM_001142706 Cfb 2.51 0.014 2763 chr17 - 34993318 34999459 NM_001200041 Gm1078 2.50 0.022 3152 chr7 - 4916861 4922563 NM_007797 ACCEPTED Ctla2b 2.50 0.032 856 chr13 - 60996711 60998808 NM_207268 Ccdc87 2.45 0.010 3163 chr19 + 4839365 4842528 NM_001011872 Olfr1034 2.45 0.020 1023 chr2 + 85886600 85887623 NM_009170 Shh 2.44 0.047 2727 chr5 - 28783379 28793641 NM_011430 Sncg 2.44 0.036 757 chr14 - 35183459 35187855 NM_010060 Dnahc11 2.43 0.030 14072 chr12 - 119116454 119437516 NM_024264 Cyp27a1 2.43 0.043 1890 chr1 + 74760147 74784464 NM_001163569 Kif9 2.42 0.028 3162 chr9 + 110379497 110426944 NM_146630 Olfr123 2.41 0.023 930 chr17 + 37932390 37933320 NM_001172055 Bdh2 2.41 0.013 1172 chr3 + 134944184 134967389 ACCEPTED MANUSCRIPT NM_018738 Igtp 2.40 0.033 2064 chr11 + 58013057 58021094 NM_139269 Pla2g16 2.40 0.031 3523 chr19 + 7631948 7663035 NM_146015 Efemp1 2.40 0.006 2036 chr11 + 28753204 28826743 NM_027040 1700007K13Rik 2.39 0.003 833 chr2 - 28317520 28321844 NM_053135 Pcdhb10 2.39 0.047 2842 chr18 + 37571327 37574168 NM_177216 Cyb5r2 2.38 0.047 2688 chr7 - 114891968 114901510 NM_013555 Hoxd9 2.38 0.021 2153 chr2 + 74535819 74538265 NM_028169 Fam71e1 2.37 0.041 849 chr7 + 51751957 51756504 NM_008967 Ptgir 2.35 0.010 3334 chr7 + 17491838 17496254 NM_001139519 Zbp1 2.34 0.004 781 chr2 - 173039236 173044423 NM_028623 Cst6 2.34 0.004 3951 chr19 - 5344704 5349574 NM_010358 Gstm1 2.33 0.010 1310 chr3 - 107815167 107820891 NM_153789 Mylip 2.33 0.011 2983 chr13 + 45485110 45507309 NM_001032298 Bglap2 2.31 0.017 471 chr3 - 88181657 88182621 NM_021394 Zbp1 2.30 0.004 1988 chr2 - 173032113 173044423 NM_025759 Speer4d 2.30 0.029 1159 chr5 + 15124916 15129682 NM_008198 Cfb 2.29 0.012 2767 chr17 - 34993318 34999459 NM_178404 Zc3h6 2.29 0.014 4916 chr2 + 128793137 128844299 NM_026880 Pink1 2.26 0.029 2367 chr4 - 137869324 137882211 NM_008486 Anpep 2.26 0.041 3439 chr7 - 86966688 86987238 NM_001042779 Sema3b 2.25 0.015 3305 chr9 - 107500445 107511572 NM_001012322 Sctr 2.23 0.020 1939 chr1 + 121903556 121960109 NM_145467 Itgbl1 2.22 0.000 2357 chr14 + 124059361 124373301 NM_001039122 Defb25 2.21 0.023 297 chr2 - 152448091 152448789 NM_008107 Gdf1 2.21 0.041 1419 chr8 + 72853663 72855487 NM_207657 5031410I06Rik 2.21 0.031 2947 chr5 - 26425207 26431854 NM_013792 Naglu 2.20 0.014 2504 chr11 + 100931407 100938985 NM_010359 Gstm3 2.20 0.018 1202 chr3 - 107766613 107772076 NM_175692 Snhg11 2.20 0.023 MANUSCRIPT 5864 chr2 + 158201373 158211881 NM_027153 Pir 2.20 0.002 1601 chrX + 160707362 160810945 NM_001007570 Slc25a42 2.19 0.044 3181 chr8 - 72708238 72736180 NM_001145926 C530028O21Rik 2.19 0.037 2091 chr6 + 124948627 124953117 NM_011261 Reln 2.18 0.045 11702 chr5 - 21390271 21850523 NM_025496 Cdrt4 2.18 0.048 723 chr11 + 62764694 62806597 NM_026599 Cgnl1 2.16 0.005 6754 chr9 - 71474315 71619409 NM_022880 Slc29a1 2.16 0.001 2047 chr17 - 45722148 45729342 NM_001101475 F830016B08Rik 2.15 0.035 3297 chr18 + 60453033 60462670 NM_012044 Pla2g2e 2.12 0.005 851 chr4 + 138433856 138438729 NM_011322 Scn1b 2.11 0.036 1568 chr7 - 31901542 31911964 NM_175486 6430571L13Rik 2.11 0.004 2552 chr9 + 107242970 107252014 NM_028181 Ccpg1 2.11 0.037 2689 chr9 + 72833357 72863806 NM_001134299 Gm10220 2.11 0.023 2984 chr5 - 26441303 26447965 NM_174857 Mamdc2 2.10 0.041 3338 chr19 - 23377098 23522812 NM_010140 Epha3 2.10 0.011 3978 chr16 - 63545043 63863983 NM_175030 Tctex1d4 2.08 0.033 982 chr4 + 116799417 116801335 NM_001114328 ACCEPTED Ccpg1 2.08 0.047 2966 chr9 + 72833357 72861745 NM_001081131 Dhtkd1 2.08 0.002 3535 chr2 - 5819105 5863838 NM_011909 Usp18 2.07 0.046 1778 chr6 + 121195923 121220935 NM_009250 Serpini1 2.07 0.046 3133 chr3 + 75361454 75446445 NM_001136088 Sh3bp2 2.07 0.018 2957 chr5 + 34892336 34906288 NM_029376 Speer4a 2.07 0.036 1503 chr5 - 26360809 26366045 NM_001004159 Clec4b2 2.06 0.035 1044 chr6 + 123123040 123154689 NM_025658 Ms4a4d 2.06 0.026 1480 chr19 + 11611338 11632956 NM_001037713 Xaf1 2.06 0.029 2621 chr11 + 72115130 72127235 ACCEPTED MANUSCRIPT NM_010778 Cd46 2.06 0.003 1213 chr1 - 196868093 196918442 NM_181344 C1rl 2.06 0.010 3010 chr6 + 124443130 124460661 NM_028561 Speer4b 2.06 0.027 1977 chr5 - 27822348 27827932 NM_207624 Ace 2.06 0.014 4885 chr11 + 105829260 105851259 NM_030738 Vmn1r65 2.05 0.006 2685 chr7 - 5959351 5962612 NM_025711 Aspn 2.05 0.008 2362 chr13 + 49639811 49662931 NM_027062 C8g 2.04 0.035 1063 chr2 - 25354175 25356026 NM_001081351 A430107O13Rik 2.04 0.039 4898 chr6 + 21935909 22205606 NM_027835 Ifih1 2.04 0.011 5519 chr2 - 62433849 62484312 NM_007796 Ctla2a 2.04 0.030 1373 chr13 - 61035515 61037986 NM_145153 Oas1f 2.03 0.024 1480 chr5 + 121297375 121307995 NM_021486 Bcmo1 2.03 0.034 2327 chr8 + 119619764 119657620 NM_019963 Stat2 2.03 0.024 4402 chr10 + 127707631 127729905 NM_144938 C1s 2.03 0.006 2947 chr6 - 124480361 124492339 NM_001113198 Mitf 2.03 0.014 4890 chr6 + 97757051 97971352 NM_148942 Serpinb6c 2.02 0.020 1390 chr13 - 33971684 33997577 NM_020561 Smpdl3a 2.01 0.006 1791 chr10 + 57514349 57531636 NM_010630 Kifc2 2.01 0.045 3143 chr15 + 76491070 76498626 NM_001040112 Arap1 2.01 0.037 5314 chr7 + 108526635 108561100 NM_008626 Mrc2 2.00 0.037 5801 chr11 + 105153959 105212459

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT Supplementary Table 2. Differentially Expressed downregulated genes that passed the filtering (Fold Change ≥≥≥ 2.0, p-value ≤≤≤ 0.05)

Accession number Gene Symbol FC p-val length Chr S Start End NM_009491 Vmn2r10 9.16 0.0002 2544 chr5 - 109424557 109435455 NM_011477 Sprr2k 8.65 0.0340 639 chr3 + 92236503 92237849 NM_001104623 Vmn2r12 7.93 0.0024 2496 chr5 - 109514867 109526883 NM_008216 Has2 6.48 0.0414 4262 chr15 - 56497181 56526101 NM_008522 Ltf 5.40 0.0441 2742 chr9 + 110921795 110945270 NM_001082546 BC100530 5.06 0.0219 453 chr16 - 36359467 36367656 NM_153786 Vgll2 4.68 0.0308 1483 chr10 + 51742491 51748277 NM_022879 Myl7 4.49 0.0161 599 chr11 - 5796639 5798785 NM_007424 Acan 4.33 0.0134 7355 chr7 + 86198368 86259985 NM_011613 Tnfsf11 3.95 0.0498 2243 chr14 - 78677252 78707850 NM_020596 Egr4 3.91 0.0414 2100 chr6 - 85461115 85463536 NM_001167567 Vmn1r186 3.73 0.0203 903 chr7 + 5626923 5627826 NM_001104624 Vmn2r13 3.70 0.0089 2496 chr5 - 109585086 109621126 NM_177752 Eme1 3.54 0.0475 2228 chr11 - 94506315 94515068 NM_008566 Mcm5 3.38 0.0155 3422 chr8 + 77633426 77652338 NM_001081099 2610002D18Rik 3.34 0.0472 1270 chr4 + 134066913 134079837 NM_153404 Liph 3.33 0.0132 2050 chr16 - 21955463 21995523 NM_016777 Nasp 3.31 0.0439 3087 chr4 - 116273656 116300556 NM_009523 Wnt4 3.28 0.0402 1101 chr4 + 136833549 136852694 NM_009828 Ccna2 3.21 0.0295 2827 chr3 - 36463786 36470918 NM_011851 Nt5e 3.16 0.0479 3580 chr9 + 88222446 88266927 NM_001199955 Ankrd60 3.16 0.0013 598 chr2 - 173397890 173403842 NM_001039155 Triobp 3.14 0.0171 3807 chr15 + 78778153 78799272 NM_001033149 Ttc9 3.12 0.0162 MANUSCRIPT 2042 chr12 + 82732355 82765928 NM_010043 Des 3.10 0.0408 2162 chr1 + 75356918 75364290 NM_001195298 Kifc1 3.05 0.0010 2330 chr17 - 34012610 34027578 NM_146298 Olfr746 3.01 0.0162 945 chr14 + 51272913 51273858 NM_001085524 Gm5634 3.01 0.0489 842 chrX - 8539259 8540101 NM_027290 Mcm10 2.96 0.0377 3510 chr2 - 4911769 4933837 NM_027411 Ccdc99 2.96 0.0203 2526 chr11 - 34622686 34647143 NM_009922 Cnn1 2.94 0.0276 1987 chr9 + 21903696 21913665 NM_024245 Kif23 2.94 0.0296 3439 chr9 - 61765084 61794606 NM_008563 Mcm3 2.93 0.0098 2886 chr1 - 20793094 20810294 NM_009104 Rrm2 2.85 0.0441 2199 chr12 + 25393118 25399011 NM_010615 Kif11 2.85 0.0315 4850 chr19 + 37450892 37496349 NM_172453 Pif1 2.80 0.0134 3680 chr9 + 65435011 65443769 NM_053173 Kifc5b 2.79 0.0009 2627 chr17 + 27054035 27069524 NM_016958 Krt14 2.78 0.0286 1680 chr11 - 100064475 100068824 NM_008652 Mybl2 2.76 0.0325 3702 chr2 + 162880370 162910423 NM_029835 ACCEPTED 5730590G19Rik 2.75 0.0445 7213 chr7 + 86805081 86843031 NM_001164253 Tpm1 2.74 0.0405 1675 chr9 - 66870399 66891678 NM_026785 Ube2c 2.72 0.0311 931 chr2 + 164595428 164598402 NM_029937 Nup210l 2.71 0.0025 5681 chr3 + 89908053 90015939 NM_022724 Suv39h2 2.71 0.0439 4282 chr2 - 3373086 3392258 NM_145150 Prc1 2.69 0.0315 3035 chr7 + 87439350 87461145 NM_009132 Scin 2.68 0.0012 2708 chr12 - 40786357 40860815 NM_009575 Zic3 2.65 0.0046 4035 chrX + 55283804 55289807 NM_008567 Mcm6 2.64 0.0106 2901 chr1 - 130228167 130256233 NM_027182 Trip13 2.64 0.0410 2267 chr13 - 74049909 74075215 ACCEPTED MANUSCRIPT NM_011196 Ptger3 2.64 0.0281 2090 chr3 + 157229855 157307722 NM_012012 Exo1 2.64 0.0384 5506 chr1 + 177810908 177841527 NM_011234 Rad51 2.61 0.0486 2138 chr2 + 118938552 118961806 NM_001014976 Espl1 2.61 0.0074 6630 chr15 + 102126723 102154787 NM_009971 Csf3 2.59 0.0249 1363 chr11 + 98562626 98564943 NM_138673 Stab2 2.59 0.0065 8152 chr10 - 86303954 86470687 NM_001009940 Il19 2.57 0.0344 1066 chr1 - 132829232 132835818 NM_011623 Top2a 2.57 0.0184 5217 chr11 - 98854260 98885503 NM_009860 Cdc25c 2.57 0.0424 1941 chr18 - 34892650 34911187 NM_029662 Mfsd2a 2.56 0.0469 2166 chr4 - 122624093 122638431 NM_009863 Cdc7 2.55 0.0110 2960 chr5 + 107393340 107413450 NM_001037751 Defb48 2.55 0.0284 445 chr14 - 63596360 63603347 NM_197959 Kif18b 2.54 0.0341 3345 chr11 - 102766832 102786438 NM_001033484 Iqgap3 2.53 0.0382 5676 chr3 + 87885972 87924970 NM_001141977 Tpx2 2.53 0.0250 4365 chr2 + 152673699 152721057 NM_026560 Cdca8 2.52 0.0254 1626 chr4 - 124595708 124614161 NM_011634 Traip 2.52 0.0075 2697 chr9 + 107853293 107874599 NM_007681 Cenpa 2.52 0.0324 1337 chr5 + 30969274 30977199 NM_011497 Aurka 2.52 0.0286 1905 chr2 - 172181695 172196006 NM_023058 Pkmyt1 2.50 0.0038 2039 chr17 + 23863302 23873696 NM_007634 Ccnf 2.50 0.0276 3099 chr17 - 24360176 24388354 NM_144553 Dlgap5 2.50 0.0430 2966 chr14 - 48007453 48038082 NM_011015 Orc1 2.49 0.0500 3027 chr4 + 108252058 108287436 NM_028232 Sgol1 2.48 0.0488 3609 chr17 - 53814111 53828640 NM_030712 Cxcr6 2.48 0.0270 1893 chr9 + 123715594 123720872 NM_008506 Mycl1 2.47 0.0164 3518 chr4 + 122673341 122679723 NM_026410 Cdca5 2.47 0.0213 1906 chr19 + 6085096 6091773 NM_027650 Speer3 2.46 0.0311 1191 chr5 + 13791618 13796819 NM_001160262 Fam78b 2.45 0.0127 MANUSCRIPT 4986 chr1 + 168931547 169021433 NM_172578 Mis18bp1 2.44 0.0472 4038 chr12 - 66233720 66273567 NM_011131 Pold1 2.44 0.0073 3428 chr7 - 51788113 51804185 NM_008564 Mcm2 2.42 0.0138 3381 chr6 - 88833467 88848774 NM_011495 Plk4 2.42 0.0146 3567 chr3 + 40603872 40620805 NM_007526 Barx1 2.41 0.0172 1366 chr13 + 48758404 48761876 NM_013787 Skp2 2.40 0.0371 3204 chr15 - 9041741 9070207 NM_020034 Hist1h1b 2.39 0.0053 672 chr13 - 21871751 21872423 NM_009022 Aldh1a2 2.38 0.0329 2264 chr9 + 71063595 71144050 NM_001040435 Tacc3 2.38 0.0365 2637 chr5 + 34000795 34014846 NM_153544 BC030867 2.38 0.0347 2543 chr11 + 102110195 102126497 NM_001113204 Ncam1 2.35 0.0271 6993 chr9 - 49310250 49607174 NM_008446 Kif4 2.34 0.0326 4712 chrX + 97821403 97922610 NM_001146081 Fancb 2.34 0.0364 2984 chrX + 161418523 161435204 NM_001081363 Cenpf 2.34 0.0332 11130 chr1 - 191464492 191511965 NM_024184 Asf1b 2.34 0.0397 1599 chr8 + 86479592 86494094 NM_013882 Gtse1 2.34 0.0065 2707 chr15 + 85690375 85707003 NM_172786 ACCEPTED Il20ra 2.34 0.0247 2088 chr10 + 19432392 19479859 NM_001164250 Tpm1 2.33 0.0241 1702 chr9 - 66870399 66897020 NM_029898 Ankrd55 2.33 0.0296 2781 chr13 + 113078658 113174210 NM_001081306 Ptprz1 2.32 0.0393 8068 chr6 + 22825501 23002916 NM_008815 Etv4 2.32 0.0224 2336 chr11 - 101631055 101646624 NM_013538 Cdca3 2.30 0.0490 1488 chr6 + 124780193 124783719 NM_178309 Brip1 2.30 0.0307 6933 chr11 - 85871637 86014695 NM_026778 Cthrc1 2.29 0.0433 1164 chr15 + 38908477 38918665 NM_008565 Mcm4 2.29 0.0312 3589 chr16 - 15623989 15637493 ACCEPTED MANUSCRIPT NM_013749 Tnfrsf12a 2.28 0.0437 980 chr17 - 23812411 23814416 NM_008632 Mtap2 2.27 0.0407 5445 chr1 + 66221902 66489157 NM_017407 Spag5 2.25 0.0426 3822 chr11 + 78115092 78135956 NM_029368 1700029F09Rik 2.24 0.0241 1265 chr1 - 44143461 44159233 NM_025995 Fbxo5 2.24 0.0408 1820 chr10 + 4541075 4547383 NM_028109 Tpx2 2.24 0.0434 4352 chr2 + 152673699 152721057 NM_172616 C330027C09Rik 2.23 0.0475 3974 chr16 + 48994300 49019818 NM_028131 Cenpn 2.21 0.0235 1768 chr8 + 119445639 119465403 NM_030609 Hist1h1a 2.19 0.0438 747 chr13 + 23855536 23856283 NM_010006 Cyp2d9 2.19 0.0070 1651 chr15 + 82282806 82287257 NM_009928 Col15a1 2.18 0.0463 5335 chr4 + 47220883 47326037 NM_021288 Tyms 2.18 0.0300 3798 chr5 - 30384739 30400165 NM_001103182 Lin9 2.17 0.0098 2996 chr1 + 182571464 182620818 NM_001164485 Fam170b 2.17 0.0251 1694 chr14 + 33647147 33649974 NM_001029856 Atad5 2.16 0.0129 7272 chr11 + 79902901 79949293 NM_009171 Shmt1 2.16 0.0262 2074 chr11 - 60602398 60624767 NM_001162506 Troap 2.16 0.0357 2255 chr15 + 98905403 98913840 NM_027699 1700108M19Rik 2.16 0.0207 660 chr12 - 36934931 36944789 NM_029150 Spata16 2.16 0.0093 2011 chr3 + 26536552 26882134 NM_001039934 Mtap2 2.16 0.0218 5535 chr1 + 66221902 66489157 NM_001159513 H2afy 2.14 0.0101 1975 chr13 - 56174982 56236911 NM_001033170 Fam83e 2.13 0.0209 2900 chr7 + 52976589 52984862 NM_001034867 Pm20d2 2.13 0.0035 5578 chr4 - 33257381 33276712 NM_028083 Chaf1b 2.12 0.0237 1913 chr16 + 93884145 93906351 NM_010305 Gnai1 2.12 0.0427 3193 chr5 - 17770952 17866231 NM_026340 Pop1 2.12 0.0042 3303 chr15 + 34425065 34460408 NM_001080129 Tmpo 2.12 0.0212 3533 chr10 - 90610315 90634327 NM_001159317 Il1rap 2.11 0.0192 4031 chr16 + 26581790 26725233 NM_178184 Hist1h2an 2.11 0.0040 MANUSCRIPT 393 chr13 - 21878694 21879087 NM_011711 Fmnl3 2.11 0.0034 4428 chr15 - 99147653 99200897 NM_026024 Ube2t 2.10 0.0438 1079 chr1 + 136859153 136870714 NM_145142 Chst10 2.09 0.0063 3135 chr1 - 38920717 38955005 NM_177372 Dna2 2.09 0.0459 4122 chr10 + 62409776 62436936 NM_027435 Atad2 2.09 0.0231 5683 chr15 - 57925601 57966637 NM_013733 Chaf1a 2.08 0.0344 3308 chr17 + 56179838 56207449 NM_177357 Kalrn 2.08 0.0236 15439 chr16 - 33969158 34514113 NM_001080995 4632434I11Rik 2.08 0.0243 3450 chr7 - 100006036 100022742 NM_011284 Rpa2 2.07 0.0160 1782 chr4 + 132324274 132334661 NM_001033166 2700094K13Rik 2.07 0.0140 697 chr2 - 84509377 84510865 NM_134010 Nup107 2.07 0.0269 3092 chr10 - 117187698 117229761 NM_001081390 Palld 2.06 0.0368 3566 chr8 - 63993819 64381487 NM_001080130 Tmpo 2.05 0.0174 3413 chr10 - 90610315 90634327 NM_133815 Lbr 2.05 0.0043 3568 chr1 - 183745445 183772532 NM_181589 Ckap2l 2.04 0.0353 3154 chr2 - 129093945 129122948 NM_178211 Hist1h4k 2.04 0.0148 312 chr13 - 21842062 21842374 NM_010158 ACCEPTED Khdrbs3 2.04 0.0253 1954 chr15 + 68758849 68923948 NM_013455 Acr 2.04 0.0462 1503 chr15 + 89398756 89405015 NM_178591 Nrg1 2.02 0.0230 2103 chr8 - 32928499 33028675 NM_007525 Bard1 2.02 0.0251 5448 chr1 - 71074108 71149546 NM_020567 Gmnn 2.01 0.0473 995 chr13 - 24843713 24853806 NM_016692 Incenp 2.01 0.0199 3217 chr19 - 9946786 9974023 NM_134184 Vmn1r16 2.01 0.0411 912 chr6 - 57272717 57273629 NM_198605 F630043A04Rik 2.01 0.0168 2260 chr14 - 58425397 58445000 NM_001037719 Btla 2.01 0.0140 3235 chr16 + 45224449 45253008 ACCEPTED MANUSCRIPT NM_009272 Srm 2.00 0.0213 1328 chr4 + 147965621 147968728 NM_001080711 Dfnb59 2.00 0.0085 1219 chr2 + 76488329 76496613 NM_001076789 Cbx5 2.00 0.0358 8801 chr15 - 103021976 103070247

MANUSCRIPT

ACCEPTED Supplementary Table 3. Differentially expressed (DE) Upregulated lncRNAs ACCEPTED MANUSCRIPT

Associated Sequence name FC p-val length S Ch Start End Source* Gene AK042398 10.96 0.038 1455 - chr13 13681874 13683327 fantom3 NM_010748 AK042700 6.75 0.041 2340 - chr4 42172661 42175000 fantom3 AK039830 6.39 0.003 3332 + chr3 15128606 15131937 NRED uc.183- 5.49 0.007 236 + chr11 32580147 32580383 UCR NM_134015 AK145320 5.15 0.020 2227 + chr16 81871754 81873980 fantom3 uc.289+ 4.96 0.001 254 + chr14 23564681 23564935 UCR NM_028275 AK143356 4.75 0.017 2289 + chr5 26408711 26410997 fantom3 NM_001177579 ENSMUST00000170876 4.73 0.028 1004 - chr11 96607345 96608724 Ensembl NM_001177899 ENSMUST00000170876 4.73 0.028 1004 - chr11 96607345 96608724 Ensembl NM_001177898 ENSMUST00000170876 4.73 0.028 1004 - chr11 96607345 96608724 Ensembl NM_001033186 ENSMUST00000167770 4.36 0.024 966 + chr8 35157601 35159203 Ensembl NM_011722 NR_001584 4.27 0.046 1121 + chr5 14945293 14978541 RefSeq_NR ENSMUST00000169039 4.21 0.009 3539 + chr4 42566009 42600570 Ensembl uc007bdt.1 4.16 0.017 487 + chr1 59383514 59409292 UCSC_kg NM_001033373 AK087836 4.15 0.023 1241 + chr5 26341388 26342629 fantom3 AK087893 3.88 0.027 1799 + chr5 26423108 26424904 fantom3 AK038167 3.88 0.004 2755 + chr1 110313653 110316409 fantom3 AK033305 3.82 0.043 1866 + chr5 26340763 26342629 fantom3 AK048921 3.78 0.048 1515 - chr8 115092137 115093651 fantom3 NM_130457 ENSMUST00000121909 3.76 0.031 1569 + chrX 111135605 111137174 Ensembl AK132740 3.69 0.037 1579 + chr5 121835530 121837110 fantom3 NM_172275 AK132740 3.69 0.037 1579 + chr5 121835530 121837110 fantom3 NM_001163470 ENSMUST00000157493 3.67 0.009 312 + chr6 8389352 8389664 Ensembl NR_003564 3.64 0.001 812 - chr11 88825980 88828231 RefSeq_NR AK050947 3.57 0.008 1870 - chr12 8298631 8300500 fantom3 AK045912 3.49 0.004 1413 - chr3 24737848 24739261 fantom3 AK134457 3.37 0.017 3169 + chr5 MANUSCRIPT26418740 26421912 fantom3 uc008wjx.1 3.30 0.047 454 - chr5 8092259 8116659 UCSC_kg NM_001007221 uc008wjx.1 3.30 0.047 454 - chr5 8092259 8116659 UCSC_kg NM_001098225 uc008wjx.1 3.30 0.047 454 - chr5 8092259 8116659 UCSC_kg NM_001007220 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199960 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199963 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199964 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199966 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001177580 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001099348 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_023052 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_023052 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_011335 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_011335 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001193666 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001193666 NR_033506 3.26ACCEPTED 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_010550 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199962 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001164046 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199961 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001100596 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001193668 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001193668 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001085530 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199959 NR_033506 3.26 0.024 3558 + chr4 41763293 42104673 RefSeq_NR NM_001199965 ENSMUST00000121026 3.22 0.005 360 + chrX 138495397 138495757 Ensembl AK046587 3.19 0.029 1571 - chr7 113033809 113035380 fantom3 AK132557 3.18 0.015 3835 + chr14 64456259 64460091 fantom3 ENSMUST00000119221 3.11 0.032 343 - chr4 126201573 126201916 Ensembl NM_153177 ENSMUST00000131638 3.10 0.045 1216 + chr18 60380496 60381712 Ensembl NM_001033767 uc007qle.1 3.04 0.010 2940ACCEPTED - chr13 MANUSCRIPT 50772139 50775593 UCSC_kg AK082796 2.99 0.017 1483 + chr11 66849005 66850488 fantom3 uc009rmk.1 2.96 0.023 439 + chr9 107500683 107501122 UCSC_kg NM_001042779 uc009rmk.1 2.96 0.023 439 + chr9 107500683 107501122 UCSC_kg NM_009153 ENSMUST00000101090 2.91 0.044 478 + chr5 77357392 77357870 Ensembl NM_172146 NR_033123 2.91 0.022 4551 - chr4 41902018 41925853 RefSeq_NR AK140313 2.87 0.032 4953 - chr15 68152942 68157895 fantom3 MM9LINCRNAEXON115 23- 2.85 0.002 444 - chr13 28510817 28511261 lincRNA ENSMUST00000130159 2.84 0.001 458 - chrX 76511897 76540620 Ensembl uc007aev.1 2.84 0.012 2257 - chr1 3638391 3648985 UCSC_kg NM_001011874 uc008ysj.1 2.81 0.045 669 + chr5 112635825 112639018 UCSC_kg NR_003248 2.76 0.005 3732 - chr9 98849573 98855729 RefSeq_NR NM_012020 uc009iks.1 2.74 0.037 1133 - chr7 105830845 105851438 UCSC_kg NM_028410 ENSMUST00000172223 2.74 0.039 621 - chr3 96205072 96205937 Ensembl ENSMUST00000155944 2.72 0.022 3543 - chr4 42418154 42452715 Ensembl AK046186 2.72 0.003 1540 - chr7 130618901 130620441 fantom3 ENSMUST00000144604 2.72 0.012 741 - chr4 101019135 101028853 Ensembl MM9LINCRNAEXON115 22- 2.72 0.015 238 - chr13 28510437 28510675 lincRNA MM9LINCRNAEXON104 19- 2.71 0.034 394 - chr6 31149982 31150376 lincRNA uc008skp.1 2.70 0.024 371 + chr4 41763413 41763784 UCSC_kg ENSMUST00000171819 2.67 0.026 3539 + chr4 41925874 41960431 Ensembl ENSMUST00000140782 2.66 0.003 1853 + chr3 152329876 152344396 Ensembl NM_001081277 AK134233 2.65 0.019 2190 - chr8 122083619 122085806 fantom3 MM9LINCRNAEXON109 44- 2.64 0.037 1342 - chr2 71581306 71582648 lincRNA uc008wth.1 2.62 0.046 777 - chr5 26786609 26819829 UCSC_kg AK047207 2.62 0.039 526 + chr4 41760540 41761066 fantom3 uc008zxj.1 2.62 0.019 576 - chr5 MANUSCRIPT135487992 135489007 UCSC_kg NM_145215 uc008zxj.1 2.62 0.019 576 - chr5 135487992 135489007 UCSC_kg NM_001190437 ENSMUST00000130639 2.62 0.027 909 - chr17 8486230 8503917 Ensembl NM_134114 ENSMUST00000130639 2.62 0.027 909 - chr17 8486230 8503917 Ensembl NM_018819 chr9_ rando AK134642 2.60 0.029 1838 - m 147587 149423 fantom3 ENSMUST00000167606 2.59 0.028 2215 - chr9 20412209 20416929 Ensembl chrUn _rand ENSMUST00000115902 2.56 0.026 1386 - om 554393 555791 Ensembl uc009fxb.1 2.54 0.003 283 + chr7 28554249 28555744 UCSC_kg ENSMUST00000141440 2.53 0.037 269 + chr6 145004908 145008412 Ensembl NM_007532 ENSMUST00000119405 2.51 0.045 1849 + chr4 41764013 41765862 Ensembl ENSMUST00000119510 2.50 0.016 849 + chr1 89921785 89922634 Ensembl ENSMUST00000115901 2.50 0.036 672 + chr4 42106046 42106718 Ensembl ENSMUST00000146404 2.50 0.001 1675 + chr2 38279521 38311371 Ensembl ACCEPTEDchrUn _rand ENSMUST00000166295 2.49 0.025 1446 + om 610376 616170 Ensembl ENSMUST00000152279 2.47 0.021 1157 - chr14 62238317 62301162 Ensembl ENSMUST00000099292 2.44 0.048 1743 - chr2 143998885 144015026 Ensembl ENSMUST00000133960 2.43 0.017 2953 + chr4 3173151 3185239 Ensembl ENSMUST00000117125 2.43 0.046 1284 - chr4 41896151 41897435 Ensembl NR_026688 2.42 0.021 519 - chr5 135487991 135489027 RefSeq_NR NM_145215 NR_026688 2.42 0.021 519 - chr5 135487991 135489027 RefSeq_NR NM_001190437 ENSMUST00000053717 2.42 0.013 684 - chr19 20660563 20661247 Ensembl MM9LINCRNAEXON120 72- 2.42 0.035 2230 - chr1 137562833 137565063 lincRNA AK052921 2.42 0.031 1526 + chr6 66222498 66234839 NRED ENSMUST00000120408 2.41 0.036 822 - chr2 177715238 177717405 Ensembl ENSMUST00000151294 2.39 0.015 731ACCEPTED - chr7 MANUSCRIPT 111682121 111683365 Ensembl NR_015566 2.38 0.045 5195 + chr1 196843592 196864102 RefSeq_NR ENSMUST00000144933 2.37 0.043 557 + chr4 3174664 3175674 Ensembl AK158457 2.37 0.018 2833 - chr3 96047474 96050303 fantom3 NM_178212 AK158457 2.37 0.018 2833 - chr3 96047474 96050303 fantom3 NM_013549 AK158457 2.37 0.018 2833 - chr3 96047474 96050303 fantom3 NM_178216 uc008ski.1 2.37 0.029 426 - chr4 41758222 41758648 UCSC_kg AK142834 2.35 0.042 2388 + chrX 118021841 118024227 fantom3 CR515238 2.35 0.034 215 - chr12 25852471 25852681 lincRNA uc008tsr.1 2.35 0.046 864 + chr4 94742359 94822969 UCSC_kg MM9LINCRNAEXON113 65+ 2.34 0.046 324 + chr15 85470594 85470918 lincRNA ENSMUST00000121568 2.34 0.024 512 - chrX 87989884 87990401 Ensembl uc008wsy.1 2.33 0.006 2609 + chr5 25005758 25008367 UCSC_kg AK145626 2.33 0.028 1756 - chr4 42101119 42102873 fantom3 AK086591 2.31 0.016 1002 + chr1 92177032 92180487 fantom3 ENSMUST00000151170 2.31 0.010 1607 + chr6 17148106 17155693 Ensembl ENSMUST00000128654 2.30 0.014 1870 - chr11 18745853 18772158 Ensembl MM9LINCRNAEXON120 61+ 2.29 0.008 70 + chr1 122987123 122987193 lincRNA ENSMUST00000171522 2.28 0.036 3220 - chr6 21935907 22017687 Ensembl NM_001081351 ENSMUST00000151501 2.28 0.014 3326 + chr14 70132590 70145676 Ensembl NM_134078 ENSMUST00000121579 2.28 0.023 328 + chr4 25346495 25346823 Ensembl uc007wgm.1 2.28 0.038 269 - chr15 74826881 74828331 UCSC_kg NM_010738 AK076168 2.24 0.004 2312 + chr9 41427074 41429386 fantom3 uc009qvo.1 2.23 0.049 1482 + chr9 81525964 81538763 UCSC_kg NM_010482 ENSMUST00000165103 2.22 0.036 4231 - chr13 39037411 39043182 Ensembl NM_134060 ENSMUST00000165103 2.22 0.036 4231 - chr13 39037411 39043182 Ensembl NM_001170431 ENSMUST00000165103 2.22 0.036 4231 - chr13 39037411 39043182 Ensembl NM_001170430 ENSMUST00000122214 2.22 0.007 226 + chr4 122132452 122132678 Ensembl ENSMUST00000142634 2.21 0.010 608 - chr4 MANUSCRIPT100195851 100200406 Ensembl NM_001033773 ENSMUST00000138007 2.21 0.033 3220 + chr11 88579958 88583914 Ensembl NM_054043 ENSMUST00000138007 2.21 0.033 3220 + chr11 88579958 88583914 Ensembl NM_001201341 ENSMUST00000130892 2.20 0.047 1250 - chr5 110596526 110605523 Ensembl NM_008146 ENSMUST00000130892 2.20 0.047 1250 - chr5 110596526 110605523 Ensembl NM_172717 AK043175 2.20 0.006 2258 - chr4 98858830 98861087 fantom3 NM_175029 AK043175 2.20 0.006 2258 - chr4 98858830 98861087 fantom3 NM_001145967 NR_028122 2.20 0.022 459 + chr2 163298280 163298739 RefSeq_NR NM_173397 AK085737 2.19 0.012 2426 - chr17 74226578 74229003 fantom3 ENSMUST00000154798 2.19 0.032 1045 - chr11 102481109 102485730 Ensembl ENSMUST00000137057 2.19 0.012 656 - chr6 129182643 129188000 Ensembl AK139146 2.16 0.002 964 - chr11 3227122 3228084 fantom3 ENSMUST00000117226 2.14 0.008 497 + chr14 54349178 54349856 Ensembl MM9LINCRNAEXON106 07- 2.14 0.032 2164 - chr5 113627537 113629701 lincRNA AK083522 2.14 0.026 1019 + chr2 167458749 167459769 fantom3 ENSMUST00000119869 2.14 0.044 1048 + chr4 84343766 84344814 Ensembl uc007qkb.1 2.14ACCEPTED 0.025 2940 + chr13 50357183 50360637 UCSC_kg ENSMUST00000132326 2.13 0.019 460 - chr2 74541304 74550111 Ensembl NM_010468 ENSMUST00000132326 2.13 0.019 460 - chr2 74541304 74550111 Ensembl NM_008276 AK039686 2.13 0.013 2347 - chr6 128137835 128150641 NRED uc007bdq.1 2.13 0.040 395 + chr1 59344613 59367703 UCSC_kg NM_001033373 ENSMUST00000145799 2.12 0.001 511 - chr2 74548249 74554053 Ensembl NM_010468 ENSMUST00000118930 2.12 0.022 291 - chr2 176386914 176387205 Ensembl NM_001177543 ENSMUST00000163635 2.12 0.044 445 - chr14 8597331 8606583 Ensembl AK033843 2.11 0.020 1237 + chr7 19449514 19450751 fantom3 uc008gfj.1 2.11 0.032 4277 - chr19 5798394 5802671 UCSC_kg AK079652 2.10 0.026 1049 + chr6 125196441 125197489 fantom3 AK080602 2.10 0.006 2773 + chr14 64471552 64474322 fantom3 AK020198 2.10 0.017 1035 - chr2 11259992 11320127 fantom3 AK083796 2.10 0.050 2842ACCEPTED + chr7 MANUSCRIPT 28565647 28568488 NRED ENSMUST00000139288 2.10 0.029 410 + chr2 33033421 33037401 Ensembl NM_175211 uc007mnh.1 2.09 0.035 626 + chr11 117472658 117474111 UCSC_kg uc008smn.1 2.09 0.027 684 + chr4 42415893 42416577 UCSC_kg BY031985 2.08 0.033 470 - chr14 92394267 92394664 lincRNA ENSMUST00000127631 2.07 0.009 942 + chr8 70480668 70501950 Ensembl NM_177698 AK053656 2.07 0.002 4598 - chr8 118211623 118216217 fantom3 ENSMUST00000118430 2.06 0.012 226 + chr4 121870821 121871047 Ensembl MM9LINCRNAEXON104 85- 2.06 0.022 1649 - chr6 99561279 99562928 lincRNA AK043941 2.06 0.032 924 - chr7 111411900 111412824 fantom3 uc007iyy.1 2.06 0.013 520 + chr11 54950545 54953695 UCSC_kg NM_172258 ENSMUST00000120530 2.06 0.012 342 - chr17 92438999 92439341 Ensembl uc007zaj.1 2.06 0.028 3017 + chr16 33755635 33768281 UCSC_kg NM_175256 humanlincRNA2392- 2.05 0.027 9266 + chrX 152944622 152953888 lincRNA ENSMUST00000123905 2.04 0.044 659 - chr16 30969478 30973604 Ensembl NM_198626 ENSMUST00000139653 2.04 0.017 675 + chr4 141640770 141643992 Ensembl NM_145402 AK043325 2.04 0.025 1003 - chr1 190912396 190913399 fantom3 ENSMUST00000161461 2.04 0.035 793 + chr1 162965308 162968670 Ensembl NM_173424 NR_015533 2.04 0.042 2006 - chr7 68850735 69072460 RefSeq_NR AK081202 2.03 0.020 2082 - chr1 196863022 196865102 fantom3 AK082426 2.03 0.015 1754 + chr17 70679696 70681450 fantom3 MM9LINCRNAEXON105 07- 2.03 0.050 176 - chr6 129188203 129188379 lincRNA uc009aux.1 2.03 0.010 2991 - chr6 3283193 3296069 UCSC_kg MM9LINCRNAEXON112 80- 2.03 0.050 2861 - chr16 30180887 30183748 lincRNA uc007gjn.1 2.02 0.018 490 + chr10 81816999 81863591 UCSC_kg ENSMUST00000121541 2.02 0.032 279 + chr8 22358662 22359442 Ensembl AK082404 2.02 0.042 1340 + chr5 120876868 120878207 fantom3 MM9LINCRNAEXON117 MANUSCRIPT 01- 2.01 0.023 1027 - chr12 85220758 85221785 lincRNA AK016911 2.00 0.017 1450 - chr10 75298720 75300169 fantom3 AK017999 2.00 0.020 1357 + chr6 125196422 125197490 fantom3 ENSMUST00000120181 2.00 0.024 324 + chr2 176526876 176527200 Ensembl NM_001177543

The table contains the following information about the DE upregulated lncRNAs: Sequence name (the sequence identifier of the LncRNA), FC (Absolute Fold change is the absolute ratio (no log scale) of normalized intensities between two conditions), p-val (P-value, P-value calculated from t-test), length (RNA length), Chr (chromosome), S (DNA strand), Start and End (coding or non-coding genome location), , Source of the collection and Associated gene IS (the Accession number of the associated coding gene to the lncRNA).

* Source of LncRNA collection: - RefSeq_NR: RefSeq validated non-coding RNA - UCSC_kg: UCSC known genes annotated as "non-coding", "near-coding" and "antisense" (http://genome.ucsc.edu/cgi-bin/hgTables/)ACCEPTED - Ensembl: Ensembl (http://www.ensembl.org/index.html) - Fantom3: Fantom project (http://fantom.gsc.riken.jp/) - RNAdb: RNAdb2.0 (http://research.imb.uq.edu.au/rnadb/) - NRED: NRED (http://jsm-research.imb.uq.edu.au/nred/cgi-bin/ncrnadb.pl) - UCR: "ultra-conserved region" among human, mouse and rat (http://users.soe.ucsc.edu/~jill/ultra.html) - lincRNA: lincRNA identified by John Rinn's group (Guttman et al. 2009; Khalil et al. 2009)

Supplementary Table 4. Differentially expressed (DE) Downregulated lncRNAs ACCEPTED MANUSCRIPT Associated Sequence name FC p-val length S Ch Start End Source* gene ID ENSMUST00000116395 9.65 0.0002 240 - chrX 72117534 72117774 Ensembl uc009uoz.1 4.34 0.003 2940 - chrX 147726516 147779389 UCSC_kg NM_198105 humanlincRNA2046- 3.86 0.024 18943 + chr13 17931594 17950537 lincRNA NR_028427 3.85 0.029 5292 - chr19 53515701 53539286 RefSeq_NR AK039897 3.65 0.024 903 + chr6 120901981 120902884 fantom3 MM9LINCRNAEXON11597+ 3.60 0.013 327 + chr13 83869681 83870008 lincRNA humanlincRNA1512- 3.49 0.005 5490 + chr5 37112733 37118223 lincRNA humanlincRNA1948+ 3.49 0.011 26171 + chr10 30142092 30168263 lincRNA MM9LINCRNAEXON11652- 3.41 0.012 802 - chr12 12895177 12895979 lincRNA mouselincRNA0294- 3.30 0.035 15295 + chr12 10663990 10679285 lincRNA MM9LINCRNAEXON11105+ 3.23 0.016 493 + chr19 27461455 27461948 lincRNA ENSMUST00000166710 3.22 0.034 614 + chr5 13811241 13814452 Ensembl uc007pzn.1 3.22 0.034 2852 - chr13 31670024 31717661 UCSC_kg NM_010225 uc008hgf.1 3.19 0.014 1210 - chr19 34314826 34316036 UCSC_kg NM_007392 ENSMUST00000120731 3.17 0.034 1585 + chr4 54865999 54867584 Ensembl BY307334 3.05 0.009 377 - chr13 34873453 34906413 lincRNA MM9LINCRNAEXON10055- 3.03 0.050 345 - chrX 135890738 135891083 lincRNA ENSMUST00000119494 3.02 0.036 1788 + chr5 35896832 35898620 Ensembl ENSMUST00000121232 2.95 0.019 1527 - chrX 8239427 8240954 Ensembl ENSMUST00000117514 2.91 0.028 1493 - chr16 91513385 91514878 Ensembl ENSMUST00000140978 2.88 0.008 654 + chr2 69876967 69880463 Ensembl NM_177376 uc007zfw.1 2.76 0.018 4098 - chr16 42725814 42875693 UCSC_kg uc007ocn.1 2.75 0.046 4628 + chr12 82732355 82768538 UCSC_kg NM_001033149 ENSMUST00000117166 2.68 0.010 1344 - chr2 6053253 6055002 Ensembl uc008uju.1 2.67 0.025 6387 - chr4 118035347 118056021 UCSC_kg NM_026601 uc008uju.1 2.67 0.025 6387 - chr4 118035347 118056021 UCSC_kg NM_198170 AK136349 2.63 0.021 1102 - chr10MANUSCRIPT 68797903 68799006 fantom3 MM9LINCRNAEXON11230- 2.62 0.002 885 - chr17 66831155 66832040 lincRNA uc008sir.1 2.61 0.006 1112 - chr4 41401422 41411881 UCSC_kg NM_025539 uc008sir.1 2.61 0.006 1112 - chr4 41401422 41411881 UCSC_kg NM_024241 uc008uxa.1 2.61 0.030 1747 - chr4 129118294 129124212 UCSC_kg ENSMUST00000121946 2.59 0.043 2902 - chr6 38492302 38496074 Ensembl ENSMUST00000152745 2.59 0.050 1261 + chr5 23356414 23360742 Ensembl AK135697 2.53 0.029 2877 + chr10 112412677 112465278 fantom3 mouselincRNA0154+ 2.48 0.043 5300 + chr10 24333365 24338665 lincRNA AK014021 2.48 0.040 1294 + chr2 109858118 110013517 lincRNA NM_026613 mouselincRNA1616+ 2.46 0.017 9450 + chrX 45398900 45408350 lincRNA uc008atc.1 2.43 0.009 270 + chr17 23873321 23873696 UCSC_kg NM_023058 uc008atc.1 2.43 0.009 270 + chr17 23873321 23873696 UCSC_kg NM_023824 ENSMUST00000166061 2.42 0.020 1153 - chr4 145914739 145915894 Ensembl ENSMUST00000165496 2.42 0.038 289 + chr12 108657350 108657639 Ensembl ENSMUST00000152660 2.42 0.016 300 + chr8 71144036 71144336 Ensembl NM_172753 MM9LINCRNAEXON11665+ 2.41 0.013 1574 + chr12 33824347 33825921 lincRNA uc007kde.1 ACCEPTED 2.41 0.029 863 + chr11 74986061 74991135 UCSC_kg NM_027136 ENSMUST00000165118 2.40 0.023 1153 - chr4 146460094 146461249 Ensembl NM_027285 uc009bpx.1 2.40 0.030 734 + chr6 41493458 41498351 UCSC_kg AK131677 2.37 0.038 631 + chr13 24853436 24854065 fantom3 NM_020567 AK090241 2.34 0.021 2526 - chr16 25943095 25945619 fantom3 MM9LINCRNAEXON10457- 2.34 0.046 197 - chr6 67213651 67213848 lincRNA ENSMUST00000117910 2.33 0.048 477 - chr2 4755181 4755658 Ensembl AK007126 2.33 0.042 413 + chr12 92208388 92209958 fantom3 ENSMUST00000084861 2.31 0.023 1091 + chr4 145632856 145633949 Ensembl ENSMUST00000120764 2.27 0.017 505 + chr8 102584015 102584520 Ensembl uc009gft.1 2.25 0.004 2105 - chr7 31438730 31449988 UCSC_kg NM_027999 MM9LINCRNAEXON10746- 2.25 0.022 1505 - chr4 124288832 124290337 lincRNA ENSMUST00000166606 2.25 0.002 698 + chr5 100406704 100407877 Ensembl NM_007516 ENSMUST00000166606 2.25 0.002 ACCEPTED 698 + chr5MANUSCRIPT 100406704 100407877 Ensembl NM_001077266 ENSMUST00000166606 2.25 0.002 698 + chr5 100406704 100407877 Ensembl NM_001077267 ENSMUST00000166606 2.25 0.002 698 + chr5 100406704 100407877 Ensembl NM_001077265 uc007qbc.1 2.24 0.038 1033 - chr13 34176023 34205141 UCSC_kg ENSMUST00000058584 2.24 0.020 4116 + chr15 60655895 60663348 Ensembl NM_001162926 ENSMUST00000119302 2.21 0.041 1984 + chr1 67631626 67633610 Ensembl RefSeq_ NR_028404 2.20 0.004 4330 - chrX 99261880 99266646 NR NM_183318 RefSeq_ NR_028404 2.20 0.004 4330 - chrX 99261880 99266646 NR NM_001163610 uc009kdq.1 2.19 0.030 1463 - chr7 141376578 141423814 UCSC_kg NM_007400 AK051578 2.18 0.017 3037 + chr1 91826835 91829865 fantom3 NM_010262 AK020521 2.16 0.011 388 + chr2 70550040 70550427 fantom3 ENSMUST00000162565 2.16 0.047 867 + chr2 93292976 93296878 Ensembl NM_001136055 ENSMUST00000162565 2.16 0.047 867 + chr2 93292976 93296878 Ensembl NM_007656 uc008wvu.1 2.15 0.028 1482 + chr5 30969274 30977199 UCSC_kg NM_007681 humanlincRNA2338- 2.15 0.038 9701 + chr4 39054681 39064382 lincRNA ENSMUST00000116301 2.14 0.006 411 + chr11 58775313 58775724 Ensembl BX521937 2.14 0.035 530 + chr1 35034878 35035099 lincRNA AK201973 2.14 0.031 221 + chr1 91828299 91828518 NRED NM_010262 AK142421 2.13 0.011 3373 - chr4 144999190 145002564 fantom3 ENSMUST00000141637 2.12 0.050 512 + chr4 84387378 84388195 Ensembl ENSMUST00000121775 2.10 0.020 661 - chr11 40236195 40236856 Ensembl uc.461+ 2.10 0.010 397 - chrX 90703238 90703635 UCR NM_008892 AK076567 2.06 0.019 910 - chr1 9657495 9658406 fantom3 uc007gnh.1 2.05 0.050 483 + chr10 85391518 85408951 UCSC_kg NM_001163614 uc007gnh.1 2.05 0.050 483 + chr10 85391518 85408951 UCSC_kg NM_145422 AK033479 2.05 0.027 3562 - chr1 146867202 146870764 fantom3 predicte AK041010 2.04 0.017 1086 + chr4 32326403 32327486 d uc007dkt.1 2.04 0.018 4316 + chr1 MANUSCRIPT 168931605 169021141 UCSC_kg NM_001160262 uc007dkt.1 2.04 0.018 4316 + chr1 168931605 169021141 UCSC_kg NM_175461 uc007dkt.1 2.04 0.018 4316 + chr1 168931605 169021141 UCSC_kg NM_001160261 ENSMUST00000119909 2.03 0.017 387 - chr2 165750765 165751341 Ensembl chr4_ rando ENSMUST00000168749 2.03 0.035 1091 - m 41109 42202 Ensembl MM9LINCRNAEXON11621+ 2.02 0.039 2759 + chr13 98280390 98283149 lincRNA ENSMUST00000119135 2.02 0.039 1371 + chr7 48745720 48747091 Ensembl NM_001033530 chr1_ rando AW557181 2.02 0.005 487 + m 31011 31498 lincRNA ENSMUST00000129696 2.01 0.025 639 + chr1 38364746 38368775 Ensembl NM_010678 AK143705 2.00 0.033 2611 + chr10 96114479 96117090 fantom3

The table contains the following information about the DE downregulated lncRNAs: Sequence name (the sequence identifier of the LncRNA),ACCEPTED FC (Absolute Fold change is the absolute ratio (no log scale) of normalized intensities between two conditions), p-val (P-value, P-value calculated from t-test), length (RNA length), Chr (chromosome), S (DNA strand), Start and End (coding or non-coding genome location), , Source of the collection and Associated gene IS (the Accession number of the associated coding gene to the lncRNA).

* Source of LncRNA collection: - RefSeq_NR: RefSeq validated non-coding RNA - UCSC_kg: UCSC known genes annotated as "non-coding", "near-coding" and "antisense" (http://genome.ucsc.edu/cgi-bin/hgTables/) - lincRNA: lincRNA identified by John Rinn's group (Guttman et al. 2009; Khalil et al. 2009)

ACCEPTED MANUSCRIPT * Source of LncRNA collection: - RefSeq_NR: RefSeq validated non-coding RNA - UCSC_kg: UCSC known genes annotated as "non-coding", "near-coding" and "antisense" (http://genome.ucsc.edu/cgi-bin/hgTables/) - Ensembl: Ensembl (http://www.ensembl.org/index.html) - Fantom3: Fantom project (http://fantom.gsc.riken.jp/) - RNAdb: RNAdb2.0 (http://research.imb.uq.edu.au/rnadb/) - NRED: NRED (http://jsm-research.imb.uq.edu.au/nred/cgi-bin/ncrnadb.pl) - UCR: "ultra-conserved region" among human, mouse and rat (http://users.soe.ucsc.edu/~jill/ultra.html) - lincRNA: lincRNA identified by John Rinn's group (Guttman et al. 2009; Khalil et al. 2009)

MANUSCRIPT

ACCEPTED Ensembl gene ID log2FoldChange pvalue padjACCEPTED Gene symbol MANUSCRIPT biotype Description ENSMUSG00000082035 8.578651898 0.00135794 0.02707008 Rpl17-ps8 processed_pseudogene ribosomal protein L17, pseudogene 8 [Source:MGI Symbol;Acc:MGI:3802129] ENSMUSG00000030769 6.246271323 0.0030832 0.04474588 Slc5a11 protein_coding solute carrier family 5 (sodium/glucose cotransporter), member 11 [Source:MGI Symbol;Acc:MGI:1919316] ENSMUSG00000109509 6.078360439 7.87E-05 0.00469833 Rps12-ps4 processed_pseudogene ribosomal protein S12, pseudogene 4 [Source:MGI Symbol;Acc:MGI:3780139] ENSMUSG00000083929 5.9241466 0.00129223 0.02609515 Gm10600 protein_coding predicted gene 10600 [Source:MGI Symbol;Acc:MGI:3710628] ENSMUSG00000092412 5.913137354 0.00071292 0.01837021 Gm20507 processed_transcript predicted gene 20507 [Source:MGI Symbol;Acc:MGI:5141972] ENSMUSG00000022347 5.231533236 7.55E-05 0.00465523 A1bg protein_coding alpha-1-B glycoprotein [Source:MGI Symbol;Acc:MGI:2152878] ENSMUSG00000116933 4.995374545 0.00010579 0.00577426 NA NA NA ENSMUSG00000030519 4.434390369 0.00119917 0.02504481 Apba2 protein_coding amyloid beta (A4) precursor protein-binding, family A, member 2 [Source:MGI Symbol;Acc:MGI:1261791] ENSMUSG00000081620 4.117443904 0.00144498 0.02813986 Gm14633 processed_pseudogene predicted gene 14633 [Source:MGI Symbol;Acc:MGI:3705509] ENSMUSG00000089996 3.942851657 1.63E-05 0.00172278 Tmsb15b2 protein_coding thymosin beta 15b2 [Source:MGI Symbol;Acc:MGI:3843061] ENSMUSG00000081210 3.942536292 0.00267465 0.04120267 Gm12933 processed_pseudogene predicted gene 12933 [Source:MGI Symbol;Acc:MGI:3651147] ENSMUSG00000026149 3.915062813 0.0017201 0.03159802 Tm4sf20 protein_coding transmembrane 4 L six family member 20 [Source:MGI Symbol;Acc:MGI:1913511] ENSMUSG00000100862 3.889949579 0.0007589 0.01923603 Gm10925 unprocessed_pseudogene predicted gene 10925 [Source:MGI Symbol;Acc:MGI:3809095] ENSMUSG00000116665 3.73368505 0.00367495 0.0490186 NA NA NA ENSMUSG00000105565 3.616300799 0.00049499 0.01463048 Gm43566 sense_intronic predicted gene 43566 [Source:MGI Symbol;Acc:MGI:5663703] ENSMUSG00000036198 3.591620547 0.00024366 0.0096091 Arhgap36 protein_coding Rho GTPase activating protein 36 [Source:MGI Symbol;Acc:MGI:1922654] ENSMUSG00000052271 3.552453016 5.21E-06 0.00080001 Bhlha15 protein_coding basic helix-loop-helix family, member a15 [Source:MGI Symbol;Acc:MGI:891976] ENSMUSG00000031698 3.427598832 0.00198214 0.03443325 Mylk3 protein_coding myosin light chain kinase 3 [Source:MGI Symbol;Acc:MGI:2443063] ENSMUSG00000093826 3.326818321 0.00017029 0.00773717 Gm6900 processed_pseudogene predicted gene 6900 [Source:MGI Symbol;Acc:MGI:3645052] ENSMUSG00000029352 3.23613833 0.00010474 0.00573502 Crybb3 protein_coding crystallin, beta B3 [Source:MGI Symbol;Acc:MGI:102717] ENSMUSG00000082192 3.19417063 0.00295261 0.04391883 Gm14719 processed_pseudogene predicted gene 14719 [Source:MGI Symbol;Acc:MGI:3705771] ENSMUSG00000085172 3.191731935 0.00227143 0.03745674 Gm6542 processed_pseudogene predicted gene 6542 [Source:MGI Symbol;Acc:MGI:3644649] ENSMUSG00000026822 2.979666008 0.00044902 0.01384658 Lcn2 protein_coding lipocalin 2 [Source:MGI Symbol;Acc:MGI:96757] ENSMUSG00000058290 2.723933643 0.00040233 0.01292102 Espl1 protein_coding extra spindle pole bodies 1, separase [Source:MGI Symbol;Acc:MGI:2146156] ENSMUSG00000027533 2.635324453 0.00022088 0.0089846 Fabp5 protein_coding fatty acid binding protein 5, epidermal [Source:MGI Symbol;Acc:MGI:101790] ENSMUSG00000032482 2.462231933 9.43E-08 6.33E-05 Cspg5 protein_coding chondroitin sulfate proteoglycan 5 [Source:MGI Symbol;Acc:MGI:1352747] ENSMUSG00000026542 2.430650947 0.00067207 0.01782866 Apcs protein_coding serum amyloid P-component [Source:MGI Symbol;Acc:MGI:98229] ENSMUSG00000021091 2.285895504 0.00077158 0.01945272 Serpina3n protein_coding serine (or cysteine) peptidase inhibitor, clade A, member 3N [Source:MGI Symbol;Acc:MGI:105045] ENSMUSG00000038295 2.194433102 0.00247094 0.03956121 Atg9b protein_coding autophagy related 9B [Source:MGI Symbol;Acc:MGI:2685420] ENSMUSG00000072214 2.186088973 0.00308551 0.04474588 Sep-05 protein_coding septin 5 [Source:MGI Symbol;Acc:MGI:1195461] ENSMUSG00000049303 2.155639724 8.48E-05 0.0049451 Syt12 protein_coding synaptotagmin XII [Source:MGI Symbol;Acc:MGI:2159601] ENSMUSG00000106411 -2.000360997 0.0022405 0.0372342 Gm42445 TEC predicted gene 42445 [Source:MGI Symbol;Acc:MGI:5662582] ENSMUSG00000040118 -2.002869123 0.00211394 0.03589917 Cacna2d1 protein_coding calcium channel, voltage-dependent, alpha2/delta subunit 1 [Source:MGI Symbol;Acc:MGI:88295] ENSMUSG00000040703 -2.011340039 0.0003575 0.01192869 Cyp2s1 protein_coding cytochrome P450, family 2, subfamily s, polypeptide 1 [Source:MGI Symbol;Acc:MGI:1921384] ENSMUSG00000035403 -2.015055675 0.00207384 0.03542944 Crb2 protein_coding crumbs family member 2 [Source:MGI Symbol;Acc:MGI:2679260] ENSMUSG00000113667 -2.016404202 0.00319956 0.04562652 AC122840.3 processed_pseudogene ENSMUSG00000050315 -2.022252655 0.00073593 0.01873733 Synpo2 protein_coding synaptopodin 2 [Source:MGI Symbol;Acc:MGI:2153070] ENSMUSG00000032484 -2.023352463 0.00353678 0.04803053 Ngp protein_coding neutrophilic granule protein [Source:MGI Symbol;Acc:MGI:105983] ENSMUSG00000047414 -2.029629458 0.00022646 0.00910299 Flrt2 protein_coding fibronectin leucine rich transmembrane protein 2 [Source:MGI Symbol;Acc:MGI:3603594] ENSMUSG00000039585 -2.037656392 0.00033294 0.01144468 Myo9a protein_coding myosin IXa [Source:MGI Symbol;Acc:MGI:107735] ENSMUSG00000068699 -2.049540524 0.00183918 0.03300474 Flnc protein_coding filamin C, gamma [Source:MGI Symbol;Acc:MGI:95557] ENSMUSG00000020057 -2.051419453 2.00E-05 0.00196364 Dram1 protein_coding DNA-damage regulated autophagy modulator 1 [Source:MGI Symbol;Acc:MGI:1918962] ENSMUSG00000071203 -2.05406369 0.00182477 0.03291917 Naip5 protein_coding NLR family, apoptosis inhibitory protein 5 [Source:MGI Symbol;Acc:MGI:1298220] ENSMUSG00000040111 -2.054957818 0.00073001 0.01865183 Gramd1b protein_codingMANUSCRIPT GRAM domain containing 1B [Source:MGI Symbol;Acc:MGI:1925037] ENSMUSG00000087478 -2.057086835 0.00286244 0.04297174 4930506C21Rik processed_transcript RIKEN cDNA 4930506C21 gene [Source:MGI Symbol;Acc:MGI:1922310] ENSMUSG00000044017 -2.06656453 3.72E-05 0.00288945 Adgrd1 protein_coding adhesion G protein-coupled receptor D1 [Source:MGI Symbol;Acc:MGI:3041203] ENSMUSG00000054580 -2.076455684 0.00126663 0.0257916 Pla2r1 protein_coding phospholipase A2 receptor 1 [Source:MGI Symbol;Acc:MGI:102468] ENSMUSG00000102758 -2.081526912 0.00143683 0.02803187 Naaladl2 protein_coding N-acetylated alpha-linked acidic dipeptidase-like 2 [Source:MGI Symbol;Acc:MGI:2685867] ENSMUSG00000059486 -2.082464938 4.37E-10 1.20E-06 Kbtbd2 protein_coding kelch repeat and BTB (POZ) domain containing 2 [Source:MGI Symbol;Acc:MGI:2384811] ENSMUSG00000017002 -2.083370429 1.96E-07 9.85E-05 Slpi protein_coding secretory leukocyte peptidase inhibitor [Source:MGI Symbol;Acc:MGI:109297] ENSMUSG00000030970 -2.085869421 1.15E-05 0.00137224 Ctbp2 protein_coding C-terminal binding protein 2 [Source:MGI Symbol;Acc:MGI:1201686] ENSMUSG00000027015 -2.09541743 0.00077089 0.01945272 Cybrd1 protein_coding cytochrome b reductase 1 [Source:MGI Symbol;Acc:MGI:2654575] ENSMUSG00000112226 -2.098264777 0.00017299 0.00776511 AC152979.2 processed_pseudogene ENSMUSG00000105247 -2.101502452 0.00028343 0.01039094 Gm42519 TEC predicted gene 42519 [Source:MGI Symbol;Acc:MGI:5662656] ENSMUSG00000105370 -2.108119955 0.00164668 0.03064617 Gm42718 processed_pseudogene predicted gene 42718 [Source:MGI Symbol;Acc:MGI:5662855] ENSMUSG00000103222 -2.117663395 0.00054359 0.01537524 Gm37729 TEC predicted gene, 37729 [Source:MGI Symbol;Acc:MGI:5610957] ENSMUSG00000039497 -2.129299828 6.70E-06 0.00098677 Dse protein_coding dermatan sulfate epimerase [Source:MGI Symbol;Acc:MGI:2443455] ENSMUSG00000097695 -2.137372777 2.79E-05 0.00233937 Gm26905 lincRNA predicted gene, 26905 [Source:MGI Symbol;Acc:MGI:5477399] ENSMUSG00000055704 -2.140930897 0.00141134 0.02765054 Gm9978 TEC predicted gene 9978 [Source:MGI Symbol;Acc:MGI:3641806] ENSMUSG00000027070 -2.141597549 0.0011987 0.02504481 Lrp2 protein_coding low density lipoprotein receptor-related protein 2 [Source:MGI Symbol;Acc:MGI:95794] ENSMUSG00000044042 -2.141884587 9.31E-05 0.00526702 Fmn1 protein_coding formin 1 [Source:MGI Symbol;Acc:MGI:101815] transcribed_unprocessed_ ENSMUSG00000053168 -2.147155597 3.93E-06 0.0007065 9030619P08Rik pseudogene RIKEN cDNA 9030619P08 gene [Source:MGI Symbol;Acc:MGI:3612405] ENSMUSG00000037852 -2.147413415 5.53E-07 0.0002009 Cpe protein_coding carboxypeptidase E [Source:MGI Symbol;Acc:MGI:101932] ENSMUSG00000026779 -2.150251671 0.00234184 0.038212 Mastl protein_coding microtubule associated serine/threonine kinase-like [Source:MGI Symbol;Acc:MGI:1914371] ENSMUSG00000092341 -2.154023106 0.00201567 0.03467848 Malat1 lincRNA metastasis associated lung adenocarcinoma transcript 1 (non-coding RNA) [Source:MGI Symbol;Acc:MGI:1919539] ENSMUSG00000022385 -2.157557858 0.00031633 0.01119459 Gtse1 protein_coding G two S phase expressed protein 1 [Source:MGI Symbol;Acc:MGI:1352755] ENSMUSG00000113146 -2.161654501ACCEPTED 0.000473 0.01425175 AC126043.1 processed_pseudogene ENSMUSG00000114407 -2.172261114 1.79E-05 0.00183559 AC124562.2 antisense_RNA ENSMUSG00000048498 -2.173869513 0.00076709 0.01941479 Cd300e protein_coding CD300E molecule [Source:MGI Symbol;Acc:MGI:2387602] ENSMUSG00000113032 -2.177839457 1.88E-06 0.00043322 AC158633.3 antisense_RNA ENSMUSG00000094747 -2.192921732 4.53E-05 0.00328832 Olfr1307 protein_coding olfactory receptor 1307 [Source:MGI Symbol;Acc:MGI:3031141] ENSMUSG00000047798 -2.195617841 0.00139241 0.02744415 Cd300lf protein_coding CD300 molecule like family member F [Source:MGI Symbol;Acc:MGI:2442359] ENSMUSG00000067786 -2.197088205 0.00136634 0.02711104 Nnat protein_coding neuronatin [Source:MGI Symbol;Acc:MGI:104716] ENSMUSG00000061653 -2.201128818 0.00038294 0.01253284 Vmn1r46 protein_coding vomeronasal 1 receptor 46 [Source:MGI Symbol;Acc:MGI:2148519] ENSMUSG00000115030 -2.209642203 0.00289049 0.04331678 NA NA NA ENSMUSG00000038126 -2.21654619 0.00101185 0.02285254 Mphosph9 protein_coding M-phase phosphoprotein 9 [Source:MGI Symbol;Acc:MGI:2443138] ENSMUSG00000090077 -2.226533985 3.95E-05 0.00298907 Lime1 protein_coding Lck interacting transmembrane adaptor 1 [Source:MGI Symbol;Acc:MGI:1919949] ENSMUSG00000021338 -2.235625353 2.28E-07 0.00011114 Carmil1 protein_coding capping protein regulator and myosin 1 linker 1 [Source:MGI Symbol;Acc:MGI:1915982] ENSMUSG00000026276 -2.236687424 1.58E-05 0.00168686 Sep-02 protein_coding septin 2 [Source:MGI Symbol;Acc:MGI:97298] ENSMUSG00000091239 -2.242551406 0.00059095 0.01628346 Vmn2r76 protein_coding vomeronasal 2, receptor 76 [Source:MGI Symbol;Acc:MGI:3761332] ENSMUSG00000067430 -2.256458524 0.00050336 0.01482647 Zfp763 protein_coding zinc finger protein 763 [Source:MGI Symbol;Acc:MGI:1920701] ENSMUSG00000026565 -2.257871311 1.46E-06 0.00036637 Pou2f1 protein_coding POU domain, class 2, transcription factor 1 [Source:MGI Symbol;Acc:MGI:101898] ENSMUSG00000102095 -2.26251558 0.00125353 0.02572536 C730036E19Rik lincRNA RIKEN cDNA C730036E19 gene [Source:MGI Symbol;Acc:MGI:3028040] Ensembl gene ID log2FoldChange pvalue padjACCEPTED Gene symbol MANUSCRIPT biotype Description ENSMUSG00000091228 7.655353496 0.00059102 0.00702431 Gm20390 protein_coding predicted gene 20390 [Source:MGI Symbol;Acc:MGI:5141855] ENSMUSG00000018868 7.556916179 1.17E-07 7.76E-06 Pnpla5 protein_coding patatin-like phospholipase domain containing 5 [Source:MGI Symbol;Acc:MGI:1923022] ENSMUSG00000114818 7.318439419 9.55E-10 1.39E-07 AC154612.1 lincRNA ENSMUSG00000078901 7.002877667 0.00163822 0.01513646 Gm14440 protein_coding predicted gene 14440 [Source:MGI Symbol;Acc:MGI:3702430] ENSMUSG00000113630 6.561497127 0.00019261 0.00299686 CT010460.2 lincRNA

ENSMUSG00000098369 6.5378131 0.007743 0.04862324 Gm2274 unprocessed_pseudogene predicted gene 2274 [Source:MGI Symbol;Acc:MGI:3780444] ENSMUSG00000104156 6.39786987 1.38E-08 1.39E-06 Gm38102 lincRNA predicted gene, 38102 [Source:MGI Symbol;Acc:MGI:5611330] ENSMUSG00000083929 6.37062402 0.0005046 0.00620183 Gm10600 protein_coding predicted gene 10600 [Source:MGI Symbol;Acc:MGI:3710628] ENSMUSG00000109129 6.297555491 0.00419718 0.03094717 Gm44973 protein_coding predicted gene 44973 [Source:MGI Symbol;Acc:MGI:5753549] ENSMUSG00000027577 6.218092066 2.11E-29 3.61E-25 Chrna4 protein_coding cholinergic receptor, nicotinic, alpha polypeptide 4 [Source:MGI Symbol;Acc:MGI:87888] ENSMUSG00000106889 6.204815331 8.00E-05 0.0015143 Gm7463 processed_pseudogene predicted gene 7463 [Source:MGI Symbol;Acc:MGI:3645336] ENSMUSG00000029663 6.111913164 6.12E-06 0.00019042 Gngt1 protein_coding guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 [Source:MGI Symbol;Acc:MGI:109165] ENSMUSG00000027716 5.925152742 5.41E-07 2.66E-05 Trpc3 protein_coding transient receptor potential cation channel, subfamily C, member 3 [Source:MGI Symbol;Acc:MGI:109526] ENSMUSG00000079620 5.896924184 0.00060359 0.00712927 Muc4 protein_coding mucin 4 [Source:MGI Symbol;Acc:MGI:2153525] ENSMUSG00000038379 5.696443029 0.00042013 0.00543038 Ttk protein_coding Ttk protein kinase [Source:MGI Symbol;Acc:MGI:1194921] ENSMUSG00000085834 5.652874815 0.00019054 0.00297828 Gm15622 antisense_RNA predicted gene 15622 [Source:MGI Symbol;Acc:MGI:3783067] ENSMUSG00000079243 5.507489907 3.70E-08 3.01E-06 Xirp1 protein_coding xin actin-binding repeat containing 1 [Source:MGI Symbol;Acc:MGI:1333878] ENSMUSG00000041468 5.493818638 0.0004135 0.00536801 Gpr12 protein_coding G-protein coupled receptor 12 [Source:MGI Symbol;Acc:MGI:101909] ENSMUSG00000090610 5.491368904 6.03E-05 0.00121034 Gm3571 processed_pseudogene predicted gene 3571 [Source:MGI Symbol;Acc:MGI:3781748] ENSMUSG00000028240 5.475133316 5.14E-05 0.00107577 Cyp7a1 protein_coding cytochrome P450, family 7, subfamily a, polypeptide 1 [Source:MGI Symbol;Acc:MGI:106091] ENSMUSG00000041653 5.359648613 3.40E-15 2.42E-12 Pnpla3 protein_coding patatin-like phospholipase domain containing 3 [Source:MGI Symbol;Acc:MGI:2151796] ENSMUSG00000037509 5.253984735 0.00055385 0.00665562 Arhgef4 protein_coding Rho guanine nucleotide exchange factor (GEF) 4 [Source:MGI Symbol;Acc:MGI:2442507] ENSMUSG00000078503 5.220894632 0.00182808 0.01648067 Zfp990 protein_coding zinc finger protein 990 [Source:MGI Symbol;Acc:MGI:3652161] ENSMUSG00000028587 5.212916168 3.94E-05 0.00086505 Orc1 protein_coding origin recognition complex, subunit 1 [Source:MGI Symbol;Acc:MGI:1328337] ENSMUSG00000114452 5.128964407 0.00280775 0.02296196 AC123619.1 lincRNA

ENSMUSG00000110757 5.104602699 0.00401654 0.02988617 AC159308.1 unprocessed_pseudogene ENSMUSG00000110488 5.076736858 0.00026165 0.0037882 Gm45724 TEC predicted gene 45724 [Source:MGI Symbol;Acc:MGI:5804839] ENSMUSG00000026058 5.038270688 0.00064646 0.00748756 Khdrbs2 protein_coding KH domain containing, RNA binding, signal transduction associated 2 [Source:MGI Symbol;Acc:MGI:2159649] ENSMUSG00000025582 4.972433297 0.00020237 0.00311749 Nptx1 protein_coding neuronal pentraxin 1 [Source:MGI Symbol;Acc:MGI:107811] ENSMUSG00000036027 4.920486992 0.00046456 0.00584587 1810046K07Rik protein_coding RIKEN cDNA 1810046K07 gene [Source:MGI Symbol;Acc:MGI:1917059] ENSMUSG00000021613 4.801607379 0.00074127 0.00829331 Hapln1 protein_coding hyaluronan and proteoglycan link protein 1 [Source:MGI Symbol;Acc:MGI:1337006] ENSMUSG00000027762 4.767926484 7.30E-09 8.28E-07 Sucnr1 protein_coding succinate receptor 1 [Source:MGI Symbol;Acc:MGI:1934135] ENSMUSG00000092499 4.761613251 0.00119091 0.01188403 1700092C10Rik antisense_RNA RIKEN cDNA 1700092C10 gene [Source:MGI Symbol;Acc:MGI:1920804] ENSMUSG00000072978 4.745276449 0.00368179 0.0279803 Gm5830 processed_pseudogene predicted pseudogene 5830 [Source:MGI Symbol;Acc:MGI:3647375] ENSMUSG00000104501 4.708280406 2.27E-14 1.29E-11 Gm37736 TEC predicted gene, 37736 [Source:MGI Symbol;Acc:MGI:5610964] ENSMUSG00000087173 4.641867253 0.00281813 0.02302483 Gm11337 antisense_RNA predicted gene 11337 [Source:MGI Symbol;Acc:MGI:3651858] transcribed_processed_ps ENSMUSG00000049249 4.63491528 0.00083468 0.00899636 Gm5316 eudogene predicted gene 5316 [Source:MGI Symbol;Acc:MGI:3645576] ENSMUSG00000103539 4.612639544 0.00352379 0.02706097 Gm37834 TEC predicted gene, 37834 [Source:MGI Symbol;Acc:MGI:5611062] ENSMUSG00000090217 4.527477158 0.00134053 0.01299748 Gm16116 antisense_RNA predicted gene 16116 [Source:MGI Symbol;Acc:MGI:3802040] ENSMUSG00000021983 4.445154515 0.00110366 0.01118071 Atp8a2 protein_coding ATPase, aminophospholipid transporter-like, class I, type 8A, member 2 [Source:MGI Symbol;Acc:MGI:1354710] ENSMUSG00000095562 4.442156684 0.00035341 0.00478426 Gm21887 protein_coding predicted gene, 21887 [Source:MGI Symbol;Acc:MGI:5434051] ENSMUSG00000008307 4.390542363 4.72E-05 0.00100106 1700109H08Rik protein_codingMANUSCRIPT RIKEN cDNA 1700109H08 gene [Source:MGI Symbol;Acc:MGI:1924286] ENSMUSG00000112109 4.340205901 0.00301483 0.0241469 AC159466.1 lincRNA ENSMUSG00000115575 4.289703725 0.00191365 0.01706304 NA NA NA ENSMUSG00000042942 4.277495542 0.00026458 0.00382093 Greb1l protein_coding growth regulation by estrogen in breast cancer-like [Source:MGI Symbol;Acc:MGI:3576497] ENSMUSG00000038751 4.232831062 1.08E-06 4.68E-05 Ptk6 protein_coding PTK6 protein tyrosine kinase 6 [Source:MGI Symbol;Acc:MGI:99683] ENSMUSG00000109674 4.189154707 1.76E-05 0.00045508 Gm45470 antisense_RNA predicted gene 45470 [Source:MGI Symbol;Acc:MGI:5791306] ENSMUSG00000035686 4.128881478 7.28E-15 4.61E-12 Thrsp protein_coding thyroid hormone responsive [Source:MGI Symbol;Acc:MGI:109126] ENSMUSG00000097783 4.123141283 0.00162196 0.01501229 Gm26747 lincRNA predicted gene, 26747 [Source:MGI Symbol;Acc:MGI:5477241] ENSMUSG00000106030 4.116066957 0.00043829 0.00558783 Gm43611 TEC predicted gene 43611 [Source:MGI Symbol;Acc:MGI:5663748] ENSMUSG00000102982 4.097369018 0.00619982 0.04130959 Gm38319 TEC predicted gene, 38319 [Source:MGI Symbol;Acc:MGI:5611547] ENSMUSG00000030346 4.037321012 0.00029977 0.00420281 Rad51ap1 protein_coding RAD51 associated protein 1 [Source:MGI Symbol;Acc:MGI:1098224] ENSMUSG00000114977 4.033627487 0.00628209 0.04170652 NA NA NA ENSMUSG00000112615 3.991873238 8.58E-07 3.83E-05 AC125041.3 processed_pseudogene ENSMUSG00000073102 3.985941714 2.05E-05 0.00051538 Drc1 protein_coding dynein regulatory complex subunit 1 [Source:MGI Symbol;Acc:MGI:2685906] ENSMUSG00000083287 3.967598014 1.39E-05 0.00037483 Gm13502 processed_pseudogene predicted gene 13502 [Source:MGI Symbol;Acc:MGI:3649894] ENSMUSG00000074987 3.95961045 0.00520549 0.0362481 Wt1os antisense_RNA Wilms tumor 1 homolog, opposite strand [Source:MGI Symbol;Acc:MGI:2138884] ENSMUSG00000113063 3.921937401 9.02E-08 6.26E-06 AC141642.1 lincRNA ENSMUSG00000089901 3.857546403 0.00225682 0.01938434 Gm8113 protein_coding predicted gene 8113 [Source:MGI Symbol;Acc:MGI:3648791] ENSMUSG00000037579 3.84482561 0.00010801 0.00191844 Kcnh3 protein_coding potassium voltage-gated channel, subfamily H (eag-related), member 3 [Source:MGI Symbol;Acc:MGI:1341723] ENSMUSG00000071532 3.781318082 0.00598352 0.04021858 Gm10335 processed_pseudogene predicted gene 10335 [Source:MGI Symbol;Acc:MGI:3641693] ENSMUSG00000101211 3.779276392 0.00096971 0.01011905 Gm28818 lincRNA predicted gene 28818 [Source:MGI Symbol;Acc:MGI:5579524] ENSMUSG00000045776 3.772725871 5.76E-05 0.00117041 Lrtm1 protein_coding leucine-rich repeats and transmembrane domains 1 [Source:MGI Symbol;Acc:MGI:2442106] ENSMUSG00000090031 3.749024954 0.00252049 0.02111867 4732440D04Rik antisense_RNA RIKEN cDNA 4732440D04 gene [Source:MGI Symbol;Acc:MGI:3604103] ENSMUSG00000058258 3.748522772 4.66E-16 4.43E-13 Idi1 protein_coding isopentenyl-diphosphate delta isomerase [Source:MGI Symbol;Acc:MGI:2442264] bidirectional_promoter_ln ENSMUSG00000074052 3.736200583ACCEPTED 0.00085366 0.00913779 BC048644 cRNA cDNA sequence BC048644 [Source:MGI Symbol;Acc:MGI:3039566] ENSMUSG00000017499 3.722268842 5.52E-07 2.69E-05 Cdc6 protein_coding cell division cycle 6 [Source:MGI Symbol;Acc:MGI:1345150] ENSMUSG00000023940 3.712738045 0.00105036 0.01074514 Sgo1 protein_coding shugoshin 1 [Source:MGI Symbol;Acc:MGI:1919665] ENSMUSG00000074657 3.70895992 0.00019736 0.00306026 Kif5a protein_coding kinesin family member 5A [Source:MGI Symbol;Acc:MGI:109564] ENSMUSG00000037572 3.68346262 0.00052036 0.00634984 Wdhd1 protein_coding WD repeat and HMG-box DNA binding protein 1 [Source:MGI Symbol;Acc:MGI:2443514] ENSMUSG00000111429 3.673973428 0.00014739 0.00245417 AC098716.1 antisense_RNA ENSMUSG00000095143 3.619397415 0.00053447 0.00648496 Hsd3b4 protein_coding hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 4 [Source:MGI Symbol;Acc:MGI:96236] ENSMUSG00000049493 3.562750773 2.41E-05 0.00058353 Pls1 protein_coding plastin 1 (I-isoform) [Source:MGI Symbol;Acc:MGI:104809] ENSMUSG00000108105 3.55386375 7.06E-05 0.001381 Gm5340 processed_pseudogene predicted gene 5340 [Source:MGI Symbol;Acc:MGI:3779484] ENSMUSG00000051452 3.547341641 3.33E-11 7.58E-09 Gm11437 protein_coding predicted gene 11437 [Source:MGI Symbol;Acc:MGI:3650287] ENSMUSG00000027579 3.537811179 8.56E-08 6.09E-06 Srms protein_coding src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites [Source:MGI Symbol;Acc:MGI:101865] ENSMUSG00000100550 3.52680222 0.00080159 0.00876226 2310039L15Rik lincRNA RIKEN cDNA 2310039L15 gene [Source:MGI Symbol;Acc:MGI:1916879]

ENSMUSG00000092471 3.488939093 3.38E-05 0.00076576 Cyp21a2-ps unprocessed_pseudogene cytochrome P450, family 21, subfamily a, polypeptide 2 pseudogene [Source:MGI Symbol;Acc:MGI:3645529] ENSMUSG00000065952 3.479429223 1.76E-08 1.69E-06 C330021F23Rik protein_coding RIKEN cDNA C330021F23 gene [Source:MGI Symbol;Acc:MGI:3612471] ENSMUSG00000046005 3.476262284 0.00505189 0.03545873 D830044D21Rik lincRNA RIKEN cDNA D830044D21 gene [Source:MGI Symbol;Acc:MGI:2444378] ENSMUSG00000031712 3.47129275 0.00038566 0.00509171 Il15 protein_coding interleukin 15 [Source:MGI Symbol;Acc:MGI:103014] ENSMUSG00000022523 3.463669276 0.00250562 0.02103849ACCEPTED Fgf12 protein_coding MANUSCRIPT fibroblast growth factor 12 [Source:MGI Symbol;Acc:MGI:109183] ENSMUSG00000021010 3.446475906 0.004299 0.03146703 Npas3 protein_coding neuronal PAS domain protein 3 [Source:MGI Symbol;Acc:MGI:1351610] ENSMUSG00000062209 3.402198047 0.00053649 0.00650032 Erbb4 protein_coding erb-b2 receptor tyrosine kinase 4 [Source:MGI Symbol;Acc:MGI:104771] ENSMUSG00000106535 3.391249556 0.00010919 0.00193638 Gm43031 sense_intronic predicted gene 43031 [Source:MGI Symbol;Acc:MGI:5663168] ENSMUSG00000116885 3.385059957 0.00504691 0.03543832 NA NA NA ENSMUSG00000028536 3.377261802 1.03E-17 1.47E-14 2610528J11Rik protein_coding RIKEN cDNA 2610528J11 gene [Source:MGI Symbol;Acc:MGI:1913701] ENSMUSG00000111074 3.338420009 7.01E-07 3.23E-05 AC160051.1 lincRNA ENSMUSG00000043629 3.311247282 0.00598 0.04021858 1700019D03Rik protein_coding RIKEN cDNA 1700019D03 gene [Source:MGI Symbol;Acc:MGI:1914330] ENSMUSG00000022034 3.309335969 0.0014501 0.01372715 Esco2 protein_coding establishment of sister chromatid cohesion N-acetyltransferase 2 [Source:MGI Symbol;Acc:MGI:1919238] ENSMUSG00000079110 3.307622145 0.00021642 0.0032749 Capn3 protein_coding calpain 3 [Source:MGI Symbol;Acc:MGI:107437] ENSMUSG00000021221 3.298741463 0.00190689 0.01704724 Dpf3 protein_coding D4, zinc and double PHD fingers, family 3 [Source:MGI Symbol;Acc:MGI:1917377] ENSMUSG00000032500 3.293520818 1.22E-13 5.62E-11 Dclk3 protein_coding doublecortin-like kinase 3 [Source:MGI Symbol;Acc:MGI:3039580] ENSMUSG00000045094 3.278332701 1.64E-10 3.04E-08 Arhgef37 protein_coding Rho guanine nucleotide exchange factor (GEF) 37 [Source:MGI Symbol;Acc:MGI:3045339] ENSMUSG00000117011 3.274913522 0.00086199 0.00920336 NA NA NA ENSMUSG00000035365 3.241065534 0.002852 0.02321275 Parpbp protein_coding PARP1 binding protein [Source:MGI Symbol;Acc:MGI:1922567]

ENSMUSG00000092075 3.237929477 1.31E-10 2.54E-08 Serpina4-ps1 unprocessed_pseudogene serine (or cysteine) peptidase inhibitor, clade A, member 4, pseudogene 1 [Source:MGI Symbol;Acc:MGI:2448363] ENSMUSG00000034774 3.228898822 1.35E-10 2.59E-08 Dsg1c protein_coding desmoglein 1 gamma [Source:MGI Symbol;Acc:MGI:2664358] ENSMUSG00000038246 3.224899248 0.00730435 0.04666696 Fam50b protein_coding family with sequence similarity 50, member B [Source:MGI Symbol;Acc:MGI:1351640] ENSMUSG00000038233 3.220455793 2.58E-14 1.38E-11 Fam198a protein_coding family with sequence similarity 198, member A [Source:MGI Symbol;Acc:MGI:3041196] ENSMUSG00000037474 3.196076311 7.89E-10 1.18E-07 Dtl protein_coding denticleless E3 ubiquitin protein ligase [Source:MGI Symbol;Acc:MGI:1924093] ENSMUSG00000098318 3.185556808 0.00128727 0.01260271 Lockd lincRNA lncRNA downstream of Cdkn1b [Source:MGI Symbol;Acc:MGI:1915081] ENSMUSG00000030219 3.135955242 0.007416 0.0471862 Erp27 protein_coding endoplasmic reticulum protein 27 [Source:MGI Symbol;Acc:MGI:1916437] ENSMUSG00000038112 3.135034192 0.00575967 0.03904689 AW551984 protein_coding expressed sequence AW551984 [Source:MGI Symbol;Acc:MGI:2143322] ENSMUSG00000102525 3.132451306 7.17E-18 1.22E-14 Gm37784 processed_pseudogene predicted gene, 37784 [Source:MGI Symbol;Acc:MGI:5611012] ENSMUSG00000093930 3.129053198 2.46E-21 1.05E-17 Hmgcs1 protein_coding 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 [Source:MGI Symbol;Acc:MGI:107592] ENSMUSG00000028687 3.123119623 1.83E-05 0.00046555 Mutyh protein_coding mutY DNA glycosylase [Source:MGI Symbol;Acc:MGI:1917853] ENSMUSG00000113543 3.116961819 2.97E-07 1.62E-05 AC125484.1 lincRNA ENSMUSG00000024694 3.116671629 4.53E-22 2.58E-18 Keg1 protein_coding kidney expressed gene 1 [Source:MGI Symbol;Acc:MGI:1928492] ENSMUSG00000078773 3.110362403 0.00010235 0.00185032 Rad54b protein_coding RAD54 homolog B (S. cerevisiae) [Source:MGI Symbol;Acc:MGI:3605986] ENSMUSG00000097095 3.105784232 1.05E-05 0.00030325 Gm26547 lincRNA predicted gene, 26547 [Source:MGI Symbol;Acc:MGI:5477041] ENSMUSG00000097503 3.091015436 7.97E-07 3.58E-05 3110045C21Rik antisense_RNA RIKEN cDNA 3110045C21 gene [Source:MGI Symbol;Acc:MGI:1914553] ENSMUSG00000045294 3.075109376 8.80E-20 2.51E-16 Insig1 protein_coding insulin induced gene 1 [Source:MGI Symbol;Acc:MGI:1916289] ENSMUSG00000086929 3.056085001 0.00624276 0.04153088 Gm11788 antisense_RNA predicted gene 11788 [Source:MGI Symbol;Acc:MGI:3649943] ENSMUSG00000063730 3.047977245 4.58E-11 1.03E-08 Hsd3b2 protein_coding hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 [Source:MGI Symbol;Acc:MGI:96234] ENSMUSG00000116341 3.038316475 0.00116123 0.01164227 NA NA NA ENSMUSG00000023959 3.020539102 1.85E-14 1.09E-11 Clic5 protein_coding chloride intracellular channel 5 [Source:MGI Symbol;Acc:MGI:1917912] ENSMUSG00000024056 3.011476403 0.00373271 0.02824634 Ndc80 protein_coding NDC80 kinetochore complex component [Source:MGI Symbol;Acc:MGI:1914302] ENSMUSG00000030149 3.011394117 0.00516945 0.03604687 Klrk1 protein_coding killer cell lectin-like receptor subfamily K, member 1 [Source:MGI Symbol;Acc:MGI:1196250] ENSMUSG00000114433 3.001004136 0.00205315 0.01802905 AC124392.1 lincRNA ENSMUSG00000041372 2.997770557 8.31E-14 3.94E-11 B4galnt3 protein_coding beta-1,4-N-acetyl-galactosaminyl transferase 3 [Source:MGI Symbol;Acc:MGI:3041155] ENSMUSG00000026839 2.967560506 8.62E-05 0.00161276 Upp2 protein_coding uridine phosphorylase 2 [Source:MGI Symbol;Acc:MGI:1923904] ENSMUSG00000039099 2.967172753 0.0022151 0.0191177 Wdr93 protein_coding WD repeat domain 93 [Source:MGI Symbol;Acc:MGI:3646885] ENSMUSG00000031489 2.956941953 0.00036677 0.00492282 Adrb3 protein_coding adrenergic receptor, beta 3 [Source:MGI Symbol;Acc:MGI:87939] ENSMUSG00000110755 2.955698307 0.00017195 0.00275447 AC151971.2 lincRNA ENSMUSG00000055733 2.941033215 0.00080963 0.00882684 Nap1l3 protein_codingMANUSCRIPT nucleosome assembly protein 1-like 3 [Source:MGI Symbol;Acc:MGI:1859565] ENSMUSG00000027965 2.939841955 1.36E-06 5.54E-05 Olfm3 protein_coding olfactomedin 3 [Source:MGI Symbol;Acc:MGI:2387329] ENSMUSG00000034159 2.933543713 0.00016701 0.00270186 2310007B03Rik protein_coding RIKEN cDNA 2310007B03 gene [Source:MGI Symbol;Acc:MGI:1919124] ENSMUSG00000042834 2.933365014 3.13E-13 1.30E-10 Nrep protein_coding neuronal regeneration related protein [Source:MGI Symbol;Acc:MGI:99444] ENSMUSG00000033031 2.928506464 0.00021685 0.00327852 C330027C09Rik protein_coding RIKEN cDNA C330027C09 gene [Source:MGI Symbol;Acc:MGI:2146335] ENSMUSG00000041498 2.924936825 0.00137415 0.0132018 Kif14 protein_coding kinesin family member 14 [Source:MGI Symbol;Acc:MGI:1098226] ENSMUSG00000025001 2.901787131 1.60E-06 6.39E-05 Hells protein_coding helicase, lymphoid specific [Source:MGI Symbol;Acc:MGI:106209] ENSMUSG00000037709 2.899293981 8.06E-09 8.88E-07 Fam13a protein_coding family with sequence similarity 13, member A [Source:MGI Symbol;Acc:MGI:1889842] ENSMUSG00000021747 2.898125242 0.00055022 0.00662905 4930452B06Rik protein_coding RIKEN cDNA 4930452B06 gene [Source:MGI Symbol;Acc:MGI:1926154] ENSMUSG00000110353 2.87951152 7.58E-11 1.56E-08 Gm45531 protein_coding predicted gene, 33543 [Source:MGI Symbol;Acc:MGI:5592702] ENSMUSG00000050445 2.878207224 2.38E-08 2.11E-06 Cyp8b1 protein_coding cytochrome P450, family 8, subfamily b, polypeptide 1 [Source:MGI Symbol;Acc:MGI:1338044] ENSMUSG00000102095 2.861911537 0.00021116 0.00321231 C730036E19Rik lincRNA RIKEN cDNA C730036E19 gene [Source:MGI Symbol;Acc:MGI:3028040] ENSMUSG00000104528 2.852181258 0.00032144 0.00443448 Gm43314 TEC predicted gene 43314 [Source:MGI Symbol;Acc:MGI:5663451] ENSMUSG00000094613 2.846274428 0.00722529 0.04628301 A630076J17Rik protein_coding RIKEN cDNA A630076J17 gene [Source:MGI Symbol;Acc:MGI:2442999] ENSMUSG00000048938 2.845994808 0.00387585 0.02905442 Nr1h5 protein_coding nuclear receptor subfamily 1, group H, member 5 [Source:MGI Symbol;Acc:MGI:3026618] ENSMUSG00000102702 2.831838243 0.00698753 0.04526921 Gm37260 TEC predicted gene, 37260 [Source:MGI Symbol;Acc:MGI:5610488] ENSMUSG00000032066 2.807530702 8.44E-18 1.31E-14 Bco2 protein_coding beta-carotene oxygenase 2 [Source:MGI Symbol;Acc:MGI:2177469] ENSMUSG00000046794 2.792157885 2.49E-14 1.37E-11 Ppp1r3b protein_coding protein phosphatase 1, regulatory (inhibitor) subunit 3B [Source:MGI Symbol;Acc:MGI:2177268] ENSMUSG00000047757 2.787302266 0.00590301 0.03984474 Fancb protein_coding Fanconi anemia, complementation group B [Source:MGI Symbol;Acc:MGI:2448558] ENSMUSG00000074623 2.775155262 0.00373915 0.02827782 Gm826 protein_coding predicted gene 826 [Source:MGI Symbol;Acc:MGI:2685672] ENSMUSG00000032357 2.757741508 0.00579512 0.03923402 Tinag protein_coding tubulointerstitial nephritis antigen [Source:MGI Symbol;Acc:MGI:1349477] ENSMUSG00000062510 2.754023419 0.0010182 0.01051692 Nsl1 protein_coding NSL1, MIS12 kinetochore complex component [Source:MGI Symbol;Acc:MGI:2685830] ENSMUSG00000057068 2.730845007 6.69E-11 1.43E-08 Fam47e protein_coding family with sequence similarity 47, member E [Source:MGI Symbol;Acc:MGI:2686227] ENSMUSG00000019214 2.72971928 0.00012827 0.00221571 Chtf18 protein_coding CTF18, chromosome transmission fidelity factor 18 [Source:MGI Symbol;Acc:MGI:2384887] ENSMUSG00000104520 2.727627839 0.00013818 0.0023536 Gm37336 lincRNA predicted gene, 37336 [Source:MGI Symbol;Acc:MGI:5610564] ENSMUSG00000025588 2.716113985ACCEPTED 0.00305208 0.02437667 Nat1 protein_coding N-acetyl transferase 1 [Source:MGI Symbol;Acc:MGI:97279] ENSMUSG00000117485 2.715136026 1.90E-11 4.57E-09 NA NA NA ENSMUSG00000086610 2.680656815 0.00044571 0.00565712 Gm15408 lincRNA predicted gene 15408 [Source:MGI Symbol;Acc:MGI:3705101] ENSMUSG00000058897 2.673541317 0.00353355 0.02709475 Col25a1 protein_coding collagen, type XXV, alpha 1 [Source:MGI Symbol;Acc:MGI:1924268] ENSMUSG00000008153 2.673486641 1.49E-08 1.47E-06 Clstn3 protein_coding calsyntenin 3 [Source:MGI Symbol;Acc:MGI:2178323] ENSMUSG00000047048 2.669855936 0.00654791 0.04312432 Olfr432 protein_coding olfactory receptor 432 [Source:MGI Symbol;Acc:MGI:3030266] ENSMUSG00000038403 2.668821085 9.60E-17 1.02E-13 Hfe2 protein_coding hemochromatosis type 2 (juvenile) [Source:MGI Symbol;Acc:MGI:1916835] ENSMUSG00000049353 2.661324239 0.00013011 0.00223852 Rd3 protein_coding retinal degeneration 3 [Source:MGI Symbol;Acc:MGI:1921273] ENSMUSG00000035226 2.658907702 0.00518009 0.03610637 Rims4 protein_coding regulating synaptic membrane exocytosis 4 [Source:MGI Symbol;Acc:MGI:2674366] ENSMUSG00000032420 2.647188468 0.00141311 0.01347938 Nt5e protein_coding 5' nucleotidase, ecto [Source:MGI Symbol;Acc:MGI:99782] ENSMUSG00000069733 2.644928368 0.00043019 0.00552585 Ube2u protein_coding ubiquitin-conjugating enzyme E2U (putative) [Source:MGI Symbol;Acc:MGI:3588216] ENSMUSG00000048489 2.642053205 2.37E-08 2.11E-06 8430408G22Rik protein_coding RIKEN cDNA 8430408G22 gene [Source:MGI Symbol;Acc:MGI:1918730] ENSMUSG00000041044 2.634137024 1.03E-08 1.09E-06 Lrit1 protein_coding leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 [Source:MGI Symbol;Acc:MGI:2385320] ENSMUSG00000020381 2.629277004 1.97E-10 3.58E-08 Mrnip protein_coding MRN complex interacting protein [Source:MGI Symbol;Acc:MGI:1915317] ENSMUSG00000097426 2.624388346 5.00E-06 0.00016227 Gm8941 processed_pseudogene predicted gene 8941 [Source:MGI Symbol;Acc:MGI:3779824] ENSMUSG00000091648 2.617010638 0.00211736 0.01846504 C2cd4d protein_coding C2 calcium-dependent domain containing 4D [Source:MGI Symbol;Acc:MGI:2685505] ENSMUSG00000032028 2.612215148 0.00010477 0.00187511 Nxpe2 protein_coding neurexophilin and PC-esterase domain family, member 2 [Source:MGI Symbol;Acc:MGI:1925502] ENSMUSG00000112006 2.611040575 3.72E-08 3.01E-06ACCEPTED AC125041.1 MANUSCRIPT lincRNA ENSMUSG00000038541 2.601985287 4.24E-08 3.39E-06 Srd5a2 protein_coding steroid 5 alpha-reductase 2 [Source:MGI Symbol;Acc:MGI:2150380] ENSMUSG00000038092 2.600694765 0.00038561 0.00509171 Hsd3b5 protein_coding hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5 [Source:MGI Symbol;Acc:MGI:104645] ENSMUSG00000111436 2.598553514 0.00361828 0.02759582 AC158598.1 processed_pseudogene ENSMUSG00000112920 2.584764896 0.00024955 0.00366271 Spata22 protein_coding spermatogenesis associated 22 [Source:MGI Symbol;Acc:MGI:2685728] ENSMUSG00000107516 2.582171298 0.00016374 0.00267174 Gm30784 lincRNA predicted gene, 30784 [Source:MGI Symbol;Acc:MGI:5589943] ENSMUSG00000062410 2.581924254 2.41E-13 1.03E-10 Hsd3b3 protein_coding hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3 [Source:MGI Symbol;Acc:MGI:96235] ENSMUSG00000038641 2.572253046 2.07E-06 7.80E-05 Akr1d1 protein_coding aldo-keto reductase family 1, member D1 [Source:MGI Symbol;Acc:MGI:2384785] ENSMUSG00000024313 2.570837824 0.00199304 0.01762691 Mep1b protein_coding meprin 1 beta [Source:MGI Symbol;Acc:MGI:96964] ENSMUSG00000039632 2.565458481 6.59E-06 0.00020315 Ccdc151 protein_coding coiled-coil domain containing 151 [Source:MGI Symbol;Acc:MGI:1924859] ENSMUSG00000109249 2.556601357 0.00012078 0.00211199 Gm44610 TEC predicted gene 44610 [Source:MGI Symbol;Acc:MGI:5753186] ENSMUSG00000037169 2.543692087 4.21E-05 0.00090916 Mycn protein_coding v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived [Source:MGI Symbol;Acc:MGI:97357] ENSMUSG00000114339 2.520039034 0.00755012 0.04780809 AC160984.1 processed_pseudogene ENSMUSG00000018727 2.514395208 0.00147674 0.01390775 Cpsf4l protein_coding cleavage and polyadenylation specific factor 4-like [Source:MGI Symbol;Acc:MGI:1277182] ENSMUSG00000109262 2.513995212 0.00165612 0.01527708 Gm44744 lincRNA predicted gene 44744 [Source:MGI Symbol;Acc:MGI:5753320] transcribed_unprocessed ENSMUSG00000102802 2.513184114 0.00153518 0.01436698 Mgam2-ps _pseudogene maltase-glucoamylase 2, pseudogene [Source:MGI Symbol;Acc:MGI:3645497] ENSMUSG00000113986 2.502563775 0.00297822 0.02393224 CT010462.2 lincRNA ENSMUSG00000074219 2.500846728 5.53E-06 0.00017701 Gm10644 protein_coding predicted gene 10644 [Source:MGI Symbol;Acc:MGI:3704314] ENSMUSG00000010601 2.489262303 1.97E-10 3.58E-08 Apol7a protein_coding apolipoprotein L 7a [Source:MGI Symbol;Acc:MGI:1923011] ENSMUSG00000031262 2.489051955 0.00785155 0.04913404 Cenpi protein_coding centromere protein I [Source:MGI Symbol;Acc:MGI:2147897] ENSMUSG00000069793 2.487979328 8.83E-09 9.67E-07 Slfn9 protein_coding schlafen 9 [Source:MGI Symbol;Acc:MGI:2445121] ENSMUSG00000033900 2.486596037 0.00756343 0.04787461 Map9 protein_coding microtubule-associated protein 9 [Source:MGI Symbol;Acc:MGI:2442208] ENSMUSG00000028133 2.482602169 9.05E-05 0.00167265 Rwdd3 protein_coding RWD domain containing 3 [Source:MGI Symbol;Acc:MGI:1920420] ENSMUSG00000001493 2.479546817 0.00083339 0.00899636 Meox1 protein_coding mesenchyme homeobox 1 [Source:MGI Symbol;Acc:MGI:103220] ENSMUSG00000023216 2.475500052 0.00761191 0.04805676 Epb42 protein_coding erythrocyte membrane protein band 4.2 [Source:MGI Symbol;Acc:MGI:95402] ENSMUSG00000059743 2.472577984 6.40E-18 1.21E-14 Fdps protein_coding farnesyl diphosphate synthetase [Source:MGI Symbol;Acc:MGI:104888] ENSMUSG00000048327 2.469860323 0.00047702 0.00593896 Ckap2l protein_coding cytoskeleton associated protein 2-like [Source:MGI Symbol;Acc:MGI:1917716] ENSMUSG00000091742 2.465138934 0.00062043 0.00727488 Gm5093 protein_coding predicted gene 5093 [Source:MGI Symbol;Acc:MGI:3644404] ENSMUSG00000025271 2.465082814 7.38E-16 6.64E-13 Pfkfb1 protein_coding 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 [Source:MGI Symbol;Acc:MGI:107816] ENSMUSG00000074794 2.462372588 6.93E-08 5.13E-06 Arrdc3 protein_coding arrestin domain containing 3 [Source:MGI Symbol;Acc:MGI:2145242] ENSMUSG00000040447 2.462194626 4.48E-12 1.44E-09 Spns2 protein_coding spinster homolog 2 [Source:MGI Symbol;Acc:MGI:2384936] ENSMUSG00000040380 2.446130409 1.65E-05 0.00043493 Cbln3 protein_coding cerebellin 3 precursor protein [Source:MGI Symbol;Acc:MGI:1889286] ENSMUSG00000105096 2.442523592 9.00E-06 0.00026598 Gbp10 protein_coding guanylate-binding protein 10 [Source:MGI Symbol;Acc:MGI:4359647] ENSMUSG00000097286 2.440929014 7.98E-09 8.85E-07 Gm26684 lincRNA predicted gene, 26684 [Source:MGI Symbol;Acc:MGI:5477178] ENSMUSG00000055782 2.440142987 3.21E-07 1.74E-05 Abcd2 protein_coding ATP-binding cassette, sub-family D (ALD), member 2 [Source:MGI Symbol;Acc:MGI:1349467] ENSMUSG00000061601 2.43493056 0.00014906 0.00247961 Pclo protein_coding piccolo (presynaptic cytomatrix protein) [Source:MGI Symbol;Acc:MGI:1349390] ENSMUSG00000002835 2.428283916 7.96E-07 3.58E-05 Chaf1a protein_coding chromatin assembly factor 1, subunit A (p150) [Source:MGI Symbol;Acc:MGI:1351331] ENSMUSG00000097134 2.426093135 0.00397673 0.02966747 1110002J07Rik lincRNA RIKEN cDNA 1110002J07 gene [Source:MGI Symbol;Acc:MGI:1915738] ENSMUSG00000002076 2.421548112 1.36E-06 5.54E-05 Hsf2bp protein_coding heat shock transcription factor 2 binding protein [Source:MGI Symbol;Acc:MGI:1921627] ENSMUSG00000024978 2.420075073 6.62E-12 1.98E-09 Gpam protein_coding glycerol-3-phosphate acyltransferase, mitochondrial [Source:MGI Symbol;Acc:MGI:109162] ENSMUSG00000067430 2.419651664 0.00027911 0.00396042 Zfp763 protein_coding zinc finger protein 763 [Source:MGI Symbol;Acc:MGI:1920701] ENSMUSG00000020914 2.416842384 8.00E-05 0.0015143 Top2a protein_coding topoisomerase (DNA) II alpha [Source:MGI Symbol;Acc:MGI:98790] ENSMUSG00000043418 2.4158396 0.00032739 0.00450326 Lrit2 protein_coding leucine-rich repeat, immunoglobulin-like and transmembrane domains 2 [Source:MGI Symbol;Acc:MGI:2444885] ENSMUSG00000114019 2.41555567 0.00111 0.01122084 AC154231.4 TEC ENSMUSG00000075144 2.409015481 0.00224544 0.01931573 Olfr1156 protein_codingMANUSCRIPT olfactory receptor 1156 [Source:MGI Symbol;Acc:MGI:3030990] ENSMUSG00000005553 2.399961217 4.75E-10 7.59E-08 Atp4a protein_coding ATPase, H+/K+ exchanging, gastric, alpha polypeptide [Source:MGI Symbol;Acc:MGI:88113] ENSMUSG00000005410 2.394638893 4.58E-21 1.57E-17 Mcm5 protein_coding minichromosome maintenance complex component 5 [Source:MGI Symbol;Acc:MGI:103197] ENSMUSG00000051041 2.392438993 2.18E-07 1.26E-05 Olfml1 protein_coding olfactomedin-like 1 [Source:MGI Symbol;Acc:MGI:2679264] ENSMUSG00000044359 2.388887475 2.99E-08 2.53E-06 P2ry4 protein_coding pyrimidinergic receptor P2Y, G-protein coupled, 4 [Source:MGI Symbol;Acc:MGI:1926594] ENSMUSG00000097730 2.38491134 0.00012673 0.00219797 Gm26588 antisense_RNA predicted gene, 26588 [Source:MGI Symbol;Acc:MGI:5477082] ENSMUSG00000095975 2.380408738 0.00016036 0.00262169 Cphx1 protein_coding cytoplasmic polyadenylated homeobox 1 [Source:MGI Symbol;Acc:MGI:2145733] ENSMUSG00000072763 2.374343852 0.00156025 0.01458165 5430403G16Rik protein_coding RIKEN cDNA 5430403G16 gene [Source:MGI Symbol;Acc:MGI:1924450] transcribed_unprocessed ENSMUSG00000110597 2.367688636 0.00739224 0.04707011 Gm8798 _pseudogene predicted gene 8798 [Source:MGI Symbol;Acc:MGI:3646429] ENSMUSG00000025429 2.363491604 5.50E-10 8.62E-08 Pstpip2 protein_coding proline-serine-threonine phosphatase-interacting protein 2 [Source:MGI Symbol;Acc:MGI:1335088] ENSMUSG00000049588 2.360279906 0.00252817 0.02116183 Ccdc69 protein_coding coiled-coil domain containing 69 [Source:MGI Symbol;Acc:MGI:1196234] ENSMUSG00000074345 2.359474394 0.00492121 0.03482768 Tnfaip8l3 protein_coding tumor necrosis factor, alpha-induced protein 8-like 3 [Source:MGI Symbol;Acc:MGI:2685363] ENSMUSG00000032826 2.353970597 0.00066387 0.0076374 Ank2 protein_coding ankyrin 2, brain [Source:MGI Symbol;Acc:MGI:88025] ENSMUSG00000041798 2.3536161 3.14E-10 5.32E-08 Gck protein_coding glucokinase [Source:MGI Symbol;Acc:MGI:1270854] ENSMUSG00000112947 2.346110999 0.00012692 0.00219825 CT572985.1 TEC ENSMUSG00000104459 2.335570615 7.14E-08 5.24E-06 Gm37824 TEC predicted gene, 37824 [Source:MGI Symbol;Acc:MGI:5611052] ENSMUSG00000001095 2.331027019 0.00162089 0.01501229 Slc13a2 protein_coding solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 [Source:MGI Symbol;Acc:MGI:1276558] ENSMUSG00000026489 2.321721298 2.71E-10 4.71E-08 Coq8a protein_coding coenzyme Q8A [Source:MGI Symbol;Acc:MGI:1914676] ENSMUSG00000028671 2.317821577 1.82E-11 4.44E-09 Gale protein_coding galactose-4-epimerase, UDP [Source:MGI Symbol;Acc:MGI:1921496] ENSMUSG00000022762 2.313278992 0.0009729 0.01011905 Ncam2 protein_coding neural cell adhesion molecule 2 [Source:MGI Symbol;Acc:MGI:97282] ENSMUSG00000030924 2.3124576 0.00142017 0.01352409 Rexo5 protein_coding RNA exonuclease 5 [Source:MGI Symbol;Acc:MGI:1919402] ENSMUSG00000020917 2.305373341 2.24E-27 1.91E-23 Acly protein_coding ATP citrate lyase [Source:MGI Symbol;Acc:MGI:103251] ENSMUSG00000033715 2.305105606 4.00E-06 0.00013436 Akr1c14 protein_coding aldo-keto reductase family 1, member C14 [Source:MGI Symbol;Acc:MGI:2145458] ENSMUSG00000084224 2.301364248 0.00573826 0.03891721 Gm12337 processed_pseudogene predicted gene 12337 [Source:MGI Symbol;Acc:MGI:3650615] ENSMUSG00000027778 2.295298649ACCEPTED 0.00013032 0.00223979 Ift80 protein_coding intraflagellar transport 80 [Source:MGI Symbol;Acc:MGI:1915509] ENSMUSG00000007080 2.286781192 6.81E-13 2.53E-10 Pole protein_coding polymerase (DNA directed), epsilon [Source:MGI Symbol;Acc:MGI:1196391] ENSMUSG00000024987 2.283674595 9.99E-07 4.37E-05 Cyp26a1 protein_coding cytochrome P450, family 26, subfamily a, polypeptide 1 [Source:MGI Symbol;Acc:MGI:1096359] ENSMUSG00000095026 2.281343355 0.00783645 0.04905748 Gm3336 protein_coding predicted gene 3336 [Source:MGI Symbol;Acc:MGI:3781514] ENSMUSG00000001166 2.274803183 0.00025808 0.00375231 Oas1c protein_coding 2'-5' oligoadenylate synthetase 1C [Source:MGI Symbol;Acc:MGI:2149633] ENSMUSG00000044927 2.26973801 6.17E-05 0.00123044 H1fx protein_coding H1 histone family, member X [Source:MGI Symbol;Acc:MGI:2685307] ENSMUSG00000097131 2.259990937 0.00082726 0.0089619 D230017M19Rik lincRNA RIKEN cDNA D230017M19 gene [Source:MGI Symbol;Acc:MGI:2445071] ENSMUSG00000097184 2.249750214 0.00373004 0.02824634 4632428C04Rik lincRNA RIKEN cDNA 4632428C04 gene [Source:MGI Symbol;Acc:MGI:1921600] ENSMUSG00000115979 2.238974179 0.00642056 0.04241643 NA NA NA ENSMUSG00000112349 2.23795485 0.00022616 0.0033803 AC153532.2 processed_pseudogene ENSMUSG00000046167 2.233516363 1.69E-05 0.00044116 Gldn protein_coding gliomedin [Source:MGI Symbol;Acc:MGI:2388361] ENSMUSG00000028188 2.222133236 0.00352104 0.02706097 Spata1 protein_coding spermatogenesis associated 1 [Source:MGI Symbol;Acc:MGI:1918201] ENSMUSG00000092686 2.221718718 0.00325679 0.02559294 Gm25745 miRNA predicted gene, 25745 [Source:MGI Symbol;Acc:MGI:5455522] ENSMUSG00000037922 2.219461862 0.00024763 0.00364391 Bank1 protein_coding B cell scaffold protein with ankyrin repeats 1 [Source:MGI Symbol;Acc:MGI:2442120] ENSMUSG00000059742 2.218271701 0.00053315 0.00648283 Kcnh7 protein_coding potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:MGI Symbol;Acc:MGI:2159566] ENSMUSG00000025153 2.206802761 1.82E-07 1.11E-05 Fasn protein_coding fatty acid synthase [Source:MGI Symbol;Acc:MGI:95485] ENSMUSG00000085498 2.191192141 0.00112102 0.01129218 Gm14023 processed_transcript predicted gene 14023 [Source:MGI Symbol;Acc:MGI:3650639] ACCEPTEDtranscribed_unprocessed MANUSCRIPT ENSMUSG00000090306 2.188625678 3.76E-09 4.76E-07 Adh6-ps1 _pseudogene alcohol dehydrogenase 6 (class V), pseudogene 1 [Source:MGI Symbol;Acc:MGI:1918999] ENSMUSG00000100594 2.18722299 3.54E-05 0.00079566 2810414N06Rik lincRNA RIKEN cDNA 2810414N06 gene [Source:MGI Symbol;Acc:MGI:1919065] ENSMUSG00000043068 2.18631619 3.65E-07 1.91E-05 Fam89a protein_coding family with sequence similarity 89, member A [Source:MGI Symbol;Acc:MGI:1916877] ENSMUSG00000109787 2.180501068 0.0001468 0.00245031 Gm45286 TEC predicted gene 45286 [Source:MGI Symbol;Acc:MGI:5791122] ENSMUSG00000001467 2.174225245 4.44E-09 5.35E-07 Cyp51 protein_coding cytochrome P450, family 51 [Source:MGI Symbol;Acc:MGI:106040] ENSMUSG00000050270 2.171383618 3.59E-07 1.88E-05 Tmem220 protein_coding transmembrane protein 220 [Source:MGI Symbol;Acc:MGI:2443691] ENSMUSG00000031767 2.17109144 2.15E-07 1.24E-05 Nudt7 protein_coding nudix (nucleoside diphosphate linked moiety X)-type motif 7 [Source:MGI Symbol;Acc:MGI:1914778] ENSMUSG00000117226 2.169994447 6.09E-06 0.00019042 NA NA NA ENSMUSG00000026162 2.169087233 0.00253912 0.02123268 Nhej1 protein_coding nonhomologous end-joining factor 1 [Source:MGI Symbol;Acc:MGI:1922820] ENSMUSG00000067081 2.168135836 0.00339193 0.02632791 Asb18 protein_coding ankyrin repeat and SOCS box-containing 18 [Source:MGI Symbol;Acc:MGI:2655109] ENSMUSG00000028976 2.168023136 0.00025412 0.00371065 Slc2a5 protein_coding solute carrier family 2 (facilitated glucose transporter), member 5 [Source:MGI Symbol;Acc:MGI:1928369] ENSMUSG00000112328 2.164228285 0.00372694 0.02824634 AC153840.2 processed_pseudogene ENSMUSG00000031549 2.162554541 4.78E-13 1.90E-10 Ido2 protein_coding indoleamine 2,3-dioxygenase 2 [Source:MGI Symbol;Acc:MGI:2142489] ENSMUSG00000101514 2.158346685 1.64E-05 0.0004321 Gm5524 lincRNA predicted gene 5524 [Source:MGI Symbol;Acc:MGI:3646041] ENSMUSG00000021273 2.15455674 1.19E-17 1.53E-14 Fdft1 protein_coding farnesyl diphosphate farnesyl transferase 1 [Source:MGI Symbol;Acc:MGI:102706] ENSMUSG00000033105 2.153159703 1.25E-17 1.53E-14 Lss protein_coding lanosterol synthase [Source:MGI Symbol;Acc:MGI:1336155] ENSMUSG00000026950 2.152609737 1.86E-06 7.12E-05 Neb protein_coding nebulin [Source:MGI Symbol;Acc:MGI:97292] ENSMUSG00000109482 2.147166719 5.58E-05 0.0011429 Gm4756 protein_coding predicted gene 4756 [Source:MGI Symbol;Acc:MGI:3644906] ENSMUSG00000006517 2.145630159 1.44E-12 5.13E-10 Mvd protein_coding mevalonate (diphospho) decarboxylase [Source:MGI Symbol;Acc:MGI:2179327] ENSMUSG00000068964 2.14252426 0.00378981 0.02859767 Gm6361 pseudogene predicted gene 6361 [Source:MGI Symbol;Acc:MGI:3646180] ENSMUSG00000112013 2.139339301 0.00059207 0.00702431 AC153522.1 processed_pseudogene ENSMUSG00000049038 2.123641985 0.00305021 0.02437375 Mterf2 protein_coding mitochondrial transcription termination factor 2 [Source:MGI Symbol;Acc:MGI:1921488] ENSMUSG00000085404 2.112348957 0.00164544 0.01519495 Gm12909 antisense_RNA predicted gene 12909 [Source:MGI Symbol;Acc:MGI:3651135] ENSMUSG00000070368 2.094165228 7.23E-08 5.28E-06 Prok1 protein_coding prokineticin 1 [Source:MGI Symbol;Acc:MGI:2180370] ENSMUSG00000032018 2.092963606 1.65E-13 7.44E-11 Sc5d protein_coding sterol-C5-desaturase [Source:MGI Symbol;Acc:MGI:1353611] ENSMUSG00000015852 2.091212103 0.00625373 0.04158767 Fcrls protein_coding Fc receptor-like S, scavenger receptor [Source:MGI Symbol;Acc:MGI:1933397] ENSMUSG00000021611 2.088167065 0.00026898 0.00386043 Tert protein_coding telomerase reverse transcriptase [Source:MGI Symbol;Acc:MGI:1202709] ENSMUSG00000029417 2.084419866 3.00E-05 0.00070054 Cxcl9 protein_coding chemokine (C-X-C motif) ligand 9 [Source:MGI Symbol;Acc:MGI:1352449] ENSMUSG00000090925 2.083032623 0.00090049 0.0094846 1810064F22Rik antisense_RNA RIKEN cDNA 1810064F22 gene [Source:MGI Symbol;Acc:MGI:1917112] ENSMUSG00000097811 2.081786108 0.0001425 0.00239848 2810425M01Rik lincRNA RIKEN cDNA 2810425M01 gene [Source:MGI Symbol;Acc:MGI:1917222] ENSMUSG00000041220 2.079176597 3.46E-10 5.69E-08 Elovl6 protein_coding ELOVL family member 6, elongation of long chain fatty acids (yeast) [Source:MGI Symbol;Acc:MGI:2156528] ENSMUSG00000035878 2.078450744 5.62E-15 3.84E-12 Hykk protein_coding hydroxylysine kinase 1 [Source:MGI Symbol;Acc:MGI:2443139] ENSMUSG00000074213 2.066790343 0.00011334 0.00200034 Gm10642 protein_coding predicted gene 10642 [Source:MGI Symbol;Acc:MGI:3704338] ENSMUSG00000042213 2.06300444 1.20E-05 0.00033739 Zfand4 protein_coding zinc finger, AN1-type domain 4 [Source:MGI Symbol;Acc:MGI:1914742] ENSMUSG00000039485 2.061725972 1.03E-05 0.00029802 Tspyl4 protein_coding TSPY-like 4 [Source:MGI Symbol;Acc:MGI:106393] ENSMUSG00000055493 2.059141622 2.87E-06 0.00010249 Epm2a protein_coding epilepsy, progressive myoclonic epilepsy, type 2 gene alpha [Source:MGI Symbol;Acc:MGI:1341085] ENSMUSG00000058921 2.055194832 1.27E-07 8.21E-06 Slc10a5 protein_coding solute carrier family 10 (sodium/bile acid cotransporter family), member 5 [Source:MGI Symbol;Acc:MGI:2685251] ENSMUSG00000029650 2.053730774 8.74E-08 6.17E-06 Slc46a3 protein_coding solute carrier family 46, member 3 [Source:MGI Symbol;Acc:MGI:1918956] ENSMUSG00000086010 2.053537904 6.73E-07 3.13E-05 Gm15318 antisense_RNA predicted gene 15318 [Source:MGI Symbol;Acc:MGI:3705106] ENSMUSG00000102627 2.047259254 0.00146455 0.01382344 Snurf protein_coding SNRPN upstream reading frame [Source:MGI Symbol;Acc:MGI:1891236] ENSMUSG00000032498 2.046601624 3.26E-08 2.70E-06 Mlh1 protein_coding mutL homolog 1 [Source:MGI Symbol;Acc:MGI:101938] ENSMUSG00000041939 2.045131507 1.05E-12 3.81E-10 Mvk protein_coding mevalonate kinase [Source:MGI Symbol;Acc:MGI:107624] ENSMUSG00000002428 2.04005976 6.23E-07 2.95E-05 Hltf protein_coding helicase-like transcription factor [Source:MGI Symbol;Acc:MGI:1196437] ENSMUSG00000102432 2.039176771 0.00043513 0.00556835 Gm29856 processed_transcript predicted gene, 29856 [Source:MGI Symbol;Acc:MGI:5589015] ENSMUSG00000089943 2.035965896 1.25E-06 5.21E-05 Ugt1a5 protein_codingMANUSCRIPTUDP glucuronosyltransferase 1 family, polypeptide A5 [Source:MGI Symbol;Acc:MGI:3032634] ENSMUSG00000041119 2.034662123 1.35E-09 1.89E-07 Pde9a protein_coding phosphodiesterase 9A [Source:MGI Symbol;Acc:MGI:1277179] ENSMUSG00000006711 2.032584915 0.00326942 0.0256568 D130043K22Rik protein_coding RIKEN cDNA D130043K22 gene [Source:MGI Symbol;Acc:MGI:3036268] bidirectional_promoter_ln ENSMUSG00000097357 2.025046073 0.00414567 0.03069976 Gm16793 cRNA predicted gene, 16793 [Source:MGI Symbol;Acc:MGI:4439717] ENSMUSG00000039763 2.021613493 0.00019108 0.00298126 Dnajc28 protein_coding DnaJ heat shock protein family (Hsp40) member C28 [Source:MGI Symbol;Acc:MGI:2181053] ENSMUSG00000031349 2.015719618 1.38E-08 1.39E-06 Nsdhl protein_coding NAD(P) dependent steroid dehydrogenase-like [Source:MGI Symbol;Acc:MGI:1099438] ENSMUSG00000097673 2.014633078 0.00104374 0.01070946 Gm26608 lincRNA predicted gene, 26608 [Source:MGI Symbol;Acc:MGI:5477102] ENSMUSG00000030364 2.013723961 0.0056652 0.0385595 Clec2h protein_coding C-type lectin domain family 2, member h [Source:MGI Symbol;Acc:MGI:2136934] ENSMUSG00000004038 2.007341575 6.34E-05 0.00125837 Gstm3 protein_coding glutathione S-transferase, mu 3 [Source:MGI Symbol;Acc:MGI:106026] ENSMUSG00000035864 2.003672301 1.17E-05 0.00033064 Syt1 protein_coding synaptotagmin I [Source:MGI Symbol;Acc:MGI:99667] ENSMUSG00000005125 -2.000972226 6.37E-12 1.94E-09 Ndrg1 protein_coding N-myc downstream regulated gene 1 [Source:MGI Symbol;Acc:MGI:1341799] ENSMUSG00000020893 -2.001518937 6.63E-06 0.00020369 Per1 protein_coding period circadian clock 1 [Source:MGI Symbol;Acc:MGI:1098283] ENSMUSG00000110605 -2.001728793 5.30E-07 2.64E-05 Gm32856 lincRNA predicted gene, 32856 [Source:MGI Symbol;Acc:MGI:5592015] ENSMUSG00000096592 -2.007799104 3.73E-19 9.11E-16 Gm15801 processed_pseudogene predicted gene 15801 [Source:MGI Symbol;Acc:MGI:3779625] ENSMUSG00000019997 -2.016346308 1.55E-07 9.62E-06 Ctgf protein_coding connective tissue growth factor [Source:MGI Symbol;Acc:MGI:95537] ENSMUSG00000037613 -2.024832458 0.00062581 0.00732406 Tnfrsf23 protein_coding tumor necrosis factor receptor superfamily, member 23 [Source:MGI Symbol;Acc:MGI:1930269] ENSMUSG00000022863 -2.02556747 6.09E-08 4.62E-06 Btg3 protein_coding B cell translocation gene 3 [Source:MGI Symbol;Acc:MGI:109532] ENSMUSG00000024558 -2.029808423 2.96E-05 0.00069231 Mapk4 protein_coding mitogen-activated protein kinase 4 [Source:MGI Symbol;Acc:MGI:2444559] ENSMUSG00000043165 -2.043440219 3.14E-05 0.00072793 Lor protein_coding loricrin [Source:MGI Symbol;Acc:MGI:96816] ENSMUSG00000036698 -2.047126201 2.24E-10 3.98E-08 Ago2 protein_coding argonaute RISC catalytic subunit 2 [Source:MGI Symbol;Acc:MGI:2446632] ENSMUSG00000038331 -2.06324064 0.00065367 0.00755564 Satb2 protein_coding special AT-rich sequence binding protein 2 [Source:MGI Symbol;Acc:MGI:2679336] ENSMUSG00000044716 -2.069523309 0.00338723 0.02631533 Dok7 protein_coding docking protein 7 [Source:MGI Symbol;Acc:MGI:3584043] ENSMUSG00000032245 -2.070197259 7.08E-12 2.08E-09 Cln6 protein_coding ceroid-lipofuscinosis, neuronal 6 [Source:MGI Symbol;Acc:MGI:2159324] ENSMUSG00000042510 -2.072191428 7.73E-05 0.00147907 AA986860 protein_coding expressed sequence AA986860 [Source:MGI Symbol;Acc:MGI:2138143] ENSMUSG00000021678 -2.097261572ACCEPTED 0.00053421 0.00648496 F2rl1 protein_coding coagulation factor II (thrombin) receptor-like 1 [Source:MGI Symbol;Acc:MGI:101910] ENSMUSG00000026981 -2.097828758 2.24E-08 2.04E-06 Il1rn protein_coding interleukin 1 receptor antagonist [Source:MGI Symbol;Acc:MGI:96547] ENSMUSG00000026204 -2.099433589 0.00190939 0.01705909 Ptprn protein_coding protein tyrosine phosphatase, receptor type, N [Source:MGI Symbol;Acc:MGI:102765] ENSMUSG00000022025 -2.100042042 0.00365415 0.02783216 Cnmd protein_coding chondromodulin [Source:MGI Symbol;Acc:MGI:1341171] ENSMUSG00000078532 -2.101699372 0.00059111 0.00702431 Nkain1 protein_coding Na+/K+ transporting ATPase interacting 1 [Source:MGI Symbol;Acc:MGI:1914399] ENSMUSG00000024042 -2.101994917 6.27E-11 1.36E-08 Sik1 protein_coding salt inducible kinase 1 [Source:MGI Symbol;Acc:MGI:104754] ENSMUSG00000087249 -2.102221086 7.15E-05 0.00139097 Gm16062 antisense_RNA predicted gene 16062 [Source:MGI Symbol;Acc:MGI:3802162] ENSMUSG00000041046 -2.113870834 0.00275986 0.02263533 Ramp3 protein_coding receptor (calcitonin) activity modifying protein 3 [Source:MGI Symbol;Acc:MGI:1860292] ENSMUSG00000032332 -2.115495801 1.04E-08 1.09E-06 Col12a1 protein_coding collagen, type XII, alpha 1 [Source:MGI Symbol;Acc:MGI:88448] ENSMUSG00000046223 -2.120233642 5.42E-05 0.00111478 Plaur protein_coding plasminogen activator, urokinase receptor [Source:MGI Symbol;Acc:MGI:97612] ENSMUSG00000026271 -2.126394925 0.00033013 0.00453741 Gpr35 protein_coding G protein-coupled receptor 35 [Source:MGI Symbol;Acc:MGI:1929509] ENSMUSG00000024912 -2.131155198 9.89E-05 0.00179898 Fosl1 protein_coding fos-like antigen 1 [Source:MGI Symbol;Acc:MGI:107179] ENSMUSG00000021250 -2.135413414 1.74E-06 6.80E-05 Fos protein_coding FBJ osteosarcoma oncogene [Source:MGI Symbol;Acc:MGI:95574] bidirectional_promoter_ln ENSMUSG00000111977 -2.137720005 0.00033647 0.00459857 AC132265.1 cRNA ENSMUSG00000027313 -2.147931967 2.54E-07 1.43E-05 Chac1 protein_coding ChaC, cation transport regulator 1 [Source:MGI Symbol;Acc:MGI:1916315] ENSMUSG00000112527 -2.167273207 9.18E-05 0.00169262 AC124413.2 lincRNA ENSMUSG00000021708 -2.168919614 0.00067912 0.0077658ACCEPTED Rasgrf2 protein_coding MANUSCRIPTRAS protein-specific guanine nucleotide-releasing factor 2 [Source:MGI Symbol;Acc:MGI:109137] ENSMUSG00000000078 -2.196040228 1.11E-07 7.40E-06 Klf6 protein_coding Kruppel-like factor 6 [Source:MGI Symbol;Acc:MGI:1346318] ENSMUSG00000085355 -2.202021257 2.77E-05 0.00065397 3010003L21Rik antisense_RNA RIKEN cDNA 3010003L21 gene [Source:MGI Symbol;Acc:MGI:1924094] ENSMUSG00000031861 -2.206367019 1.09E-08 1.13E-06 Lpar2 protein_coding lysophosphatidic acid receptor 2 [Source:MGI Symbol;Acc:MGI:1858422] ENSMUSG00000028341 -2.210676722 0.00086381 0.00921187 Nr4a3 protein_coding nuclear receptor subfamily 4, group A, member 3 [Source:MGI Symbol;Acc:MGI:1352457] ENSMUSG00000024401 -2.213401841 0.00050444 0.00620183 Tnf protein_coding tumor necrosis factor [Source:MGI Symbol;Acc:MGI:104798] ENSMUSG00000022126 -2.220772169 0.00075983 0.00841282 Acod1 protein_coding aconitate decarboxylase 1 [Source:MGI Symbol;Acc:MGI:103206] ENSMUSG00000027612 -2.222176016 0.00022479 0.00337429 Mmp24 protein_coding matrix metallopeptidase 24 [Source:MGI Symbol;Acc:MGI:1341867] ENSMUSG00000043889 -2.222753643 0.00445863 0.03231794 Gm8399 processed_pseudogene predicted gene 8399 [Source:MGI Symbol;Acc:MGI:3647971] ENSMUSG00000095061 -2.228185781 0.00580832 0.03929877 E030018B13Rik protein_coding RIKEN cDNA E030018B13 gene [Source:MGI Symbol;Acc:MGI:2686543] ENSMUSG00000062991 -2.233109515 9.76E-10 1.41E-07 Nrg1 protein_coding neuregulin 1 [Source:MGI Symbol;Acc:MGI:96083] ENSMUSG00000034731 -2.238655979 7.11E-06 0.00021677 Dgkh protein_coding diacylglycerol kinase, eta [Source:MGI Symbol;Acc:MGI:2444188] ENSMUSG00000036480 -2.238914357 0.00246217 0.02072101 Prss56 protein_coding protease, serine 56 [Source:MGI Symbol;Acc:MGI:1916703] ENSMUSG00000027171 -2.240018829 1.54E-06 6.18E-05 Prrg4 protein_coding proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) [Source:MGI Symbol;Acc:MGI:2442211] ENSMUSG00000027859 -2.242335057 1.25E-05 0.00034879 Ngf protein_coding nerve growth factor [Source:MGI Symbol;Acc:MGI:97321] ENSMUSG00000044645 -2.246184505 7.59E-08 5.47E-06 Gm7334 protein_coding predicted gene 7334 [Source:MGI Symbol;Acc:MGI:3647393]

ENSMUSG00000084315 -2.249558113 0.00333265 0.02600959 Vmn1r-ps128 unprocessed_pseudogene vomeronasal 1 receptor, pseudogene 128 [Source:MGI Symbol;Acc:MGI:3651039] ENSMUSG00000035385 -2.305144695 0.00013325 0.00228095 Ccl2 protein_coding chemokine (C-C motif) ligand 2 [Source:MGI Symbol;Acc:MGI:98259] ENSMUSG00000022893 -2.310755954 2.60E-09 3.41E-07 Adamts1 protein_coding a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1 [Source:MGI Symbol;Acc:MGI:109249] ENSMUSG00000024883 -2.321104864 0.00020078 0.00309857 Rin1 protein_coding Ras and Rab interactor 1 [Source:MGI Symbol;Acc:MGI:2385695] ENSMUSG00000031734 -2.332905157 0.00011643 0.00204226 Irx3 protein_coding Iroquois related homeobox 3 [Source:MGI Symbol;Acc:MGI:1197522] ENSMUSG00000002983 -2.34237634 3.28E-13 1.33E-10 Relb protein_coding avian reticuloendotheliosis viral (v-rel) oncogene related B [Source:MGI Symbol;Acc:MGI:103289] ENSMUSG00000082676 -2.347170848 0.00081573 0.00885385 Gm11843 processed_pseudogene predicted gene 11843 [Source:MGI Symbol;Acc:MGI:3651166] ENSMUSG00000043421 -2.376521694 2.27E-08 2.04E-06 Hilpda protein_coding hypoxia inducible lipid droplet associated [Source:MGI Symbol;Acc:MGI:1916823] ENSMUSG00000023905 -2.377213372 1.75E-07 1.08E-05 Tnfrsf12a protein_coding tumor necrosis factor receptor superfamily, member 12a [Source:MGI Symbol;Acc:MGI:1351484] ENSMUSG00000004814 -2.382098831 1.08E-05 0.00030794 Ccl24 protein_coding chemokine (C-C motif) ligand 24 [Source:MGI Symbol;Acc:MGI:1928953] ENSMUSG00000031383 -2.388031683 0.00109529 0.01112648 Dusp9 protein_coding dual specificity phosphatase 9 [Source:MGI Symbol;Acc:MGI:2387107] ENSMUSG00000063531 -2.410898214 0.001897 0.01698552 Sema3e protein_coding sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E [Source:MGI Symbol;Acc:MGI:1340034] ENSMUSG00000043613 -2.426307008 0.00481683 0.03421655 Mmp3 protein_coding matrix metallopeptidase 3 [Source:MGI Symbol;Acc:MGI:97010] ENSMUSG00000025283 -2.426459864 2.44E-18 5.20E-15 Sat1 protein_coding spermidine/spermine N1-acetyl transferase 1 [Source:MGI Symbol;Acc:MGI:98233] ENSMUSG00000044162 -2.439079981 0.00307988 0.02447287 Tnip3 protein_coding TNFAIP3 interacting protein 3 [Source:MGI Symbol;Acc:MGI:3041165] ENSMUSG00000028680 -2.439332979 1.19E-07 7.83E-06 Plk3 protein_coding polo-like kinase 3 [Source:MGI Symbol;Acc:MGI:109604] ENSMUSG00000053475 -2.442098455 3.64E-05 0.00081384 Tnfaip6 protein_coding tumor necrosis factor alpha induced protein 6 [Source:MGI Symbol;Acc:MGI:1195266] ENSMUSG00000050359 -2.445825238 0.00070541 0.00797565 Sprr1a protein_coding small proline-rich protein 1A [Source:MGI Symbol;Acc:MGI:106660] ENSMUSG00000035373 -2.447343744 0.00047506 0.00592836 Ccl7 protein_coding chemokine (C-C motif) ligand 7 [Source:MGI Symbol;Acc:MGI:99512] ENSMUSG00000035678 -2.515239305 0.00445876 0.03231794 Tnfsf9 protein_coding tumor necrosis factor (ligand) superfamily, member 9 [Source:MGI Symbol;Acc:MGI:1101058] ENSMUSG00000049551 -2.539990444 3.24E-05 0.00074179 Fzd9 protein_coding frizzled class receptor 9 [Source:MGI Symbol;Acc:MGI:1313278] ENSMUSG00000037887 -2.559267026 0.00287062 0.02330802 Dusp8 protein_coding dual specificity phosphatase 8 [Source:MGI Symbol;Acc:MGI:106626] ENSMUSG00000023034 -2.569788554 0.00255016 0.02127979 Nr4a1 protein_coding nuclear receptor subfamily 4, group A, member 1 [Source:MGI Symbol;Acc:MGI:1352454] ENSMUSG00000074607 -2.599053155 3.30E-07 1.77E-05 Tox2 protein_coding TOX high mobility group box family member 2 [Source:MGI Symbol;Acc:MGI:3611233] ENSMUSG00000042622 -2.609140932 9.09E-09 9.84E-07 Maff protein_coding v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) [Source:MGI Symbol;Acc:MGI:96910] ENSMUSG00000046733 -2.639301509 1.47E-06 5.93E-05 Gprc5a protein_coding G protein-coupled receptor, family C, group 5, member A [Source:MGI Symbol;Acc:MGI:1891250] ENSMUSG00000068600 -2.664912727 0.00662046 0.0434878 Gml2 protein_coding glycosylphosphatidylinositol anchored molecule like 2 [Source:MGI Symbol;Acc:MGI:1341831] ENSMUSG00000031765 -2.717824138 0.00093113 0.00975912 Mt1 protein_coding metallothionein 1 [Source:MGI Symbol;Acc:MGI:97171] ENSMUSG00000031880 -2.720149363 1.15E-06 4.87E-05 Rrad protein_codingMANUSCRIPT Ras-related associated with diabetes [Source:MGI Symbol;Acc:MGI:1930943] ENSMUSG00000065767 -2.770452395 0.00060873 0.00715724 Gm23849 snRNA predicted gene, 23849 [Source:MGI Symbol;Acc:MGI:5453626] ENSMUSG00000026604 -2.781979936 1.61E-14 9.84E-12 Ptpn14 protein_coding protein tyrosine phosphatase, non-receptor type 14 [Source:MGI Symbol;Acc:MGI:102467] ENSMUSG00000030142 -2.794945606 5.76E-07 2.78E-05 Clec4e protein_coding C-type lectin domain family 4, member e [Source:MGI Symbol;Acc:MGI:1861232] ENSMUSG00000065037 -2.851570466 1.47E-08 1.46E-06 Rn7sk misc_RNA RNA, 7SK, nuclear [Source:MGI Symbol;Acc:MGI:103186] ENSMUSG00000071847 -2.856462591 0.000423 0.00545983 Apcdd1 protein_coding adenomatosis polyposis coli down-regulated 1 [Source:MGI Symbol;Acc:MGI:3513977] ENSMUSG00000116657 -2.89142977 6.02E-07 2.87E-05 NA NA NA ENSMUSG00000050370 -2.900142061 2.33E-05 0.0005707 Ch25h protein_coding cholesterol 25-hydroxylase [Source:MGI Symbol;Acc:MGI:1333869] ENSMUSG00000049580 -2.910708946 1.68E-05 0.00044036 Tsku protein_coding tsukushi, small leucine rich proteoglycan [Source:MGI Symbol;Acc:MGI:2443855] ENSMUSG00000029321 -2.946652522 0.00033183 0.00455268 Slc10a6 protein_coding solute carrier family 10 (sodium/bile acid cotransporter family), member 6 [Source:MGI Symbol;Acc:MGI:1923000] ENSMUSG00000041272 -2.989776249 1.92E-07 1.15E-05 Tox protein_coding thymocyte selection-associated high mobility group box [Source:MGI Symbol;Acc:MGI:2181659] ENSMUSG00000045502 -3.040101232 1.77E-08 1.69E-06 Hcar2 protein_coding hydroxycarboxylic acid receptor 2 [Source:MGI Symbol;Acc:MGI:1933383] ENSMUSG00000031530 -3.051851864 2.46E-08 2.16E-06 Dusp4 protein_coding dual specificity phosphatase 4 [Source:MGI Symbol;Acc:MGI:2442191] ENSMUSG00000034765 -3.10074681 1.54E-09 2.14E-07 Dusp5 protein_coding dual specificity phosphatase 5 [Source:MGI Symbol;Acc:MGI:2685183] ENSMUSG00000051379 -3.102230239 1.52E-07 9.48E-06 Flrt3 protein_coding fibronectin leucine rich transmembrane protein 3 [Source:MGI Symbol;Acc:MGI:1918686] ENSMUSG00000056758 -3.127353763 0.00029497 0.00415445 Hmga2 protein_coding high mobility group AT-hook 2 [Source:MGI Symbol;Acc:MGI:101761] ENSMUSG00000068349 -3.147152943 6.01E-05 0.00120694 Gml protein_coding glycosylphosphatidylinositol anchored molecule like [Source:MGI Symbol;Acc:MGI:3644767] ENSMUSG00000005148 -3.21192653 6.65E-07 3.12E-05 Klf5 protein_coding Kruppel-like factor 5 [Source:MGI Symbol;Acc:MGI:1338056] ENSMUSG00000003541 -3.258473917 3.54E-09 4.51E-07 Ier3 protein_coding immediate early response 3 [Source:MGI Symbol;Acc:MGI:104814] ENSMUSG00000048455 -3.288209838 0.00241629 0.02042045 Sprr1b protein_coding small proline-rich protein 1B [Source:MGI Symbol;Acc:MGI:106659] ENSMUSG00000055675 -3.444267032 0.00312867 0.02473398 Kbtbd11 protein_coding kelch repeat and BTB (POZ) domain containing 11 [Source:MGI Symbol;Acc:MGI:1922151] ENSMUSG00000037411 -3.453782345 0.00074802 0.00834344 Serpine1 protein_coding serine (or cysteine) peptidase inhibitor, clade E, member 1 [Source:MGI Symbol;Acc:MGI:97608] ENSMUSG00000000805 -3.481181058 0.00614113 0.04103052 Car4 protein_coding carbonic anhydrase 4 [Source:MGI Symbol;Acc:MGI:1096574] ENSMUSG00000071537 -3.63878159 2.50E-08 2.17E-06 Klrg2 protein_coding killer cell lectin-like receptor subfamily G, member 2 [Source:MGI Symbol;Acc:MGI:1921503] ENSMUSG00000064899 -3.661819705 1.11E-06 4.78E-05 Snord118 snoRNA small nucleolar RNA, C/D box 118 [Source:MGI Symbol;Acc:MGI:3819519] ENSMUSG00000088252 -3.732680546ACCEPTED 0.00218564 0.01895406 Snord13 snoRNA small nucleolar RNA, C/D box 13 [Source:MGI Symbol;Acc:MGI:3819521] ENSMUSG00000029378 -3.777169905 6.86E-11 1.45E-08 Areg protein_coding amphiregulin [Source:MGI Symbol;Acc:MGI:88068] ENSMUSG00000004791 -3.815918103 0.00076719 0.00846297 Pgf protein_coding placental growth factor [Source:MGI Symbol;Acc:MGI:105095] ENSMUSG00000050423 -3.824109643 6.47E-08 4.85E-06 Ppp1r3g protein_coding protein phosphatase 1, regulatory (inhibitor) subunit 3G [Source:MGI Symbol;Acc:MGI:1923737] ENSMUSG00000098943 -3.926260049 5.81E-09 6.89E-07 Rnu3b1 snoRNA U3B small nuclear RNA 1 [Source:MGI Symbol;Acc:MGI:97985] ENSMUSG00000036832 -4.186227045 1.85E-05 0.00046948 Lpar3 protein_coding lysophosphatidic acid receptor 3 [Source:MGI Symbol;Acc:MGI:1929469] ENSMUSG00000047562 -4.473637565 2.71E-07 1.51E-05 Mmp10 protein_coding matrix metallopeptidase 10 [Source:MGI Symbol;Acc:MGI:97007] ENSMUSG00000058427 -4.538399248 0.00032161 0.00443448 Cxcl2 protein_coding chemokine (C-X-C motif) ligand 2 [Source:MGI Symbol;Acc:MGI:1340094] ENSMUSG00000026347 -4.711206298 4.20E-05 0.00090916 Tmem163 protein_coding transmembrane protein 163 [Source:MGI Symbol;Acc:MGI:1919410] ENSMUSG00000026241 -5.330671561 0.00054643 0.00660664 Nppc protein_coding natriuretic peptide type C [Source:MGI Symbol;Acc:MGI:97369] ENSMUSG00000110867 -5.813010628 0.00404265 0.03002809 AC157591.1 processed_pseudogene ENSMUSG00000095590 -5.889469518 0.00184385 0.01658782 Gm24305 snRNA predicted gene, 24305 [Source:MGI Symbol;Acc:MGI:5454082] ENSMUSG00000058126 -5.912084646 0.0001908 0.00297962 Tpm3-rs7 protein_coding tropomyosin 3, related sequence 7 [Source:MGI Symbol;Acc:MGI:99705] ENSMUSG00000101431 -6.016218156 3.51E-07 1.86E-05 Gm7901 processed_pseudogene predicted gene 7901 [Source:MGI Symbol;Acc:MGI:3645047] ENSMUSG00000094076 -6.107937492 0.00055204 0.00664534 Gm4767 protein_coding predicted gene 4767 [Source:MGI Symbol;Acc:MGI:3644409] ENSMUSG00000110126 -7.62064658 2.95E-08 2.52E-06 Gm9347 processed_pseudogene predicted gene 9347 [Source:MGI Symbol;Acc:MGI:3648409] ENSMUSG00000089739 -8.124615439 0.00030212 0.00422036 Gm20431 protein_coding predicted gene 20431 [Source:MGI Symbol;Acc:MGI:5141896] ACCEPTED MANUSCRIPT patatin-like phospholipase domain containing 5 [Source:MGI Symbol;Acc:MGI:1923022]

cholinergic receptor, nicotinic, alpha polypeptide 4 [Source:MGI Symbol;Acc:MGI:87888] guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 [Source:MGI Symbol;Acc:MGI:109165] transient receptor potential cation channel, subfamily C, member 3 [Source:MGI Symbol;Acc:MGI:109526]

cytochrome P450, family 7, subfamily a, polypeptide 1 [Source:MGI Symbol;Acc:MGI:106091] patatin-like phospholipase domain containing 3 [Source:MGI Symbol;Acc:MGI:2151796] Rho guanine nucleotide exchange factor (GEF) 4 [Source:MGI Symbol;Acc:MGI:2442507]

KH domain containing, RNA binding, signal transduction associated 2 [Source:MGI Symbol;Acc:MGI:2159649] hyaluronan and proteoglycan link protein 1 [Source:MGI Symbol;Acc:MGI:1337006]

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2 [Source:MGI Symbol;Acc:MGI:1354710] MANUSCRIPT growth regulation by estrogen in breast cancer-like [Source:MGI Symbol;Acc:MGI:3576497]

Wilms tumor 1 homolog, opposite strand [Source:MGI Symbol;Acc:MGI:2138884] potassium voltage-gated channel, subfamily H (eag-related), member 3 [Source:MGI Symbol;Acc:MGI:1341723] leucine-rich repeats and transmembrane domains 1 [Source:MGI Symbol;Acc:MGI:2442106] isopentenyl-diphosphate delta isomerase [Source:MGI Symbol;Acc:MGI:2442264] ACCEPTED

WD repeat and HMG-box DNA binding protein 1 [Source:MGI Symbol;Acc:MGI:2443514] hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 4 [Source:MGI Symbol;Acc:MGI:96236]

src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites [Source:MGI Symbol;Acc:MGI:101865] cytochrome P450, family 21, subfamily a, polypeptide 2 pseudogene [Source:MGI Symbol;Acc:MGI:3645529] ACCEPTED MANUSCRIPT

establishment of sister chromatid cohesion N-acetyltransferase 2 [Source:MGI Symbol;Acc:MGI:1919238]

D4, zinc and double PHD fingers, family 3 [Source:MGI Symbol;Acc:MGI:1917377]

Rho guanine nucleotide exchange factor (GEF) 37 [Source:MGI Symbol;Acc:MGI:3045339]

serine (or cysteine) peptidase inhibitor, clade A, member 4, pseudogene 1 [Source:MGI Symbol;Acc:MGI:2448363] family with sequence similarity 50, member B [Source:MGI Symbol;Acc:MGI:1351640] family with sequence similarity 198, member A [Source:MGI Symbol;Acc:MGI:3041196]

3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 [Source:MGI Symbol;Acc:MGI:107592]

hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 [Source:MGI Symbol;Acc:MGI:96234]

NDC80 kinetochore complex component [Source:MGI Symbol;Acc:MGI:1914302] killer cell lectin-like receptor subfamily K, member 1 [Source:MGI Symbol;Acc:MGI:1196250] beta-1,4-N-acetyl-galactosaminyl transferase 3 [Source:MGI Symbol;Acc:MGI:3041155] MANUSCRIPT

family with sequence similarity 13, member A [Source:MGI Symbol;Acc:MGI:1889842] cytochrome P450, family 8, subfamily b, polypeptide 1 [Source:MGI Symbol;Acc:MGI:1338044]

nuclear receptor subfamily 1, group H, member 5 [Source:MGI Symbol;Acc:MGI:3026618] protein phosphatase 1, regulatory (inhibitor) subunit 3B [Source:MGI Symbol;Acc:MGI:2177268] Fanconi anemia, complementation group B [Source:MGI Symbol;Acc:MGI:2448558]

NSL1, MIS12 kinetochore complex component [Source:MGI Symbol;Acc:MGI:2685830] family with sequence similarity 47, member E [Source:MGI Symbol;Acc:MGI:2686227] CTF18, chromosome transmission fidelity factor 18 [Source:MGI Symbol;Acc:MGI:2384887] ACCEPTED

regulating synaptic membrane exocytosis 4 [Source:MGI Symbol;Acc:MGI:2674366] ubiquitin-conjugating enzyme E2U (putative) [Source:MGI Symbol;Acc:MGI:3588216] leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 [Source:MGI Symbol;Acc:MGI:2385320]

C2 calcium-dependent domain containing 4D [Source:MGI Symbol;Acc:MGI:2685505] neurexophilin and PC-esterase domain family, member 2 [Source:MGI Symbol;Acc:MGI:1925502] ACCEPTED MANUSCRIPT hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5 [Source:MGI Symbol;Acc:MGI:104645]

hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3 [Source:MGI Symbol;Acc:MGI:96235] aldo-keto reductase family 1, member D1 [Source:MGI Symbol;Acc:MGI:2384785]

v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived [Source:MGI Symbol;Acc:MGI:97357] cleavage and polyadenylation specific factor 4-like [Source:MGI Symbol;Acc:MGI:1277182]

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 [Source:MGI Symbol;Acc:MGI:107816]

ATP-binding cassette, sub-family D (ALD), member 2 [Source:MGI Symbol;Acc:MGI:1349467] chromatin assembly factor 1, subunit A (p150) [Source:MGI Symbol;Acc:MGI:1351331] heat shock transcription factor 2 binding protein [Source:MGI Symbol;Acc:MGI:1921627] glycerol-3-phosphate acyltransferase, mitochondrial [Source:MGI Symbol;Acc:MGI:109162] leucine-rich repeat, immunoglobulin-like and transmembrane domains 2 [Source:MGI Symbol;Acc:MGI:2444885] MANUSCRIPT ATPase, H+/K+ exchanging, gastric, alpha polypeptide [Source:MGI Symbol;Acc:MGI:88113] minichromosome maintenance complex component 5 [Source:MGI Symbol;Acc:MGI:103197] pyrimidinergic receptor P2Y, G-protein coupled, 4 [Source:MGI Symbol;Acc:MGI:1926594] cytoplasmic polyadenylated homeobox 1 [Source:MGI Symbol;Acc:MGI:2145733]

proline-serine-threonine phosphatase-interacting protein 2 [Source:MGI Symbol;Acc:MGI:1335088] tumor necrosis factor, alpha-induced protein 8-like 3 [Source:MGI Symbol;Acc:MGI:2685363]

solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 [Source:MGI Symbol;Acc:MGI:1276558] aldo-keto reductase family 1, member C14 [Source:MGI Symbol;Acc:MGI:2145458] ACCEPTED cytochrome P450, family 26, subfamily a, polypeptide 1 [Source:MGI Symbol;Acc:MGI:1096359]

B cell scaffold protein with ankyrin repeats 1 [Source:MGI Symbol;Acc:MGI:2442120] potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:MGI Symbol;Acc:MGI:2159566] ACCEPTED MANUSCRIPT alcohol dehydrogenase 6 (class V), pseudogene 1 [Source:MGI Symbol;Acc:MGI:1918999] family with sequence similarity 89, member A [Source:MGI Symbol;Acc:MGI:1916877]

nudix (nucleoside diphosphate linked moiety X)-type motif 7 [Source:MGI Symbol;Acc:MGI:1914778] ankyrin repeat and SOCS box-containing 18 [Source:MGI Symbol;Acc:MGI:2655109] solute carrier family 2 (facilitated glucose transporter), member 5 [Source:MGI Symbol;Acc:MGI:1928369]

farnesyl diphosphate farnesyl transferase 1 [Source:MGI Symbol;Acc:MGI:102706]

mitochondrial transcription termination factor 2 [Source:MGI Symbol;Acc:MGI:1921488]

ELOVL family member 6, elongation of long chain fatty acids (yeast) [Source:MGI Symbol;Acc:MGI:2156528]

epilepsy, progressive myoclonic epilepsy, type 2 gene alpha [Source:MGI Symbol;Acc:MGI:1341085] solute carrier family 10 (sodium/bile acid cotransporter family), member 5 [Source:MGI Symbol;Acc:MGI:2685251]

UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:MGI Symbol;Acc:MGI:3032634] MANUSCRIPT

DnaJ heat shock protein family (Hsp40) member C28 [Source:MGI Symbol;Acc:MGI:2181053] NAD(P) dependent steroid dehydrogenase-like [Source:MGI Symbol;Acc:MGI:1099438]

C-type lectin domain family 2, member h [Source:MGI Symbol;Acc:MGI:2136934]

tumor necrosis factor receptor superfamily, member 23 [Source:MGI Symbol;Acc:MGI:1930269]

special AT-rich sequence binding protein 2 [Source:MGI Symbol;Acc:MGI:2679336] coagulation factor II (thrombin) receptor-like 1 [Source:MGI Symbol;Acc:MGI:101910] ACCEPTED protein tyrosine phosphatase, receptor type, N [Source:MGI Symbol;Acc:MGI:102765]

Na+/K+ transporting ATPase interacting 1 [Source:MGI Symbol;Acc:MGI:1914399] receptor (calcitonin) activity modifying protein 3 [Source:MGI Symbol;Acc:MGI:1860292] RAS protein-specific guanine nucleotide-releasing factor 2 [Source:MGI Symbol;Acc:MGI:109137] ACCEPTED MANUSCRIPT

nuclear receptor subfamily 4, group A, member 3 [Source:MGI Symbol;Acc:MGI:1352457]

proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) [Source:MGI Symbol;Acc:MGI:2442211]

vomeronasal 1 receptor, pseudogene 128 [Source:MGI Symbol;Acc:MGI:3651039] a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1 [Source:MGI Symbol;Acc:MGI:109249] avian reticuloendotheliosis viral (v-rel) oncogene related B [Source:MGI Symbol;Acc:MGI:103289] hypoxia inducible lipid droplet associated [Source:MGI Symbol;Acc:MGI:1916823] tumor necrosis factor receptor superfamily, member 12a [Source:MGI Symbol;Acc:MGI:1351484] sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E [Source:MGI Symbol;Acc:MGI:1340034] spermidine/spermine N1-acetyl transferase 1 [Source:MGI Symbol;Acc:MGI:98233] tumor necrosis factor alpha induced protein 6 [Source:MGI Symbol;Acc:MGI:1195266] tumor necrosis factor (ligand) superfamily, member 9 [Source:MGI Symbol;Acc:MGI:1101058] nuclear receptor subfamily 4, group A, member 1 [Source:MGI Symbol;Acc:MGI:1352454] TOX high mobility group box family member 2 [Source:MGI Symbol;Acc:MGI:3611233] v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) [Source:MGI Symbol;Acc:MGI:96910] G protein-coupled receptor, family C, group 5, member A [Source:MGI Symbol;Acc:MGI:1891250] glycosylphosphatidylinositol anchored molecule like 2 [Source:MGI Symbol;Acc:MGI:1341831] MANUSCRIPT protein tyrosine phosphatase, non-receptor type 14 [Source:MGI Symbol;Acc:MGI:102467] C-type lectin domain family 4, member e [Source:MGI Symbol;Acc:MGI:1861232] adenomatosis polyposis coli down-regulated 1 [Source:MGI Symbol;Acc:MGI:3513977] tsukushi, small leucine rich proteoglycan [Source:MGI Symbol;Acc:MGI:2443855] solute carrier family 10 (sodium/bile acid cotransporter family), member 6 [Source:MGI Symbol;Acc:MGI:1923000] thymocyte selection-associated high mobility group box [Source:MGI Symbol;Acc:MGI:2181659]

fibronectin leucine rich transmembrane protein 3 [Source:MGI Symbol;Acc:MGI:1918686] glycosylphosphatidylinositol anchored molecule like [Source:MGI Symbol;Acc:MGI:3644767]

kelch repeat and BTB (POZ) domain containing 11 [Source:MGI Symbol;Acc:MGI:1922151] serine (or cysteine) peptidase inhibitor, clade E, member 1 [Source:MGI Symbol;Acc:MGI:97608] killer cell lectin-like receptor subfamily G, member 2 [Source:MGI Symbol;Acc:MGI:1921503] ACCEPTED protein phosphatase 1, regulatory (inhibitor) subunit 3G [Source:MGI Symbol;Acc:MGI:1923737] Supplementary Table 7. QuantitativeACCEPTED PCR primers MANUSCRIPT used for lncRNA corroboration and protein- coding RNAs validation.

Gene Sequence Name Forward and reverse primer pair Anneal bp Symbol sequences temp product AK080187 uc008hgf.1 GAAGGGGGAAAACGGCAGTA 57 142 TGCATTTTTGGGGACACCCT Has2 NM_008216 AGTCCCTTGAAACCCCGATT 57 161 GTCGTCTGAGTTCCCATCGA Myl7 NM_022879 AGCTCGGGAGGGTAAGTGTT 57 112 CCATTGAGCTTCTCCCCGAA Des NM_010043 CAAGGGCTCCTCGAGTTCAA 57 174 AACTCCTGGTTCACAGCGTC Acan NM_007424 GAACTTGGCCATGGTCCTTC 57 161 GGGTAAGCAGACAGGTCACT Cdk15 NM_001033373.2 CAGAAGCATCCAGTTCCACG 57 128 CCCCTGCCTCAGATTCTCTTC Tnxb NM_031176.2 CCAAGTCCTGTCCCGAAGAC 57 223 CGTCCTCTCTGGTTGCAGTT Sepp1 NM_009155 TGACAGTGTGCGGAAAACCT 57 116 GGCTGATTTTGTCAGGCAGC Ostn NM_198112.2 GCCACTGAGCTTTCGGCTAA 57 120 GAGTCTGTCAAGGGGAGACC Has1 NM_008215.2 TCTTTGCCCTGCTCATCCTG 57 122 TAGGTGTGCGCTGAGGAATGMANUSCRIPT Has3 NM_008217.4 GCTTCTTTGTGTGGCGTAGC 57 189 AGTCCACTGAGTTGCCAAGG Mcm6 NM_008567 TGCTCACCCGAATCAGTGG 57 159 CACACACTGGATTTCGGCAG Mcm5 NM_008566 CATCCGGAGCTCGTACATCC 57 285 GGGTCTCCCAACATCAGCAA Mcm4 NM_008565 CCAATCGGAGACGTAGAGGC 57 281 CACCTGCAAACCCTTTCGTG Mcm3 NM_008563 CGAGGAGGACCAAGGCATTT 57 120 AGGCGGTTAGCCCTCTTTTC Mcm2 NM_008564 AAGTGTCTAGCCGTGCCATC 57 151 TCGTCAATGAGACACACCCC Eme1 NM_177752 GCAGTAGCAGTGAGGACGAA 57 178 ACCEPTEDATCTTTGGCCATGGTTGCCT Brip1 NM_178309 CACTGTTTGCTGGAGAGTCC 57 188 TCCAGGTTTGTGTCGCTGTAG Rad51 NM_011234 AGGGTTCAACACAGACCACC 57 153 TGCATTTGCCTGGCTGAAAG Ccna2 NM_009828 TGTCACTGCTGGTCCTTCAT 57 157 TCCGGGTAAAGAGACAGCTG Pold1 NM_011131 ATTCTTGCGTCTGGCACTCA 57 264 TGGAAGGAGGAGTCACGGAT ACCEPTED MANUSCRIPT Dna2 NM_177372 GCGGAAAAATGGTCCCATGC 57 131 AGGTAACGGCTGCCTTGTTC Rpa2 NM_011284 GAGTTCACCGCACACATCCT 57 154 GGCCATTTGCTGGCATGAAG Col1a1 NM_001145366.1 CTGACTGGAAGAGCGGAGAG 58 113 (rat) CTGAGTGGGGAACACACAGG TGF βββ NM_021578.2 GACTCTCCACCTGCAAGACC 58 100 (rat) GGACTGGCGAGCCTTAGTTT TIMP-1 NM_053819.1 TCTGGCATCCTCTTGTTGCT 58 100 (rat) TAACCAGGTCCGAGTTGCAG MMP13 NM_008607 TGTTTGCAGAGCACTACTTGAA 60 132 CAGTCACCTCTAAGCCAAAGAAA TNFα NM_013693 CCCTCACACTCAGATCATCTTCT 60 61 GCTACGACGTGGGCTACAG IL-1b NM_008361 CAACCAACAAGTGATATTCTCCATG 60 152 GATCCACACTCTCCAGCTGCA IL-6 NM_031168 TAGTCCTTCCTACCCCAATTTCC 60 76 TTGGTCCTTAGCCACTCCTTC MIP2α/ NM_009140 CCAACCACCAGGCTACAGG 60 108 CXCL2 GCGTCACACTCAAGCTCTG GAPDH NM_008084 GCACAGTCAAGGCCGAGAAT 57 151 GCCTTCTCCATGGTGGTGAA βββactin NM_031144.3 AGCCATGTACGTAGCCATCC 57 228 CTCTCAGCTGTGGTGGTGAA

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT Supplementary Figure legends

Supplementary Figure 1 and 2 – Ingenuity pathway analysis was used to form a network of differentially expressed focus genes. Blue nodes signify that a gene was downregulated in MeCP2 -/y fibroblasts, red is upregulated. Symbol shapes signify the nature of the encoded protein, while unshaded symbol signify genes relevant to the pathway but not differentially expressed in our dataset.

Supplementary Figure 3 - A) mRNA level of Has2, Myl7, Des and Acan as downregulated genes and B) Cdk15, Tnxb, Sepp1 and Osnt as upregulated genes was quantified by qPCR in order to validate the results of microarray. Error bars in relevant panels represent mean ± SEM. Statistical significance was determined by

Student’s t test, *p <0.05; **p <0.01. MANUSCRIPT Supplementary Figure 4 – A) mRNA level of Mcm6-2 quantified by qPCR in order to validate the results of microarray. B) and C) mRNA level of Pold1, Dna2, Rpa2,

Eme1, Brip1 and Rad51 quantified by qPCR in order to validate the results of microarray. Error bars in relevant panels represent mean ± SEM. Statistical significance was determined by Student’s t test, *p <0.05; **p <0.01.

SupplementaryACCEPTED Figure 5 - Identification/representation of the down-regulated transcript uc008hgf as in close physical association with the ACTA2 ( α-SMA) locus.

mRNA level of uc008hgf.1 and α-SMA quantified by qPCR in order to validate the results of microarray. Predicted RNA secondary structures from uc008hgf.1 lncRNA obtained with CentroidFold software using the CONTRAfold model. Error bars in

1 ACCEPTED MANUSCRIPT relevant panels represent mean ± SEM. Statistical significance was determined by

Student’s t test, *p <0.05.

Supplementary Figure 6 - Graphical view of DE coding-non-coding (CNC) gene

coexpression network analysis represents similar patterns of expression and

interconnectivity of the most representative GO terms (cell cycle, DNA metabolic

process, innate immunity and protein activation cascades). The interaction network

was produced in Cytoscape, where nodes correspond to mRNA (triangles in purple)

or lncRNA (circle in green) and the edges are the coexpression links.

Supplementary Figure 7 – HSCs were isolated from three control and three

MeCP2 S80AKi mice, seeded at equal density at the start of the experiment (day 0) and

allowed to transdifferentiate in vitro . Photomicrographs were taken on days 1, 2, 3, 4, 6 and 8. Representative pictures from all three MANUSCRIPT lines from Wt and MeCP2 S80AKi are shown.

Supplementary Figure 8 – A) Western blot for MeCP2 in whole liver or activated

HSCs; MeCP2 Wt and KO brain was used as positive or negative control

respectively.

S80A B) Liver-to-body-weight ratio in Wt and MeCP2 mice treated with chronic CCl 4 or vehicle. Error ACCEPTEDbars in relevant panels represent mean ± SEM. ***p <0. 001 and C) Serum transaminases, alanine transaminase (ALT) and aspartate transaminase

(AST), assessment

2 ACCEPTED MANUSCRIPT Supplementary materials and methods

Quantitative PCR (RT-qPCR) analysis - Total RNA was purified from isolated cells using the Total RNA purification kit (Qiagen, UK) following manufacturer’s instructions. One microgram of total RNA was DNAse treated (Promega) and used as template to generate cDNA using a random hexamer primer (p(dN)6) and MMLV reverse transcriptase (Promega). Primer sequences are included in Supplementary

Table 1. SYBR Green quantitative RT-PCR reactions were performed in a total volume of 13 l, containing 20ng of cDNA template, 6.5 l of SYBR Green JumpStart

Taq ReadyMix (Sigma), and 20pmols of forward and reverse primers

(Supplementary Tables 1-3). The PCR reaction was carried out on a 7500 Fast Real-

Time PCR System (Applied Biosystem, Warrington, Cheshire, UK) with the following parameters: 1 cycle at 95 °C for 10 sec followed by 40 cycles at 95°C for 10 sec, 57°C - 60°C (for primer pair specific annealing MANUSCRIPT tem perature, see Supplementary Table 1 for 30 sec, and finally 72°C for 30 sec. Me lt curve analysis was employed to confirm presence of a single PCR product. All reactions were normalized to β-actin

or GAPDH internal control, and relative level of transcriptional difference calculated

by using the following equation: (1/[2A]) ×100.

MTT assay - Cellular viability was determined using MTT assay where day-2, day-3, day-5 and day-8ACCEPTED primary HSCs from Wt or MeCP2 S80A livers were seeded onto 24 well plates and treated with MTT (5mg/ml, Sigma) for 1.5h. Cells were rinsed with

PBS and fixed in isopropanol; the plates were shaken at 240 rpm for 10 min. The absorbance was measured at 570/620 nm in a Spectra Max (Grodig, Austria) plate reader.

3 ACCEPTED MANUSCRIPT

BrdU Assay - Cells were labelled with bromodeoxyuridine (BrdU) in fresh cell media containing 16% FBS for 18h. Cell proliferation was determined by BrdU incorporation following the manufacturer’s instructions of the Cell Proliferation ELISA (Roche).

Coding-non-coding gene (CNC) co-expression network analysis - To identify possible biological functions we performed a coding-non-coding gene coexpression

(CNC) network analysis 1 the coexpressed lncRNAs related to genes. The

coexpression matrix was calculated using the Perl package “Statistics Basic” and the

“correlation” function filtered to include only the interactions for which the absolute

value of the Pearson correlation coefficient r>0.99. 2, 3 . The CNC coexpression

network was visualized using the bioinformatics software Cytoscape 4.

Histology and Immunohistochemistry - Formalin MANUSCRIPT fixed, paraffin embedded tissue sections were stained with 0.1% Picrosirius red and Haematoxylin and Eosin (H&E) using established protocols. Immunohistochemistry was performed on deparaffinised sections, endogenous peroxidase activity was blocked using 0.6% hydrogen peroxide/methanol solution. Heat mediated antigen retrieval was achieved using antigen unmasking solution. Endogenous avidin and biotin were blocked using an

Avidin/Biotin Blocking Kit (Vector Laboratories) and non-specific binding was blocked using 20% swineACCEPTED serum for 30 mins, then αSMA 1:1000 (F3777 Sigma) was incubated overnight at 4 oC. The next day slides were washed and incubated with

biotinylated goat anti-fluorescein 1:300 (BA-0601 Vector) for 1h. Slides were washed

and incubated with Vectastain Elite ABC Reagent for 45 mins. Staining was

visualised using DAB peroxidase substrate kit and counterstained with mayers

4 ACCEPTED MANUSCRIPT haematoxylin prior to mounting. Slides were analysed at 20x magnification using a

Nikon Eclipse Upright microscope and NIS-Elements BR analysis software. Ten random fields of liver were analysed per section. All Images presented are at x100 magnification and scale bars equal 100 microns unless otherwise stated.

Oil red O staining – 15 µm frozen sections were fixed in Bakers formol-calcium,

washed in distilled water and then incubated with 60% isopropanol for 5 mins.

Sections were then incubated in Oil Red O solution for 20 mins, transferred to 60%

isopropanol for 5 mins, washed with distilled water and then mounted with Kaiser’s

glycerine-gelatin.

SDS-PAGE and immunoblotting

Whole-cell extracts were prepared and protein concentration of samples was determined using Bio-Rad DC Protein AssayMANUSCRIPT (Bio-Rad, UK). Proteins were separated on 10% or 12 % SDS polyacrylamide gel and transferred onto a

nitrocellulose membrane in buffer containing 25 mM Tris, 192 mM glycine, and 20%

methanol. Blots were blocked with TBS/Tween 20 (0.1% T-TBS) containing 5% milk

protein before overnight incubation with primary antibodies- rabbit anti-MeCP2

(C15410052, Diadogenode), MCM2 (D7G11,Cell Signalling), MCM5 (ab75975,

Abcam), PolD (ab186407, Abcam), CCNA2 (ab38, Abcam), PCNA (ab2426, Abcam), Col1A1 (AB765P,ACCEPTED Millipore), αSMA (A5228, Sigma), HAS2 (sc365263, Santa Cruz), CD44 (AF6127, R&D systems), pMeCP2 S80 (AP3595a, Abgent), pMeCP2 S421

(PA5-35396, ThermoFisher Scientific), HIPK2 (5091, Cell Signalling) and rabbit anti-

GAPDH (ab22555, Abcam). Secondary antibody anti-rabbit (7074S, Cell Signaling)

and anti-mouse (A4416, Sigma) HRP-conjugate antibody was use at 1:2000 dilution.

5 ACCEPTED MANUSCRIPT The antibody complexes were detected by chemiluminescence using Pierce ECL

Western Blotting Substrate (Thermo Scientific).

Preparation and sequencing of Wt and S80Ki whole liver RNA samples.

RNA was isolated from Wt and S80A Ki control and peak fibrosis (4 weeks CCl 4) whole livers. RNA-Seq libraries were created using Illumina TruSeq stranded mRNA kit. The sequencing was single-end with 75bp read length, performed on NextSeq

500 using a high-output 75 cycle flowcell, providing >40 million reads per sample.

Transcript quantification and differential expression analysis

Sequencing quality was assessed by FastQC software (Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Poor quality bases and adaptors were trimmed using Trimmomatic software 5, allowing a maximum of 1 mismatch and a quality threshold of 20. The MANUSCRIPT quasi-mapping mode of Salmon 6 was used for the mapping and quantification of the transcripts. DESeq2 R package 7 was used to adjust the read counts by scaling a normalized factor in all libraries and to assess the differential expression of the two treatments. The p values were corrected by the Benjamini and Hochberg method 8(4), then the expression level was

considered significantly different at p adjusted < 0.05 and log2 Fold Change of >1.

Plots were created with ‘gplots’ R package. The genes with significantly different expression levelACCEPTED as selected by R were input into the Ingenuity Pathway Analysis tools (http://www.ingenuity.com) for functional annotation.

Microarray and Computational Analysis - RNA was purified from of total RNA

after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre).

6 ACCEPTED MANUSCRIPT Each sample was amplified and transcribed into fluorescent cRNA along the entire length of the transcripts without 3’ bias utilizing a random priming method. The labeled cRNAs were purified and 1 g of each labeled cRNA hybridized onto the

Mouse LncRNA Array v2.0 (8 x 60K, Arraystar) for 17 hours at 65°C in an Agilent

Hybridization Oven. 25376 protein-coding RNAs and 31423 LncRNAs in mouse

genome were collected from the most authoritative data sources including RefSeq,

UCSC Knowngenes, Ensembl and many related literatures. After having washed the

slides, the arrays were scanned by the Agilent DNA Microarray Scanner (part

number G2505C). The acquired array images were analysed by Agilent Feature

Extraction software (version 11.0.1.1). Quantile normalization and subsequent data

processing were performed with using the GeneSpring GX v11.5.1 software package

(Agilent Technologies). Differentially expressed LncRNAs and mRNAs with statistical

significance between the two groups were identified through Volcano Plot filtering. GO analysis and Pathway analysis were performedMANUSCRIPT in the standard enrichment computation method. The Integrative Genomics Viewer (IGV)

(http://www.broadinstitute.org/igv/home) was used to visualized and interactive explore the location and organization within the mouse genome of the differentially expressed lncRNAs and their associated protein-coding genes 9, 10 . Predicted secondary structures from lncRNA sequences were obtained using the CentroidFold software available online in http://www.ncrna.org/software/centroidfold/ and applying the CONTRAfoldACCEPTED model to calculate base-paring probabilities with 2 ^2 gamma parameter to control the specificity and sensitivity of predicted base-pairs 11, 12.

Genes with expression level that was considered significantly different were input

into the Ingenuity Pathway Analysis tools (http://www.ingenuity.com) for functional

annotation.

7 ACCEPTED MANUSCRIPT

References

1. Liao Q, Liu C, Yuan X, et al. Large-scale prediction of long non-coding RNA functions in a coding-non-coding gene co-expression network. Nucleic Acids Res 2011;39:3864-78. 2. Hou Z, Xu C, Xie H, et al. Long noncoding RNAs expression patterns associated with chemo response to cisplatin based chemotherapy in lung squamous cell carcinoma patients. PLoS One 2014;9:e108133. 3. Wan Z-Y, Song F, Sun Z, et al. Aberrantly expressed long noncoding RNAs in human intervertebral disc degeneration: a microarray related study. Arthritis Research & Therapy 2014;16:1-11. 4. Shannon P, Markiel A, Ozier O, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 2003;13:2498- 504. 5. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 2014;30:2114-20.MANUSCRIPT 6. Patro R, Duggal G, Love MI, et al. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods 2017;14:417-419. 7. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 2014;15:550. 8. Benjamini Y, Hochberg Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society. Series B (Methodological) 1995;57:289-300. 9. Robinson JT, Thorvaldsdottir H, Winckler W, et al. Integrative genomics viewer. Nat Biotech 2011;29:24-26. 10. Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high- performance genomics data visualization and exploration. Briefings in Bioinformatics 2013;14:178-192. 11. Hamada M, Kiryu H, Sato K, et al. Prediction of RNA secondary structure using generalized centroid estimators. Bioinformatics 2009;25:465-473. 12. Sato K, ACCEPTEDHamada M, Asai K, et al. CentroidFold: a web server for RNA secondary structure prediction. Nucleic Acids Research 2009;37:W277-W280.

8 ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

MANUSCRIPT

ACCEPTED